KR102286636B1 - Novel microalgae having high productivity for loliolide - Google Patents

Abstract

The present invention relates to a novel microalgae with high loliolide productivity, and HS4 (Scenedesmus sp. HS4) of the present invention has high biomass productivity and a high content of loliolide. It can be used as a biological resource that can be produced, and it can be used in pharmaceutical or cosmetic compositions requiring loliolide derived from HS4 of the genus Senedesmus.

Description

New microalgae with high productivity of loliolide {Novel microalgae having high productivity for loliolide}

The present invention relates to microalgae of the genus Senedesmus characterized by excellent growth rate and high loliolide content.

Since the skin is the outermost organ in the human body, it is constantly directly affected by various air pollutants or physical stimuli, especially sunlight including ultraviolet rays, and is exposed to external stimuli compared to other organs. It is a fragile organ. Cells constituting the skin by such external stimuli may experience cellular aging such as inhibition of cell growth and necrosis due to various causes, and the fibrous proteins present in the skin cells may be destroyed or reduced in synthesis. It can cause wrinkles on the skin.

The aging phenomenon of the skin is chronological aging (intrinsic aging), which is a natural aging that appears over time according to biological processes, and photoaging (photogenic aging) in which degenerative changes that occur in areas exposed to sunlight and the chronological aging are combined. aging) can be distinguished. When the expression or activity of various factors related to cell growth is inhibited, natural cell aging may occur, and photoaging of skin cells may proceed by light with a wavelength of 280 nm to 400 nm included in sunlight. Among them, damage to the skin or fibers may occur due to irradiation of ultraviolet rays such as UVB having a wavelength in the range of 280 nm to 320 nm, and soot phenomenon may occur in which the skin is charred. When UVB is irradiated, the accumulation of ROS and free radicals in the skin cells is promoted, and the intracellular signaling system is stimulated by the radicals to induce oxidative stress on biomolecules such as DNA, proteins, and lipids, which in turn causes skin tissue damage may occur.

When the oxidative stress of skin cells increases, stimulation occurs in keratinocytes of the epidermis or fibroblasts of the dermis, and through a series of intracellular signal transduction processes, the expression of genes such as matrix metalloproteinase (MMP), a collagen degrading enzyme, is increased. As a major component of the skin, it occupies 90% of the dermis and gives strength and tension to the skin, thereby causing a decrease in collagen, which protects the skin from external stimuli or force. or wrinkles may form. Therefore, it is possible to prevent aging of skin cells and to improve wrinkles by regulating the expression of genes involved in the synthesis or degradation of fibrous proteins such as collagen.

Cell aging according to the irradiation of ultraviolet rays contained in sunlight not only causes cosmetic problems due to damage to the skin, but also causes DNA damage in cells to cause cancer or skin diseases. As a result, serious health problems may occur, and solutions are needed.

In relation to the above problems, as the living standards of consumers improve, consumers' interest in skin aging problems and health is also increasing, so research to develop medicines or cosmetics to prevent and improve skin aging is active, There are attempts to improve skin aging and wrinkles by using extracts extracted from natural materials such as plants. Retinol (vitamin A), AHA (a-hydroxy acid), adenosine, etc. increase the synthesis of collagen, a fiber protein, and It is widely used as a material that contributes to skin regeneration by normalizing the keratinization process of the epidermis, but such materials are known to have problems in that they are unstable to light and heat and cause irritation to the skin.

On the other hand, loliolide is known as a material mainly synthesized from plants or macroalgae, and it is found in Phyllanthus urinaria and is known as a substance having an activity to inhibit the penetration of hepatitis C virus (HCV). , It has been reported as a substance with antioxidant activity in the marine macroalgae, Sargassum ringgoldianum. However, in freshwater microalgae, it is only known that there is a thing containing loliolide in the extract, and there is no report on an attempt to synthesize a large amount of loliolide with high efficiency using the freshwater microalgae as described above.

In addition, the genus Senedesmus ( Scenedesmus ) is classified as a green algae, and belongs to the Chlorophyta order and Chlorophyceae family according to the classification system, and there are 4-8 unit cells attached to it. Senedesmus is evenly distributed in freshwater all over the world, and it is known that the content of lipids in the body is 20-30%. Although the conversion of Senedesmus-derived lipids into biodiesel has been studied, further research is needed on its use as a raw material for pharmaceuticals or cosmetics related to skin beauty or skin health.

The present invention provides a novel microalgae with excellent productivity that can produce loliolide with higher efficiency, which has the effect of preventing and improving skin aging by increasing the synthesis of fiber protein in skin cells, compared to the previously known microalgae. intended to provide

In addition, an object of the present invention is to provide a pharmaceutical composition for preventing and improving skin aging by using the novel microalgae extract as described above.

