KR102472270B1 - Development of novel methanotroph that co-assimilate methane and xylose, and producing shinorine using itself - Google Patents

Abstract

The present invention relates to a transgenic methanogen that uses methane and xylose as a common carbon source and a method for producing shinoline using the same, and more specifically, to a xylose metabolic pathway in the methanogen and methane and xylose as carbon sources can be used as a high value-added useful product derived from methane as a method of improving cell growth rate and shinoline productivity compared to existing methanogens.

Description

Development of a novel methanotroph that co-assimilate methane and xylose, and producing shinorine using itself}

The present invention relates to a method for improving cell growth and shinoline productivity by improving the non-oxidative RuMP pathway by simultaneously utilizing methane and xylose as carbon sources by introducing a xylose metabolic pathway into methanogens.

Research on the production of chemicals and fuels through C1 carbon-based bioconversion is being actively conducted, which is expected to bring about changes in the production methods of chemicals and fuels in the future. In particular, methanotrophs, which use methane as the only carbon and energy source, are the only biocatalysts for methane conversion. Attempts to produce various high value-added useful products derived from methane using methanotrophic bacteria have been steadily attempted, but lack of overall understanding of the physiological characteristics of methanotrophic bacteria, low growth rate of the strain itself, and absence of genetic tools Due to various difficulties such as, it is still difficult to be widely used.

Recently, chemical substances and fuels have been successfully produced from engineered methanotrophs through several studies, but the potency and productivity are still far below the level required by the industry and need improvement. Since both the growth rate and metabolic capacity of methanogens greatly affect the efficiency of the bioconversion process, an effective method for improving these factors is required to achieve high productivity.

The non-oxidative ribulose monophosphate RuMP cycle, the major pathway for C1 assimilation in Type I methanogens, consists of C1 and C5 condensation steps to produce the C6 unit and the non-oxidative portion of the pentose phosphate pathway. According to genome scale model analysis, the carbon flux through the non-oxidizing RuMP cycle is one of the highest fluxes in the metabolism of methanogens. It is expected that the productivity of the product can be improved. To prove this, we tried to synthesize shinorine from sedoheptulose-7-phosphate (S7P), an intermediate in the non-oxidative RuMP cycle of methanomatous bacteria. In addition, in order to activate the pentose phosphate pathway, a xylose metabolic pathway was introduced into methanogens to improve the growth rate and production of shinoline by using methane and xylose at the same time.

Republic of Korea Patent Publication No. 10-2019-0049575

An object of the present invention is a gene encoding 2-dimethyl 4-deoxygadusol synthase (DDGS) comprising SEQ ID NO: 1, an O-methyltransfer comprising SEQ ID NO: 2 Cyanobacteria ( Nostoc punctiforme ) to provide a methanotroph that produces shinorine containing a gene encoding D-ala-D-ala ligase derived from.

Another object of the present invention is to generate a gene encoding xylose isomerase (xylA) comprising SEQ ID NO: 6 involved in the xylose metabolic pathway, and a xylose sequence comprising SEQ ID NO: 7 in the methane magnetizing bacteria. Methane and xyl It is to provide a transformed methanotroph capable of simultaneously metabolizing rosacea.

Another object of the present invention, the above methanogenic bacteria (Methanotroph) or its culture medium; and

methane and xylose; Or methanol and xylose; to provide a composition for production of shinorine (shinorine) comprising a carbon source consisting of.

Another object of the present invention, the methanogenic bacteria, methane and xylose; Or methanol and xylose; step of inoculating and culturing in a medium containing as a carbon source;

recovering the supernatant from the culture medium; and

It is to provide a method for producing shinorine, including obtaining shinorine from the recovered supernatant.

The present invention, a gene encoding 2-dimethyl 4-deoxygadusol synthase (DDGS) comprising SEQ ID NO: 1, O-methyltransferase (SEQ ID NO: 2) Gene encoding O-methyltransferase, OMT), ATP-grasp-ligase comprising SEQ ID NO: 3, and cyanobacteria comprising SEQ ID NO: 4 ( Nostoc punctiforme ) Derived Provided is a Methanotroph that produces shinorine containing a gene encoding D-ala-D-ala ligase of

In addition, the present invention is a gene encoding xylose isomerase (xylA) including SEQ ID NO: 6 involved in the xylose metabolic pathway, and a xylulose kinase including SEQ ID NO: 7 in the methane magnetizing bacteria (xylulosekinase, xylB) and a gene encoding ribulose-phosphate 3-epimerase (rpe) containing SEQ ID NO: 8 are introduced or enhanced to simultaneously produce methane and xylose A transformed methanotroph capable of metabolizing is provided.

In addition, the present invention, the above methanogenic bacteria (Methanotroph) or its culture medium; and

methane and xylose; or methanol and xylose; provides a composition for producing shinorine comprising a carbon source consisting of

In addition, the present invention, methane and xylose; Or methanol and xylose; step of inoculating and culturing in a medium containing as a carbon source;

recovering the supernatant from the culture medium; and

It provides a method for producing shinorine, including obtaining shinorine from the recovered supernatant.

The present invention relates to a transgenic methanogen that uses methane and xylose as a common carbon source and a method for producing shinoline using the same, and more specifically, to a xylose metabolic pathway in the methanogen and methane and xylose as carbon sources can be used as a high value-added useful product derived from methane as a method of improving cell growth rate and shinoline productivity compared to existing methanogens.

1 is a diagram showing a pathway in which the transformed methanotroph SH-XYL-1 of the present invention synthesizes shinoline using methane and xylose as substrates.
Figure 2 is a diagram confirming the transcription and protein expression levels of genes related to C1 oxidation and ribulose monophosphate pathway in the transformed methanogens of the present invention.
Figure 3 is a diagram showing the absorbance (OD 600nm) when the transformed methanotroph SH-1 strain of the present invention was cultured for 48 hours in a medium containing 1% by weight of methanol as a carbon source.
Figure 4 is a diagram comparing the amount of shinorine produced when the transformed strain SH-1 of the present invention was cultured for 48 hours in a medium supplied with methane and methanol as carbon sources.
5 is a diagram showing the production process of the vector and transformant strain used for constructing the xylose metabolic pathway in the present invention.
6 is methane; xylose; And methane and xylose; is a diagram comparing the growth of the SH-XYL-1 strain, respectively, in NMS medium with carbon sources.
7 is xylose after 120 hours; And methane and xylose; is a comparison of xylose consumption of SH-XYL-1 strain in NMS medium with carbon sources.
8 is methane; xylose; And methane and xylose; is a diagram comparing the amount of shinoline production of the SH-XTL-1 strain in NMS medium as a carbon source.
9 is methane; and methane and xylose; is a diagram comparing the amount of shinoline obtained in the supernatant by centrifuging the SH-XTL-1 strain in NMS medium with carbon sources.
10 is a diagram showing genes differentially expressed in M. alcaliphilum 20Z pXYl grown in methane (methanol) and xylose.
11 is a diagram showing the growth and fermentation profiles of strain SH-XYL-1 grown in methane and xylose with the addition of 5 μM tungsten.
12 is a diagram confirming the production of shinorine over time in SH-XYL-1 cultured in methane and xylose with the addition of 5 μM tungsten.
Figure 13 is a schematic diagram of the NpR synthetic operon designed using operon clusters.
14 is a diagram showing shinoline production of strain SH-2 cultured using methane or methanol as a single carbon source.
15 is a diagram showing growth and fermentation profiles of strain SH-XYL-2 grown in xylose and methane added with 5 μM tungsten.
16 is a diagram confirming the production of shinoline over time in SH-XYL-2 grown in xylose and methane with the addition of 5 μM tungsten.

The present invention, a gene encoding 2-dimethyl 4-deoxygadusol synthase (DDGS) comprising SEQ ID NO: 1, O-methyltransferase (SEQ ID NO: 2) Gene encoding O-methyltransferase, OMT), ATP-grasp-ligase comprising SEQ ID NO: 3, and cyanobacteria comprising SEQ ID NO: 4 ( Nostoc punctiforme ) Derived Provided is a Methanotroph that produces shinorine containing a gene encoding D-ala-D-ala ligase of

Shinorine is a substance that can be used as an anti-aging cosmetic product because it has excellent UV absorbing power, prevents skin aging induced by UV rays, and has effects such as anti-inflammatory, antioxidant, and skin texture improvement. In addition, according to a recent study, shinoline regulates the skin signal transduction process, and is effective in promoting cell migration and wound regeneration. Although it has been discovered and extracted from microalgae, the amount of extraction and production is low for commercial use, so it is treated as a fairly expensive material, and various methods for producing shinoline are being developed.

In the present invention, the term "metahnotroph" means a bacterium that uses methane as a main carbon source or energy source. The methanogenic bacteria may mean a host strain to be transformed in the present invention, and for the purpose of the present invention, it is not particularly limited thereto as long as it has a non-oxidizing RuMP cycle using methane as a carbon source. In addition, among methylotrophs that use C1 compounds such as methane, methanol, and methylamine as energy sources, it is obvious to those skilled in the art that strains capable of using methane together may also be included in the methanating bacteria of the present invention.

The methanogenic bacteria are not particularly limited as long as they can use C1 compounds such as methane as an energy source, but Methylomonas, Methylobacter, Methylococcus, Methylose Methylosphaera, Methylocaldum, Methyloglobus, Methylosarcina, Methyloprofundus, Methylothermus ), Methylohalobius, Methylogaea, Methylomarinum, Methylovulum, Methylomarinovum, Methylolorubum Methylorubrum, Methyloparacoccus, Methylocystis, Methylocella, Methylocapsa, Methylofurula, Methylacid Methylacidiphilum, Methylacidimicrobium, Methylomicrobium and Methylosinus may be strains, specifically Methylomicrobium alcaliphilum It may be 20Z.

In the present invention, the term "transformed methanogenic bacteria" means a strain transformed by introducing or removing the gene of the methanogenic bacteria.

The term “vector” refers to a DNA fragment(s) or nucleic acid molecule that is delivered into a cell, capable of replicating DNA and independently reproducing in a host cell. "Expression vector" means a recombinant DNA molecule comprising a coding sequence of interest and appropriate nucleic acid sequences necessary to express an operably linked coding sequence in a particular host organism. Expression vectors are generally derived from plasmid or viral DNA, or may contain elements of both. Thus, expression vector refers to a recombinant DNA or RNA construct such as a plasmid, phage, recombinant virus or other vector that, when introduced into a suitable host cell, results in the expression of the cloned DNA. Suitable expression vectors are well known to those skilled in the art, and include those capable of replicating in eukaryotic and/or prokaryotic cells and those that remain episomal or integrate into the host cell genome.

