KR102417999B1 - Method for measuring library complexity for next generation sequencing - Google Patents

Abstract

It provides a way to measure the complexity of a library. Accordingly, the complexity of the library can be measured in a simple and accurate manner in real time during the preparation of the library for nucleic acid sequence analysis, during the nucleic acid sequencing process after library preparation, or after completion of the nucleic acid sequencing analysis.

Description

Method for measuring library complexity for next generation sequencing

It relates to a method for measuring the complexity of a library for next-generation nucleic acid sequence analysis and an apparatus using the same.

Next generation nucleic acid sequencing (NGS) is widely used for research and diagnostic purposes. Although NGS differs depending on the type of equipment, broadly speaking, it can be divided into three steps: sample collection, library preparation, and nucleic acid sequence analysis. After the library is prepared, quality control (QC) is performed before starting the nucleic acid sequence analysis, and it is determined whether or not to proceed with the nucleic acid sequence analysis with the prepared library. In order to check whether the nucleic acid sequence analysis is smoothly performed in real time even during the nucleic acid sequence analysis, QC is performed by the method provided by the manufacturer of the library. After the nucleic acid sequence analysis, the generated nucleic acid sequence data (ie, read) is analyzed to substantially measure the quality of data generation before analysis of mutations, gene mutations, gene expression, and the like. As such, quality is measured for each stage of next-generation nucleic acid sequence analysis, and one of the factors determining the quality is the complexity of the library. After the library is prepared, during nucleic acid sequencing, or after nucleic acid sequencing is completed, the complexity of the library is measured to determine whether to perform, stop, and utilize the generated nucleic acid sequence data. have.

A method is known to perform two minimum-range nucleic acid sequencing analyzes before performing bulk nucleic acid sequencing and statistically predict the complexity of a library using the data obtained therefrom (US Publication No. US20140324359 A1). However, in this method, in order to measure the complexity of the library, nucleic acid sequence analysis must first be performed twice on the library, and the complexity of the library cannot be measured directly and in real time.

Therefore, there is a need for a method capable of measuring the complexity of a library in real time during nucleic acid sequencing or after nucleic acid sequencing in a simple and accurate manner.

A method for determining the complexity of a library for nucleic acid sequencing is provided.

According to one aspect, fragmenting the nucleic acid extracted from the target sample;

preparing a first library for nucleic acid sequence analysis by ligating a first polynucleotide to one or more ends of the fragmented nucleic acid;

preparing a second library by spiking a second polynucleotide to the first library;

calculating a first threshold cycle (Ct) value by performing a first polymerase chain reaction (PCR) using the second library and a first primer set complementary to the first polynucleotide;

calculating a second Ct value by performing a second PCR using a second primer set complementary to the second library and the second polynucleotide; and

It provides a method of measuring the complexity of a library for nucleic acid sequence analysis, comprising measuring the complexity of the first library by calculating a ratio of the second Ct value to the first Ct value.

The nucleic acid sequencing of the “library for nucleic acid sequencing” may be next generation sequencing (NGS). The term "next generation sequencing (NGS)" may be used interchangeably with the term "massive parallel sequencing" or the term "second-generation sequencing". NGS refers to a technology for fragmenting the entire genome in a chip-based and PCR-based paired-end format, and performing nucleic acid sequence analysis on the fragment at high speed based on hybridization. NGS is a technique for simultaneous nucleic acid sequence analysis of a large number of fragments of nucleic acids, and NGS-based target nucleic acid sequencing or panel sequencing can be performed. NGS is, for example, 454 platform (Roche), GS FLX Titanium, Illumina MiSeq, Illumina HiSeq, Illumina Genome Analyzer, Solexa platform, SOLiD System (Applied Biosystems), Ion Proton (Life Technologies), Complete Genomics, Helicos Biosciences Heliscope, Pacific Biosciences' Single Molecule Real Time (SMRT™) technology, or a combination thereof.

The term “library” refers to a collection of nucleic acid fragments. The library is, for example, a genomic library, a complementary DNA library, or a randomized mutant library.

The term "library complexity" refers to the number of unique fragments present in a corresponding library. The complexity may be affected by the amount of nucleic acid as a starting material, the amount of nucleic acid lost during library preparation, the amount of nucleic acid amplified through PCR, and the like. The complexity of the library can be expressed at a relative level.