In addition, an object of the present invention is to provide a cosmetic composition for preventing and improving skin aging by using the novel microalgae extract as described above.

In order to achieve the above object, one aspect of the present invention provides a Senedesmus genus HS4 ( Scenedesmus sp. HS4) deposited with accession number KCTC 13784BP.

Another aspect of the present invention provides a pharmaceutical composition for preventing and improving skin aging, comprising, as an active ingredient, an extract or a fraction thereof of Senedesmus genus HS4 deposited with accession number KCTC 13784BP.

Another aspect of the present invention provides a cosmetic composition for preventing and improving skin aging, comprising, as an active ingredient, an extract of Senedesmus genus HS4 deposited with accession number KCTC 13784BP or a fraction thereof.

Another aspect of the present invention provides a composition for preventing skin aging, including loliolide produced from HS4 of the genus Senedesmus deposited with accession number KCTC 13784BP.

HS4 of the genus Senedesmus, newly improved in the present invention, has the characteristics of accumulating a high content of loliolide in cells compared to other previously published microalgae, and excellent organic carbon catabolism efficiency, even under conditions in which light is not given. It can grow and can be cultured at a fast growth rate to ensure high biomass productivity and loliolide productivity. This high productivity of loliolide provides the possibility of lowering the production cost of loliolide by culturing the microalgae of the present invention in large quantities. expected.

However, the effects of the present invention are not limited to the above-mentioned effects, and other effects not mentioned will be clearly understood by those skilled in the art from the following description.

1 shows the genus Senedesmus HS4 ( Scenedesmus sp. HS4) of the present invention.
2 is a diagram showing the principle of the adaptive evolution induction process for improving the HS4 microalgae of the genus Senedesmus of the present invention. It is about a method of culturing by gradually decreasing the amount of light irradiation and increasing the concentration of organic carbon in the medium as the microalgae are cultured.
3 is a photo-culture condition ('Photo' in FIG. 3), subculture conditions ('Hetero' in FIG. 3), mixed culture conditions ('Mixo' in FIG. 3), respectively, for the HS4 microalgae of the genus Senedesmus of the present invention. shows a graph of the growth curve cultured for 7 days and a photograph of the culture medium.
4a to 4e show the NMR spectroscopic analysis results for elucidating the chemical structure of the active ingredient in the HS4 microalgae extract of the genus Senedesmus of the present invention, respectively, ¹ H NMR, ¹³ C NMR, ¹ H- ¹ H COSY, HMQC and HMBC spectrum measurement results.
Figure 5a shows the ESI-mass spectrum measurement results for measuring the molecular weight of the active ingredient in the HS4 microalgae extract of the genus Senedesmus of the present invention.
Figure 5b is the chemical structure of the active ingredient Loriolide in the HS4 microalgae extract of the genus Senedesmus of the present invention, which was identified based on the results of Figures 4a to 4e and Figure 5a.
Figure 6a is an LC analysis result of the purified Loriolide and a quantitative line prepared using the same, Figure 6b is a LC analysis result of the HS4 microalgae extract of the genus Senedesmus of the present invention using the quantitative line of Figure 6a .
Figure 7 compares the biomass production of HS4 microalgae of the genus Senedesmus of the present invention in heteroculture (Hetero) and mixed culture (Mixo) with the photocultured Senedesmus genus JD052 microalgae, and in the extract of the microalgae It is a graph showing the comparison of the content of loliolide.
8 is a graph comparing human dermal fibroblasts with loliolide separated and purified from HS4 microalgae of the genus Senedesmus by concentration, measuring and comparing the cell viability of the cells.
FIG. 9 is a graph comparing human dermal fibroblasts irradiated with ultraviolet (UVB) light by treatment with loliolide separated and purified from HS4 microalgae of the genus Senedesmus for each concentration, and the cell viability of the cells is measured and compared. As a control group, human dermal fibroblasts that were not irradiated with ultraviolet light and were not treated with loliolide were targeted.
10 is a qRT-PCR of the expression level of the Col1A1 gene expressed in human dermal fibroblasts irradiated with ultraviolet (UVB) light by treatment with loliolide separated and purified from HS4 microalgae of the genus Senedesmus for each concentration. It is a graph measured through As a control group, human dermal fibroblasts that were not irradiated with ultraviolet light and were not treated with loliolide were targeted.
11 is a qRT-PCR of the expression level of MMP1 gene expressed in human dermal fibroblasts irradiated with ultraviolet (UVB) light by treatment with loliolide separated and purified from HS4 microalgae of the genus Senedesmus for each concentration. It is a graph measured through As a control group, human dermal fibroblasts that were not irradiated with ultraviolet light and were not treated with loliolide were targeted.

