KR102469369B1 - Medium composition for in vitro culture of mammalian fertilized eggs containing interleukin 7 - Google Patents

Abstract

The present invention relates to a medium composition for the in vitro culture of mammalian fertilized eggs containing interleukin 7 (IL-7). When the composition of the present invention is used for in vitro culture, the ROS level and apoptosis of embryos can be reduced, and the division rate, blastocyst formation rate, and inner cell mass ratio of the embryos can be increased.

Description

Medium composition for in vitro culture of mammalian fertilized eggs containing interleukin (IL)-7

The present invention relates to a medium composition for in vitro culture of mammalian embryos containing IL-7.

In vitro production of embryos is a technique for securing embryos that have developed beyond a certain level by performing a series of processes of oocyte maturation, fertilization, and embryo development that occur in the body outside the body. In the livestock industry, in vitro production technology of embryos is one of the important technologies, and is used in various fields such as mass production of animals and livestock for medical research. In particular, because pigs have similar organ properties to humans, many studies have been conducted in the field of xenotransplantation animals or transgenic animals for the development of human disease models.

In vitro culture varies in production efficiency depending on the similarity of the culture environment to the in vivo environment, so it is desirable to carry out the in vitro production technology in an environment similar to the in vivo environment as much as possible. However, the efficiency of in vitro production is still low due to the in vitro environment unsuitable for culture, such as higher oxygen concentration than in the body, exposure to light, and contamination of the culture medium, and thus, in vitro culture technology needs improvement.

Therefore, studies are being actively conducted to increase the efficiency of in vitro production of embryos. External conditions such as temperature, atmosphere, and composition of the medium affect the functions of mitochondria, cytoskeleton development, and other organelles in eggs and embryos, and there are marked differences in maturation and developmental stages. A number of studies have been reported that it is related to the development of cells, eggs, and embryos.

Reactive oxygen species (ROS) are generated during normal intracellular activity and are involved in various biological processes including cell differentiation, gene expression, and response to cytokines. Therefore, maintaining ROS homeostasis is very important for cell growth and survival. Oxidative stress is a phenomenon in which ROS increase in cells due to an imbalance between the production of ROS and the antioxidant reaction that removes ROS, which reacts with DNA, proteins, and lipids to damage cells. ROS are known to play a role as intermediate signaling mediators in apoptosis.

During embryonic development, high ROS levels are known to induce lipid peroxidation of cell membranes, DNA damage, protein synthesis, and RNA transcription disorders, thereby affecting embryonic development and cell death. Embryos cultured in vitro have fewer cells and a relatively higher rate of apoptosis than fertilized eggs in vivo, which is known to be caused by the deterioration of the quality of embryos and blastocysts due to intracellular ROS produced in the in vitro environment. Accordingly, a number of studies have been reported on the addition of antioxidants and vitamins to culture compositions to reduce oxidative stress during embryonic development.

Prior art related to a method for improving embryo development efficiency in in vitro culture is disclosed in Korean Patent Publication No. 10-2020-0145804 entitled "Composition for Embryo Development Containing Melatonin and Method for Improving Efficiency of Embryo Development Using the Same" The effect of reducing active oxygen and apoptosis of embryos of a composition containing melatonin is disclosed, and Korean Patent Publication No. 10-2018-0037967 "culture medium" includes an embryo culture medium containing acetyl-carnitine and lipoic acid or a derivative thereof. Effects of reducing oxidative stress and increasing antioxidant activity are disclosed. Korean Patent No. 10-1733818 "Method composition for maturation of mammalian oocytes and promotion of embryonic development and method for promoting maturation of mammalian oocytes and development of embryos using the same" contains tauroursodeoxycholate as an active ingredient Disclosed is that a medium composition for promoting maturation of oocytes and development of embryos in mammals containing , increases embryo survival rate by inhibiting apoptosis during in vitro culture of embryos, and promotes maturation of oocytes and development of embryos. have. Also, Shen et al. discloses that treatment with recombinant porcine IL-6 improves embryo viability by increasing the development rate to the blastocyst stage and reducing apoptosis during in vitro culture of pig embryos.

The present inventors found that when porcine mature oocytes were treated with interleukin IL-7, a type of cytokine, in the culture medium during in vitro culture, the ROS level and apoptosis of pig embryos were reduced, and the division rate of embryos and blastocysts were reduced. The present invention was completed by confirming that embryonic developmental ability is improved, such as an increase in formation rate and inner cell mass (ICM) ratio.

An object of the present invention is to provide a medium composition for in vitro culture of mammalian embryos containing IL-7.

Another object of the present invention is to provide a method for culturing mammalian fertilized eggs in vitro.

In order to achieve the above purpose,

The present invention provides a medium composition for in vitro culture of mammalian embryos containing IL-7 as an active ingredient.

In addition, the present invention comprises the steps of 1) preparing an egg of a mammal; 2) maturing the eggs in vitro; and 3) culturing the matured oocytes in a composition containing IL-7 for in vitro culture; It provides a method for in vitro culture of a mammalian fertilized egg comprising a.

In addition, the present invention provides an embryo produced by the above culture method.

In addition, the present invention provides a blastocyst produced by the above culture method.

In addition, the present invention provides embryonic stem cells prepared by the above culture method.

The present invention relates to a culture composition for promoting embryonic development containing IL-7. When the composition of the present invention is used for in vitro culture, the ROS level and apoptosis of the embryo are reduced, the division rate of the embryo, the rate of blastocyst formation, and the internal Since the cell aggregation ratio can be increased, the efficiency of in vitro production of embryos can be improved, and furthermore, it can be usefully used to produce embryonic stem cells.