The method includes fragmenting the nucleic acid extracted from the target sample.

The target sample may be derived from an individual or a cell. The subject may be a mammal, including humans, cattle, horses, pigs, sheep, goats, dogs, cats, and rodents. The cell may be a cell or cell line derived from an individual. The target sample may be a biological sample. The biological sample may be obtained from, for example, blood, plasma, serum, urine, saliva, mucosal secretions, sputum, feces, tears, or a combination thereof. The biological sample may be a sample such as eukaryotic cells, prokaryotic cells, viruses, and bacteriophages derived from various species.

The nucleic acid may be a genome or a fragment thereof. The term “genome” is a generic term for the entirety of chromosomes, chromatin, or genes. The genome or fragment thereof may be isolated DNA, for example, cell-free DNA (cf DNA). A method for extracting or isolating a nucleic acid from a target sample may be performed by a method known to those skilled in the art.

The method of extracting the nucleic acid from the target sample may be performed by a method known to those skilled in the art.

The fragmentation may be to physically, chemically, or enzymatically cut the genome. For example, the fragmentation is cutting the genome with a restriction enzyme.

The method may further comprise selecting the size of the fragmented nucleic acid. The step of selecting the size may be performed by electrophoresis, centrifugation, chromatography, or a combination thereof. The fragmented nucleic acid has a length of about 10 bp (base pair) to about 2000 bp, about 20 bp to about 1500 bp, about 50 bp to about 1000 bp, about 100 bp to about 800 bp, about 150 bp to about 600 bp, or from about 300 bp to about 600 bp.

The method includes preparing a first library for nucleic acid sequence analysis by ligating a first polynucleotide to one or more ends of the fragmented nucleic acid.

The step of preparing the first library may further include end-repair of the fragmented nucleic acid and 3'-adenosine tailing (3'-A tailing).

The first polynucleotide may be an adapter. The adapter may be a polynucleotide including a primer sequence for enriching a target nucleic acid in NGS. The adapter may be a polynucleotide known to a person skilled in the art. The adapter may include a universal sequence for nucleic acid sequence analysis. For example, it is an adapter included in a library preparation kit for nucleic acid sequence analysis.

Ligation refers to joining ends between nucleic acid fragments. The ligation may be performed using a DNA ligase.

The first library may be a library prepared for nucleic acid sequence analysis.

The method includes preparing a second library by spiking a second polynucleotide to the first library.

The spiking may be mixing the first library and a small amount of the second polynucleotide.

The second polynucleotide comprises a first region comprising a nucleic acid sequence in which at least two consecutive nucleotides are identical to a target nucleic acid sequence, and at one or more ends of the first region, and at least two consecutive nucleotides from one or more ends of the target nucleic acid sequence; a second region comprising a different nucleic acid sequence.

The target nucleic acid sequence may include a genetic variation used for companion diagnostics (CDx).

The length of the second polynucleotide is about 20 nucleotides (hereinafter referred to as 'nt') to about 500 nt, about 30 nt to about 450 nt, about 40 nt to about 400 nt, about 50 nt to about 350 nt, about 60 nt to about 300 nt, about 70 nt to about 250 nt, about 80 nt to about 200 nt, about 90 nt to about 190 nt, about 100 nt to about 180 nt, about 110 nt to about 170 nt, about 120 nt to about 160 nt, about 130 nt to about 150 nt, or about 150 nt.

The first region may comprise a nucleic acid sequence in which at least two consecutive nucleotides are identical to the target nucleic acid sequence. The first region is from about 10 nucleotides (hereinafter referred to as 'nt') to about 490 nt, from about 20 nt to about 440 nt, from about 30 nt to about 390 nt, from about 40 nt to about 340 nt, from about 50 nt to about 290 nt, about 60 nt to about 240 nt, about 70 nt to about 150 nt, about 80 nt to about 180 nt, about 90 nt to about 170 nt, about 100 nt to about 160 nt, about 110 nt to about 150 nt, about 120 nt to about 150 nt, about 130 nt to about 150 nt, about 140 nt to about 150 nt, or about 142 nt.

wherein said second regions are located at both ends of the first region, each second region comprising a sequence different from at least two contiguous nucleotides from the 5' end of the target nucleic acid sequence and a sequence different from at least two contiguous nucleotides from the 3' end of the target nucleic acid sequence. can The length of the second region is about 2 nt to about 15 nt, about 2 nt to about 13 nt, about 2 nt to about 10 nt, about 2 nt to about 8 nt, about 2 nt to about 6 nt, about 2 nt to about 4 nt, about 3 nt, or about 4 nt.

