KR102384992B1 - Age-specific biomarker of a patient with colorectal cancer and use thereof - Google Patents

Abstract

The present invention relates to an age-specific biomarker of a colorectal cancer patient and a use thereof, and specifically, a platelet derived growth factor receptor alpha (PDGFRA) gene or a protein encoded by the gene for a subject under 40 years of age for colorectal cancer diagnosis or It relates to a use for predicting prognosis and a method for screening an anticancer drug customized for colorectal cancer patients under 40 years of age. The expression of the PDGFRA gene according to the present invention is significantly increased in the low-age patient group under 40 years of age compared to the high-age colorectal cancer patient group, and even between the CMS4 type patient group with a poor prognosis, it was significantly increased in the low-age patient group. The expression is increased, and it was confirmed that it is also associated with the expression of EMT and angiogenic factors. In addition, it was confirmed that cells (PDCs) derived from a patient group under 40 years of age exhibit sensitivity when the expression of PDGFRA is inhibited or treated with an anticancer agent that targets it. It can be used for diagnosis and prognosis prediction of colorectal cancer in the following subjects, and is also expected to be usefully used in determining a treatment strategy for selecting a customized anticancer agent for colorectal cancer patients of the above age group.

Description

Age-specific biomarker of a patient with colorectal cancer and use thereof

The present invention relates to an age-specific biomarker of a colorectal cancer patient and a use thereof, specifically, a platelet derived growth factor receptor alpha (PDGFRA) gene or a protein encoded by the gene for colorectal cancer diagnosis or It relates to a method for predicting prognosis and a method for selecting an anticancer drug customized for colorectal cancer patients under 40 years of age.

Colorectal cancer (CRC) is one of the most common cancers worldwide and the leading cause of cancer-related deaths. However, successful results have not been reported in studies on specific treatment strategies and appropriate drug development for colorectal cancer. Although colorectal cancer has been mainly diagnosed in the average age of 60 years or older, recent population-based studies have reported that the incidence of colorectal cancer tends to increase in people younger than 50 years of age. Moreover, many studies have reported that younger patients have a poorer prognosis than older patients and that early diagnosis is difficult. there is no situation.

While many cases of early-onset colorectal cancer are caused by genetic mutations, studies using selected gene sets have shown that several somatic mutations tend to occur frequently in colorectal cancer patients, except for hereditary cancer syndromes. showed In addition, the results of gene expression studies in young patients without a family history showed that upregulated genes were involved in various biological processes compared to healthy controls (Clin. Cancer. Res. 13, 1107-1114 (2007)). . However, previous studies have limitations in that they are derived from an insufficient gene set and patients. Recent high-efficiency genomic and transcriptome sequencing technologies can more sensitively detect multiple oncogenes and quantify gene expression levels with high resolution. Therefore, comparative analysis at the genomic and transcript level can provide more detailed insight into the molecular mechanisms of young colorectal cancer patients.

Recently, four types of biologically distinct consensus molecular subtypes (CMS) based on more detailed gene expression levels for colorectal cancer have been proposed; CMS1 (microsatellite instable (MSI) and immune activation), CMS2 (epithelial and marked WNT signaling), CMS3 (epithelial and metabolic dysregulation) and CMS4 (mesenchymal and activated TGF-β signaling) ). Moreover, from a clinical point of view, it is known that CMS4 is associated with a poor prognosis, and the other types show a relatively good prognosis. CMS has been used in the diagnosis and treatment of colorectal cancer patients in many recent studies because it enables more detailed and accurate classification than the existing classification method. Therefore, CMS classification for individuals enables more precise and advanced treatment for colorectal cancer patients.

Accordingly, the present inventors performed a comprehensive analysis of the molecular characteristics of 49 colorectal cancer patients through exome sequencing and RNA sequencing using tumor tissue and normal tissue matched thereto. Furthermore, in order to discover specific biomarkers for low-age colorectal cancer patients, colorectal cancer patients were classified into three groups of low age (young), middle age (middle) and high age (old), and comparisons between these groups were performed. The difference between the low age and the high age was analyzed for molecular subtypes and genomic variations. As a result, a specific biomarker for the patient group was finally discovered along with an in-depth understanding of tumors derived from low-age colorectal cancer patients.

Accordingly, an object of the present invention is to provide a marker composition for diagnosing or prognosing colorectal cancer in a subject under 40 years of age, comprising a platelet derived growth factor receptor alpha (PDGFRA) gene or a protein encoded by the gene.

In addition, the present invention provides a composition for diagnosing or prognosing colorectal cancer in a subject under 40 years of age, comprising an agent for measuring the mRNA level of the platelet derived growth factor receptor alpha (PDGFRA) gene or a protein encoded by the gene, and the composition It is another object to provide a kit comprising a.

In addition, the present invention is a colorectal cancer patient under 40 years of age, comprising measuring the mRNA level of the platelet derived growth factor receptor alpha (PDGFRA) gene or protein encoded by the gene from a sample derived from a colorectal cancer patient under 40 years of age Another object of the present invention is to provide a customized anticancer drug screening method.

However, the technical problem to be achieved by the present invention is not limited to the above-mentioned problems, and other problems not mentioned will be clearly understood by those skilled in the art from the following description.

In order to achieve the object of the present invention as described above, the present invention includes a PDGFRA (platelet derived growth factor receptor alpha; GenBank accession number: XM_006714041) gene or a protein encoded by the gene, in subjects under 40 years of age It provides a marker composition for the diagnosis or prognosis of colorectal cancer.