Hereinafter, the present invention will be described in detail.

1. New Senedesmus genus microalgae

The present invention provides microalgae in the novel microalgae.

The novel microalgae of the present invention is the genus Senedesmus HS4 ( Scenedesmus sp. HS4) deposited with accession number KCTC 13784BP.

The Senedesmus genus HS4 is the microalga Scenedesmus sp. The base sequence is the same as that of JD052, and considering the morphological characteristics of the cell, it was classified as belonging to the genus Senedesmus, and it was specifically named HS4.

The Senedesmus genus HS4 maximizes the efficiency of catabolism using organic carbon, so when culturing the Senedesmus genus HS4 in a culture medium containing glucose, photoautotrophic culture, a general method of culturing microalgae ), it shows a high cell growth rate compared to the method and has excellent biomass productivity.

The Senedesmus genus HS4 can be cultured even in culture conditions in which light is not given. Even when culturing under heterotrophic culture conditions that exclude light and only organic carbon is given, it can grow at a growth rate similar to that of culturing under mixed culture conditions that provide both light and organic carbon. there is a characteristic

In particular, the Senedesmus genus HS4 can produce a very high content of loliolide, the conventional microalgae Scenedesmus sp. Even in comparison with JD052, the loliolide productivity of the Senedesmus genus HS4 is superior. The Senedesmus genus JD052 microalgae is known to have better productivity of loliolide compared to other types of microalgae. Compared to all of the JD052 microalgae, the productivity of biomass and loriolide is significantly improved. Therefore, by producing the loliolide using the Senedesmus genus HS4 of the present invention, it is possible to replace the process or system used for the production of the loliolide.

In a specific embodiment of the present invention, HS4 of the genus Senedesmus is cultured under heterotrophic conditions in which only organic carbon (glucose) is provided and light is not given, and mixed culture that provides both organic carbon and light (mixotrophic) culture) conditions and cultured under the photoautotrophic culture conditions commonly used for culturing microalgae, it was confirmed that the growth rate was the fastest in the mixed culture condition and the high growth rate even in the subculture condition. It was confirmed that, unlike microalgae, it has the characteristics of being able to grow even in the absence of light. Specifically, as the HS4 microalgae of the Senedesmus genus were cultured for 7 days in a medium containing 10 g/L of glucose as an organic carbon source and 1 g/L of yeast extract in the absence of light, the cell concentration was 5.9 g It can grow to a level of /L and biomass productivity can reach about 0.81 g/L/day. Therefore, when irradiated with light of 50 μmol·m ^-2 ·s ^-1 and cultured for 7 days in a medium containing the same amount of glucose and yeast extract as described above, the cell concentration is about 5.65 g/L and the bio Compared with the mass productivity of about 0.91 g/L/day, there is a characteristic that it can grow at a level similar to that in the case of culturing under the light condition even in the absence of light.

In addition, according to a specific embodiment of the present invention, as a result of culturing Senedesmus genus HS4 microalgae and Senedesmus genus JD052 microalgae under the above culture conditions, respectively, subculture and mixing compared to light-cultured JD052 microalgae It was confirmed that the growth rate of the cultured HS4 was much better, and thus the productivity of biomass was high. As a result of confirming the content of loliolide, the productivity of loliolide was also about 2 to 4 times compared to the conventional JD052 microalgae. was confirmed to be high.

2. Pharmaceutical composition for preventing and improving skin aging

The present invention provides a pharmaceutical composition for preventing and improving skin aging.

The pharmaceutical composition for preventing and improving skin aging according to an aspect of the present invention includes an extract of the genus Senedesmus HS4 (Scenedesmus sp. HS4) deposited with the accession number KCTC 13784BP or a fraction thereof as an active ingredient.

In addition, the pharmaceutical composition for preventing and improving skin aging according to another aspect of the present invention includes loliolide as an active ingredient, and in particular, the loliolide is Senedesmus HS4 ( Scenedesmus) deposited with the accession number KCTC 13784BP. sp. HS4) may be produced.

The extract of the Senedesmus genus HS4 ( Scenedesmus sp. HS4, KCTC 13784BP) may exhibit an effective effect in preventing and improving skin aging. The skin aging may be natural aging or photoaging of skin cells, and wrinkles, fine lines, reduction of skin elasticity and/or tension, wrinkling, thinning, loss of gloss and gloss, etc. of the skin that may be caused by skin aging It may be physiological and/or actinic aging, and may be external skin changes due to aging, such as internal skin degradation in which the dermis is thinned by exposure to ultraviolet rays, in particular, degradation of collagen fibers.