1 is a schematic diagram showing the in vitro maturation process of eggs.
Figure 2 is a schematic diagram showing the in vitro culture process.
Figure 3a is a diagram confirming the expression of IL-7 and IL-7R in MII stage embryos through immunostaining.
Figure 3a is a diagram confirming the expression of IL-7 and IL-7R in two-cell stage embryos through immunostaining.
Figure 3a is a diagram confirming the expression of IL-7 and IL-7R in 4-cell stage embryos through immunostaining.
Figure 3a is a diagram confirming the expression of IL-7 and IL-7R in 8-cell stage embryos through immunostaining.
Figure 3a is a diagram confirming the expression of IL-7 and IL-7R in blastocyst stage embryos through immunostaining.
Figure 4a is a microscopic view of embryos at the cleavage and blastocyst stages according to IL-7 treatment concentrations.
Figure 4b is a diagram confirming the division rate of embryos according to the treatment concentration of IL-7 (a and b have a significant difference of p<0.05).
Figure 4c is a diagram confirming the blastocyst formation rate according to the IL-7 treatment concentration (a and b have a significant difference of p<0.05).
Figure 5a is a diagram confirming apoptosis of blastocysts according to IL-7 treatment concentration by terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL) assay.
5B is a diagram showing the cell number of blastocysts according to IL-7 treatment concentration.
Figure 5c is a diagram showing the number of apoptotic cells in blastocysts according to the concentration of IL-7 treatment (a, b, c have a significant difference of p<0.05).
Figure 5d is a diagram showing the apoptosis index of blastocysts according to IL-7 treatment concentration (a, b, c have a significant difference of p<0.05).
Figure 6a is CellTracker Blue 4-chloromethyl-6,8-difluoro-7-hydroxycoumarin (CMF2HC) and 20,70-dichlorodihydrofluorescein diacetate (H2DCFDA) staining for glutathione and ROS of 4-cell stage embryos according to IL-7 treatment concentrations. It is also
Figure 6b is a diagram showing the level of glutathione in 4-cell stage embryos according to the concentration of IL-7 treatment (a and b have a significant difference of p<0.05).
6c is a diagram showing ROS levels in 4-cell stage embryos according to IL-7 treatment concentrations.
Figure 7a is a diagram confirming the mRNA expression of apoptosis-related genes in blastocysts produced by IL-7 treatment (*: p<0.05, **: p<0.01).
Figure 7b is a diagram confirming the mRNA expression of IL-7 signaling-related genes in blastocysts produced by IL-7 treatment (*: p<0.05, **: p<0.01).
Figure 7c is a diagram confirming the mRNA expression of genes related to embryonic development in blastocysts produced by IL-7 treatment (*: p<0.05, **: p<0.01).
8a is a diagram confirming the expression level of SOX2 or pAKT in blastocysts according to IL-7 treatment by immunostaining.
8B is a diagram showing the cell number of blastocysts according to IL-7 treatment.
Figure 8c is a diagram showing the number of SOX2-expressing cells according to IL-7 treatment (*** indicates p<0.001).
Figure 8d is a diagram showing the ratio of inner cell mass according to IL-7 treatment (*** indicates p<0.001).
Figure 8e is a diagram showing the expression level of pAKT according to IL-7 treatment (* indicates p<0.05).
9a is a diagram confirming the expression level of pSTAT5 in blastocysts following IL-7 treatment by immunostaining.
9B is a diagram showing the expression level of pSTAT5 according to IL-7 treatment (** indicates p<0.01).
10A shows IL-7 and/or Wort. It is a microscopic view of embryos at the cleavage and blastocyst stages according to the treatment.
10B shows IL-7 and/or Wort. It is a diagram confirming the embryo division rate according to the treatment (a and b have a significant difference of p<0.05).
10C shows IL-7 and/or Wort. It is a diagram confirming the blastocyst formation rate according to the treatment (a, b, c have a significant difference of p<0.05).
11A shows IL-7 and/or Wort. It is a diagram confirming the expression level of SOX2 or pAKT according to treatment by immunostaining.
11b shows IL-7 and/or Wort. It is a diagram showing the number of blastocyst cells according to treatment (a and b have a significant difference of p<0.05).
11C shows IL-7 and/or Wort. It is a diagram showing the number of SOX2 expressing cells according to treatment (a, b, c have a significant difference of p<0.05).
11D shows IL-7 and/or Wort. It is a diagram showing the ratio of inner cell mass according to treatment (a, b, c have a significant difference of p<0.05).
11E shows IL-7 and/or Wort. It is a diagram showing the expression level of pAKT according to treatment (a, b, c have a significant difference of p<0.05).

Hereinafter, the present invention will be described in detail.

The present invention provides a composition for in vitro culture of mammalian embryos containing interleukin (IL)-7 as an active ingredient.

In the present invention, mammals may include pigs, cows, goats, sheep, and mice, excluding humans.

In the present invention, the term embryo (embryo) refers to the first cell division of a fertilized egg until it becomes a fetus, and the embryo differentiates into an inner cell mass (ICM) and a placenta through cell division after formation. It reaches the blastocyst stage where it has developed into a trophectoderm (TE).

In the present invention, the term embryonic development refers to the process of forming an embryo after fertilization of animal sperm and eggs, and growing through cell division and differentiation of the embryo to become a new entity. Development is divided into germinal stage, gastrulation, neurulation, and development of organs. Germination is the first stage of development, and refers to the period from fertilization of sperm and egg to implantation of the fertilized egg into the uterine wall. Cell division of the fertilized egg causes cleavage to occur and blastocyst is formed through blastulation.

In the present invention, the embryo may be formed through parthenogenetic activation (PA).

In the present invention, the term parthenogenesis refers to the growth and development of embryos without fertilization, and is also referred to as parthenogenesis, parthenogenesis, and parthenogenesis. When stimulation occurs in parthenogenesis eggs in mammals, free Ca ²⁺ flows into the cytoplasm, and when Ca ²⁺ increases, an environment similar to sperm invasion is obtained, and the eggs are recognized as having been fertilized. At this time, the egg releases a second polar body, and the second polar body is recognized as a nucleus and combines with the nucleus of the egg to form an embryo, which goes through cell division to reach the blastocyst stage.