In addition, the present invention is PDGFRA (platelet derived growth factor receptor alpha; GenBank accession (accession) number: XM_006714041) of the gene mRNA or comprising an agent for measuring the protein level encoded by the gene, colorectal cancer in subjects under 40 years of age A composition for diagnosis or prognosis is provided.

In addition, the present invention provides a kit for diagnosing or prognosing colorectal cancer in a subject under 40, comprising the composition.

In one embodiment of the present invention, the agent for measuring the mRNA level may be sense and antisense primers or probes complementary to the mRNA of the gene.

In another embodiment of the present invention, the agent for measuring the protein level may be an antibody that specifically binds to the protein.

As another aspect of the present invention, the present invention provides a method for selecting a customized anticancer agent for colorectal cancer patients under 40 years of age, comprising the following steps.

(a) measuring the mRNA level of the gene or protein encoded by the gene (PDGFRA; platelet derived growth factor receptor alpha; GenBank accession number: XM_006714041) from a sample derived from colorectal cancer patients under 40 years of age; and

(b) when the level of PDGFRA mRNA or the protein encoded by the gene is increased in colorectal cancer patients under 40 years of age compared to colorectal cancer patients over 61 years of age, determining a PDGFRA target anticancer agent.

In one embodiment of the present invention, the anticancer agent may be regorafenib (Regorafenib).

In another embodiment of the present invention, the expression level of the mRNA is nucleotide sequence analysis, nanoString nCounter analysis, polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR), real-time polymerization It can be measured by at least one method selected from the group consisting of enzyme chain reaction (Real-time PCR), RNase protection assay (RPA), microarray and northern blotting. .

In another embodiment of the present invention, the protein expression level is western blotting (western blotting), radioimmunoassay (RIA), radioimmunodiffusion, enzyme immunoassay (ELISA), immunoprecipitation (immunoprecipitation) ), flow cytometry, immunofluorescence, ouchterlony, complement fixation assay, and protein chip at least one method selected from the group consisting of can be measured through

The expression of the PDGFRA gene according to the present invention is significantly increased in the low-age patient group under 40 years of age compared to the high-age colorectal cancer patient group, and even between the CMS4 type patient group with a poor prognosis, it was significantly increased in the low-age patient group. The expression is increased, and it was confirmed that it is also associated with the expression of EMT and angiogenic factors. In addition, it was confirmed that cells (PDCs) derived from a patient group under 40 years of age exhibit sensitivity when the expression of PDGFRA is inhibited or treated with an anticancer agent that targets it. It can be used for diagnosis and prognosis prediction of colorectal cancer in the following subjects, and is also expected to be usefully used in determining a treatment strategy for selecting a customized anticancer agent for colorectal cancer patients of the above age group.

1 is a result of classifying colorectal cancer patients into three groups according to age and showing the distribution of CMS types in each group as a pie chart (Young Age CRC: composed of patients under 40 years old; Middle Age CRC: 41-60 consisting of three patients; Old Age CRC: consisting of patients aged 61 years and older).
2 is a result of analyzing mRNA expression and gene profiling differentially expressed between tumor tissues of a low-age colorectal cancer patient (Young CRC) and a high-age colorectal cancer patient (Old CRC), FIG. 2a shows the two groups Genes differentially expressed between tumor tissues (Young Tumor vs Old Tumor) and genes differentially expressed between normal tissues (Young Normal vs Old Normal) of the It is a result of a Venn diagram showing genes differentially expressed between tumor tissues or normal tissues, and FIG. 2c is a heat map showing the expression profiles for 180 genes differentially expressed only in the tumor tissues of the two groups. , Figure 2d is a result of performing pathway analysis related to genes whose expression has significantly changed using a network-based pathway analysis tool, Figure 2e is an Oncoprint result of colorectal cancer-related mutations (missense, nonsense and splicing), 2f is a result showing the copy number amplification and deletion frequently detected in the two groups (Young CRC and Old CRC).
Figure 3 is a result of comparative analysis of the expression level of PDGFRA between the group of colorectal cancer patients of low age (young) and colorectal cancer patients of high age (Old). It is a result of measuring the expression level of PDGFRA mRNA according to It is a result shown by comparing mRNA expression levels.
4 is a result of analyzing the co-expression of PDGFRA with EMT and angiogenesis factors, FIG. 4a is a scatter plot showing the gene expression level between PDGFRA and EMT-related markers, and FIG. 4b is a result of PDGFRA and angiogenesis-related The result is a scatter plot showing gene expression levels between markers.
5 is a result of analyzing the expression of PDGFRA and the reactivity to a PDGFRA target drug in colon cancer patient-derived cells (PDCs). The results are shown by measuring the expression level of PDGFRA mRNA in each of the cells (Old PDCs) isolated from cancer patients by RT-qPCR, and FIG. 5B shows the cells (#1, #2) and high It is the result of analyzing the expression level of PDGFRA protein through Western blot in each of the cells (#3, #4) isolated from colorectal cancer patients of age. is the result of analyzing the viability of cells after inhibiting the expression of PDGFRA by transfecting them, and FIG. 5d is the sensitivity to the drug by measuring the cell viability after treating each of the PDCs with a PDGFRA target drug, Regorafenib. is the result of the analysis.