The extract of HS4 microalgae in the Senedesmus genus has the effect of inhibiting the aging of skin cells, so in particular, it improves skin wrinkles and increases skin elasticity, thereby maintaining a good skin condition in terms of beauty and skin health. It protects skin cells from UV rays and can suppress the negative effects on the skin caused by UV rays.

The extract of HS4 microalgae of the genus Senedesmus contains loliolide as an active ingredient. The loliolide is a substance having an antioxidant activity and thus has an effect of preventing or improving skin cell aging. Specifically, loliolide acts on skin cells to promote the expression of a collagen synthesis gene, such as Col1A1 gene, which is a type of fibrous protein constituting skin cells, and suppresses the expression of a collagenase gene, such as MMP1 gene, which degrades collagen. As it increases the amount of collagen, it has the activity of improving the wrinkles of the skin. In addition, loliolide improves cell viability by improving the decrease in the survival rate of skin cells caused by ultraviolet rays or the decrease in the amount of collagen as described above, and by increasing the amount of collagen, it is possible to restore the negative effect of the skin cells by ultraviolet rays. can

The loliolide may be included in the composition at a concentration of 1 μg/ml to 25 μg/ml. Specifically, the loliolide is 2 μg/ml to 23 μg/ml, 3 μg/ml to 20 μg/ml, 5 μg/ml to 18 μg/ml, 5 μg/ml to 15 μg/ml in the composition, Alternatively, it may be included at a concentration of 5 μg/ml to 10 μg/ml. When the loliolide is included in a concentration within the above range based on the entire composition, the composition suppresses a decrease in cell viability due to ultraviolet rays without being toxic to the treated cells, and effectively suppresses the expression of collagen-related genes. It has the effect of increasing the amount of collagen production by controlling it.

In a specific embodiment of the present invention, the chemical structure of the active ingredient in the extract of the Senedesmus genus HS4 microalgae was ^{analyzed by NMR spectroscopy including 1} H NMR, ¹³ C NMR, ¹ H- ¹ H COSY, HMQC and HMBC spectra. Through analysis, it was confirmed that the extract of the present invention contains loliolide as an active ingredient by measuring the molecular weight of the active ingredient through the ESI-mass spectrum and comparing it with the existing database.

In a specific embodiment of the present invention, loliolide does not exhibit cytotoxicity to human dermal fibroblasts up to a concentration of 20 μg/ml, and restores the cell viability of the human dermal fibroblasts, which is reduced by irradiation with ultraviolet rays. It was confirmed that there is activity. In addition, it was confirmed that the expression of the collagen gene ( Col1A1 ) was promoted according to the treatment of the loliolide and had the activity of inhibiting the expression of the collagenase gene ( MMP1 ).

The extract is culturing the Senedesmus genus HS4; drying the cultured HS4 of the genus Senedesmus to obtain a dried product; and extracting an organic solvent into the obtained dried product.

The step of culturing HS4 in the Senedesmus is a medium having a composition consisting of a temperature condition of 20 ° C to 30 ° C, glucose 5 g / L to 15 g / L and an enzyme extract 0.5 g / L to 1.5 g / L, light It may be carried out under conditions that are not irradiated. In addition, in addition to the above conditions, it may be carried out under conditions in which light is irradiated with a luminous intensity of ^{30 μmol·m -2} ·s ^-1 to 100 μmol·m ^-2 ·s ^-1. When cultured outside the temperature range or in a lower range than the glucose concentration contained in the medium, the growth rate of HS4 in Senedesmus genus is significantly reduced, so the obtained biomass may decrease, and antioxidant and skin anti-aging effects Since the production of substances (eg, loliolide) representing

When the extract is obtained by extracting from the raw material, a solvent extraction method or a reflux extraction method may be used as an extraction method, for example, all conventional extraction methods known in the art such as ultrasonic extraction and filtration may be used. The extraction process may be repeated several times, and thereafter, a step such as concentration or freeze-drying may be additionally performed. Specifically, the obtained extract is concentrated under reduced pressure to obtain a concentrate, and after freeze-drying the concentrate, a high concentration extract powder can be prepared using a grinder.

When the extract is obtained by extracting from the raw material, the extraction process may be repeated several times, and thereafter, a method such as concentration or freeze-drying may be additionally performed. Specifically, the obtained extract is concentrated under reduced pressure to obtain a concentrate, and after freeze-drying the concentrate, a high concentration extract powder can be prepared by using a grinder.