The term "plasmid" used in the present invention is a DNA that can independently proliferate while existing separately from chromosomes in the cells of microorganisms. It is not an essential gene for survival, but includes factors and vectors related to environmental adaptation of microorganisms. refers to a cyclical gene.

As used herein, the term "transformation" means that a microorganism changes its genetic properties by accepting DNA given from the outside.

As used herein, the term "metabolic pathway" refers to a series of processes that induce anabolic reactions that biosynthesize organic molecules such as proteins, nucleic acids, amino acids, etc., and catabolism that decomposes organic molecules through enzyme-mediated biochemical reactions.

The term "cotrophic metabolism" used in the present invention refers to a culture method capable of promoting cell growth and metabolite production of microorganisms by adding an additional auxiliary carbon source to a single carbon source.

In the present invention, the term "2-dimethyl 4-deoxygadusol synthase (2-demethyl 4-deoxygadusol synthase)" is an enzyme that converts D-sedoheptulose 7-phosphate into demethyl-4-deoxygadusol.

The 2-dimethyl 4-deoxygadusol synthase (DDGS) encoding gene (DDGS) may be derived from Nostoc punctiforme , and specifically may be composed of the nucleotide sequence of SEQ ID NO: 1.

The term "O-methyltransferase" of the present invention is an enzyme that converts 2-demethyl 4-deoxygadusol into 4-deoxygadusol.

The O-methyltransferase (O-methyltransferase) encoding gene (OMT) may be derived from Nostoc punctiforme and may be composed of the nucleotide sequence of SEQ ID NO: 2.

The term "ATP-grasp-ligase" of the present invention is an enzyme that converts 4-deoxygadusol into mycosporine-glycine.

The gene encoding the ATP-grasp-ligase may be composed of the nucleotide sequence of SEQ ID NO: 3.

The term "D-ala-D-ala ligase" of the present invention is an enzyme that attaches serine to mycosporine-glycine and converts it to shinoline.

The gene encoding the D-ala-D-ala ligase may be derived from Nostoc punctiforme and may be composed of the nucleotide sequence of SEQ ID NO: 4.

The term "transketolase" of the present invention is an enzyme that converts D-xylulose-5-P into sedoheptulose-7-P.

According to one embodiment of the present invention, the methanotroph is further transformed to further include a gene encoding the tkt1 gene encoding transketolase comprising SEQ ID NO: 5 can be

The gene encoding the transketolase ( tkt1 ) is M. alcaliphilum 20Z It may be derived from, and may be composed of the nucleotide sequence of SEQ ID NO: 5.

According to one embodiment of the present invention, the methanogens contain a gene encoding xylose isomerase (xylA) including SEQ ID NO: 6 involved in the xylose metabolic pathway, and SEQ ID NO: 7 Methane magnetization further transformed with a gene encoding xylulosekinase (xylB) and a gene encoding ribulose-phosphate 3-epimerase (rpe) comprising SEQ ID NO: 8 Methanotrophs may be further included.

The term "xylose isomerase" of the present invention is an enzyme that converts D-xylose into D-xylulose.

The gene (xylA) encoding the xylose isomerase may be derived from E. coli K12 and may be composed of the nucleotide sequence of SEQ ID NO: 6.

The term "xylulosekinase" of the present invention is an enzyme that converts D-xylulose into D-xylulose 5-phosphate.

The gene (xylB) encoding the xylulosekinase may be derived from E. coli K12 and may be composed of the nucleotide sequence of SEQ ID NO: 7.

The term "ribulose-phosphate 3-epimerase" of the present invention is an enzyme that converts D-xylulose 5-phosphate into D-ribulose 5-phosphate.

The gene (rep) encoding the ribulose-phosphate 3-epimerase may be derived from Methylotuvimicrobium alcaliphilum 20Z and may be composed of the nucleotide sequence of SEQ ID NO: 8.

The term "operon" used in the present invention refers to a group of adjacent genes that are uniformly regulated by structural genes, operator genes, promoter genes, regulatory genes, and the like, on the microbial genome.

The methanogenic bacterium of the present invention is a methanotrophic bacterium transformed with an expression vector specifically expressing a gene and operon producing shinoline, wherein the expression vector is a nucleic acid consisting of a nucleotide sequence including SEQ ID NO: 1 to SEQ ID NO: 9 , which contains fragments functionally equivalent to it.

A "functionally equivalent fragment" to the expression vector of the present invention means a fragment or part of a nucleic acid consisting of the nucleotide sequences represented by SEQ ID NO: 1 to SEQ ID NO: 9, which exhibits substantially equivalent effects to the expression vector of the present invention. These nucleic acid fragments are 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94% compared to the nucleotide sequences set forth in SEQ ID NOs: 1 to 9. , 95%, 96%, 97%, 98%, 99% or more sequence homology, and such nucleic acid fragments can be easily prepared by molecular biological methods widely known in the art. In addition, the expression vectors represented by SEQ ID NOs: 1 to SEQ ID NOs: 9 and some gene regions of the present invention are sequences containing some of the disclosed shinorine biosynthetic pathway genes, among the nucleotide sequences represented by SEQ ID NOs: 1 to SEQ ID NO: 9. Even if a part is substituted, inserted, or deleted, it may be included in the scope of the present invention as long as it maintains homology with sequences located in some gene regions of the shinorine biosynthetic pathway and exhibits substantially equivalent effects.

According to one embodiment of the present invention, the methanogenic bacteria are characterized in that they are microorganisms of the genus Methylomicrobium, and more specifically, methane, characterized in that Methylomicrobium alcaliphilum 20Z ( Methylomicrbium alcaliphilum 20Z) It may be a methanotroph.

In addition, the present invention, the above methanogenic bacteria (Methanotroph) or its culture medium; and

methane and xylose; or methanol and xylose; provides a composition for producing shinorine comprising a carbon source consisting of

The term "culture medium" used in the present invention is obtained after incubating a target microorganism in a medium containing elements suitable for the growth of microorganisms and culturing for a certain period of time, and is a concept including microorganisms and a medium.

The term “composition” used in the present invention refers to a mixture of various materials for producing a target material, and includes a microbial culture medium, a carbon source, trace elements, and microbial spawn.

According to one embodiment of the present invention, the composition may be a composition for producing shinorine (shinorine) characterized in that it further comprises tungsten, calcium or copper as trace elements.

According to one embodiment of the present invention, the composition comprises 25 to 50% by volume of methane or 0.5 to 2% by weight of methanol and 0.5 to 2% by weight of xylose as a carbon source, Shinorine It may be a production composition.

According to one embodiment of the present invention, the composition may further include tungsten as a trace element.

In addition, the present invention, methane and xylose; Or methanol and xylose; step of inoculating and culturing in a medium containing as a carbon source;

recovering the supernatant from the culture medium; and

It provides a method for producing shinorine, including obtaining shinorine from the recovered supernatant.

Hereinafter, the present invention will be described in more detail by examples. These examples are merely for explaining the present invention in more detail, and it will be apparent to those skilled in the art that the scope of the present invention is not limited to these examples.

<Experiment method>

(1) Preparation of strains and plasmids and culture conditions

Escherichia coli (control group) and M. alcaliphilum 20Z (experimental group) strains used in the present invention are shown in Table 1 below, and are screwed into a 500 ml baffle flask to which 50 ml of nutrient mineral salt medium (NMS medium) was added. The inlet was sealed with a cap and incubated at 30° C. for 48 hours. As a carbon source, methane was added at 30 to 70% by volume of the culture medium using a gas exchanger, preferably at 50% by volume. To provide a common carbon source for the transformed strain SH-XYL-1, 1% (w/v) xylose was additionally added to the NMS medium as a co-substrate. For the co-trophic culture of the transformed strain, 1% by weight of xylose in the culture medium was additionally added as a supplementary substrate. Inoculation of the strain was inoculated so that the initial absorbance (OD 600nm) was 0.1. All cultures were cultured for RNA extraction and sequencing for subsequent RNA-sequencing experiments, and the cultured strains were inoculated onto a plate medium containing 50 μg/ml kanamycin to select methanotrophs and E. coli with recombinant plasmids did

Strain Characteristic(s) Escherichia coli DH5α Escherichia coli K12 MG1655 Methylotuvimicrobium alcaliphilum 20Z Used as host strain SH-1 M. alcaliphilum 20Z harboring shr-1 pXYL M. alcaliphilum 20Z harboring pCM351-XYL SH-XYL-1 M. alcaliphilum 20Z pXYL harboring shr-1 SH-2 M. alcaliphilum 20Z harboring shr-2 SH-XYL-2 M. alcaliphilum 20Z pXYL harboring shr-2 Vector pAWP89 oriV oriT trfA ahp dTomato P _tac pBudK.p pAWP89-based backbone carrying Ptac promoter and 2,3-BDO gene cluster originated from Klebsiella pneumoniae KCTC 2242 pXyl pAWP89-based backbone carrying Ptac promoter and xylAB _gene cluster originated from Escherichia coli K12 MG1655 and rpe from M. alcaliphilum 20Z pCM351 Ap ^R , Gen ^R , Tc ^R ; broad-host range cre-lox allelic exchange vector pCM351-glgA pCM351 containing flanks for knockout glgA1 pCM351-XYL pCM351-glgA containing construct for integration of Ptac- _xylAB -rpe coex413-NpR4 CEN/ARS plasmid, HIS3 , P _TEF1 -NpR5597-T _GPM1 , P _TDH3 -NpR5600-T _CYC1 , P _TEF1 -NpR5598-T _GPM1 , P _TDH3 -NpR5599-T _CYC1 pET-28a(+) Expression vector with N-terminal His-tag pET-28a-NpR5600 pET-28a containing NpR5600 pET-28a-NpR5600-NpR5599 pET-28a containing NpR5600 and NpR5599 pET-28a-NpR5600-NpR5599-NpR5598 pET-28a containing NpR5600- NpR5599-NpR5598 pET-28a-NpR5600-NpR5599-NpR5598-NpR5597 pET-28a containing NpR5600-NpR5599-NpR5598-NpR5597 pET-28a-NpR5600-NpR5599-NpR5598-NpR5597-TKT pET-28a containing NpR5600-NpR5599-NpR5598-NpR5597-TKT shr-1 pAWP89-based backbone carrying Ptac promoter and _NpR5600 -NpR5599-NpR5598-NpR5597-TKT pET-28a-NpR5600-RBS-NpR5599 pET-28a containing NpR5600 and NpR5599 with synthetic RBS pET-28a-NpR5600-RBS-NpR5599-RBS-NpR5598 pET-28a containing NpR5600 and NpR5599-NpR5598 with synthetic RBS pET-28a-NpR5600-RBS-NpR5599-RBS-NpR5598-RBS-NpR5597 pET-28a containing NpR5600 and NpR5599-NpR5598-NpR5597 with synthetic RBS pET-28a-NpR5600-RBS-NpR5599-RBS-NpR5598-RBS-NpR5597-RBS-TKT pET-28a containing NpR5600 and NpR5599-NpR5598-NpR5597-TKT with synthetic RBS shr-2 pAWP89-based backbone carrying Ptac promoter and _NpR5600 -NpR5599-NpR5598-NpR5597-TKT with synthetic RBS

All plasmids of the present invention were constructed using Gison assembly. Primers used to construct expression vectors and knockout vectors are shown in Table 2 below.