The second polynucleotide may include, for example, a second region, a first region, and a second region in a 3' direction from its 5'-end.

The second polynucleotide may further include two or more consecutive nucleotides identical to the first polynucleotide at one or more ends thereof. The second polynucleotide may be, for example, from its 5'-end 3' direction at least two consecutive nucleotides identical to the first polynucleotide, a second region, a first region, a second region, and 2 identical to the first polynucleotide It may contain more than one consecutive nucleotide.

The method includes calculating a first threshold cycle (Ct) value by performing a first polymerase chain reaction (PCR) using a first primer set complementary to a second library and a first polynucleotide do.

The PCR is, for example, quantitative PCR (qPCR), digital PCR (dPCR), hot start PCR, touchdown PCR, nested (nested) PCR, booster (booster) ) PCR, multiplex PCR, real-time PCR, differential display PCR (D-PCR), rapid amplification of cDNA ends (RACE), inverse PCR (inverse PCR) polymerase chain reaction: IPCR), vectorette PCR, and thermal asymmetric interlaced PCR (TAIL-PCR).

The first primer set may be a polynucleotide complementary to the first polynucleotide. The first primer set may be a universal primer set.

The second primer set may be a polynucleotide complementary to the second polynucleotide. The second primer set may be a polynucleotide complementary to a second polynucleotide but not complementary to the first polynucleotide.

In the PCR reaction, a probe complementary to a target nucleic acid may be further used for detection of the amplified nucleic acid. One or more ends of the probe may be labeled with a fluorescent material, quantum dot, FRET, or the like.

Ct (threshold cycle) value refers to the number of cycles in PCR that first show an amplification signal exceeding the background signal. In the case of quantitative PCR, it refers to the number of cycles representing the threshold of the fluorescence signal. Since the Ct value has an inverse correlation with the copy number of the original nucleic acid as a starting material in the amplification reaction, the Ct value can be used to calculate the copy number of the nucleic acid in the target sample.

The first Ct value may represent total reads of the second library. The term "read" refers to nucleic acid sequence information of a nucleic acid fragment obtained by nucleic acid sequencing.

The method includes calculating a second Ct value by performing a second PCR using a second primer set complementary to a second library and a second polynucleotide.

The second Ct value may represent a read of a second polynucleotide in the second library.

The first PCR, the second PCR, or a combination thereof may be performed by quantitative PCR (qPCR) or digital PCR (dPCR).

The first PCR and the second PCR may be performed simultaneously or sequentially.

The method includes determining the complexity of the first library by calculating a ratio of a second Ct value to a first Ct value.

As the ratio of the second Ct value to the first Ct value is lower, the complexity of the first library may be higher. As the ratio of the second Ct value to the first Ct value increases, the complexity of the first library may be lower.

Another aspect comprises the steps of fragmenting the nucleic acid extracted from the target sample;

preparing a first library for nucleic acid sequence analysis by ligating a first polynucleotide to one or more ends of the fragmented nucleic acid;

preparing a second library by adding a second polynucleotide to the first library,

The second polynucleotide comprises a first region comprising a nucleic acid sequence in which at least two consecutive nucleotides are identical to a target nucleic acid sequence, and at one or more ends of the first region, and at least two consecutive nucleotides from one or more ends of the target nucleic acid sequence; comprising a second region comprising a different nucleic acid sequence;

performing nucleic acid sequencing using the second library and a first primer complementary to the first polynucleotide to obtain total reads of the second library;

selecting a read of the second polynucleotide from the total reads obtained to obtain a read of a second polynucleotide; and

measuring the complexity of the first library by calculating a ratio of the number of reads of the second polynucleotide to the total number of reads,

A method for determining the complexity of a library for nucleic acid sequencing is provided.