The present inventors classified the colorectal cancer patient group according to age and discovered the differentially expressed genes between the groups, and finally, the expression significantly increased in the colorectal cancer patient group under 40 years old and the correlation with factors related to poor prognosis PDGFRA was finally selected as an age-specific biomarker for colorectal cancer patients confirmed to have a, and the present invention was completed based on this.

Accordingly, the present invention includes a PDGFRA (platelet derived growth factor receptor alpha; GenBank accession number: XM_006714041) gene or a protein encoded by the gene, a marker composition for diagnosis or prognosis of colorectal cancer in a subject under 40 years of age provides

In addition, the present invention is PDGFRA (platelet derived growth factor receptor alpha; GenBank accession (accession) number: XM_006714041) of the gene mRNA or comprising an agent for measuring the protein level encoded by the gene, colorectal cancer in subjects under 40 years of age A composition for diagnosis or prognosis is provided.

In addition, the present invention provides a kit for diagnosing or prognosing colorectal cancer in a subject under 40, comprising the composition.

As used herein, the term “diagnosis” in a broad sense means judging the actual condition of a patient's disease in all aspects. The content of the judgment is the disease name, etiology, disease type, severity, detailed mode of the disease, and the presence or absence of complications. Diagnosis in the present invention is to determine whether the onset of colorectal cancer, the level of the advanced stage, and the like.

As used herein, the term “prognosis” refers to prediction of disease progression and recovery, and refers to a prospect or a preliminary evaluation. In the present invention, the prognosis means colon cancer recurrence, overall survival, or disease-free survival, but is not limited thereto.

The agent capable of detecting the mRNA expression may be sense and antisense primers or probes complementary to the mRNA of the gene, but is not limited thereto.

As used herein, the term “primer” refers to an oligonucleotide synthesized for use in diagnosis, DNA sequencing, etc. as a short gene sequence serving as a starting point of DNA synthesis. The primers may be synthesized and used with a length of typically 15 to 30 base pairs, but may vary depending on the purpose of use, and may be modified by methylation, capping, etc. by a known method.

As used herein, the term “probe” refers to a nucleic acid capable of specifically binding to mRNA having a length of several bases to several hundreds of bases produced through enzymatic, chemical separation, purification or synthesis. The presence or absence of mRNA can be checked by labeling radioactive isotopes or enzymes, and it can be designed and modified by a known method.

The agent capable of detecting the protein may be an antibody that specifically binds to the protein, but is not limited thereto.

As used herein, the term “antibody” includes immunoglobulin molecules having immunological reactivity with a specific antigen, and includes both monoclonal and polyclonal antibodies. The antibody also includes forms produced by genetic engineering such as chimeric antibodies (eg, humanized murine antibodies) and heterologous antibodies (eg, bispecific antibodies).

The kit for diagnosing or predicting colorectal cancer of the present invention consists of one or more other component compositions, solutions or devices suitable for the analysis method.

For example, the kit of the present invention contains genomic DNA derived from a sample to be analyzed, a primer set specific for the marker gene of the present invention, an appropriate amount of a DNA polymerase, a dNTP mixture, a PCR buffer, and water to perform PCR. It may be a kit comprising The PCR buffer solution may contain KCl, Tris-HCl and MgCl ₂ . In addition, components necessary for performing electrophoresis that can confirm whether or not the PCR product is amplified may be additionally included in the kit of the present invention.

In addition, the kit of the present invention may be a kit including essential elements necessary for performing RT-PCR. In addition to each primer pair specific for a marker gene, the RT-PCR kit includes a test tube or other suitable container, reaction buffer, deoxynucleotides (dNTPs), enzymes such as Taq-polymerase and reverse transcriptase, DNase, RNase inhibitors, DEPC -Water (DEPC-water), sterile water, etc. may be included. In addition, a primer pair specific for a gene used as a quantitative control may be included.

In addition, the kit of the present invention may be a kit including essential elements necessary for performing a DNA chip. The DNA chip kit may include a substrate to which cDNA corresponding to a gene or fragment thereof is attached as a probe, and the substrate may include cDNA corresponding to a quantitative structural gene or fragment thereof. In addition, the kit of the present invention may be in the form of a microarray having a substrate on which the marker gene of the present invention is immobilized.

In addition, the kit of the present invention may be a kit characterized in that it includes essential elements necessary for performing ELISA. The ELISA kit includes an antibody specific for a marker protein, and an agent for measuring the protein level. The ELISA kit may include a reagent capable of detecting an antibody that has formed an “antigen-antibody complex”, for example, a labeled secondary antibody, chromopores, an enzyme, and a substrate thereof. In addition, an antibody specific for the quantitative control protein may be included.

As used herein, the term “antigen-antibody complex” refers to a combination of a protein encoded by a gene and an antibody specific thereto. The amount of formation of the antigen-antibody complex can be quantitatively measured through the magnitude of the signal of the detection label. The detection label may be selected from the group consisting of an enzyme, a fluorescent substance, a ligand, a luminescent substance, a microparticle, a redox molecule, and a radioisotope, but is not limited thereto.

The present invention confirmed that PDGFRA is effective as a biomarker for diagnosing or predicting the prognosis of colorectal cancer for subjects under 40 years of age, and determining a treatment strategy in colorectal cancer patients under 40 years of age through specific examples. .

In one embodiment of the present invention, as a result of classifying 49 colorectal cancer patients into 3 groups according to age and classifying each colorectal cancer patient according to CMS, a poor prognosis in a group consisting of low-age patients under 40 years of age While the ratio of CMS4 representing (see Example 2).