The "blastocyst" is a parthenogenetic egg that has developed enough to be divided into an inner cell mass to be differentiated into a fetus and a trophectoderm to be differentiated into a placenta by forming a blastocyst cavity after a dense morula in the process of repeatedly dividing and growing a parthenogenetic egg. means

In the present invention, "embryonic development" means that a parthenogenetic egg passes through the 2-cell stage and the 4-cell stage and reaches the blastocyst stage, which is the germinal stage, early embryonic development, or pre-implantation stage. (pre-implantation embryo development).

The IL-7 can increase the division rate of embryos and blastocyst formation rate.

The IL-7 can reduce blastocyst apoptosis.

The IL-7 can increase the production of glutathione (GSH) in the blastocyst.

The glutathione is a crystalline peptide composed of three amino acids, glutamic acid, cysteine, and glycine, and is found in all organisms, and is an antioxidant having a function of protecting cells from biotic and abiotic stresses including oxidative stress. Glutathione can prevent damage to important components of cells caused by active oxygen such as free radicals and peroxides.

The IL-7 can reduce the generation of reactive oxygen species (ROS) in the blastocyst.

The ROS refers to all kinds of modified oxygen that damages cells. ROS are produced during cellular metabolism, and ROS produced at this time are involved in mitochondrial electron transfer, enzymatic reactions, activation of transcription factors in the nucleus, signal transduction, and antibacterial activity of neutrophils and macrophages. However, large amounts of ROS have negative effects on cells, such as cell death, cell damage, lipid peroxidation, and enzyme inactivation. reduces efficiency. It is known that the quality of embryos produced outside the body is lower than that of fertilized eggs derived from the body due to intracellular ROS produced in the outside environment.

The IL-7 reduces the expression of an apoptosis inducing gene (eg, BAX) and increases the expression of an apoptosis inhibitory gene (eg, MCL1) in the blastocyst.

The BAX is mainly associated with organelle membranes, in particular, initiates apoptosis in mitochondrial membranes, induces cytochrome c and other apoptosis-inducing factors, and induces apoptosis by activating caspases. do.

The MCL1 is mainly located in the mitochondria and leads to inhibition of apoptosis by inhibiting the BAK/BAX protein that induces apoptosis through the BH3 domain. In particular, Joseph T. Opferman et al. showed that MCl1 was expressed by IL-7 in lymphocytes and inhibited apoptosis of lymphocytes.

The IL-7 can increase the expression of genes related to embryonic development (eg, OCT4 or NANOG) in the blastocyst.

The OCT4 and NANOG are essential regulators for the formation and maintenance of the inner cell mass during embryonic germination. Both genes are expressed in the inner cell mass of the blastocyst and embryonic stem cells derived from the inner cell mass, and are required to maintain the pluripotency and self-renewal of embryonic stem cells.

The IL-7 increases the expression of genes related to the IL-7 signaling pathway (eg, PIK3R1, AKT1 or ERK2) in the blastocyst.

The PIK3R1 and AKT1 are involved in the PI3K/AKT signaling pathway, and the signaling pathway is activated by IL-7 in T-cells to regulate various cellular functions such as cell cycle activity, transcription, and metabolism. ERK2 is involved in the mitogen-activated protein kinase (MAPK) signaling pathway. IL-7 induces the Ras/MAPK/ERK signaling pathway in T cells, which is the basis for development.

The IL-7 increases the proportion of inner cell mass (ICM) in the blastocyst.

The inner cell mass is a cell mass contained in an embryo at an early stage, and is a cell population that develops into a fetus when fertilized. It is known that the inner cell mass plays an important role in the production of embryonic stem cells.

The IL-7 may be added to an in vitro culture medium.

The term in vitro culture (IVC) of the present invention refers to culturing the fertilized egg in an external medium, and refers to a process of forming an embryo and a blastocyst through in vitro culture of the fertilized egg.

The medium for in vitro culture used in the present invention means a substance that enables the growth and proliferation of cells in vitro, including essential elements such as sugar, amino acids, various nutrients, serum, growth factors, and minerals, etc. , Specifically, a basal medium used for culturing in vitro fertilized eggs may be included without limitation. The medium may be appropriately selected and used by a person skilled in the art according to the type of embryo fertilized in vitro, such as porcine zygote medium 5 (PZM5), porcine zygote medium-3 (PZM-3) or SOF-BE1 (modified A synthetic oviduct fluid-bovine embryo 1) medium may be used, but is not particularly limited thereto. In one embodiment of the present invention, the cleavage rate of fertilized eggs and the developmental efficiency to the blastocyst stage were evaluated using a medium in which IL-7 was added to the PZM5 medium. In vitro culture was performed using PZM5 medium containing -7.

In addition, the present invention comprises the steps of 1) preparing an egg of a mammal; 2) maturing the eggs in vitro; and 3) culturing the matured oocyte in vitro using a composition containing IL-7; Including, it provides a method for in vitro culture of mammalian fertilized eggs.

The term "in vitro maturation (IVM)" as used herein refers to a method of inducing oocytes collected prior to in vitro fertilization to undergo meiosis to reach the second meiosis metaphase (metaphase II). do. The oocyte refers to a cell that has been differentiated from an oocyte and has ceased cell activity, and the term "oocyte" of the present invention may be considered to mean a cell substantially the same as the "oocyte". The oocyte can be matured by a special signal stimulus. Through two meiosis, a mature egg and two polar bodies are formed, and the nucleus of the oocyte rapidly expands, and the in vitro maturation step can proceed for 35 to 50 hours. and preferably for 40 to 48 hours.

As the in vitro maturation medium, any medium used for in vitro maturation of immature oocytes may be used. The basal medium varies depending on the species of mammal, but may include inorganic salts, carbon sources, amino acids, bovine serum albumin, cofactors, and the like, and may include all general media known to those skilled in the art. At this time, NaCl, KCl, and NaHCO3 may be used as the inorganic salts, sugars such as glucose and pyruvate may be used as the carbon source, and essential and non-essential amino acids including glutamine as the amino acid, and cofactors may include Other trace elements and buffers may be used. For example, in the present invention, 0.6 mM cysteine, 0.91 mM sodium pyruvate, 10 ng/mL epidermal growth factor, 75 μg/mL kanamycin, 1 μg/mL insulin, and 10% (v/v) TCM-199 medium containing porcine follicular fluid (pFF) was used, but since this medium was only selected for the convenience of experiments, the medium is not limited thereto.