The target sample, nucleic acid, nucleic acid sequencing, fragmentation, first polynucleotide, ligation, addition, second polynucleotide, PCR, Ct value, library, and complexity of the library are as described above.

The method includes fragmenting the nucleic acid extracted from the target sample.

The method includes preparing a first library for nucleic acid sequence analysis by ligating a first polynucleotide to one or more ends of the fragmented nucleic acid.

The method includes preparing a second library by adding a second polynucleotide to the first library.

The method includes performing nucleic acid sequencing using a second library and a first primer complementary to the first polynucleotide to obtain total reads of the second library.

The first primer may be one primer or a set of primers.

The method includes selecting a read of the second polynucleotide from the total reads obtained to obtain a read of the second polynucleotide.

The method includes determining the complexity of the first library by calculating a ratio of the number of reads of the second polynucleotide to the total number of reads.

The lower the ratio of the number of reads of the second polynucleotide to the total number of reads, the higher the complexity of the first library. The higher the ratio of the number of reads of the second polynucleotide to the total number of reads, the lower the complexity of the first library.

The method can monitor the complexity of the first library in real time during nucleic acid sequencing or after nucleic acid sequencing.

According to the method of measuring the complexity of a library according to one aspect or another aspect, in real time during the preparation of a library for nucleic acid sequencing, during the nucleic acid sequencing process after library preparation, or after completion of nucleic acid sequencing, the library is performed in a simple and accurate manner. can measure the complexity of

1A is a schematic diagram showing the principle of a method for measuring the complexity of a library for NGS according to an aspect, and FIG. 1B is a schematic diagram showing the ratio of artificial sequence reads among all reads when the complexity of the library is high or low (in reads) ■: adapter, in read □: artificial sequence).
2 is a graph showing Ct values in quantitative PCR according to library complexity.
3 is a graph showing the ratio of artificial sequence reads among total reads according to library complexity.

Hereinafter, the present invention will be described in more detail through examples. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited to these examples.

Example 1. Next Generation Halsan Determination of the complexity of libraries for sequencing analysis

1. Preparation of Nucleic Acid Fragments Containing Artificial Sequences

For next generation nucleic acid sequencing (NGS), the genes KRAS, IDH1, BRAC1, ALK, and ERBB2 and regions of these genes containing mutations known to be utilized in companion diagnostics (CDx) as target sequences. was selected. A reference sequence of about 150 bp was selected based on the selected position.

Although the selected reference sequence and the nucleic acid sequence are the same, 4 bp from the 5' end and 4 bp from the 3' end are substituted with an artificial sequence, and a nucleic acid fragment containing the adapter nucleic acid sequence of the library at both ends (hereinafter , referred to as "a nucleic acid fragment containing an artificial sequence") was prepared by a gene synthesis method.

The remaining nucleic acid sequences excluding the adapter nucleic acid sequence from the nucleic acid sequences of the selected genes, reference sequences, and artificial sequence-containing nucleic acid fragments are shown in Table 1 below.