In another embodiment of the present invention, genes differentially expressed between a group consisting of low-age colorectal cancer patients under 40 years of age and a group consisting of high-age patients over 61 years of age were analyzed. As a result, 180 genes with different expressions were identified only in the tumor tissues of the two patient groups, not in normal tissues, and oncogenes and cancer suppressor genes that were up-regulated or down-regulated in the younger patient group were extracted (Table 2). and 3). Furthermore, the pathways significantly changed from the differentially expressed genes were identified using a network-based pathway analysis tool, and among these pathways, the pathways related to CMS4 were found to be high in the low-age patient group, and the pathways were significantly changed in the low-age patient group. It was confirmed that it is generally related to the up-regulated PDGFRA gene (see Example 3).

In another embodiment of the present invention, as a result of analyzing the expression level of PDGFRA in the two colorectal cancer patient groups classified according to age, it has a negative correlation with the age of the patient, and the expression level is significantly higher in the lower age group of patients. It was confirmed that it increased. In addition, as a result of comparing the expression level between the two age groups in the CMS4 type sample, it was found that the expression level was higher in the younger patient group even when only the CMS4 type was considered (see Example 4).

In another embodiment of the present invention, as CMS4 is a mesenchymal type and is activated upon invasion and angiogenesis, it was analyzed whether PDGFRA is closely related to epithelial mesenchymal transition (EMT) markers and angiogenesis markers. As a result, it was confirmed that PDGFRA showed a positive correlation with the EMT marker and the angiogenesis marker (see Example 5).

In another embodiment of the present invention, as a result of measuring the expression level of PDGFRA using PDCs isolated from a low-age colorectal cancer patient and a high-age colorectal cancer patient, respectively, PDGFRA mRNA and protein were significantly increased in the low-age patient group. It was confirmed that the level was increased. Furthermore, as a result of inhibiting the expression of PDGFRA in PDCs of each patient group, cell viability was decreased in PDCs derived from patients of low age, and patients-derived from low-age patients with respect to the anticancer drug Regorafenib that targets PDGFRA. It was confirmed that only PDC showed sensitivity and decreased cell viability (see Example 6).

In another aspect of the present invention, the present invention is a sample derived from a subject under the age of 40, measuring the mRNA level of the PDGFRA (platelet derived growth factor receptor alpha; GenBank accession number: XM_006714041) gene or the protein level encoded by the gene. It provides an information providing method for diagnosing or prognosing colorectal cancer in a subject under 40 years of age, including a.

The biological sample derived from the subject may include tissue, cells, whole blood, blood, saliva, sputum, cerebrospinal fluid, urine, etc., and preferably may be tissue or cells, but is not limited thereto.

The expression level of the mRNA is determined by a conventional method known in the art, such as nucleotide sequence analysis, nanoString nCounter analysis, polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR), real-time polymerization It can be measured through one or more methods selected from the group consisting of enzyme chain reaction (Real-time PCR), RNase protection assay (RPA), microarray, and northern blotting. However, the present invention is not limited thereto.

The protein expression level is determined by a conventional method known in the art, such as western blotting, radioimmunoassay (RIA), radioimmunodiffusion, enzyme immunoassay (ELISA), immunoprecipitation. , flow cytometry, immunofluorescence, ouchterlony, complement fixation assay, or at least one method selected from the group consisting of a protein chip It may be measured through, but is not limited thereto.

As used in the present invention, the term “information providing method for diagnosis or prognosis of colorectal cancer” is a preliminary step for diagnosis or prognosis, and provides objective basic information necessary for diagnosis or prognosis of colorectal cancer, and the doctor’s Clinical judgments or findings are excluded.

As another aspect of the present invention, including a formulation measuring the level of mRNA or protein encoded by the gene of the platelet derived growth factor receptor alpha (PDGFRA; GenBank accession number: XM_006714041) gene, the colon under 40 years of age Provided is a composition for screening cancer patients customized for anticancer drugs.

In the present invention, the anticancer agent may be a PDGFRA target anticancer agent.

In addition, the present invention provides a method for selecting a customized anticancer agent for colorectal cancer patients under 40 years of age, comprising the following steps.

(a) measuring the mRNA level of the gene or protein encoded by the gene (PDGFRA; platelet derived growth factor receptor alpha; GenBank accession number: XM_006714041) from a sample derived from colorectal cancer patients under 40 years of age; and

(b) when the level of PDGFRA mRNA or the protein encoded by the gene is increased in colorectal cancer patients under 40 years of age compared to colorectal cancer patients over 61 years of age, determining a PDGFRA target anticancer agent.

In the present invention, the PDGFRA-targeted anticancer agent may preferably be Regorafenib, but if it is a substance capable of targeting PDGFRA and exhibiting a cancer therapeutic effect, the type is not limited.

Hereinafter, preferred examples are presented to help the understanding of the present invention. However, the following examples are only provided for easier understanding of the present invention, and the contents of the present invention are not limited by the following examples.

[Example]

Example 1. Experimental preparation and experimental method

1-1. Sample Collection and TCGA Colorectal Cancer Dataset

This experiment was approved by the Institutional Review Board (IRB) of Samsung Medical Center (IRB approval number SMC 2013-11-007-001), and was conducted after obtaining written consent from each patient. The experiment was conducted on 49 patients diagnosed with colorectal cancer at Samsung Medical Center in Seoul, and tumors and their matching normal tissues were obtained from surgical specimens.