The in vitro culture was as described above.

In addition, the present invention provides an embryo produced by the above culture method.

The embryos are as described above.

In addition, the present invention provides a blastocyst produced by the above culture method.

The blastocyst is as described above.

In addition, the present invention provides embryonic stem cells prepared by the above culture method.

The embryonic stem cell is a cell line obtained from an early embryo, and is a normal non-transformed cell capable of cell proliferation in an undifferentiated state. Embryonic stem cells are pluripotent stem cells that have the potential to differentiate into all cell types except for the placenta, so they can be used in cell therapy.

The method for establishing embryonic stem cells can establish embryonic stem cells using blastocysts aged 6-7 days in vitro maturation in the case of porcine species. After removing the zona pellucida of the blastocyst, the blastocyst from which the zona pellucida has been removed is placed on mouse embryonic fibroblasts, and when the inner cell mass in the blastocyst adheres to the mouse fetal fibroblasts and proliferates, embryonic stem cells can be obtained. can be established

In specific examples and experimental examples of the present invention, the present inventors maturated porcine eggs in vitro (see FIG. 1), then unitgenated the matured eggs, and then cultured them in vitro using a culture medium containing IL-7. (see Figure 2). First, it was confirmed that both IL-7 and IL-7R were expressed in pig embryos treated with IL-7 (see Figs. 3a to 3e), and in the case of treatment with IL-7, the embryo division rate and blastocyst formation rate were increased. It was confirmed that it increased (see FIGS. 4a to 4c). In addition, when treated with IL-7, it was confirmed that apoptosis of blastocysts was reduced (see FIGS. 5A to 5D). In addition, when IL-7 was treated, it was confirmed that the production of glutathione, an antioxidant, increased, while the production of ROS decreased (see FIGS. 6a to 6c). In addition, when IL-7 was treated, it was confirmed that the expression of blastocyst apoptosis-inducing genes decreased, the expression of apoptosis inhibitory genes increased, and the expression of genes related to embryo development and genes related to IL-7 signaling increased. (See Figs. 7a to 7c) Related signaling pathways were identified. In addition, it was confirmed that the inner cell mass ratio and pAKT were increased in blastocysts upon treatment with IL-7 (see Figs. 8a to 8e), and it was confirmed that pSTAT5 related to IL-7 signaling was activated (see Figs. 9a to 9b). In addition, it was confirmed that IL-7 increases embryo division rate, blastocyst formation rate, and inner cell mass through the PI3K/AKT signaling pathway (see FIGS. 10a to 10c and 11a to 11e).

Through the above results, IL-7 improves embryo quality, such as reducing ROS and apoptosis in embryonic development, increasing embryo division rate and blastocyst formation rate, and increasing the ratio of inner cell mass through the PI3K/AKT signaling pathway. , it was demonstrated that it increased embryonic developmental ability.

Hereinafter, the present invention will be described in detail by examples.

However, the following examples are illustrative of the present invention, and the scope of the present invention is not limited thereto, and various modifications and improvements made by those skilled in the art using the basic concept of the present invention defined in the claims are also within the scope of the present invention. that belongs to

<Example 1> Materials and methods

<1-1> Preparation of porcine oocytes and embryos

Oocytes were obtained from pig ovaries obtained from a slaughterhouse, and immature oocytes were matured through an in vitro maturation (IVM) process (FIG. 1).

Specifically, follicles with a size of 3-6 mm were aspirated with a syringe using pig ovaries, and then 15 mL of follicular fluid was collected in conical tubes. After precipitating the follicular fluid for 5 minutes, the supernatant was removed and washed twice using HEPES-buffered Tyrode's medium. Cumulus-oocyte complexes were randomly selected using a microscope, and 50 to 60 cumulus-oocyte complexes were cultured per well of a 4-well Nunc dish (Nunc, Roskilde, Denmark). In vitro maturation was cultured for a total of 40 to 42 hours, and cultured under 39 °C, 5% CO ₂ , and humid conditions. In vitro maturation culture was performed in IVM medium containing 10 IU/mL of human chorionic gonadotropin (hCG) (Intervet, Boxmeer, Netherlands) for the first 22 hours. After 22 hours, the cumulus cell-oocyte complex was transferred to hormone-free IVM medium and cultured for an additional 18 to 20 hours. IVM medium contains TCM-199 (Invitrogen Corporation, Carlsbad, CA, USA) containing 0.6 mM cysteine, 0.91 mM sodium pyruvate, 10 ng/mL epidermal growth factor, 75 µg/mL kanamycin, 1 µg/mL insulin, and 10% (v/v) porcine follicular fluid (pFF) were added.

Afterwards, for matured eggs, meiosis is resumed using parthenogenetic activation (PA) technology, and is generally used for IVC during the in vitro culture (IVC) period, which proceeds for 7 days after parthenogenetic activation (PA) technology. Porcine zygote media-5 (PZM5) was treated with IL-7, a type of cytokine, to generate pig embryos (FIG. 2).

<Experimental Example 1> Verification of expression of IL-7 and IL-7R in preimplantation embryos

Immunostaining was performed to confirm the expression of IL-7 and IL-7R (IL-7 specific receptor) at the level of pig preimplantation embryos.

Specifically, oocytes that have completed in vitro maturation and embryos at metaphase II, 2-cell, 4-cell, 8-cell and blastocyst stages at 24, 48, 72 and 168 hours after PA were incubated in 4% paraformaldehyde for 30 days. fixed for min. Then, 0.5% Triton X-100 was treated for 1 hour, and Image-iT™ FX Signal Enhancer (Invitrogen, Carlsbad, CA, USA) was treated for 30 minutes. Then, after incubation in a blocking solution (PBS containing 3% BSA and 0.05% Tween) for 1 hour and 30 minutes, the primary antibody (rabbit anti-IL-7 (ab 175380, 1:50 dilution; Abcam, Cambridge, UK) and rabbit anti-IL-7R (ab 180521, 1:100; Abcam) were added and incubated overnight at 4° C. The next day, the samples were washed three times with 0.1% PVA-PBS, A secondary antibody (Donkey anti-rabbit IgG (H + L) Alexa Fluor ^TM 594 (A21207, 1:400; Invitrogen)) was added and incubated for 2 hours at room temperature. After washing twice, it was stained for 10 minutes using Hoechst 33342. After staining, the sample was placed on a slide glass and mounted using anti-fade mounting medium (Molecular Probes, Inc., Eugene, OR, USA).