Primer Sequence Description pAWP89-For TAGTTGTCGGGAAGATGCGT For amplifying pAWP89 backbone which contained P _tac promoter and SD sequence pAWP89-Rev AGCTGTTTCCTGTGTGAATA xylAB-For-89 ttcacacaggaaacagctATGCAAGCCTATTTTGACCAGC For amplifying xylAB gene cluster from E. coli K12 MG1655 and rpe from Methylotuvimicrobium alcaliphilum 20Z then PCR products were ligated into pAWP89 backbone to construct pXyl. xylAB-Rev-Invert TTACGCCATTAATGGCAGAAGT RPE-For CTGCCATTAATGGCGTAAAAGGAGATATACATGGCCCAAAACTGGATAGCT RPE-Rev gcatcttcccgacaactaTTACTCGGCTTTTGCAATTTCCG glgA1-For acctgacgtctagatctgCTACCCGGCACTTCACCAAT For amplifying flanks to knockout glgA1 to construct pCM351-glgA glgA1-Rev gtaccaattgtacagctgGATCCGCCAAAAGCCTTAGGT glgA2-For cgtgttaaccggtgagctCTGTCGTCGATGCTCTACCC glgA2-Rev tggatcctctagtgagctTAGCGTTAGGAGAGGGACCC pTac-Integration-For CTCTGAAATGAGCTGTTGACA For amplifying xylAB gene cluster from E. coli K12 MG1655 and rpe from M. alcaliphilum 20Z from pXyl plasmid then PCR products were ligated into lineared pCM351-glgA to construct pCM351-XYL RPE-Invert-Rev TTACTCGGCTTTTGCAATTTCCG GenR-For ATTGCAAAAGCCGAGTAAATATGGCGGCCGCATAACTT pCM351-Inver-Rev GTCAACAGCTCATTTCAGAGGCATCCATGGTACCAATTGT NpR_5600_BamHI-For gacagcaaatgggtcgcgATGAGTAATGTTCAAGCATCGT For amplifying NpR5600 from coex413-NpR4 and then ligated to pET28, resulting in pET-28a-NpR5600 NpR_5600_BamHI-Rev cgacggagctcgaattcgTCACACTCCCAATAGTTTGGA NpR_5599_SacI-For gtgtgacgaattcgagctTTCACACAGGAAACAGCTATGACCAGTATTTTAGGACGAGA For amplifying NpR5599 from coex413-NpR4 and then ligated to pET-28a-NpR5600, resulting in pET-28a-NpR5600-NpR5599 NpR_5599_SacI-Rev aagcttgtcgacggagctTTATACCAAGCGTCTAATCAGGGT NPR_5598_SalI_For gcttggtataaagctccgTTCACACAGGAAACAGCTATGGCACAATCAATCTCTTT For amplifying NpR5598 from coex413-NpR4 and then ligated to pET-28a-NpR5600- NpR5599, resulting in pET-28a-NpR5600-NpR5599- NpR5598 NPR_5598_SalI_Rev agtgcggccgcaagcttgTTAGTCGCCCCCTAATTCCAC NPR_5597_HindIII_For attagggggcgactaacaTTCACACAGGAAACAGCTATGCCAGTACTTAATATCCTTCA For amplifying NpR5597 from coex413-NpR4 and then ligated to pET-28a-NpR5600-NpR5599-NpR5598, resulting in pET-28a-NpR5600-NpR5599-NpR5598- NpR5597 NPR_5597_HindIII_Rev tgctcgagtgcggccgcaTCAATTTTGTAACACCTTTTT TKT_20Z_NotI_For ggtgttacaaaattgatgcTTCACACAGGAAACAGCTATGCCTTCGCGCCGAG For amplifying TKT from M. alcaliphilum 20Z and then ligated to pET-28a-NpR5600-NpR5599-NpR5598-NpR5597, resulting in pET-28a-NpR5600-NpR5599-NpR5598-NpR5597-TKT TKT_20Z_NotI_Rev gtggtggtgctcgagtgcTTAAGCAGAGCTTCGACGTG NPR5600-89-For ttcacacaggaaacagctATGAGTAATGTTCAAGCATCGT For amplifying NpR operon and TKT from pET-28a-NpR5600-NpR5599-NpR5598-NpR5597-TKT then ligated to linear pAWP89, resulting in shr-1 vector TKT-20Z-89-Rev gcatcttcccgacaactaTTAAAGCAGAGCTTCGACGTG NPR_5599_SacI-65K-For gtgtgacgaattcgagctCCTAGCTGTAAGAAGGAGGTTTTTG
ATGACCAGTATTTTAGGACGAGA For amplifying NpR5599 from coex413-NpR4 and then ligated to pET-28a-NpR5600, resulting in pET-28a-NpR5600-RBS-NpR5599 NpR_5599_SacI-Rev aagcttgtcgacggagctTTATACCAAGCGTCTAATCAGGGT NPR_5598_SalI_46K_For gcttggtataaagctccgCGACACTATTTTCTAAGGCACTTTTT
ATGGCACAATCAATCTCTTT For amplifying NpR5598 from coex413-NpR4 and then ligated to pET-28a-NpR5600-RBS-NpR5599, resulting in pET-28a-NpR5600-RBS-NpR5599-RBS-NpR5598 NPR_5598_SalI_Rev agtgcggccgcaagcttgTTAGTCGCCCCCTAATTCCAC NPR_5597_HindIII_7K_For attagggggcgactaacaAGCATCAGAACAAGGAGCTTCTTTT
ATGCCAGTACTTAATATCCTTCA For amplifying NpR5597 from coex413-NpR4 and then ligated to pET-28a-NpR5600-RBS-NpR5599-RBS-NpR5598, resulting in pET-28a-NpR5600-RBS-NpR5599-RBS-NpR5598-RBS-NpR5597 NPR_5597_HindIII_Rev tgctcgagtgcggccgcaTCAATTTTGTAACACCTTTTT TKT_20Z_NotI_67K_For ggtgttacaaaattgatgcTCCTACGGGAAATAAGGAGGTCTTT
ATGCCTTCGCGCCGAG For amplifying TKT from M. alcaliphilum 20Z and then ligated to pET-28a-NpR5600-RBS-NpR5599-RBS-NpR5598-RBS-NpR5597, resulting in pET-28a-NpR5600-RBS-NpR5599-RBS-NpR5598-RBS NpR5597-RBS -TKT TKT_20Z_NotI_Rev gtggtggtgctcgagtgcTTAAGCAGAGCTTCGACGTG Invert-pTac-89-Rev TCCACACATTATACGAGCCG For amplifying _pAWP89 backbone which contained Ptac promoter pAWP89-Rev AGCTGTTTCCTGTGTGAATA NPR5600-89-52K-For gctcgtataatgtgtggaGTGGATAGAGTCAGGAGGTTATAGG
ATGAGTAATGTTCAAGCATCGT For amplifying NpR operon and TKT with synthetic RBS from pET-28a-NpR5600-RBS-NpR5599-RBS-NpR5598-RBS-NpR5597-RBS-TKT then ligated to linear pAWP89, resulting in shr-2 vector TKT-20Z-89-Rev gcatcttcccgacaactaTTAAAGCAGAGCTTCGACGTG TesB-89-Rev gcttgtcgacggagctcgTTAATTGTGATTACGCATCACCCC

Full length DNA of M. alcalilphilum 20Z, Escherichia coli K12 MG1655 and R. eutropha H16 were isolated with the Wizard Genomic DNA Purification Kit (Promega, USA). The master mix used for Gibson assembly was purchased from NEB (Hitchin, UK) and used. A polymerase for the PCR reaction was purchased and used Lamp Pfu polymerase (BioFACT, Daejeon).

After gene sequence analysis, the operon was designed using Operon Calculator v2.1, and the 5' untranslated region and the beginning of each protein-coding sequence were determined to have high translation rate and capacity even in 100,000 experiments by the RBS Calculator proportional scale. Gene clusters were co-optimized. Optimized ribosome binding sites and protein-coding sequences for the NpR operon and TKT were assembled into one bacterial operon driven by the Ptac promoter.

(2). M. alcaliphlum 20Z's electroporation-based genetic manipulation method

M. alcaliphlum 20Z was engineered using an electroporation-based genetic engineering method. Briefly, 50 ml of the culture was incubated in the presence of 1% methanol until it had an absorbance of 0.4 to 0.6 (600 nm). The cultured cells were centrifuged at 5000 × g at 4° C. for 10 minutes, and then resuspended in 50 ml of cold water to obtain cells. The cells obtained above were further washed twice with cold water. The obtained cell pellet was resuspended in 100 μL sterile distilled water. 50 μL of the cell suspension was gently mixed with 500 ng of DNA, and the mixture was transferred to a 1 mm ice-cold gap cuvette (Bio-Rad). Electroporation was performed at 1.3 kV, 25 μF and 200 Ω using a Gene Pulser Xcell™ Electroporation System (Bio-Rad). Immediately after electroporation, 1 ml of NMS was added to the cells and then transferred to 10 ml NMS medium in a 180 ml serum bottle containing 0.1% methanol for cell recovery. After overnight shaking at 30° C., the cells were centrifuged at 5000 × g for 10 min at room temperature and plated on a solid selective medium.