Meanwhile, gene expression profiles of 594 mRNASeq colorectal adenocarcinoma (COAD) samples were obtained from cBioPortal (https://www.cbioportal.org/, TCGA, PanCancer Atlas) and used for validation experiments.

1-2. DNA and RNA isolation

Genomic DNA and RNA in tissues were purified using AllPrep DNA/RNA mini kit (Qiagen, Valencia, CA, USA). Genomic DNA from peripheral blood was extracted using the QIAamp DNA Blood Mini Kit. The concentration and purity of genomic DNA were measured using a NanoDrop 8000 UV-Vis spectrometer (Thermo Scientific Inc., Wilmington, USA) and a Qubit 2.0 Fluorometer (Life Technologies Inc., Grand Island, NY, USA). DNA degradation was estimated by measuring the average DNA size and ΔCt value with a 2200 TapeStation instrument (Agilent Technologies, CA, CA, USA) and real-time PCR (Agilent Technologies), respectively. In the case of RNA, the concentration and purity were measured with NanoDrop and Bioanalyzer (Agilent Technologies).

1-3. Whole-exome sequencing

Genomic DNA (1 μg) from each sample was digested using a Covaris S220 (Covaris, MA, USA; was built. The kit captures 335,756 exons of 21,058 genes covering -71 Mb of the human genome. After multiplexing the enriched exome library, sequencing was performed on the library on a HiSeq 2500 platform (Illumina, San Diego, CA, USA). Briefly, paired-end DNA sequencing libraries were prepared via gDNA cleavage, end repair, A-tailing, paired-end adapter ligation and amplification. After hybridization of the library with the bait sequence for 16 hours, the captured library was purified and amplified with an index barcode tag, and the library quality and quantity were measured. Sequencing was then performed in 100-bp paired-end mode of the TruSeq Rapid PE cluster kit and the TruSeq Rapid SBS kit (Illumina).

1-4. Exome-sequencing data analysis

Raw sequencing reads were aligned to the UCSC hg19 reference genome (downloaded at http://genome.ucsc.edu) using the Browserows-Wheeler Aligner (BWA) version 0.7.5a with default settings. Next, PCR duplicates were marked using Picard-tools-1.93 (http://picard.sourceforge.net/), data cleanup was performed with GATK, and variants were identified with GATK-3.5. Then, point mutations were identified with sample pairs using MuTect, variants annotated using ANNOVAR, and somatic cell count variations were identified using the Excavator tool. Genomic regions that were significantly amplified or deleted throughout the sample were detected with the GISTIC tool.

1-5. RNA sequencing

Library construction for RNA sequencing was performed with Truseq RNA Sample Preparation v2 Kit (Illumina). The isolated total RNA was used for reverse transcription with poly(dT) primers using SuperScript ^TM II reverse transcriptase (Invitrogen/Life Technologies). Briefly, RNA sequencing libraries were prepared through cDNA amplification, end repair, adenylation of the 3' end, adapter ligation and amplification. Library quality and quantity were measured using Bioanalyzer and Qubit. Sequence analysis of RNA libraries was performed in 100-bp paired-end mode of TruSeq Rapid PE Cluster Kit and TruSeq Rapid SBS Kit (Illumina).

1-6. RNA-sequencing data analysis

Reads of the FASTQ file were mapped to the hg19 human reference genome using STAR aligner version 2.5.0a, and the number of reads for each gene was corrected for transcript values per million (TPM) using the RSEM program. Differentially expressed genes (DEGs) were identified using the DESeq R package with cutoffs (|log2 fold-change|> 2 and False Discovery Rate (FDR) < 0.001). DEGs were mapped to pathways using ReactomeFI Cytoscape, and CMS in the colorectal cancer patient cohort was predicted based on gene expression profiles with the R package CMS classifier.

1-7. Organoid culture

Organoid culture medium was replaced every 2 days. To passage the organoids, the BME was digested by pipetting and the organoids were collected in tubes. The collected organoids were centrifuged at 1,000 rpm for 3 minutes, the medium was removed, 5 ml Triple Express (Invitrogen) was added, and the organoids were incubated at 37° C. for about 5 minutes. The size or organoids were checked by visual observation every minute, and care was taken not to treat the organoids with Triple Express for a long time. Next, FCS and medium were added and cells were spun at 1,500 rpm for 3 minutes, then the pellet was resuspended in BME and cells were dropped into 5-10 μl drops each. After solidifying the BME, HICS supplemented with 10 uM LY27632 (for normal organoids) or HICS without Wnt (for tumors) was added to the plate and the organoids were incubated at 37°C.

1-8. Cell transfection

For transient transfection assay, PDGFRA siRNA (#1: 5' CCUCUAUCCUUCCAAAUGAUU 3' (SEQ ID NO: 1), 5' UCAUUUGGAAGGAUGAGGUU 3' (SEQ ID NO: 2), #2: 5' CCGUCAAAGGAAAGAAGUUUU 3' (SEQ ID NO: 3), 5 'AACUUCUUUCCUUUGACGGUU 3' (SEQ ID NO: 4), Genolution, Seoul, Korea) was transfected into PDCs using lipofectamine RNAiMAX (Invitrogen, Carlsbad, CA, USA).

1-9. RT-qPCR analysis

Total RNA was extracted from patient tissues, and 500 ng RNA was reverse transcribed using a reverse transcription kit (Bioneer). Then, real-time quantitative PCR was performed with SYBR Green (ABI) using an RT-PCR system (ABI, USA). Human-specific PCR primers (Bioneer) were used to analyze the expression levels of PDGFRA and GAPDH genes, and then the mRNA level of a specific gene was calculated as ΔΔCt and corrected with GAPDH.