As a result of the immunostaining experiment, as shown in FIGS. 3A to 3E , it was confirmed that IL-7 and IL-7R proteins were expressed in all embryos at metaphase II, 2-cell stage, 4-cell stage, 8-cell stage and blastocyst stage. .

<Experimental Example 2> Confirmation of the effect of IL-7 treatment on embryonic developmental ability

During the IVC period, the effects of IL-7 (0.1, 1, 10, and 100 ng/mL) on the in vitro developmental capacity of pig embryos were evaluated.

Specifically, oocytes at the metaphase II (MII) stage where in vitro maturation was completed were parthenogenesis. As the activation solution, a 280 mM mannitol solution containing 0.01 mM CaCl ₂ and 0.05 mM MgCl was used, and as a fuser, a Cell Fusion Generator (LF101; NepaGene, Chiba, Japan) was used, and 120 V/mm was applied as electricity for 60 μs. gave me a stimulus Thereafter, the cells were immersed in PZM5 culture medium supplemented with 5 ug/mL cytochalasin B and cultured under 5% CO ₂ , 5% O ₂ and 90% N ₂ conditions for 4 hours under humidified conditions. After 4 hours, 10 to 12 embryos were placed in 30 μl of PZM5 drops, covered with mineral oil, and cultured for 7 days under the same conditions as above. IL-7 was treated on days 0, 2 and 4 of culture, respectively. The cleavage rate (CL rate) of embryos treated with various concentrations of IL-7 was evaluated on day 2 of culture, and the blastocyst formation rate (BL rate) was evaluated on day 7 of culture.

As a result, as shown in FIGS. 4a to 4c and Table 1, it was confirmed that the division rate and blastocyst formation rate increased in the IL-7 treated group compared to the control group. In particular, the division rate was significantly higher in the 10 and 100 ng/mL treatment groups, and the blastocyst formation rate was significantly higher in the 10 ng/mL treatment group.

IL-7 concentration (ng/mL) number of cultured embryos Percentage of embryos that developed beyond the 2-cell stage (%) Proportion developed into blastocyst (%) 0 135 87 (63.4±5.6) ^a 71 (51.9±5.2) ^a 0.1 134 99 (74.4±3.5) ^a,b 82 (62.0±5.4) ^a,b One 133 102 (76.7±5.1) ^a,b 77 (56.8±5.6) ^a,b 10 135 112 (83.4±3.3) ^b 96 (71.3±1.8) ^b 100 133 105 (78.4±3.2) ^b 84 (62.5±3.6) ^a,b

(a and b have a significant difference of p<0.05) <Experimental Example 3> Confirmation of the effect of IL-7 treatment on blastocyst apoptosis

TUNEL (Terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling) assay was performed to evaluate the level of apoptosis in blastocysts produced by treatment with various concentrations of IL-7 (0.1, 1, 10, and 100 ng/mL) during the IVC period did

Specifically, on day 7 after PA, blastocysts treated with various concentrations of IL-7 were fixed in 4% paraformaldehyde for 30 minutes, and then treated with PBS containing 0.3% TritonX-100 at 37 °C for 1 hour. . In situ cell death detection kit (Roche, Mannheim, Germany) was used and incubated at 37 °C for 1 hour and 30 minutes. After washing three times in 0.1% PVA-PBS, it was stained with 7.5 mg/mL Hoechst 33342 for 10 minutes. After staining, the sample was placed on a slide glass and anti-fade mounting medium (Molecular Probes, Inc., Eugene, OR, USA) was used for mounting.

As a result, as shown in Figures 5a to 5d, despite the fact that there was no significant difference in the total number of blastocysts at all concentrations, it was confirmed that cell death was significantly reduced in the 1 and 10 ng / mL treatment groups did

These results indicate that IL-7 does not affect the increase in cell number during embryonic development, but has an effect of inhibiting apoptosis.

<Experimental Example 4> Confirmation of the effect of IL-7 treatment on the production of GSH and ROS in embryos

Glutathione (GSH) and reactive oxygen species (ROS) using 4-cell stage embryos produced by treatment with various concentrations of IL-7 (0.1, 1, 10 and 100 ng/mL) for 2 days of IVC ) level was evaluated.

Specifically, experiments were performed using embryos at the 4-5 cell stage on the second day of culture after PA. CellTracker Blue 4-chloromethyl-6,8-difluoro-7-hydroxycoumarin (CMF ₂ HC; Invitrogen) was used to measure intracellular GSH, and 20,70-dichlorodihydrofluorescein diacetate (H ₂ DCFDA; Invitrogen) was used to measure ROS. ) was used. The collected embryos were placed in TLH-PVA medium containing 10 uM CMF ₂ HC or 10 uM H ₂ DCFDA, and stained for 30 minutes or 10 minutes, respectively. Embryos stained with UV filters (GSH: 370 nm and ROS: 460 nm) were measured using a fluorescence microscope (TE300, Nikon, Tokyo, Japan). The fluorescence brightness was measured and analyzed for each embryo using the Adobe Photoshop 2021 program.

As a result, as shown in FIGS. 6a to 6c, it was confirmed that GSH was significantly high in the 1 and 10 ng/mL treatment groups, and ROS was significantly low in the 10 ng/mL treatment group.

These results indicate that IL-7 does not induce oxidative stress during embryonic development and reduces oxidative stress at an appropriate concentration.

Based on the above results, it was determined that 10 ng/mL was the appropriate concentration of IL-7 in the course of embryonic development, and then, 10 ng/mL concentration was used for experiments.