(3). Total RNA isolation and sequencing

For preparation of the sequencing library, 5 ml of exponential phase microbial culture was used. Total RNA was stabilized with bacterial RNA protect (Qiagen, Germany) and extracted using RNeasy Mini kit (Qiagen). Total RNA sequencing was performed with the Illumina Hiseq-2000 platform (Macrogen, Korea).

(4). Calculation of differentially expressed genes

Raw sequence data quality was checked with FastQC (http://www.bioinformatics.babraham.ac.uk/projects/fastqc), based on known techniques. Sequencing reads were mapped from the base sequence of M. alcaliphilum 20Z, and Bowtie toolbox was used with other default options, adding 3 bp of bases from the 3' end for a maximum insert size of 1000 bp and a maximum mismatch of 2. Sequence alignment maps were aligned with SAMTools (http://samtools.sourceforge.net) and converted into map (BAM) files. The ordered map file was input to Cufflinks and Cuffdiff31, and FPKM (kilobase per million fragments per exon) and differentially expressed DNA fragments were calculated, respectively, and differential expression with a log2-fold change of 1.0 or more and an error detection rate of 0.01 The following genes were considered to be differentially expressed.

(5). Calculation of in silico metabolic fluxes by FBA analysis and Markov Chin Monte Carlo (MCMC) sampling

To calculate the in silico metabolic fluxes, FBA analysis and MCMC sampling were performed using the M. alcaliphilum genome-scale models iJO136618, iMM90419, iIA40712 and COBRApy32. The flux distribution for the reaction in each of the above models was confirmed using MCMC samples. The uptake rates for the carbon sources (methane and methanol) were model-limited to 11.7 mmol/gDCW/h and 22 mmol/gDCW/h, respectively. The modeling of glucose was limited to an uptake rate of 10 mmol/g DCW/h, and the biomass objective function (BOF) was calculated by setting the lower limit to 95% of the optimal growth rate when calculated by FBA. Therefore, the flux distribution by the MCMC sampling method was expressed as suboptimal flux. After normalizing the average flux values for BOF by performing the opt Gp Sampler sampling algorithm with a viable flux of 100,000, the flux values for each reaction were used for further analysis.

(6) Analysis method

The concentrations of xylose, formic acid and acetic acid, 2,3-BDO, acetone and 3HB were measured by centrifuging the cell culture medium and filtering the supernatant through a 0.2 μm syringe filter. Xylose, formic acid and acetic acid, 2,3-BDO, acetone and 3HB were analyzed by high-performance liquid chromatography (HPLC) and refractive index detector using an Aminex HPX-87H organic acid column (Bio-Rad, USA). analyzed. As a mobile phase, 0.005 M sulfuric acid was used, and analysis was performed at a flow rate of 0.6 ml per minute at 60 °C. 3HB was measured by setting the flow rate of the initial mobile phase to 0.55 ml/min, increasing the flow rate to 0.8 ml/min for 12 minutes, maintaining the flow rate for 8 minutes, and maintaining the column temperature at 35°C. Shinorine was analyzed using the filtered supernatant after centrifuging the cell culture medium, and quantified by comparison with the HPLC shinoline standard curve (CJcheilJedang, BIO Research Institute). In addition, in order to analyze shinoline, after adding 1 ml of water to the cell pellet obtained after centrifugation, 1.5 ml of chloroform was added and vortexed for 3 minutes to destroy the cells. When layer separation occurred after cell disruption, the layer dissolved in water was obtained to quantify intracellular shinoline concentration. The shinoline analysis was performed by HPLC using an Agilent Eclopse XDB-C18 column (5 μm, 4.6 x 250 mm), and as a mobile phase, a solution of water and acetonitrile mixed in a weight ratio of 95: 5 at a column temperature of 40 ° C. It was analyzed at a flow rate of 0.5 ml per minute and detected using a 334 nm UV detector.

(7) Enhancement of cluster of orthologous group (COG) function

In the present invention, genes showing differential expression were classified according to cluster of orthologous group (COG). The functional enhancement of the gene COG category was determined by analysis with a hypergenometric test, and it was considered significant when the P value was 0.05 or less.

Experimental Example 1. Confirmation of production efficiency of introduction of RuMP pathway in methane magnetizing bacteria type 1

Type I methanotrophs such as M. alcaliphilum 20Z can grow only on C1 carbon sources including methane or methanol. Metabolic flux analysis using a genome-scale model of M. alcaliphilum 20Z iIA40712 predicted that the key metabolic pathway of M. alcaliphilum 20Z in methane and methanol growth media mainly flows to fructose-6-phosphate (F6P) via the RuMP pathway (Fig. 1). When the carbon source uptake rates were set to ~11.7 mmol/gDCW/h for methane and ~22 mmol/gDCW/h for methanol, 94.2% and 65% carbon fluxes were fed to the RuMP cycle for methane and methanol, respectively. This major carbon flow control node has several interconnected branches, including metabolic pathways, including oxidative and non-oxidative RuMPs, and the Embden-Meyerhof-Parnas, Entner-Doudoroff, and phosphoketolase pathways, which account for a large portion of F6P (~75%). ) into non-oxidative RuMP for regeneration of ribose-5-phosphate (Ru5P), which is then used for formaldehyde fixation (Fig. 1). The high transcript levels, protein and metabolite pools of the non-oxidative RuMP pathway in M. alcaliphilum 20Z support these results (Fig. 2).

In industrial strains such as Escherichia coli and Saccharomyces cerevisiae, the oxidation site of the pentose phosphate pathway is highly active, converting glucose 6-phosphate to carbon dioxide, Ru5P and NADPH. To investigate how the carbon flux is regulated in these microorganisms, the metabolic flux states of E. coli , iJO1366 model and S. cerevisiae , iMM90419 genome-scale were predicted by flux balance analysis under growth conditions using glucose as a carbon source. Ru5P appeared to be derived from oxidative PPP and only a small fraction was directed towards non-oxidative PPP with one carbon loss in the form of CO when gluconate was converted from Ru5P via 6-phosphogluconate dehydrogenase. . When the glucose uptake rate was set to ~10 mmol/gDCW/h, only 15% and 2.63% of the carbon flux entered the nonoxidative PPP in E. coli and S. cerevisiae, respectively (Figs. 1 and 2). In M. alcaliphilum 20Z, the products derived from intermediates of the non-oxidative RuMP cycle, which have high flux, are the most promising candidates for metabolic engineering in M. alcaliphilum 20Z and type I methanotrophs.

Experimental example 2. M. alcaliphilum Construction of the shinorine synthesis pathway at 20Z

In the present invention, we tried to produce shinoline from an intermediate in the non-oxidative RuMP pathway of M. alcalilphilum 20Z. Sedoheptulos 7-phosphate (S7P), an intermediate in the nonoxidative RuMP pathway, is a major precursor for the biosynthesis of shinorine. For the biosynthesis of shinorine, S7P is first converted into 2-dimethyl 4-deoxygadusol synthase (DDGS, NPR_5600, SEQ ID NO: 1) by 2-dimethyl 4-deoxygadusol synthase. After conversion, it should be converted to 4-deoxygadusol (4-DG) by O-methyltransferase (OMT, NPR_5599, SEQ ID NO: 2). Subsequently, glycine free in the cell is conjugated to 4-DG by ATP-grasp ligase (NPR_5598, SEQ ID NO: 3) to form mycosporine-glycine (MG), and finally As a result, serine is attached to MG, and non-ribosomal peptide synthetase (NRPS) or cyanobacteria ( Nostoc punctiforme )-derived D-ala-D-ala ligase (D-ala-D-ala ligase, NPR_5597, SEQ ID NO: 4) produces shinoline (FIG. 2). Therefore, in the present invention, in order to produce shinorine in M. alcaliphilum 20Z, gene complexes related to the shinorine synthesis pathway (DDGS, OMT, ATP-grasp ligase and D-ala-Dala ligase) were transformed. In addition, since the production of shinoline increases when the S7P pool is increased, in the present invention, the tkt1 gene (SEQ ID NO: 5) encoding transketolase, which is an important pathway in the non-oxidative RuMP pathway, is overexpressed. converted (Fig. 2). Therefore, the above four shinorine synthesis genes, together with the tkt1 gene, were inserted into the pAWP89 vector to obtain a shr-1 plasmid. The pAWP89 vector has a constitutive promoter Ptac showing strong expression by lacZ, and is a vector for cloning heterogeneous genes into methanotrophs by Shine-Dalgarno sequence. Using the shr-1 plasmid, M. alcaliphilum 20Z was transformed to obtain SH-1 strain, and growth rate and shinoline production were evaluated.

The transformed SH-1 strain showed a growth rate similar to that of the wild-type strain, indicating that overexpression of the shinorine biosynthetic gene did not affect cell growth (FIG. 3). In addition, the SH-1 strain produced a small amount of shinorine at 0.6 mg/L (1.13 mg/g DCW) and 0.52 mg/L (1.41 mg/g DCW) in methanol and methane, respectively, and after centrifuging the cell culture medium A small amount of shinoline was also detected in the supernatant (FIG. 4). No other by-products were detected in the cell extract and the supernatant of the culture solution, confirming that all biosynthetic intermediates were completely converted to shinoline. The shinoline produced in the present invention is the first case produced by introducing a heterogeneous shinorine synthetase for the first time in methane magnetizing bacteria, and in previously known literature, E. coli (0.15mg/L) and yeast (0.085 mg/g) DCW) showed a relatively higher yield than synorine synthesized.