1-10. Cell Lysis and Western Blot Analysis

To prepare a whole cell extract, cells were lysed using a pro-prep buffer (Intron Biotechnology, Seoul, Korea) containing a protease inhibitor. SDS-PAGE was performed using a total of 10 to 40 μg of the protein extract, and the separated protein band was transferred to a polyvinylidene fluoride (PVDF) membrane. Next, after reacting the membrane with primary antibodies against PDGFRA (ab65258, Abcam) and β-actin (#3700, Cell Signaling Technology), horseradish peroxidase (HRP) was conjugated Secondary antibody was treated and incubated. At this time, β-actin was used as a loading control in Western blot.

Example 2. CMS classification according to the age of colorectal cancer patients

In order to investigate the difference in molecular characteristics between colorectal cancer patients according to age, the present inventors classified 49 colorectal cancer patients into 3 groups according to age, and more detailed information is shown in Table 1 below.

Young CRC Middle CRC Old CRC Number of subjects 13 23 13 age <=40 41 to 60 >60 gender male 5 (38.5%) 8 (34.8%) 10 (76.9%) female 8 (61.5%) 15 (65.2%) 3 (23.1%) tumor location Leader 9 (69.2%) 19 (82.6%) 12 (92.3%) rectal 4 (30.8%) 4 (17.4%) 1 (7.7%) Cell Differentiation Adenocarcinoma W/D 2 (15.4%) 1 (4.3%) 3 (23.1%) Adenocarcinoma M/D 10 (76.9%) 18 (78.4%) 9 (69.2%) Adenocarcinoma P/D 0 (0%) 3 (13.0%) 0 (0%) Mucinous carcinoma 1 (7.7%) 1 (4.3%) 1 (7.7%) stage stage II 2 (15.4%) 6 (26.1%) 1 (7.7%) Ⅲ 4 (30.8%) 2 (8.7%) 3 (23.1%) IV 7 (53.8%) 15 (65.2%) 9 (69.2%) MSI status MSS 13 (100%) 20 (87%) 13 (100%) MSI 0 (0%) 3 (13%) 0 (0%)

Specifically, the low-age group (n=13) consisted of patients younger than 40 years old, the middle-age group (n=23) was between 41 and 60 years old, and the older group (n=13) consisted of 60 patients. It consisted of patients over the age of three. After classifying the patients, each colorectal cancer patient was classified according to CMS using the gene expression profile. As a result, as shown in FIG. 1 , in the group consisting of young age patients (Young Age CRC), CMS4 (53.85%) appeared most frequently, followed by CMS3 (38.46%) and CMS2 (7.69%), followed by CMS1 No patients were classified as In the middle-age colorectal cancer patient group (Middle Age CRC), the frequency order of each CMS classification was the same as in the lower age group, but the frequencies of CMS2 (21.74%) and CMS1 (13.04%) were higher. In the group consisting of older patients (Old Age CRC), CMS4 (23.08%) had the lowest frequency, and CMS2 (38.46%) and CMS3 (38.46%) had the same frequency. As a result of the CMS classification according to the age, the frequency of CMS4 increased as the age increased, and CMS2 appeared more frequently in the older group.

Collectively, through the above results, it was found that young colorectal cancer patients were closely related to CMS4, which is considered the type with the worst prognosis, and had less correlation with CMS2, which had a better prognosis than other CMS.

Example 3. Gene profiling analysis differentially expressed between low-age and high-age colorectal cancer patients

In order to systematically identify the expression pattern of specific genes related to low-age colorectal cancer patients, we wanted to investigate differentially expressed genes using RNA sequencing data of 49 colorectal cancer tissues and adjacent normal tissues matching them. did

First, the present inventors identified age-related genes showing a significant difference between normal tissues of low-age and high-age patient groups as shown in FIG. 2a (log2 FC (fold change)≥±1, FDR≤ 0.05). In addition, by comparing the genes expressed in the tumor tissues of the two groups, genes showing differences were identified (log2 FC≥±1, FDR≤0.05). Specifically, 155 genes were differentially expressed in normal tissues and 204 genes were differentially expressed in tumor tissues. Next, as shown in FIG. 2B , among 204 genes differentially expressed in tumor tissues, 24 overlapping genes showing differences even in normal tissues were removed. As a result, 180 genes differentially expressed only in tumor tissues of the two age groups were considered as age-related genes specific for cancer. More specifically, as shown in Fig. 2c, 105 genes were significantly up-regulated among the 180 genes and the remaining 75 genes were down-regulated (log2 fold change≥±1, p-value≤0.05, FDR≤ 0.05).