<Experimental Example 5> Confirmation of gene expression levels related to embryonic development, apoptosis, and IL-7 signaling in IL-7-treated blastocysts

In blastocysts produced by treatment with IL-7 (10 ng/mL) during the in vitro culture period, apoptosis-related genes (BAX, BCL2L1, CASP3, MCL-1), IL-7 signaling-related genes (PIK3R1, AKT1, ERK1) , ERK2) and embryonic development related genes (PCNA, OCT4, NANOG, CDX2, GATA6) mRNA expression levels were confirmed through quantitative real-time polymerase chain reaction (qRT-PCR).

Specifically, blastocysts 7 days after PA were treated with TRIzol reagent (TaKaRa Bio, Inc., Otsu, Shiga, Japan) to extract mRNA according to the manufacturer's protocol. Reverse Transcription Master Premix (Elpis Bio, Inc., Daejeon, Republic of Korea) was used to synthesize cDNA (complementary DNA) of RNA extracted from blastocysts collected in each group. The synthesized cDNA was synthesized using 2x SYBR Premix Ex Taq (TaKaRa Bio, Inc.) and 5 pmol of primers (Macrogen, Inc., Seoul, Republic of Korea). For mRNA expression analysis, CFX96 Touch Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA) was used. PCR conditions were performed at 95 ° C for 5 minutes, then 95 ° C for 15 seconds, 56 ° C for 15 seconds, and 72 ° C for 30 seconds (40 cycles repeated). mRNA expression (R) was calculated using the formula R = 2 ^{- [ΔCt sample - ΔCt control]} . R values were normalized using the RN18S gene. Information on the primers used is shown in Table 2 below.

gene name Primer sequence (5'-3') PCR product (bp) sequence number RN18S (F) CGCGGTTCTATTTTGTTGGT 219 One RN18S (R) AGTCGGCATCGTTTATGGTC 2 BAX (F) TGCCTCAGGATGCATCTACC 199 3 BAX (R) AAGTAGAAAAGCGCGACCAC 4 BCL2L13 (F) AATGACCACCTAGAGCCTTG 182 5 BCL2L1 (R) GGTCATTTCCGACTGAAGAG 6 CASP3 (F) CGTGCTTCTAAGCCATGGTG 186 7 CASP3 (R) GTCCCACTGTCCGTCTCAAT 8 MCL-1 (F) GGACATCAAAAACGAAGACG 181 9 MCL-1 (R) TGTGATGCTTTCTGCTAACG 10 GSR (F) TGGGCTCTAAGACGTCACTG 106 11 GSR (R) TCTATGCCAGCATTCTCCAG 12 PRDX1 (F) CTTGATATCAGACCCCAAGC 187 13 PRDX1 (R) GAACTGGAAGGCCTGAACTA 14 PIK3R1 (F) CCACTACCGGAATGAATTCTC 211 15 PIK3R1 (R) TTCCTGGGAAGTACGGGTAT 16 AKT1 (F) CTACAACCAGGACCACGAGA 208 17 AKT1 (R) CTCATACACATCCTGCCACA 18 ERK1 (F) ATCACAGTGGAGGAAGCACT 202 19 ERK1 (R) GAGGCATCTGTCCAGGTTAG 20 ERK2 (F) AGTCCATCGACATCTGGTCT 240 21 ERK2 (R) GAGCTTTGGAGTCAGCATTT 22 PCNA (F) CCTGTGCAAAAGATGGAGTG 187 23 PCNA(R) GGAGAGAGTGGAGTGGCTTTT 24 OCT4 (F) GCGGACAAGTATCGAGAACC 200 25 OCT4 (R) CCTCAAAATCCTCTCGTTGC 26 NANOG (F) TAAAACCACTGCCCACATCT 131 27 NANOG (R) CTGCCTCTGAAATCTGTCGT 28 CDX2 (F) CTGTTTGGGTTGTTGGTCTG 95 29 CDX2 (R) CCCACTCCCTTTCACCATATC 30 GATA6 (F) GAGGGAATTCAGACCAGGAA 159 31 GATA6 (R) AGCTGGCGTTTGTGTTGTAG 32

As a result, as shown in FIG. 7a , it was confirmed that the level of BAX, which induces apoptosis, decreased, and the level of MCL1, an anti-apoptotic gene, increased when treated with IL-7 compared to the control group. The above results are consistent with the results of TUNEL analysis using blastocysts treated with IL-7 at various concentrations in FIGS. suggesting that it reduces the level of death.

In addition, as shown in FIG. 7B, PIK3R1 and AKT1, genes related to the PI3K / AKT signaling pathway, and ERK2, a gene related to the MAPK signaling pathway, were significantly increased when treated with IL-7 compared to the control group. did

In addition, as shown in FIG. 7c, it was confirmed that OCT4 and NANOG were significantly increased among genes related to embryonic development.

In addition, from the above results, it was confirmed that IL-7 affects genes related to embryonic development during embryonic development. It was confirmed that OCT4 and NANOG significantly increased mRNA expression, and these two genes were reported to be mainly involved in the inner cell mass in the blastocyst (Qingran Kong et al). The following experiment was conducted under the hypothesis that IL-7 could improve the inner cell mass of the blastocyst by regulating developmental genes during embryonic development.

<Experimental Example 6> Confirmation of inner cell mass ratio and protein expression level of IL-7 signaling-related genes in IL-7-treated blastocysts

It was confirmed that the expression of OCT4 and NANOG, which are genes related to embryonic development, increased in IL-7-treated blastocysts. OCT4 and NANOG are known to be involved in the formation of inner cell mass (ICM) in the blastocyst. . Accordingly, in order to confirm the ICM ratio in blastocysts produced by treatment with IL-7, immunostaining was performed for SOX2, an ICM marker. In addition, immunostaining was performed to confirm the expression of pAKT and pSTAT5 related to IL-7 signaling.