Experimental example 3. M. alcaliphilum Addition of xylose pathway and co-trophic culture in 20Z

The M. alcaliphilum 20Z strain used in the present invention cannot naturally metabolize methane and substrates other than methane. Therefore, while searching for a common substrate to improve the production of shinoline by performing cotrophic culture using other common substrates, it is possible to directly supply intermediates in the pentose metabolic pathway, which is economical and can be used in large quantities. A possible xylose metabolic pathway was introduced. As shown in FIG. 5, in the present invention, an expression vector for constructing a xylose assimilation pathway was constructed in order to increase the S7P pool of the RuMP pathway. In the case of xylose metabolism in Escherichia coli, xylose is first converted to D-xylulose by xylose isomerase encoded by xylA (SEQ ID NO: 6). Subsequently, D-xylulose is phosphorylated into xylulose-5-phosphate (Xu5P) by xylokinase encoded by xylB (SEQ ID NO: 7). Xu5P is converted to riulose 5-phosphate by ribulose-phosphate 3-epimerase (rep, SEQ ID NO: 8) and incorporated into the nonoxidative PPP pathway. By introducing a heterologous pathway consisting of the xylAB gene cluster together with endogenous genes in the non-oxidative RuMP pathway, M. alcaliphilum 20Z can utilize xylose as the sole carbon source. Therefore, in order to use xylose as a common substrate, xylose isomerase (xylA, SEQ ID NO: 6) driven by the Ptac promoter, xylokinase (xylB, SEQ ID NO: 7) and riulose-phosphate 3-epimera (rep, SEQ ID NO: 8) was ligated to the pCM351-glgA vector to generate the pCM351-XYL vector. The above vector was introduced into M. alcaliphilum 20Z to generate a pXYL strain. The strain transduced with the above vector was able to continuously grow using only xylose as the only carbon source. The shinoline-producing plasmid, shr-1, was isolated from the SH-1 strain and reintroduced into the pXYL strain through electroporation to generate the SH-XYL-1 strain. The SH-XYL-1 strain was cultured in NMS medium, in a growth medium containing methane, xylose, and a mixture of methane and xylose. As a result, the SH-XYL-1 strain showed the highest growth rate in the co-trophic culture in which methane and xylose were mixed (FIG. 6). In the culture using methane and xylose as a common carbon source, xylose consumed 4.28 g/L after 120 hours, showing a higher xylose usage efficiency than when xylose was used as a single carbon source (1.03 g/L) (Fig. 7).

The methanogen SH-XYL-1 for producing shinorine produced 2 mg/L (1.81 mg/g DCW) of shinorine when xylose and methane were used as carbon sources, whereas it was 0.87 mg/L (1.24 mg/g DCW) in methane. g DCW) was produced (FIG. 8). Unlike the pXYL strain, SH-XYL-1 showed severe growth defects when cultured in a medium containing xylose (Fig. 6). However, the shinoline content in cells grown in a medium containing methane was 1.57 mg/g. DCW was still higher than xylose (FIG. 8). As production levels increased in the presence of methane and xylose, shinoline production was higher in cell-free supernatants, suggesting modification of the transporter system for extracellular release of shinorine (FIG. 9). These results indicate that enabling mixed nutrient growth in M. alcaliphilum 20Z by using xylose and methane as co-carbon sources can effectively increase growth and shinorine production.

The above results were compared through RNA-transcriptome analysis according to differential expression of genes. As a result of comparing the culture in which methane was added as a single carbon source and the culture in which methane and xylose were provided together, 345 genes (8.33%) of 4139 genes showed significantly differential expression, of which 212 genes It was down-regulated, and it was confirmed that 133 genes were up-regulated. Expression of central carbon metabolism genes was largely unchanged. From a structural point of view, shinorine appears to be transported via membrane transporters. In the COG analysis, it can be confirmed that the highest differential expression appeared in the transport and metabolism of inorganic ions (FIG. 10). In addition, the results of the COG analysis confirmed that shinoline was released outside the cell by changing the membrane transport system. In particular, a regulatory separation of nitrate and sulfate transport systems was observed when switching growth modes. Expression levels of nitrate ABC transporter-encoding genes were reduced ~10-fold in mixed nutrient growth compared to methyltrophic mode, whereas expression levels of sulfate transporter-encoding genes were increased ~10-fold. These results support the hypothesis that shinorine is released by altering the membrane transport system.

Example 4. Stimulated shinoline production by the addition of trace minerals

The growth of M,alcaliphilum 20Z of the present invention depends on the availability of trace minerals such as copper, calcium (or lanthanum) and tungsten. Trace minerals such as copper are essential for the activation of particulate methane monooxygenase (pMMO) in methanotrophs, and calcium or lanthanum are essential for the activation of pyrroloquinoline quinone-dependent methanol dehydrogenase (pyrroloquinoline quinone-dependent methanol dehydrogenase). It is necessary for the methanol oxidation process through, and the presence of trace minerals promotes the oxidation process of methane. Therefore, in the present invention, for optimal conditions for producing shinorine, trace minerals were added to establish optimal conditions for producing shinorine.

In the present invention, when the SH-XYL-1 strain was cultured under methane and xylose conditions, it was confirmed that a significant amount (2.3 g/L) of by-products such as formic acid and acetate were included (FIG. 11). NAD-linked formate dehydrogenase (FDH) is known as the main enzyme for the oxidation of formic acid in methanogens, and the low activity of FDH can be confirmed from the accumulation of formic acid under methane and xylose conditions. there was. In addition, the oxidation process of formic acid is related to the production of NADH, and when the oxidation of formic acid is lowered, the cell growth rate decreases. Therefore, in the present invention, a small amount of tungsten was added to SH-XYL-1 under methane and xylose conditions to improve cell growth and shinoline production. It was more than 3 times higher (OD600 nm = 21) (FIG. 11), and the xylose consumption rate also increased. It was confirmed that the production of shinoline also increased by about 3 times to 6.25 mg/L after 192 hours (FIG. 12).

Example 5. Design and construction of operon to improve shinoline production

Protein expression levels are controlled by transcription, translation and mRNA stability, which are regulated by genetic elements such as promoters and strength of ribosome binding sites or coding sequences. The feature of controlling the gene expression level to efficiently produce shinorine is needed to design more carbon cycle pathways through the shinorine biosynthetic pathway. It was confirmed that Ptac, a strong promoter used in the present invention, is a suitable promoter for expressing heterogeneous genes in M. alcaliphilum 20Z. Therefore, in the present invention, an operon was designed using an operon calculator to optimize the expression of the shinorine synthesis pathway. In the process of selecting the sequence of the untranslated region from the 5' end to increase the translation rate, unnecessary genetic elements were minimized. As a result, the synthetic operon for shinorine production consists of five different genes NPR5600 (SEQ ID NO: 1), NPR5599 (SEQ ID NO: 2), NPR5598 (SEQ ID NO: 3) and NPR5597 (SEQ ID NO: 4) and TKT (SEQ ID NO: 5). By grouping together, it was designed (SEQ ID NO: 9 and FIG. 13). The synthesized operon was inserted into the pAWP89 vector to generate the shr-2 vector, and introduced into wild-type M. alcaliphilum 20Z and a xylose metabolizing strain to obtain SH-2 and SH-XYL-2 strains.

It was confirmed that the SH-2 strain produced 1.2 mg/L of shinoline, which was about 2.4 times better than the SH-1 strain (FIG. 14). Compared to strain SH-XYL-1, strain SH-XYL-2 cultured under conditions of methane and xylose with tungsten added did not show significant changes in growth and acetate formation (FIG. 15), but the production of shinoline was 17.13 mg / It was confirmed that it increased by 2.7 times as L (FIG. 16). Therefore, it was confirmed that the strain transformed with the operon designed in the present invention is a strain with improved shinoline production.