When extracting the extract, the solvent may be water, an organic solvent, or a mixture thereof. The organic solvent may be ethyl acetate, for example, alcohol, hexane (n-hexane), ether, glycerol, propylene glycol, butylene glycol, methyl acetate, dichloromethane, chloroform, or benzene, but may be limited thereto no. The extract of HS4 of the Senedesmus genus is at least one organic solvent selected from the group consisting of lower alcohols having 1 to 5 carbon atoms, acetone, acetonitrile, ethyl acetate, chloroform, dichloromethane, ethyl ether, xylene and hexane, water or It may be extracted with a mixture thereof.

The extract of Senedesmus genus HS4 may be further fractionated, and the fraction obtained as described above may also be used as an active ingredient in the pharmaceutical composition for preventing and improving skin aging of the present invention.

In order to increase the content of loliolide, the extract of HS4 of the genus Senedesmus may be fractionated to obtain a fraction of HS4 of the genus Senedesmus. The solvent that can be used in preparing the fraction may be an organic solvent such as ethyl acetate, acetone, acetonitrile, chloroform, dichloromethane, ethyl ether, xylene, hexane, and combinations thereof, but is not limited thereto.

In addition, the fraction of the present invention may be obtained by performing a conventional fractionation process in addition to concentrate the loliolide content to obtain a fraction. For example, a fraction obtained by passing the extract of Senedesmus genus HS4 according to the present invention through an ultrafiltration membrane having a constant molecular weight cut-off value, various chromatography (prepared for separation according to size, charge, hydrophobicity or affinity) The active fraction obtained through various purification methods additionally carried out such as separation by ) is also included in the fraction of the present invention.

The active fraction is a fraction having a higher loliolide content separated from the fraction, and is also referred to as an active fraction or an active fraction. A specific active fraction having a higher loliolide content is prepared by separating according to the nature of the active ingredient through concentration gradient column chromatography, etc. among the fractions in which various components obtained through a conventional fractionation process such as systematic fractionation are mixed can do. The column chromatography is performed by column chromatography using a filler selected from the group consisting of silica gel, Sephadex, LH-20, ODS gel, RP-18, polyamide, Toyopearl and XAD resin to separate the active fraction and purification, and column chromatography may be performed several times by selecting an appropriate filler as needed, but is not limited thereto. In using the chromatography, the elution solvent, elution rate, and elution time may be applied to a solvent, rate, or time generally used in the art.

On the other hand, the pharmaceutical composition comprising the extract or a fraction thereof of the present invention as an active ingredient is a pharmaceutically acceptable carrier and It may be prepared in a unit dose form by formulating using an excipient or by internalizing it in a multi-dose container. In this case, the formulation may be in the form of a solution, suspension or emulsion in oil or an aqueous medium, or may be in the form of an extract, powder, granule, tablet, capsule, or gel (eg, hydrogel), and may additionally include a dispersant or stabilizer. there is.

In addition, the extract or fraction thereof included in the pharmaceutical composition may be delivered in a pharmaceutically acceptable carrier such as colloidal suspension, powder, saline, lipid, liposome, microspheres, or nanospherical particles. there is. They may form complexes with, or be associated with, a vehicle and are known in the art such as lipids, liposomes, microparticles, gold, nanoparticles, polymers, condensation reagents, polysaccharides, polyamino acids, dendrimers, saponins, adsorption enhancing substances or fatty acids. It can be delivered in vivo using known delivery systems.

In addition, pharmaceutically acceptable carriers include lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia, gum, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, which are commonly used in the formulation. polyvinyl pyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate and mineral oil, and the like. In addition, it may further include a lubricant, a wetting agent, a sweetening agent, a flavoring agent, an emulsifying agent, a suspending agent, a preservative, etc. in addition to the above components.

The pharmaceutical composition according to the present invention may be administered orally or parenterally during clinical administration, and may be used in the form of general pharmaceutical formulations. That is, the pharmaceutical composition of the present invention may be administered in various oral and parenteral formulations during actual clinical administration. In the case of formulation, commonly used fillers, extenders, binders, wetting agents, disintegrants, diluents such as surfactants, etc. or using an excipient. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, and the like, and such solid preparations include at least one excipient, for example, starch, calcium carbonate, sucrose or It is prepared by mixing lactose, gelatin, etc. In addition to simple excipients, lubricants such as magnesium stearate talc are also used. Liquid formulations for oral administration include suspensions, solutions, emulsions, syrups, etc. In addition to commonly used simple diluents such as water and liquid paraffin, various excipients such as wetting agents, sweeteners, fragrances, and preservatives may be included. there is. Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories. Non-aqueous solvents and suspensions may include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. As the base of the suppository, Witepsol, Macrogol, Tween 61, cacao butter, laurin fat, glycerol, gelatin, etc. may be used.