Specifically, blastocysts on the 7th day after PA were used and fixed in 4% paraformaldehyde for 30 minutes. Then, 0.5% Triton X-100 was treated for 1 hour, and Image-iT™ FX Signal Enhancer (Invitrogen, Carlsbad, CA, USA) was treated for 30 minutes. Then, after incubation in blocking solution (PBS containing 3% BSA and 0.05% Tween 20) for 1 hour and 30 minutes, primary antibody [mouse anti-SOX2 (sc-365823, 1:100; Santa Cruz Biotechnology, Santa Cruz, CA, USA), rabbit anti-phospho-AKT (#9271, 1:50; Cell Signaling Technology, Inc., Danvers, MA, USA) or mouse anti-phospho-STAT5 (ab106095, 1: 25; Abcam)] and incubated overnight at 4 °C. The next day, the samples were washed three times with 0.1% PVA-PBS, followed by secondary antibody [Goat anti-mouse IgG (H + L) Alexa Fluor ^TM 488 (A11029, 1:200; Invitrogen Corporation, Carlsbad, CA, USA) , Donkey anti-rabbit IgG (H + L) Alexa Fluor ^TM 594 (A21207, 1:400; Invitrogen)] and incubated for 2 hours at room temperature. Then, after washing three times in 0.1% PVA-PBS, it was stained with Hoechst 33342 for 10 minutes. After the staining was completed, the sample was mounted on a slide glass using anti-fade mounting medium (Molecular Probes, Inc., Eugene, OR, USA) and observed.

As a result, as shown in FIGS. 8A to 8E , there was no significant difference in the total number of cells in the control group and blastocysts produced by treatment with IL-7. It was confirmed that the number of SOX2-stained cells and the ratio of ICM (SOX2-stained cell number/blastocyst cell number) increased significantly in IL-7-treated blastocysts. It was confirmed that the expression of pAKT was also significantly increased. In addition, as shown in FIGS. 9a and 9b , it was confirmed that pSTAT5 related to IL-7 signaling was also significantly expressed.

Therefore, these results suggest that IL-7 increases ICM by activating signaling pathways such as PI3K/AKT and JAK/STAT.

<Experimental Example 7> Related to embryo development of the PI3K/AKT signaling pathway in IL-7-treated blastocysts Correlation check

During the in vitro culture period, an experiment was performed to confirm the effect of the PI3K/AKT signaling pathway on embryonic development by treating the PI3K/AKT signaling pathway-specific inhibitor wortmannin (Wort.) and IL-7.

Specifically, IL-7 was treated at a concentration of 10 ng/mL and Wort. at a concentration of 1 μM on days 0, 2, and 4 of in vitro culture using the same PA as in Experimental Example 2, respectively. In addition, the control group and the IL-7 alone group were treated with DMSO at the same concentration as Wort. Cleavage rates of embryos treated with each reagent were evaluated on the 2nd day of culture, and blastocyst formation rates were evaluated on the 7th day of culture.

As a result, as shown in FIGS. 10a to 10c and Table 3, compared to the control group, the IL-7 treatment group had an increased embryo division rate and blastocyst formation rate, but Wort. It was confirmed that there was no significant difference between the single treatment group and the control group, and the Wort. and IL-7 co-treatment group showed no difference from the IL-7 treatment group.

group number of cultured embryos Percentage of embryos that developed beyond the 2-cell stage (%) Proportion developed into blastocyst (%) control group 118 80 (67.5±3.6) ^a 62(51.8±3.1) ^a,b IL-7 119 99 (83.1±3.7) ^b 73 (60.6±3.8) ^b Wort. 116 69 (58.6±4.9) ^a, 50 (42.7±2.0) ^a IL-7 + Wort. 118 85 (71.4±3.9) ^a,b 65 (53.3±7.7) ^a,b

(a and b have a significant difference of p<0.05)

The above results indicate that IL-7 helped embryonic development by activating the PI3K/AKT pathway.

<Experimental Example 8> Confirmation of the correlation between the PI3K/AKT signaling pathway and the blastocyst inner cell mass ratio in IL-7-treated blastocysts

To confirm whether IL-7 affects ICM formation through the PI3K/AKT pathway during embryonic development, blastocysts produced by treatment with IL-7 and Wort. were immunostained with SOX2, an ICM marker.

The specific immunostaining method is the same as the method shown in Experimental Example 6.

As a result, as shown in Figures 11a and 11e, Wort. and IL-7 + Wort. Compared to the control group in the group, it was confirmed that the total number of blastocysts decreased. In addition, the control and Wort. group or IL-7 + Wort. There was no significant difference between the groups in the number of SOX2-expressing cells, but Wort. IL-7 + Wort as compared to group. It was confirmed that the number of SOX2-expressing cells significantly increased in the group. In addition, it was confirmed that the ICM ratio significantly increased in the IL-7 treated group (IL-7 group and IL-7 + Wort. group) compared to the control group. Also, IL-7 + Wort. It was confirmed that the expression of pAKT significantly increased in the group compared to the control group, but there was no significant difference from the IL-7 group.

From the above results, the effects of the IL-7 and PI3K/AKT signaling pathways on ICM formation in blastocysts were confirmed. In the group treated with Wort. alone, the total number of blastocysts decreased, but the number of SOX2-expressing cells, the ICM ratio, and the pAKT expression level were not different from those of the control group. However, in the case of the group treated with IL-7 and Wort., the number of blastocyst cells decreased compared to the control group, but the number of SOX2-expressing cells, the ICM ratio, and the pAKT expression level increased significantly compared to the control group.

Therefore, the above results suggest that IL-7 helped embryonic development and blastocyst ICM formation by activating the PI3K/AKT signaling pathway.

In the present invention, it was confirmed that IL-7 and IL-7R exist in the embryonic stage and are also involved in embryonic development. In particular, it was confirmed that treatment with IL-7 increases the ratio of ICM through the PI3K/AKT signaling pathway. Since ICM is an important part in the production of embryonic stem cells, by treating IL-7 during the in vitro culture period, It was confirmed that it can be usefully used to produce embryonic stem cells by improving the quality of embryos and at the same time improving the quality of ICM.