number location of reference dielectric reference sequence Nucleic Acid Fragments Containing Artificial Sequences One KRAS: Chromosome Number 12:
exon number: 3:
Chromosome 12:25380168-25380346 5'-AGGAATCCTGAGAAGGGAGAAACACAGTCTGGATTATTACAGTGCACCTTTTACTTCAAAAAAGGTGTTATATACAACTCAACAACAAAAAATTCAATTTAAAAATGGGCAAAGGACTTGAAAAGACATTGTTCCTGCTCCAAAGATGAC-3' (SEQ ID NO: 1) 5'- CTTC ATCCTGAGAAGGGAGAAACACAGTCTGGATTATTACAGTGCACCTTTTACTTCAAAAAAGGTGTTATATACAACTCAACAACAAAAAATTCAATTTAAAAATGGGCAAAGGACTTGAAAAGACATTGTTCCTGCTCCAAAGA GAAG -3' (SEQ ID NO: 2) 2 IDH1: chromosome number 12
exon number: 4:
Chromosome 2:209113048-209113359 5'-AGATAATGGCTTCTCTGAAGACCGTGCCACCCAGAATATTTCGTATGGTGCCATTTGGTGATTTCCACATTTGTTTCAACTTGAACTCCTCAACCCTCTTCTCATCAGGAGTGATAGTGGCACATTTGACGCCAACATTATGCTTCTTTA-3' (SEQ ID NO: 3) 5'- CTTC AATGGCTTCTCTGAAGACCGTGCCACCCAGAATATTTCGTATGGTGCCATTTGGTGATTTCCACATTTGTTTCAACTTGAACTCCTCAACCCTCTTCTCATCAGGAGTGATAGTGGCACATTTGACGCCAACATTATGCTTC GAAG -3' (SEQ ID NO: 4) 3 BRAC1: Chromosome number 17
exon number: 15:
Chromosome 17:41222945-41223255 5'-TCAATTCTGGCTTCTCCCTGCTCACACTTTCTTCCATTGCATTATACCCAGCAGTATCAGTAGTATGAGCAGCAGCTGGACTCTGGGCAGATTCTGCAACTTTCAACTTTCAATTGGGGAACTTTCAATGCAGAGGTTGAAGATGGTATG-3' (SEQ ID NO: 5) 5'- CTTC TTCTGGCTTCTCCCTGCTCACACTTTCTTCCATTGCATTATACCCAGCAGTATCAGTAGTATGAGCAGCAGCTGGACTCTGGGCAGATTCTGCAACTTTCAACTTTCAATTGGGGAACTTTCAATGCAGAGGTTGAAGATGG GAAG -3' (SEQ ID NO: 6) 4 ALK: chromosome number 2
exon number: 20:
Chromosome 2:29446208-29446394 5'-GGTCACTGATGGAGGAGGTCTTGCCAGCAAAGCAGTAGTTGGGGTTGTAGTCGGTCATGATGGTCGAGGTGCGGAGCTTGCTCAGCTTGTACTCAGGGCTCTGCAGCTCCATCTGCATGGCTTGCAGCTCCTGGTGCTTCCGGCGGTACA-3' (SEQ ID NO: 7) 5'- CTTC ACTGATGGAGGAGGTCTTGCCAGCAAAGCAGTAGTTGGGGTTGTAGTCGGTCATGATGGTCGAGGTGCGGAGCTTGCTCAGCTTGTACTCAGGGCTCTGCAGCTCCATCTGCATGGCTTGCAGCTCCTGGTGCTTCCGGCGG GAAG -3' (SEQ ID NO: 8) 5 ERBB2: chromosome number 17
Exon number: 6:
Chromosome 17:37864574-37864787 5'-CAGGGCTACGTGCTCATCGCTCACAACCAAGTGAGGCAGGTCCCACTGCAGAGGCTGCGGATTGTGCGAGGCACCCAGCTCTTTGAGGACAACTATGCCCTGGCCGTGCTAGACAATGGAGACCCGCTGAACAATAACCACCCCTGTCACA-3' (SEQ ID NO: 9) 5'- CTTC GCTACGTGCTCATCGCTCACAACCAAGTGAGGCAGGTCCCACTGCAGAGGCTGCGGATTGTGCGAGGCACCCAGCTCTTTGAGGACAACTATGCCCTGGCCGTGCTAGACAATGGAGACCCGCTGAACAATAACCACCCCTGT GAAG -3' (SEQ ID NO: 10)

In Table 1, the artificial sequences of the artificial sequence-containing nucleic acid fragments are indicated in bold and underlined.

2. NGS Preparation of library for and addition of artificial sequence-containing nucleic acid fragments

To prepare a library for NGS, a total of 10 human genome samples HapMap NA07014, NA10840, NA18595, NA18957, NA18488, NA18511, NA18867, NA18924, NA19108, and NA19114 were mixed at the same molar concentration ratio. 50 ng or 200 ng were prepared. Fragmentation of the human genome, end-repair, 3'-adenosine tailing, and adapter ligation were sequentially performed on the prepared mixed sample using Kapa hyper prep kits for illumine (Kapa Biosystems) according to the method provided by the manufacturer. did

50 atmole of each of the artificial sequence-containing nucleic acid fragments prepared in Example 1.1 was spiked into the adapter-ligated library. After capturing the library to which the artificial sequence-containing nucleic acid fragment was added, a pre-capture polymerase chain reaction (PCR) was performed, and then target enrichment was performed. Thereafter, the target-enriched library was subjected to post-capture PCR.