The effective dosage of the extract of Senedesmus genus HS4 or a fraction thereof of the present invention depends on factors such as formulation method, administration method, patient's age, weight, sex, morbidity, food, administration time, administration route, excretion rate, and reaction sensitivity. Although it may vary depending on the patients, it is generally 1 to 20 mg/day, preferably 5 to 10 mg/day, per kg of body weight of an adult patient, several times a day at regular intervals according to the judgment of a doctor or pharmacist , It may be administered in divided doses, preferably 2 to 3 times a day.

3. Cosmetic composition for preventing and improving skin aging

The present invention provides a cosmetic composition for preventing and improving skin aging.

The cosmetic composition for preventing and improving skin aging according to one aspect of the present invention includes an extract of the genus Senedesmus HS4 (Scenedesmus sp. HS4) deposited with the accession number KCTC 13784BP or a fraction thereof as an active ingredient.

In addition, the cosmetic composition for preventing and improving skin aging according to another aspect of the present invention includes loliolide as an active ingredient, and in particular, the loliolide is HS4 ( Scenedesmus sp) of the genus Senedesmus deposited with the deposit number KCTC 13784BP. HS4).

The loliolide may be included in the composition at a concentration of 1 μg/ml to 25 μg/ml. Specifically, the loliolide is 2 μg/ml to 23 μg/ml, 3 μg/ml to 20 μg/ml, 5 μg/ml to 18 μg/ml, 5 μg/ml to 15 μg/ml in the composition, Alternatively, it may be included at a concentration of 5 μg/ml to 10 μg/ml. When the loliolide is included in a concentration within the above range based on the entire composition, the composition suppresses a decrease in cell viability due to ultraviolet rays without being toxic to the treated cells, and effectively suppresses the expression of collagen-related genes. It has the effect of increasing the amount of collagen production by controlling it.

The production method of the extract or fraction of the Senedesmus genus HS4 (Scenedesmus sp. HS4) is omitted since it was described in the method of "2. Pharmaceutical composition for preventing and improving skin aging".

The cosmetic composition of the present invention may include a cosmetically effective amount of the extract or fraction and a cosmetically acceptable carrier, and the cosmetically effective amount is used to achieve the aforementioned skin aging prevention and improvement effect. means a sufficient amount.

The cosmetic composition of the present invention further contains, for example, other ingredients having a characteristic that can give a synergistic effect on the activity of the extract or fraction within a range that does not affect the skin aging prevention and improvement activity of the extract or fraction. can do. For example, fatty substances, organic solvents, solubilizers, thickening and gelling agents, emollients, antioxidants, suspending agents, stabilizers, foaming agents, fragrances, surfactants, water, ionic or nonionic emulsifiers, Cosmetics such as fillers, sequestering and chelating agents, preservatives, vitamins, blocking agents, wetting agents, essential oils, dyes, pigments, fragrances, hydrophilic or lipophilic actives, lipid vesicles or any other ingredients commonly used in cosmetics, etc. However, it may contain adjuvants commonly used in the field of dermatology, and the ingredients may be contained in an amount generally used in the field of cosmetics or dermatology.

The cosmetic composition of the present invention may be prepared in any formulation conventionally prepared in the art, for example, a solution, suspension, emulsion, gel, lotion, essence, cream, powder, soap, shampoo, rinse, It can be formulated as a cosmetic such as a pack mask, surfactant-containing cleansing, cleansing foam, cleansing water, oil, liquid foundation, cream foundation, or spray.

When the formulation is a solution or emulsion, a solvent, solubilizer or emulsifier may be used as a carrier component, for example, water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1 ,3-Butylglycol oil, glycerol aliphatic ester, polyethylene glycol or fatty acid ester of sorbitan may be used. When the formulation is a suspension, as a carrier component, water, a liquid diluent such as ethanol or propylene glycol, ethoxylated isostearyl alcohol, a suspending agent such as polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester, aluminum metahydrox Seed, microcrystalline cellulose, bentonite, agar or tracanth and the like can be used. When the formulation is a cream or gel, wax, paraffin, tracanth, animal oil, starch, cellulose derivative, silicone, bentonite, polyethylene glycol, silica, zinc oxide or talc may be used as a carrier component. When the formulation is a powder or a spray, a propellant such as silica, talc, aluminum hydroxyl group, lactose, calcium silicate, chlorofluorohydrocarbon, propane/butane or dimethyl ether may be included as a carrier component. When the formulation is a surfactant-containing cleansing agent, aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, imidazolinium derivative, isethionate, methyltaurate, sarcosinate, fatty acid amide ether sulfate as carrier ingredients , aliphatic alcohols, alkylamidobetaines, fatty acid glycerides, fatty acid diethanolamide, vegetable oil, lanolin derivatives, or ethoxylated glycerol fatty acid esters may be used.