Next, in order to discover cancer-related genes as biomarkers for low-age colorectal cancer patients, the present inventors extracted only oncogenes and tumor suppressor genes. As a result, as can be seen in Tables 2 and 3 below, it was found that many oncogenes and cancer suppressor genes were up-regulated or down-regulated in the low-age colorectal cancer patient group, specifically, 8 oncogenes and 6 It was confirmed that cancer suppressor genes were upregulated, and 4 oncogenes and 5 cancer suppressor genes were downregulated.

gene Fold Change q-value Cancer associate Full Name WNT11 4.33 0.012 Suppressor Gene Wnt family member 11 HSPB7 3.28 0.023 Suppressor Gene heat shock protein family B (small) member 7 FBLN1 3.14 0.001 Suppressor Gene fibulin 1 CNN1 2.94 0.037 Suppressor Gene calponin 1 CENPW 2.34 0.021 Oncogene centromere protein W LCK 2.3 0.032 Oncogene LCK proto-oncogene, Src family tyrosine kinase CLU 2.24 0.01 Suppressor Gene clusterin AQP1 2.23 0.033 Oncogene aquaporin 1 S100A4 2.22 0.019 Oncogene S100 calcium binding protein A4 TAGLN 2.22 0.031 Suppressor Gene transgelin GREM1 2.18 0.01 Oncogene gremlin 1, DAN family BMP antagonist PDGFRA 2.18 0.001 Oncogene platelet derived growth factor receptor alpha MMP12 2.18 0.028 Oncogene matrix metallopeptidase 12 SMO 2 0.028 Oncogene smoothened, frizzled class receptor

gene Fold Change q-value Cancer associate Full Name ZIC2 0.23 0.006 Oncogene Zic family member 2 PPP1R1B 0.4 0.009 suppressor gene protein phosphatase 1 regulatory inhibitor subunit 1B NDRG2 0.43 0.001 suppressor gene NDRG family member 2 [Homo sapiens] FEZF1 0.44 0.039 Oncogene FEZ family zinc finger 1 [Homo sapiens] NFIB 0.48 0.001 Oncogene nuclear factor I B ZNF292 0.48 0.001 suppressor gene zinc finger protein 292 PHLDA2 0.48 0.001 suppressor gene pleckstrin homology like domain family A member 2 CEACAM6 0.49 0.021 Oncogene carcinoembryonic antigen related cell adhesion molecule 6 CEACAM1 0.49 0.001 suppressor gene carcinoembryonic antigen related cell adhesion molecule 1

Next, using a network-based pathway analysis tool, significantly changed pathways from differentially expressed genes were identified (34 in up-regulation and 26 in down-regulation). Among these pathways, as can be seen in FIG. 2d , a number of CMS4-related pathways, ie, 'PDGFR-alpha signaling', 'positive regulation of cell proliferation by VEGF-activated platelet-derived growth factor (PDGF) receptor signaling' , 'Cytochemotaxis', 'modulation of chemotaxis', 'positive regulation of phospholipase C (PLC) activity', and 'phosphatidylinositol phosphorylation' were found to be high in the younger group of colorectal cancer patients. It is worth noting that these pathways are closely related to metastasis, angiogenesis, proliferation and chemo-resistance associated with CMS4. Also interestingly, it was confirmed that this pathway is generally associated with PDGFRA.

In addition, the present inventors identified a number of somatic mutations, including missense, nonsense, and splicing mutations, in primary colorectal tumors of colorectal cancer patients as shown in FIG. 2E . The mutation profile showed that TP53 mutations were more frequent in the younger age group (76.9%, 10/13) than in the older patient group (23%, 3/13). Moreover, as a result of comparing the copy number amplification and deletion genomic regions between the two groups, it was confirmed that the copy number was significantly deleted only in the low-age colorectal cancer patient group in chromosome 5q22.2, as shown in FIG. 2f.

Example 4. Analysis of the expression level of PDGFRA in low-age colorectal cancer patients

To investigate whether PDGFRA correlates with the age of colorectal cancer patients, the correlation between PDGFRA and age was investigated.

First, as a result of analyzing the expression level of PDGFRA according to the age of colorectal cancer patients, it was found that the expression level of PDGFRA in the corresponding cohort had a negative correlation with the age of the patient as shown in FIG. 3a (spearman's correlation coefficient; p) =0.0001, R=-0.5264). In addition, as a result of TCGA data analysis, it was confirmed that there was a consistent inverse correlation between the expression of the gene and age in colorectal cancer patients (p=0.0113, R=-0.1697). Also, when comparing the two age groups, as can be seen in Figure 3b, the expression level of PDGFRA was higher in the low-age colorectal cancer patient group than in the high-age group (p=0.0001), and the TCGA data also A similar result was obtained (p=0.2796).

Next, to verify that PDGFRA is a factor for the lower age of colorectal cancer patients, expression levels were compared between the two age groups in CMS4-type samples. As a result, as shown in Figure 3c, although the number of samples for the experiment was not statistically significant, it was confirmed that PDGFRA was expressed at a higher level in the younger group than in the older colorectal cancer patients even if only the CMS4 type was considered. (p=0.0708).

Example 5. Analysis of co-expression of PDGFRA and CMS4-related factors

CMS4 is a mesenchymal type and is activated in stromal invasion and angiogenesis. The present inventors wanted to investigate whether PDGFRA is closely related to epithelial mesenchymal transition (EMT) markers and angiogenesis markers.

First, as a result of analyzing the relationship between PDGFRA and the EMT marker, it was confirmed that the EMT markers Vim, ZEB1, ZEB2, Twist1, Twist2 and MMP2 were positively co-expressed with PDGFRA, as shown in FIG. 4a . In addition, their expression levels showed a separate distribution that differed between the two age groups. Like PDGFRA, samples identified as CMS4 showed high expression. In the case of angiogenesis markers, as shown in FIG. 4b , it was confirmed that five markers including FLT1, FLT4, ICAM1, TIE1 and KDR showed a positive correlation with PDGFRA in gene expression. In addition, the same results as above were confirmed through the TCGA data.