Real-time PCR was performed using a quantitative PCR (qPCR) kit for measuring the KAPA Illumina library concentration, and a cycle threshold (Ct) value was calculated from the real-time qPCR result. Here, the calculated Ct value represents the total number of reads.

Meanwhile, to measure the number of reads of the artificial sequence-containing nucleic acid fragment included in the library, real-time qPCR was performed using the primer sets and probes in Table 2 below. Here, the calculated Ct value represents the number of reads derived from the artificial sequence-containing nucleic acid fragment.

primer nucleic acid sequence IDH1_artificial_forward 5'-CCACCGAGATCTACACTCTTTC-3' (SEQ ID NO: 11) IDH1_artificial_probe 5'-ACGCTCTTCCGATCTCTTCAATGGC-3' (SEQ ID NO: 12) IDH1_artificial_reverse 5'-AAATCACCAAATGGCACCATAC-3' (SEQ ID NO: 13) BRCA1_artificial_forward 5'-GCGACCACCGAGATCTACA-3' (SEQ ID NO: 14) BRCA1_artificial_probe 5'-ACGACGCTCTTCCGATCTCTTCTTCT-3' (SEQ ID NO: 15) BRCA1_artificial_reverse 5'-GAAAGTTGGAGCAGGAGAAG-3' (SEQ ID NO: 16) ERBB2_artificial_forward 5'-CCACCGAGATCTACACTCTTTC-3' (SEQ ID NO: 17) ERBB2_artificial_probe 5'-ATCTCTTCGCTACGTGCTCATCGC-3' (SEQ ID NO: 18) ERBB2_artificial_reverse 5'-CCTGCCTCACTTGGTTGT-3' (SEQ ID NO: 19)

In addition, in order to check whether the ratio of artificial sequence reads among all reads changes depending on the complexity of the library, a library was prepared in which the library complexity was changed during the library preparation process. Using the library preparation method provided by the manufacturer of Kapa hyper prep kits for illumine (Kapa Biosystems), the ligated product in the adapter ligation step was purified once, and 30 μM of the adapter was used, according to this method. The prepared library was used as a negative control. To artificially reduce the complexity of the prepared library, double purification of the ligated product in the ligation step, use of adapters at 3 μM (i.e., 1/10 dilution), or a combination thereof A reduced library was prepared.

Real-time qPCR was performed on the negative control library and the library artificially reduced in complexity, and Ct values were calculated. The calculated Ct values according to the complexity of the library are shown in FIG. 2 . As shown in FIG. 2 , as the complexity of the library decreased, the Ct value of the nucleic acid fragment containing the artificial sequence decreased. In contrast, the Ct value of total reads did not change significantly, despite the change in library complexity.

The nucleic acid sequence of the prepared library was analyzed, and the number of total reads and the ratio of artificial sequence reads among the total reads were calculated using the analyzed raw read data. According to the change in complexity, the number of total reads calculated and the ratio of artificial sequence reads among the total reads are shown in FIG. 3 . In FIG. 3 , “50 ng” means that the amount of human genomic DNA HapMap mixed sample is 50 ng during library preparation. As shown in FIG. 3 , it was confirmed that the total number of reads and the number of artificial sequence reads did not correlate with library complexity, but the ratio of artificial sequence reads among total reads was inversely correlated with library complexity.