4. Composition for preventing and improving skin aging

The present invention provides a composition for preventing and improving skin aging.

The composition for preventing and improving skin aging according to one aspect of the present invention includes loliolide produced from Senedesmus genus HS4 ( Scenedesmus sp. HS4) deposited with accession number KCTC 13784BP.

The description of the Senedesmus genus HS4 (Scenedesmus sp. HS4) is the same as that described in "1. New Senedesmus genus microalgae", so the description will be omitted.

Culturing the loliolide HS4 in the Senedesmus; drying the cultured HS4 of the genus Senedesmus to obtain a dried product; adding an organic solvent to the obtained dried product and extracting; and separating the loliolide from the extract. Description of the culturing, drying, extraction steps, etc. are the same as those described in "2. Pharmaceutical composition for preventing and improving skin aging", and thus description is omitted.

The loliolide may be included in the composition at a concentration of 1 μg/ml to 25 μg/ml. Specifically, the loliolide is 2 μg/ml to 23 μg/ml, 3 μg/ml to 20 μg/ml, 5 μg/ml to 18 μg/ml, 5 μg/ml to 15 μg/ml in the composition, Alternatively, it may be included at a concentration of 5 μg/ml to 10 μg/ml. When the loliolide is included in a concentration within the above range based on the entire composition, the composition suppresses a decrease in cell viability due to ultraviolet rays without being toxic to the treated cells, and effectively suppresses the expression of collagen-related genes. It has the effect of increasing the amount of collagen production by controlling it.

In a specific embodiment of the present invention, loliolide does not exhibit cytotoxicity to human dermal fibroblasts up to a concentration of 20 μg/ml, and restores the cell viability of the human dermal fibroblasts, which is reduced by irradiation with ultraviolet rays. It was confirmed that there is activity. In addition, it was confirmed that the expression of the collagen gene ( Col1A1 ) was promoted according to the treatment of the loliolide and had the activity of inhibiting the expression of the collagenase gene ( MMP1 ).

The loliolide may exhibit an effective effect in preventing and improving skin aging. The skin aging may be natural aging or photoaging of skin cells, and wrinkles, fine lines, reduction of skin elasticity and/or tension, wrinkling, thinning, loss of gloss and gloss, etc. of the skin that may be caused by skin aging It may be physiological and/or actinic aging, and may be external skin changes due to aging, such as internal skin degradation in which the dermis is thinned by exposure to ultraviolet rays, in particular, degradation of collagen fibers.

Since the loliolide has an effect of inhibiting the aging of skin cells, it can improve skin wrinkles and increase skin elasticity to maintain a good skin condition in terms of beauty or skin health, and protect skin cells from UV rays. It protects and can suppress the negative effects on the skin caused by UV rays.

The composition can be used as a pharmaceutical composition or a cosmetic composition, and the related description is the same as described in "2. Pharmaceutical composition for preventing and improving skin aging" and "3. Cosmetic composition for preventing and improving skin aging" Therefore, the description is omitted.

Hereinafter, the present invention will be described in detail by way of Examples.

However, the following examples specifically illustrate the present invention, and the content of the present invention is not limited by the following examples.

[Example 1] Improvement of HS4 microalgae in Senedesmus

In order to make a novel microalgae with high catabolism efficiency for organic carbon without being dependent on light, an improved HS4 microalgae of the genus Senedesmus was created by inducing adaptive evolution for light sources and organic carbon. As the parent strain for improvement, JD052 microalgae of the genus Senedesmus (Accession No. KCTC 1899P), which is one of the microalgae capable of producing Loriolide, was used, and the genus JD052 of Senedesmus was isolated from the water system in clean areas around Jeolla-do. what was used was The concentration of JD052 microalgae in the Senedesmus genus was changed while providing organic carbon and culturing by changing the amount of light irradiation. In order to develop microalgae capable of growing even in the absence of light, adaptive evolution was induced by culturing the microalgae in the light culture medium of the existing microalgae, increasing the concentration of glucose in the medium and gradually decreasing the amount of light irradiation. (See Fig. 2).