Example 6. PDGFRA Expression and PDGFRA-Target Drug Reactivity Analysis

In order to investigate the major role of PDGFRA in a group of young colorectal cancer patients, the present inventors conducted an experiment using cells (PDCs) derived from a low-age colorectal cancer patient and a high-age colorectal cancer patient, respectively.

First, as a result of analyzing the expression level of PDGFRA in the two groups through RT-qPCR, it was confirmed that PDGFRA was expressed at a higher level in PDCs (Young PDCs) derived from patients of lower age as shown in FIG. 5A . From the Western blot analysis result of FIG. 5B , it was found that PDGFRA protein was expressed at a significantly higher level in PDCs derived from patients of low age.

Next, we aimed to evaluate the possible role of PDGFRA in young colorectal cancer patients. Specifically, we transfected each PDC with two different siRNAs against PDGFRA to compare their proliferative capacity using a cell titer GLO proliferation assay. As a result, as shown in FIG. 5c , when PDGFRA was knocked down in PDCs (#1, #2) derived from a younger patient, cell viability was significantly reduced. In contrast, in the PDCs (#3, #4) derived from older patients, there was no change in cell viability compared to the control group.

Furthermore, in order to determine the PDGFRA-targeting drug for young colorectal cancer patients based on the above results, the correlation between drug sensitivity and gene expression was analyzed. Cancer Cell Line Encyclopedia (CCLE) data indicate that Sorafenib, which targets PDGFRA, has drug reactivity only in colorectal cancer. However, according to the results of the present invention, sorafenib did not exhibit PDGFRA expression in colorectal cancer patient-derived cells or drug reactivity differentiated according to the age of the colorectal cancer patient. Meanwhile, Regorafenib is a small molecule multi-kinase inhibitor including PDGFRA, and has recently been approved by the FDA for the treatment of metastatic colorectal cancer patients. The present inventors conducted an experiment using regorafenib in PDCs to investigate a treatment strategy for low-age colorectal cancer patients. As a result, as shown in FIG. 5d , treatment with regorafenib showed sensitivity to PDCs derived from a low-age colorectal cancer patient, whereas PDCs derived from a high-age patient did not show sensitivity to the drug. confirmed that.

The description of the present invention stated above is for illustration, and those of ordinary skill in the art to which the present invention pertains can understand that it can be easily modified into other specific forms without changing the technical spirit or essential features of the present invention. There will be. Therefore, it should be understood that the embodiments described above are illustrative in all respects and not restrictive.

<110> SAMSUNG LIFE PUBLIC WELFARE FOUNDATION <120> Age-specific biomarker of a patient with colorectal cancer and use it <130> PD20-057 <160> 4 <170> KoPatentIn 3.0 <210> 1 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> PDGFRA siRNA #1_1 <400> 1 ccucuauccu uccaaaugau u 21 <210> 2 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> PDGFRA siRNA #1_2 <400> 2 ucauuuggaa ggauagaggu u 21 <210> 3 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> PDGFRA siRNA #2_1 <400> 3 ccgucaaagg aaagaaguuu u 21 <210> 4 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> PDGFRA siRNA #2_2 <400> 4 aacuucuuuc cuuugacggu u 21

Claims (9)

PDGFRA (platelet derived growth factor receptor alpha; GenBank accession (accession) number: XM_006714041) gene or a marker composition for diagnosing or prognosing colorectal cancer in a subject under 40 years of age, comprising a gene or a protein encoded by the gene.
PDGFRA (platelet derived growth factor receptor alpha; GenBank accession (accession) number: XM_006714041) for diagnosing or prognosing colorectal cancer in subjects under the age of 40, including an agent measuring the mRNA level of the gene or protein encoded by the gene composition.
3. The method of claim 2,
The agent for measuring the mRNA level is characterized in that the sense and antisense primers or probes that complementarily bind to the mRNA of the gene, the composition.
3. The method of claim 2,
The agent for measuring the protein level is an antibody that specifically binds to the protein, the composition.
A kit for diagnosing or prognosing colorectal cancer in subjects under the age of 40, comprising the composition of claim 2 .
A method for selecting a customized anticancer drug for colorectal cancer patients under the age of 40, comprising the following steps:
(a) measuring the mRNA level of the gene or protein encoded by the gene (PDGFRA; platelet derived growth factor receptor alpha; GenBank accession number: XM_006714041) from a sample derived from colorectal cancer patients under 40 years of age; and
(b) determining the PDGFRA target anticancer agent when the level of PDGFRA mRNA or the protein encoded by the gene is enhanced in colorectal cancer patients under 40 years of age compared to colorectal cancer patients over 61 years of age.
7. The method of claim 6,
The PDGFRA target anticancer agent, characterized in that the regorafenib (Regorafenib), screening method.
7. The method of claim 6,
The expression level of the mRNA is nucleotide sequence analysis, nanoString nCounter analysis, polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR), real-time polymerase chain reaction (Real-time PCR) ), RNase protection assay (RPA), microarray (microarray), characterized in that measured through one or more methods selected from the group consisting of northern blotting (northern blotting), the selection method.
7. The method of claim 6,
The protein expression level was determined by western blotting, radioimmunoassay (RIA), radioimmunodiffusion, enzyme immunoassay (ELISA), immunoprecipitation, flow cytometry, Immunofluorescence (immunofluorescence), ouchterlony (ouchterlony), complement fixation assay (complement fixation assay), characterized in that measured through one or more methods selected from the group consisting of a protein chip (protein chip), selection method.

Images