<110> SAMSUNG ELECTRONICS CO., LTD Samsung Life Public Welfare Foundation <120> Method for measuring library complexity for next generation sequencing <130> PN115614-KR <160> 19 <170> KopatentIn 2.0 <210> 1 <211> 150 <212> DNA <213> Artificial Sequence <220> <223> KRAS reference sequence <400> 1 aggaatcctg agaagggaga aacacagtct ggattattac agtgcacctt ttacttcaaa 60 aaaggtgtta tatacaactc aacaacaaaa aattcaattt aaaaatgggc aaaggacttg 120 aaaagacatt gttcctgctc caaagatgac 150 <210> 2 <211> 150 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid fragment containing artificial sequence <400> 2 cttcatcctg agaagggaga aacacagtct ggattattac agtgcacctt ttacttcaaa 60 aaaggtgtta tatacaactc aacaacaaaa aattcaattt aaaaatgggc aaaggacttg 120 aaaagacatt gttcctgctc caaagagaag 150 <210> 3 <211> 150 <212> DNA <213> Artificial Sequence <220> <223> IDH1 reference sequence <400> 3 agataatggc ttctctgaag accgtgccac ccagaatatt tcgtatggtg ccatttggtg 60 atttccacat ttgtttcaac ttgaactcct caaccctctt ctcatcagga gtgatagtgg 120 cacattgac gccaacatta tgcttcttta 150 <210> 4 <211> 150 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid fragment containing artificial sequence <400> 4 cttcaatggc ttctctgaag accgtgccac ccagaatatt tcgtatggtg ccatttggtg 60 atttccacat ttgtttcaac ttgaactcct caaccctctt ctcatcagga gtgatagtgg 120 cacattgac gccaacatta tgcttcgaag 150 <210> 5 <211> 150 <212> DNA <213> Artificial Sequence <220> <223> BRAC1 reference sequence <400> 5 tcaattctgg cttctccctg ctcacacttt cttccattgc attataccca gcagtatcag 60 tagtatgagc agcagctgga ctctgggcag attctgcaac tttcaacttt caattgggga 120 actttcaatg cagaggttga agatggtatg 150 <210> 6 <211> 150 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid fragment containing artificial sequence <400> 6 cttcttctgg cttctccctg ctcacacttt cttccattgc attataccca gcagtatcag 60 tagtatgagc agcagctgga ctctgggcag attctgcaac tttcaacttt caattgggga 120 actttcaatg cagaggttga agatgggaag 150 <210> 7 <211> 150 <212> DNA <213> Artificial Sequence <220> <223> ALK reference sequence <400> 7 ggtcactgat ggaggaggtc ttgccagcaa agcagtagtt ggggttgtag tcggtcatga 60 tggtcgaggt gcggagcttg ctcagcttgt actcagggct ctgcagctcc atctgcatgg 120 cttgcagctc ctggtgcttc cggcggtaca 150 <210> 8 <211> 150 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid fragment containing artificial sequence <400> 8 cttcactgat ggaggaggtc ttgccagcaa agcagtagtt ggggttgtag tcggtcatga 60 tggtcgaggt gcggagcttg ctcagcttgt actcagggct ctgcagctcc atctgcatgg 120 cttgcagctc ctggtgcttc cggcgggaag 150 <210> 9 <211> 150 <212> DNA <213> Artificial Sequence <220> <223> ERBB2 reference sequence <400> 9 cagggctacg tgctcatcgc tcacaaccaa gtgaggcagg tcccactgca gaggctgcgg 60 attgtgcgag gcacccagct ctttgaggac aactatgccc tggccgtgct agacaatgga 120 gacccgctga acaataccac ccctgtcaca 150 <210> 10 <211> 150 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid fragment containing artificial sequence <400> 10 cttcgctacg tgctcatcgc tcacaaccaa gtgaggcagg tcccactgca gaggctgcgg 60 attgtgcgag gcacccagct ctttgaggac aactatgccc tggccgtgct agacaatgga 120 gacccgctga acaataccac ccctgtgaag 150 <210> 11 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> IDH1_art_Forward primer <400> 11 ccaccgagat ctacactctt tc 22 <210> 12 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> IDH1_art_Probe <400> 12 acgctcttcc gatctcttca atggc 25 <210> 13 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> IDH1_art_Reverse primer <400> 13 aaatcaccaa atggcaccat ac 22 <210> 14 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> BRCA1_art_Forward primer <400> 14 gcgaccaccg agatctaca 19 <210> 15 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> BRCA1_art_Probe <400> 15 acgacgctct tccgatctct tcttct 26 <210> 16 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> BRCA1_art_Reverse primer <400> 16 gaaagtgtga gcagggagaa g 21 <210> 17 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> ERBB2_art_Forward primer <400> 17 ccaccgagat ctacactctt tc 22 <210> 18 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> ERBB2_art_Probe <400> 18 atctcttcgc tacgtgctca tcgc 24 <210> 19 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> ERBB2_art_Reverse primer <400> 19 cctgcctcac ttggttgt 18