<110> University-Industry Cooperation Group of Kyung Hee University <120> Development of novel methanotroph that co-assimilate methane and xylose, and producing shinorine using itself <130> PN1910-471 <160> 9 <170> KoPatentIn 3.0 <210> 1 <211> 1233 <212> DNA <213> Unknown <220> <223> NPR_5600 (2-demethyl 4-deoxygadusol synthase) <400> 1 atgagtaatg ttcaagcatc gtttgaagca acggaagctg aattccgcgt ggaaggttac 60 gaaaaaattg agtttagtct tgtctatgta aatggtgcat ttgatatcag taacagagaa 120 attgcagaca gctatgagaa gtttggccgt tgtctgactg tgattgatgc taatgtcaac 180 agattatatg gcaagcaaat caagtcatat tttagacact atggtattga tctgaccgta 240 gttcccattg tgattactga gcctactaaa acccttgcaa cctttgagaa aattgttgat 300 gctttttctg actttggttt aatccgcaag gaaccagtat tagtagtggg tggtggttta 360 accactgatg tagctgggtt tgcgtgtgct gcttaccgtc gtaagagtaa ctatattcgg 420 gttccgacaa cgctgattgg tctgattgat gcaggtgtag cgattaaggt tgcagtcaac 480 catcgcaagt taaaaaatcg cttgggtgca tatcatgctc ctttgaaagt catcctcgat 540 ttctccttct tgcaaacatt accaacggct caagttcgta atgggatggc agagttggtc 600 aaaattgctg ttgtggcgaa ctctgaagtc tttgaattgt tgtatgaata tggcgaagag 660 ttgctttcca ctcactttgg atatgtgaat ggtacaaagg aactgaaagc gatcgcacat 720 aaactcaatt acgaggcaat aaaaactatg ctggagttgg aaactccaaa cttgcatgag 780 ttagacctcg atcgcgtcat tgcctacggt cacacttgga gtccgacctt agaattagct 840 ccgatgatac cgttgtttca cggtcatgcc gtcaatatag acatggcttt gtctgcaact 900 attgcggcaa gacgtggcta cattacatca ggagaacgcg atcgcatttt gagcttgatg 960 agtcgtatag gtttatcaat cgatcatcct ctactagatg gcgatttgct ctggtatgct 1020 acccaatcta ttagcttgac gcgagacggg aaacaacgcg cagctatgcc taaacccatt 1080 ggtgagtgct tctttgtcaa cgatttcacc cgtgaagaac tagatgcagc tttagctgaa 1140 cacaaacgtc tgtgtgctac ataccctcgt ggtggagatg gcattgacgc ttacatagaa 1200 actcaagaag aatccaaact attgggagtg tga 1233 <210> 2 <211> 834 <212> DNA <213> Unknown <220> <223 > NPR_5599 (O-methyltransferase) <400> 2 atgaccagta ttttaggacg agataccgca agaccaataa cgccacatag cattctggta 60 gcacagctac aaaaaaccct cagaatggca gaggaaagta atattccttc agagatactg 120 acttctctgc gccaagggtt gcaattagca gcaggtttag atccctatct ggatgattgc 180 actacccctg aatcgaccgc attgacagca ctagcgcaga agacaagcat tgaagactgg 240 agtaaacgct tcagtgatgg tgaaacagtg cgtcaattag agcaagaaat gctctcagga 300 catcttgaag gacaaacact aaagatgttt gtgcatatca ctaaggctaa aagcatccta 360 gaagtgggaa tgttcacagg atattcagct ttggcaatgg cagaggcgtt accagatgat 420 gggcgactga ttgcttgtga agtagactcc tatgtggccg agtttgctca aacttgcttt 480 caagagtctc cccacggccg caagattgtt gtagaagtgg cacctgcact agagacgctg 540 cacaagctgg tggctaaaaa agaatccttt gatctgatct tcattgatgc ggataaaaag 600 gagtatatag aatacttcca aattatcttg gatagccatt tactagctcc cgacggatta 660 atctgtgtag ataatacttt gttgcaagga caagtttacc tgccatcaga acagcgtaca 720 gccaatggtg aagcgatcgc tcaattcaac cgcattgtcg ccgcagatcc tcgtgtagag 780 caagttctgt tacccatacg agatggtata accctgatta gacgcttggt ataa 834 <210> 3 <211> 1386 <212> DNA <213 > Unknown <220> <223> NPR_5598 (ATP-grasp ligase) <400> 3 atggcacaat caatctcttt atctcttcct caatccacaa cgccatcaaa gggt gtgagg 60 ctaaaaatag cagctctact gaagactatc gggactctaa tactactgct gatagccttg 120 ccgcttaatg ctttgatagt attgatatct ctgatgtgta ggccgtttac aaaaaaacct 180 gccgtagcca ctcatcccca gaatatcttg gtcagtggcg gcaaaatgac caaagcattg 240 caacttgccc gctccttcca tgcagccgga cacagagtta ttctgattga aggtcataaa 300 tactggttat cagggcatag attctcaaat tctgtgagtc gtttttatac agttcctgca 360 ccacaagacg acccagaagg ctatacccaa gcgctattgg aaattgtcaa acgagagaag 420 attgacgttt atgtacccgt atgcagccct gtagctagtt attacgactc tttggcaaag 480 tctgcactat cagaatattg tgaggttttt cactttgatg ctgatataac caagatgctg 540 gatgataaat ttgcctttac cgatcgggcg cgatcgcttg gtttatcagc cccgaaatct 600 tttaaaatta ccgatcctga acaagttatc aacttcgatt ttagtaaaga gacgcgcaaa 660 tatattctta agagtatttc ttacgactca gttcgccgct taaatttaac caaacttcct 720 tgtgataccc cagaagagac agcagcgttt gtcaagagtt tacccatcag cccagaaaaa 780 ccttggatta tgcaagaatt tattcctggg aaagaattat gcacccatag cacagtccga 840 gacggcgaat taaggttgca ttgctgttca aattcttcag cgtttcagat taactatgaa 900 aatgtcgaaa atccccaaat tcaagaatgg gtacaacatt tcgtcaaaag tttacggctg 960 actggacaaa tatctcttga ctttatccaa gctgaagatg gtacagctta tgccattgaa 1020 tgtaatcctc gcacccattc ggcgatcaca atgttctaca atcacccagg tgttgcagaa 1080 gcctatcttg gtaaaactcc tctagctgca cctttggaac ctcttgcaga tagcaagccc 1140 acttactgga tatatcacga aatctggcga ttgactggga ttcgctctgg acaacaatta 1200 caaacttggt ttgggagatt agtcagaggt acagatgcca tttatcgcct ggacgatccg 1260 ataccatttt taactttgca ccattggcag attactttac ttttgctaca aaatttgcaa 1320 cgactcaaag gttgggtaaa gatcgatttt aatatcggta aactcgtgga attagggggc 1380 gactaa 1386 <210> 4 <211> 1047 <212> DNA <213> Unknown <220> <223> NPR_5597 (D-ala-D-ala ligase) <400> 4 atgccagtac ttatatatcct tcatttagagtt 60 ttatcacgtc tttatgccca agactgttta gctgcaacag cagatccatc gctttataac 120 tttcaaattg catatatcac acccgatcgg cagtggcgat ttcctgactc tctcagtcga 180 gaagatattg ctcttaccaa accgattcct gtgtttgatg ccatacaatt tctaacaggc 240 caaaacattg acatgatgtt accacaaatg ttttgtattc ctggaatgac tcag taccgt 300 gccctattcg atctgctcaa gatcccttat ataggaaata ccccagatat tatggcgatc 360 gcggcccaca aagccagagc caaagcaatt gtcgaagcag caggggtaaa agtgcctcgt 420 ggagaattgc ttcgccaagg agatattcca acaattacac ctccagcagt cgtcaaacct 480 gtaagttctg acaactcttt aggagtagtc ttagttaaag atgtgactga atatgatgct 540 gccttaaaga aagcatttga atatgcttcg gaggtcatcg tagaagcatt catcgaactt 600 ggtcgagaag tcagatgcgg catcattgta aaagacggtg agctaatagg tttacccctt 660 gaagagtatc tggtagaccc acacgataaa cctatccgta actatgctga taaactccaa 720 caaactgacg atggcgactt gcatttgact gctaaagata atatcaaggc ttggatttta 780 gaccctaacg acccaatcac ccaaaaggtt cagcaagtgg ctaaaaggtg tcatcaggct 840 ttgggttgtc gccactacag tttatttgac ttccgaatcg atccaaaggg acaaccttgg 900 ttcttagaag ctggattata ttgttctttt gcccccaaaa gtgtgatttc ttctatggcg 960 aaagcagccg gaatccctct aaatgattta ttaataaccg ctattaatga aacattgggt 1020 agtaataaaa aggtgttaca aaattga 1047 <210> 5 <211> 2013 <212 > DNA <213> Unknown <220> <223> transketolase, tkt1 <400> 5 atgccttcgc gccgagactt agcgaacg cc atacgcgctt tgagcatgga tgccgtccaa 60 aaagccaact ccggacaccc gggcgcaccg atggggatgg cggatatcgc cgaggtgtta 120 tggaacgact tcctgcagca taacccgact aacccgaact gggccaaccg agaccgcttc 180 gtactgtcta acggccacgg ctcgatgctg ctgtactcgt tactgcatct gacaggttac 240 cagctgccga tcgacgaact gaaacaattc cgtcaactgc attcaaaaac cccgggtcat 300 ccggaatacg gctatgcgcc gggcgtcgaa acgacgaccg gaccattagg tcaaggcatc 360 accaatgccg tgggctttgc gatagccgaa cgcgcactag cgggtcaatt taaccgtccc 420 ggacacgaaa tcgtcgacca ttacacctac gccttcctgg gcgacggctg tttaatggaa 480 ggcatctcgc atgaagcctg ctcattggcc ggctcgatga aactgggcaa actgattgcc 540 gtctacgacg acaacaacat ctcgatcgac ggcgaagtcc gcggtcacgg cgacacgccg 600 ggctggttcc tggacgacac gccgaaacgc ttcgaagcct acggctggca cgtcatcccg 660 aaagtagacg gccataaccc tgaagccgtc aaaaaagcct tggaagaagc gcgtagcgtc 720 actgatcggc cgaccttgat ctgctgccaa accatcattg gctggggctc gccgaataaa 780 gaaggcaaag aagaatgtca tggagcggca ttaggcgaag ccgaaatcac ggcaacccgc 840 gaacgcatcg gttggccgca tgcacctttc gaaatcccgg cggatat tta cgcgggttgg 900 gatgcgaaag acaaaggcgc gcgtcaagaa gcggagtgga acgacaaatt cgcgaaatac 960 caagcagcgc atccggaact ggcggccgaa ttcgaacgcc gcatgagcgg acagctgccg 1020 agcgactggt cggaaaaagc gaacgccttc attgctgcgg tcgacgcgaa aggcgaaacc 1080 atcgctagcc gcaaagcctc acaaaacacc ctgaacggat tcggaccgtt actgcccgaa 1140 ctgatgggcg gctcggcgga cttggcaggc tccaacttga ccctgtggtc gggttgcaaa 1200 gacgtcaacg ccccgggaca tgacggcaac tacgtctact acggcgtccg tgaattcggc 1260 atgtcggcga tcatgaacgg catcaccctg catggcggct tcaagccgta cggcgcgacc 1320 ttcctgatgt tctccgaata tgcgcggaat gccttgcgga tggcgtcgtt gatgaaaatc 1380 ccgaccatct tcgtatacac gcacgactcg atcggcttag gcgaagacgg cccgacccat 1440 caaccgatcg aacaaaccgc gaccttgcgg atgattccaa acatgcaagt gtggcgtcca 1500 tgtgatgctg tggaatcggc ggtgtcgtgg aaagcggcga ttgaacgaaa cgatggaccg 1560 agttgtctga tcttctcacg gcaaaaccta gcgcacattg cgcggacgcc ggcgcagatc 1620 gaagcgatca acaaaggcgg ctacattctg aaagacagcg aaggtcagcc ggacgtgatc 1680 ctgattgcga cgggctcgga agtcgaattg gcggtgaaag cggcagacga gttg agcggc 1740 aaaggcaaaa aagtgcgggt cgtctcgatg ccatcgacca acgtattcga tgcgcaggac 1800 gaagcctacc gtgagtcggt gctgccgtca tcggtgacaa aacgcgtcgt aattgaagcg 1860 ggcgtgaccg acagctggtg gaaatacgcg ggtacacaag gttgcgtcat cggaatggat 1920 cgtttcggcg aatcggcacc ggccggcgcg ctgttcaaag agttcggctt caccgttgac 1980 aatgtcgtca aacacgtcga agctctgctt taa 2013 <210> 6 <211> 1323 <212> DNA <213> Unknown <220> <223> xylose isomerase, xylA <400> 6 atgcaagcct attttgacca gctcgatcgc gttcgttatg aaggctcaaa atcctcaaac 60 ccgttagcat tccgtcacta caatcccgac gaactggtgt tgggtaagcg tatggaagag 120 cacttgcgtt ttgccgcctg ctactggcac accttctgct ggaacggggc ggatatgttt 180 ggtgtggggg cgtttaatcg tccgtggcag cagcctggtg aggcactggc gttggcgaag 240 cgtaaagcag atgtcgcatt tgagtttttc cacaagttac atgtgccatt ttattgcttc 300 cacgatgtgg atgtttcccc tgagggcgcg tcgttaaaag agtacatcaa taattttgcg 360 caaatggttg atgtcctggc aggcaagcaa gaagagagcg gcgtgaagct gctgtgggga 420 acggccaact gctttacaaa ccctcgctac ggcgcgggtg cggcgacgaa cggcgatcc gct4cggccagatcc cggc aacgcaagtt gttacagcga tggaagcaac ccataaattg 540 ggcggtgaaa actatgtcct gtggggcggt cgtgaaggtt acgaaacgct gttaaatacc 600 gacttgcgtc aggagcgtga acaactgggc cgctttatgc agatggtggt tgagcataaa 660 cataaaatcg gtttccaggg cacgttgctt atcgaaccga aaccgcaaga accgaccaaa 720 catcaatatg attacgatgc cgcgacggtc tatggcttcc tgaaacagtt tggtctggaa 780 aaagagatta aactgaacat tgaagctaac cacgcgacgc tggcaggtca ctctttccat 840 catgaaatag ccaccgccat tgcgcttggc ctgttcggtt ctgtcgacgc caaccgtggc 900 gatgcgcaac tgggctggga caccgaccag ttcccgaaca gtgtggaaga gaatgcgctg 960 gtgatgtatg aaattctcaa agcaggcggt ttcaccaccg gtggtctgaa cttcgatgcc 1020 aaagtacgtc gtcaaagtac tgataaatat gatctgtttt acggtcatat cggcgcgatg 1080 gatacgatgg cactggcgct gaaaattgca gcgcgcatga ttgaagatgg cgagctggat 1140 aaacgcatcg cgcagcgtta ttccggctgg aatagcgaat tgggccagca aatcctgaaa 1200 ggccaaatgt cactggcaga tttagccaaa tatgctcagg aacatcattt gtctccggtg 1260 catcagagtg gtcgccagga acaactggaa aatctggtaa accattatct gttcgacaaa 1320 taa 1323 < 210> 7 <211> 1455 <21 2> DNA <213> Unknown <220> <223> xylulosekinase, xylB <400> 7 atgtatatcg ggatagatct tggcacctcg ggcgtaaaag ttattttgct caacgagcag 60 ggtgaggtgg ttgctgcgca aacggaaaag ctgaccgttt cgcgcccgca tccactctgg 120 tcggaacaag acccggaaca gtggtggcag gcaactgatc gcgcaatgaa agctctgggc 180 gatcagcatt ctctgcagga cgttaaagca ttgggtattg ccggccagat gcacggagca 240 accttgctgg atgctcagca acgggtgtta cgccctgcca ttttgtggaa cgacgggcgc 