<110> Chungbuk National University Industry-Academic Cooperation Foundation <120> Medium composition for in vitro culture of mammalian fertilized eggs containing interleukin 7 <130> 2021p-12-032 <160> 32 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> artificial sequence <220> <223> RN18S (F) <400> 1 cgcggttcta ttttgttggt 20 <210> 2 <211> 20 <212> DNA <213> artificial sequence <220> <223> RN18S (R) <400> 2 agtcggcatc gtttatggtc 20 <210> 3 <211> 20 <212> DNA <213> artificial sequence <220> <223> BAX (F) <400> 3 tgcctcagga tgcatctacc 20 <210> 4 <211> 20 <212> DNA <213> artificial sequence <220> <223> BAX (R) <400> 4 aagtagaaaa gcgcgaccac 20 <210> 5 <211> 20 <212> DNA <213> artificial sequence <220> <223> BCL2L13 (F) <400> 5 aatgaccacc tagagccttg 20 <210> 6 <211> 20 <212> DNA <213> artificial sequence <220> <223> BCL2L1 (R) <400> 6 ggtcatttcc gactgaagag 20 <210> 7 <211> 20 <212> DNA <213> artificial sequence <220> <223> CASP3 (F) <400> 7 cgtgcttcta agccatggtg 20 <210> 8 <211> 20 <212> DNA <213> artificial sequence <220> <223> CASP3 (R) <400> 8 gtcccactgt ccgtctcaat 20 <210> 9 <211> 20 <212> DNA <213> artificial sequence <220> <223> MCL-1 (F) <400> 9 ggacatcaaa aacgaagacg 20 <210> 10 <211> 20 <212> DNA <213> artificial sequence <220> <223> MCL-1 (R) <400> 10 tgtgatgctt tctgctaacg 20 <210> 11 <211> 20 <212> DNA <213> artificial sequence <220> <223> GSR (F) <400> 11 tgggctctaa gacgtcactg 20 <210> 12 <211> 20 <212> DNA <213> artificial sequence <220> <223> GSR (R) <400> 12 tctatgccag cattctccag 20 <210> 13 <211> 20 <212> DNA <213> artificial sequence <220> <223> PRDX1 (F) <400> 13 cttgatatca gaccccaagc 20 <210> 14 <211> 20 <212> DNA <213> artificial sequence <220> <223> PRDX1 (R) <400> 14 gaactggaag gcctgaacta 20 <210> 15 <211> 20 <212> DNA <213> artificial sequence <220> <223> PIK3R1 (F) <400> 15 ccactaccgg aatgaatctc 20 <210> 16 <211> 20 <212> DNA <213> artificial sequence <220> <223> PIK3R1 (R) <400> 16 ccactaccgg aatgaatctc 20 <210> 17 <211> 20 <212> DNA <213> artificial sequence <220> <223> AKT1 (F) <400> 17 ctacaaccag gaccacgaga 20 <210> 18 <211> 20 <212> DNA <213> artificial sequence <220> <223> AKT1 (R) <400> 18 ctcatacaca tcctgccaca 20 <210> 19 <211> 20 <212> DNA <213> artificial sequence <220> <223> ERK1 (F) <400> 19 atcacagtgg aggaagcact 20 <210> 20 <211> 20 <212> DNA <213> artificial sequence <220> <223> ERK1 (R) <400> 20 gaggcatctg tccaggttag 20 <210> 21 <211> 20 <212> DNA <213> artificial sequence <220> <223> ERK2 (F) <400> 21 agtccatcga catctggtct 20 <210> 22 <211> 20 <212> DNA <213> artificial sequence <220> <223> ERK2 (R) <400> 22 gagctttgga gtcagcattt 20 <210> 23 <211> 20 <212> DNA <213> artificial sequence <220> <223> PCNA (F) <400> 23 cctgtgcaaa agatggagtg 20 <210> 24 <211> 21 <212> DNA <213> artificial sequence <220> <223> PCNA (R) <400> 24 ggagagagtg gagtggcttt t 21 <210> 25 <211> 20 <212> DNA <213> artificial sequence <220> <223> OCT4 (F) <400> 25 gcggacaagt atcgagaacc 20 <210> 26 <211> 20 <212> DNA <213> artificial sequence <220> <223> OCT4 (R) <400> 26 cctcaaaatc ctctcgttgc 20 <210> 27 <211> 20 <212> DNA <213> artificial sequence <220> <223> NANOG (F) <400> 27 taaaaccact gcccacatct 20 <210> 28 <211> 20 <212> DNA <213> artificial sequence <220> <223> NANOG (R) <400> 28 ctgcctctga aatctgtcgt 20 <210> 29 <211> 20 <212> DNA <213> artificial sequence <220> <223> CDX2 (F) <400> 29 ctgtttgggt tgttggtctg 20 <210> 30 <211> 20 <212> DNA <213> artificial sequence <220> <223> CDX2 (R) <400> 30 cccactccct tcaccatatc 20 <210> 31 <211> 20 <212> DNA <213> artificial sequence <220> <223> GATA6 (F) <400> 31 gagggaattc agaccaggaa 20 <210> 32 <211> 20 <212> DNA <213> artificial sequence <220> <223> GATA6 (R) <400> 32 agctggcgtt tgtgttgtag 20

Claims (10)

A medium composition for in vitro culture of mammalian fertilized eggs, containing interleukin (IL)-7 as an active ingredient.
According to claim 1,
Characterized in that the IL-7 increases the division rate of embryos or the formation rate of blastocysts, the composition
According to claim 1,
The composition, characterized in that the IL-7 increases the ratio of inner cell mass (ICM) in the blastocyst.
According to claim 1,
The composition, characterized in that the IL-7 reduces apoptosis of blastocysts.
According to claim 1,
The mammal is characterized in that at least one selected from the group consisting of pigs, cattle, sheep, mice, composition.
The composition according to claim 1, characterized in that the composition is added to an in vitro culture medium.
1) preparing eggs of non-human mammals;
2) maturing the eggs in vitro; and
3) culturing the matured oocytes in vitro using the composition of claim 1;
Characterized in that it comprises a, mammalian fertilized egg in vitro culture method. delete delete delete

Images