Claims (19)

fragmenting the nucleic acid extracted from the target sample;
preparing a first library for nucleic acid sequence analysis by ligating a first polynucleotide to one or more ends of the fragmented nucleic acid;
Preparing a second library by adding a second polynucleotide to the first library (spiking),
The second polynucleotide comprises a first region comprising a nucleic acid sequence in which at least two consecutive nucleotides are identical to a target nucleic acid sequence, and at one or more ends of the first region, and at least two consecutive nucleotides from one or more ends of the target nucleic acid sequence; comprising a second region comprising a different nucleic acid sequence;
calculating a first threshold cycle (Ct) value by performing a first polymerase chain reaction (PCR) using the second library and a first primer set complementary to the first polynucleotide;
calculating a second Ct value by performing a second PCR using a second primer set complementary to the second library and the second polynucleotide; and
measuring the complexity of the first library by calculating a ratio of a second Ct value to the first Ct value;
A method for determining the complexity of a library for nucleic acid sequencing. The method according to claim 1, wherein the nucleic acid sequencing is next generation sequencing (NGS). The method according to claim 1, wherein the target sample is derived from a subject or cell. The method according to claim 1, wherein the nucleic acid is a genome or a fragment thereof. The method of claim 1 , wherein the first polynucleotide is an adapter. The method of claim 1 , wherein the target nucleic acid sequence comprises a genetic variation used for companion diagnostics (CDx). The method according to claim 1, wherein the length of the second polynucleotide is 20 nucleotides to 500 nucleotides. The method according to claim 1, wherein the second region is located at both ends of the first region, and each second region comprises a sequence different from at least two consecutive nucleotides from the 5' end of the target nucleic acid sequence and at least two consecutive nucleotides from the 3' end of the target nucleic acid sequence; and different sequences. The method according to claim 1, wherein the length of the second region is 2 to 15 nucleotides. The method of claim 1 , wherein the second polynucleotide further comprises two or more consecutive nucleotides identical to the first polynucleotide at one or more ends thereof. The method according to claim 1, wherein both the first PCR and the second PCR are performed by quantitative PCR or digital PCR, the first PCR is performed by quantitative PCR and the second PCR is performed by digital PCR, or the first PCR is performed by digital PCR wherein the PCR is performed and the second PCR is performed as a quantitative PCR. The method according to claim 1, wherein the first PCR and the second PCR are performed simultaneously or sequentially. The method of claim 1 , wherein the first Ct value represents total reads of the second library. The method of claim 1 , wherein the second Ct value represents a read of a second polynucleotide in a second library. The method according to claim 1, The lower the ratio of the second Ct value to the first Ct value, the higher the complexity of the first library, and the higher the ratio of the second Ct value to the first Ct value, the higher the ratio of the first library. The method of which the complexity is low. fragmenting the nucleic acid extracted from the target sample;
preparing a first library for nucleic acid sequence analysis by ligating a first polynucleotide to one or more ends of the fragmented nucleic acid;
preparing a second library by adding a second polynucleotide to the first library,
The second polynucleotide comprises a first region comprising a nucleic acid sequence in which at least two consecutive nucleotides are identical to a target nucleic acid sequence, and at one or more ends of the first region, and at least two consecutive nucleotides from one or more ends of the target nucleic acid sequence; comprising a second region comprising a different nucleic acid sequence;
performing nucleic acid sequencing using the second library and a first primer complementary to the first polynucleotide to obtain total reads of the second library;
selecting a read of the second polynucleotide from the total reads obtained to obtain a read of a second polynucleotide; and
measuring the complexity of the first library by calculating a ratio of the number of reads of the second polynucleotide to the total number of reads,
A method for determining the complexity of a library for nucleic acid sequencing. The method of claim 16 , wherein the nucleic acid sequencing is next-generation nucleic acid sequencing (NGS). The method according to claim 16, wherein the lower the ratio of the number of reads of the second polynucleotide to the total number of reads, the higher the complexity of the first library, the higher the number of reads of the second polynucleotide to the total number of reads. wherein the higher the ratio, the lower the complexity of the first library. The method of claim 16 , wherein the method monitors the complexity of the first library in real time during nucleic acid sequencing or after nucleic acid sequencing.

Images