300 tgtgcgcaag agtgcacttt gctggaagcg cgagttccgc aatcgcgggt gattaccggc 360 aacctgatga tgcccggatt tactgcgcct aaattgctat gggttcagcg gcatgagccg 420 gagatattcc gtcaaatcga caaagtatta ttaccgaaag attacttgcg tctgcgtatg 480 acgggggagt ttgccagcga tatgtctgac gcagctggca ccatgtggct ggatgtcgca 540 aagcgtgact ggagtgacgt catgctgcag gcttgcgact tatctcgtga ccagatgccc 600 gcattatacg aaggcagcga aattactggt gctttgttac ctgaagttgc gaaagcgtgg 660 ggtatggcga cggtgccagt tgtcgcaggc ggtggcgaca atgcagctgg tgcagttggt 720 gtgggaatgg ttgatgctaa tcaggcaatg ttatcgctgg ggacgtcggg ggtctatttt 780 gctgtcagcg aagggttctt aagcaag cca gaaagcgccg tacatagctt ttgccatgcg 840 ctaccgcaac gttggcattt aatgtctgtg atgctgagtg cagcgtcgtg tctggattgg 900 gccgcgaaat taaccggcct gagcaatgtc ccagctttaa tcgctgcagc tcaacaggct 960 gatgaaagtg ccgagccagt ttggtttctg ccttatcttt ccggcgagcg tacgccacac 1020 aataatcccc aggcgaaggg ggttttcttt ggtttgactc atcaacatgg ccccaatgaa 1080 ctggcgcgag cagtgctgga aggcgtgggt tatgcgctgg cagatggcat ggatgtcgtg 1140 catgcctgcg gtattaaacc gcaaagtgtt acgttgattg ggggcggggc gcgtagtgag 1200 tactggcgtc agatgctggc ggatatcagc ggtcagcagc tcgattaccg tacggggggg 1260 gatgtggggc cagcactggg cgcagcaagg ctggcgcaga tcgcggcgaa tccagagaaa 1320 tcgctcattg aattgttgcc gcaactaccg ttagaacagt cgcatctacc agatgcgcag 1380 cgttatgccg cttatcagcc acgacgagaa acgttccgtc gcctctatca gcaacttctg 1440 ccattaatgg cgtaa 1455 <210> 8 <211> 672 <212> DNA <213> Unknown <220> <223> ribulose-phosphate 3-epimerase, rpe <400> 8 atggcccaaa actggatagc tccttccatt ctctctgccg atttcgctcg cttaggcgaa 60 gaagtcgata acgttttagc ggccggtgcc gatgttgtcc attttgacgt catggac aat 120 catttcgtac ccaatttaac gatcggccca ttggtttgcg aagcattaag aaatcatggc 180 gttaccgctc caatcgacgt acatttgatg atcgatccgg tcgatcgaat catcccggac 240 ttcgccaaag ccggcgccag ctatattacc ttccatcctg aagcttcggt tcatctggat 300 agaaccttgc aattgatcaa agaccaaggt tgtaaagccg gcttggtatt caacccgtcg 360 acttcgctgc attatctgga tcatgtgatg gataaactcg acatgatttt attgatgtcg 420 gtcaacccgg gcttcggcgg acaatcgttt ctgccgtcgg cattaaccaa actgcgcgat 480 gcaagaaaac gaatcgatga aagcggtttc gatattcgtt tggaaatcga cggcggcgtc 540 aaagtcgaca atattcgtga aatcaaagcg gcgggcgccg ataccttcgt tgccggttcg 600 gcgattttcg gcaaaccgga ctacaaagca gtcatcgacc aaatgcgcgc ggaaattgca 660 aaagccgagt aa 672 <210> 9 <211> 6778 <212> DNA <213> Unknown <220> <223> Synthetic operon (NPR5600-5599-5598-5597 -TKT1) <400> 9 ctctgaaatg agctgttgac aattaatcat cggctcgtat aatgtgtggg tggatagagt 60 caggaggtta taggatgagt aatgtacaag catcgtttga agcaacggaa gctgaattcc 120 gcgtggaagg ttacgaaaaa attgagttca gtcttgtcta tgtaaatggt gcatttgata 180 tcagtaacag agaaattgca gac agctatg agaagtttgg ccgttgtctg actgtgattg 240 atgctaatgt caaccgcctg tatggcaaac aaataaaatc ttatttccgc cactatggta 300 ttgatctgac cgtagttccc attgtgatta ctgagcctac taaaaccctt gcaacctttg 360 agaagattgt tgatgcattt tctgactttg gtctgatccg caaggaacca gtattagtag 420 tgggtggtgg tttaaccact gatgtagctg ggtttgcgtg tgctgcttac cgtcgtaaga 480 gtaactatat tcgggttccg acaacgctga ttggtctgat tgatgctggt gtagcgatta 540 aggttgcagt caaccatcgc aagttaaaaa atcgcttggg tgcatatcat gctcctttga 600 aagtcatcct cgatttctcc ttcttgcaaa cattaccaac ggctcaagtt cgtaatggga 660 tggcagagtt ggtcaagata gctgttgtgg cgaactctga agtctttgaa ctgttgtatg 720 aatatggcga agagttgctt tccactcact ttggatatgt gaatggtaca aaggaactga 780 aagcgatcgc acataaactc aattacgagg caataaaaac tatgctggag ttggaaactc 840 caaacttgca tgagttagac ctcgatcgcg tcattgccta cggtcacact tggagtccga 900 ccttagaatt agctccgatg ataccgttgt ttcacggtca tgccgtcaat atagacatgg 960 ctttgtctgc aactattgcg gcaagacgtg gctacattac atcaggagaa cgcgatcgca 1020 ttttgagctt gatgagtcgt ataggtttat caatcgatcatcctctacta gatggcgatt 1080 tgctctggta tgctacccaa tctattagct tgacgcgaga cgggaaacaa cgcgcagcta 1140 tgcctaaacc cattggtgag tgcttctttg tcaacgattt cacccgtgaa gaattggatg 1200 cagctttagc tgaacacaaa cgtctgtgtg ctacataccc tcgtggtgga gatggcattg 1260 acgcttacat agaaactcaa gaagaatcca aactattggg agtgtgacct agctgtaaga 1320 aggaggtttt tgatgaccag tattttagga cgagataccg caagaccaat aacgccacat 1380 agcattctgg tagcacagct acaaaaaacc ctcagaatgg cagaggaaag taatattcct 1440 tcagagatac tgacttctct gcgccaaggg ctacaattag cagcaggttt agatccctat 1500 ctggatgact gcactacccc tgaatcgacc gcattgacag cactagcgca gaagacatct 1560 attgaagact ggagtaaacg cttcagtgat ggtgaaacag tgcgtcaatt agagcaagaa 1620 atgctctcag gacatcttga aggacagaca ctaaagatgt ttgtgcatat cactaaggct 1680 aaaagcatcc tagaagtggg aatgttcaca ggatattcag ctttggcaat ggcagaggcg 1740 ttaccagatg atgggcgact gattgcctgt gaagtagact cctatgtggc cgagtttgcc 1800 caaacttgct ttcaagagtc tccccacggc cgcaagattg ttgtagaagt ggcacctgca 1860 ctagagacgc tgcacaagct ggtagctaaa aaagaatcct ttgatc tgat cttcattgat 1920 gcggataaaa aggagtatat agaatatttc caaattattt tggattcaca tttgctagcc 1980 ccggacggct taatctgtgt ggataatact ttgttgcaag gacaagttta cctgccatca 2040 gaacagcgta cagccaatgg tgaagcgatc gctcaattca accgcattgt cgccgcagat 2100 cctcgtgtag agcaagttct gttacccata cgagatggta taaccctgat tagacgcctc 2160 gtatgacgac actatttcta aggcactttt tatggcacaa tcaatctctt tatctcttcc 2220 tcaatccaca acgccatcaa agggtgtgag gctaaaaata gcagctctac tgaagactat 2280 cgggactcta atactactgc tgatagcctt gccgcttaac gctttaattg tattgatttc 2340 tctgatgtgt aggccgttta caaaaaaacc tgccgtagcc actcatcccc agaatatctt 2400 ggtcagtggc ggcaaaatga ccaaagcact gcaacttgcc cgctccttcc atgcagccgg 2460 acacagagtt attctgattg aaggtcataa atactggtta tcagggcata gattctcaaa 2520 ttctgtgagt cgtttttata cagttcctgc accacaagac gacccagaag gctataccca 2580 agcgctattg gaaattgtca aacgagagaa gattgacgtt tatgtacccg tatgcagccc 2640 tgtagctagt tattacgact ctttggcaaa gtctgcacta tcagaatatt gtgaggtttt 2700 tcactttgat gctgatataa ccaagatgct ggatgataaa tttgccttta c cgatcgggc 2760 tcgatcgttg ggcttatcag ccccgaaatc ctttaaaatt accgatcctg aacaagttat 2820 caatttcgat ttctcgaaag agacgcgcaa atatatactt aagagtatca gttacgactc 2880 agttcgccgc ttaaatttaa ccaaacttcc ttgtgacacc ccagaggaga cagcggcgtt 2940 tgtcaagagt ttacccatca gcccagaaaa accttggata atgcaggaat ttattcctgg 3000 gaaagaatta tgcacccata gcacagtccg agacggcgaa ttaaggttgc attgctgctc 3060 aaattcttca gcgtttcaga taaattacga aaacgttgaa aacccccaaa ttcaagaatg 3120 ggtacaacat ttcgtcaaga gtttacggct gactggacaa atatctcttg actttatcca 3180 agctgaagat ggtacagctt atgccattga atgtaatcct cgcacccatt cggcgatcac 3240 aatgttctac aatcacccag gtgttgcaga agcctatctt ggtaaaactc ctctagctgc 3300 acctttggaa cctcttgcgg atagcaagcc cacttactgg atatatcacg aaatctggcg 3360 attgactggg attcgctctg gacaacaatt acaaacttgg tttgggagat tagtcagagg 3420 tacagatgcc atttatcgcc tggacgatcc gataccattt ttaactctgc accattggca 3480 gattacgctg cttctgctac aaaatttaca acgactcaaa ggttgggtaa aaatcgattt 3540 caatataggt aagctcgtgg aattaggggg agactaaagc atcagaacaa ggagcttctt 3600 ttatgccagt acttaatatc cttcatttag ttgggtctgc acacgataaa ttttattgcg 3660 atttatcacg tctttatgcc caagactgtt tagctgcaac agcagatcca tcactttaca 3720 acttccagat cgcatacata acgcccgatc ggcagtggag atttcctgac tctctcagtc 3780 gagaagatat tgcccttacc aaaccgattc ctgtgtttga tgccatacaa tttctaacag 3840 gccaaa acat tgacatgatg ttaccacaaa tgttttgtat tcctggaatg actcagtacc 3900 gtgccctatt cgatctgctc aagatccctt atataggaaa taccccagat attatggcga 3960 tcgcggccca taaagccaga gccaaagcaa ttgtggaagc agcaggggta aaagtgcctc 4020 gtggagaatt gcttcgccaa ggagatattc caacaattac acctccagca gtcgtcaaac 4080 ctgtaagttc tgacaactct ttaggagtag tcttagttaa agatgtgact gaatatgatg 4140 ctgccttaaa aaaagcattc gaatatgctt cggaggtcat cgtagaagca ttcatcgaac 4200 ttggtcgaga agtcagatgc ggcatcattg taaaagacgg tgagctaata ggtttacccc 4260 ttgaagagta tctggtagac ccacacgata aacctatccg taactatgct gataaactcc 4320 aacagactga cgatggcgac ctgcatttga cggctaaaga taacatcaag gcttggattt 4380 tagaccctaa cgacccaatc acccaaaagg ttcagcaagt agctaagagg tgtcatcagg 4440 ctttgggttg tcgccactac agtttatttg acttccgaat cgatccaaag ggacaacctt 4500 ggttcttaga agctggatta tattgttctt tcgcccccaa aagtgtgatt tctagcatgg 4560 cgaaagcggc cggaatccct ctaaatgatc ttttgattac ggctattaat gagacattgg 4620 gtagtaataa gaaggtgctt caaaattgat cctacgggaa ataaggaggt ctttatgcct 4680 tcgcgccgag a cttagcgaa cgccatacgc gctttgagca tggatgccgt ccaaaaagcg 4740 aactccggac atccaggggc acctatggga atggcggata tcgccgaggt gttatggaac 4800 gacttcctgc agcataaccc gactaacccg aactgggcca accgagaccg cttcgtgctg 4860 tctaatggcc acggctcgat gctgctgtac tcgttactgc atctgacagg ttaccagctg 4920 ccgatcgacg aactgaaaca attccgtcaa ctgcattcaa aaaccccggg tcatccggaa 4980 tacggctatg cgccgggcgt ggaaacgacg accggaccat taggtcaagg catcaccaat 5040 gccgtgggct ttgcgatagc cgaacgcgca ctagcgggtc aatttaaccg tcccggacac 5100 gaaatcgtcg accattacac ctacgccttc ctgggggacg ggtgtttaat ggaaggcatc 5160 tcgcatgaag cctgctcatt ggccggctcg atgaaactgg gcaaactgat tgccgtctac 5220 gacgacaaca acatctcgat cgacggagaa gtccggggcc acggagacac gccgggctgg 5280 ttcctggacg acacgccgaa acgcttcgaa gcctacggct ggcacgtcat cccgaaagta 5340 gacggccata accctgaagc cgtgaaaaaa gccttggaag aagcgcgtag cgtcactgat 5400 cggccgacct tgatctgctg ccaaaccatc attggctggg gctcgccgaa taaagaaggc 5460 aaagaagaat gtcatggagc ggcattaggc gaagccgaaa tcacggcaac ccgcgaacgc 5520 atcggttggc cgcatgc acc tttcgaaatc ccggcggata tttacgcggg ttgggatgcg 5580 aaagacaaag gcgcgcgtca agaagcggag tggaacgaca aattcgcgaa ataccaagca 5640 gcgcatccgg aactggcggc cgaattcgaa cgccgcatga gcggacagct gccgagcgac 5700 tggtcggaaa aagcgaacgc cttcattgct gcggtcgacg cgaaaggcga aaccatcgct 5760 agccgcaaag cctcacaaaa caccctgaac ggattcggac cgttactgcc cgaacttatg 5820 ggaggttcgg ccgatttggc tggctccaac ttgaccctgt ggtcgggttg caaagacgtc 5880 aacgccccgg gacatgatgg caactacgtc tactacggcg tccgtgaatt cggcatgtcg 5940 gcgatcatga acggcatcac cctgcatggc ggcttcaagc cgtacggcgc gaccttcctg 6000 atgttctccg aatatgcgcg gaatgccttg cggatggcgt cgttgatgaa aatcccgacc 6060 atcttcgtat acacgcacga ctcgatcggc ttaggcgaag acggcccgac ccatcaaccg 6120 atcgaacaaa ccgcgacctt gcggatgatt ccaaacatgc aagtgtggcg tccatgtgat 6180 gctgtggaat cggcggtgtc gtggaaagcg gcgattgaac gaaacgatgg accgagttgt 6240 ctgatcttct cacggcaaaa cctagctcac attgcgagga cgccggcgca aatagaagcg 6300 atcaacaaag gcggctacat tctgaaagac agcgaaggtc agccggacgt gatcctgatt 6360 gcgacgggct cggaagtcga at tggcggtg aaagcggcag acgagttgag cggcaaaggc 6420 aaaaaagtgc gggtcgtctc gatgccatcg accaacgtat tcgatgcgca ggacgaagcc 6480 taccgtgagt cggtgctgcc gtcatcggtg acaaaacgcg tcgtaattga agcgggcgtg 6540 accgacagct ggtggaaata cgcgggtaca caaggttgcg tcatcggaat ggatcgtttc 6600 ggtgaatcgg caccggctgg ggccctgttc aaagagttcg gcttcaccgt tgacaatgtc 6660 gtcaaacacg tggaagctct gctttaaggg aactgccagg catcaaataa aacgaaaggc 6720tcagtcgaaa gactgggcct ttcgttttat ctgttgtttg tcggtgaacg ctctcctg 6778

Claims (10)

Gene encoding 2-dimethyl 4-deoxygadusol synthase (DDGS) consisting of SEQ ID NO: 1, O-methyltransferase (OMT) consisting of SEQ ID NO: 2 Gene encoding ATP-grasp-ligase consisting of SEQ ID NO: 3, gene encoding ATP-grasp-ligase, cyanobacteria consisting of SEQ ID NO: 4 ( Nostoc punctiforme ) derived from D-Ala-D-Ala A gene encoding ligase (D-ala-D-ala ligase), a tkt1 gene encoding transketolase composed of SEQ ID NO: 5, and a xylose isoform composed of SEQ ID NO: 6 involved in the xylose metabolic pathway A gene encoding xylose isomerase (xylA), a gene encoding xylulosekinase (xylB) consisting of SEQ ID NO: 7, and a ribulose-phosphate 3-epimerase consisting of SEQ ID NO: 8 Methylomicrobium alcaliphilum 20Z, in which 3-epimerase, rpe) is introduced or overexpressed to produce shinoline. delete delete delete delete delete Methylomicrobium alcaliphilum 20Z of claim 1 or its culture medium; and
methane and xylose; Or methanol and xylose; Composition for production of shinorine (shinorine) comprising a carbon source consisting of. The composition for producing shinorine according to claim 7, wherein the composition further comprises tungsten as a trace element. Methylomicrobium alcaliphilum 20Z of claim 1, methane and xylose; Or methanol and xylose; step of inoculating and culturing in a medium containing as a carbon source;
recovering the supernatant from the culture medium; and
A method for producing shinorine, comprising obtaining shinorine from the recovered supernatant. [Claim 10] The method according to claim 9, wherein the culture additionally contains tungsten as a trace element.

Images