Specifically, Senedesmus genus JD052 was cultured in a medium composed of the composition shown in Table 1 below in which bacteria were removed. The medium was used by increasing the content of _{K 2} HPO ₄ in the BG11 medium from 0.04 g to 0.2 g. The initial light dose is 50 μmol·m ^-2 ·s ^-1 , the glucose concentration is initially 0 g/L, and the culture is for 1 month, the light dose is 30 μmol·m ^-2 ·s ^-1, and the glucose concentration is Incubated for 1 month under the condition of 0.1 g/L, the light irradiation amount was 15 μmol·m ^-2 ·s ^-1, and the glucose concentration was 1 g/L for 1 month, and the light irradiation amount was 5 μmol·m ^-2 s ^-1 and glucose concentration of 5 g/L for 1 month, and finally incubated for 1 month under conditions of light irradiation dose of 0 μmol m ^-2 s ^-1 and glucose concentration of 10 g/L . It was cultured at a temperature of 25°C, and the colonies with the fastest colony production rate were selected on an agar plate for one month under each of the above conditions, and then subcultured again on the plate under the following conditions to grow even in the absence of light. This is possible and a novel microalgae with excellent organic carbon catabolism efficiency was obtained.

As a result of the nucleotide sequence analysis of the microalgae obtained through the above method, the nucleotide sequence of JD052 and 18s rRNA of the genus Senedesmus used as the parent strain was the same, but it was possible to grow only with organic carbon even in the absence of light. Therefore, it was named as a novel Senedesmus genus HS4.

Composition of BG11 modified medium Content (g/L) NaNO ₃ 1.5 K ₂ HPO ₄ 0.2 MgSO ₄ 7H ₂ O 0.075 CaCl ₂ ·2H ₂ O 0.036 Citric acid 0.006 Ferric ammonium citrate 0.006 EDTA (disodium salt) 0.001 Na ₂ CO ₃ 0.02 NaNO ₃ 1.5 Agar 10.0 trace ingredients H ₃ BO ₃ 0.00286 MnCl ₂ 4H ₂ O 0.00181 ZnSO ₄ 7H ₂ O 0.000222 NaMoO ₄ ·2H ₂ O 0.00039 CuSO ₄ ·5H ₂ O 0.000079 Co(NO ₃ ) ₂ 6H ₂ O 0.0000494

[Example 2] Confirmation of growth curve according to culture conditions

In order to confirm the growth pattern according to the culture conditions of the improved Senedesmus genus HS4 microalgae obtained through Example 1, the Senedesmus genus HS4 was subjected to heterotrophic culture (heterotrophic culture, culture conditions in which organic carbon is given) , photoautotrophic culture (culture conditions in which light is given) and mixed culture (mixotrophic culture, culture conditions in which both organic carbon and light are given) were cultured under different culture conditions, respectively.

Specifically, in the case of subculture conditions, 350 ml of a culture solution containing 10 g/L of glucose and 1 g/L of yeast extract added to the sterilized medium (pH 7.1) composed of the composition of Table 1 above was added to 25 in a 1L flask. ℃ condition, the HS4 of the genus Senedesmus of the present invention was cultured for 7 days. The initial inoculation amount of the HS4 was 0.2 g/L. In the case of light culture conditions, other conditions were the same as those of the subculture conditions, but a medium except for glucose and yeast extract was used, and culture was performed by irradiating light with an ^{amount of light of 50 μmol·m -2} ·s ^-1. In the case of the mixed culture condition, in addition to the same conditions as in the case of the subculture condition, light of 50 μmol·m ^-2 ·s ^-1 was irradiated and cultured. During the culture process, the cell weight of the microalgae of each condition was measured every day.

As a result, as shown in Table 2 below, the growth rate was the fastest in the mixed culture condition in which both light and organic carbon were given, and even when cultured in the subculture condition, it grew at a similar level, although slower than the mixed culture, in the light culture condition. It showed a significantly higher growth rate than the case. After culturing for 7 days, the final cell weight was 2.01 g/L for light culture, 5.9 g/L for subculture, and 6.65 g/L for mixed culture. case of about 0.26 g / L / day, about 0.81 g / L / day in the case of subculture, and about 0.92 g / L / day in the case of mixed culture. Unlike other conventional microalgae or JD052 microalgae, which were the parent strain of improved microalgae, it showed high growth even under subculture conditions in which no light was given and only organic carbon was provided, confirming that culturing was possible, and the growth rate compared to light culture conditions It was confirmed that it was possible to produce a large amount of biomass quickly (FIG. 3).

Early 1 day 2 days 3 days 4 days 5 days 6 days 7 days photoculture 0.2 0.21 0.29 0.78 1.32 1.74 1.89 2.01 subculture 0.2 0.34 0.99 1.56 2.21 3.56 5.32 5.9 mixed culture 0.2 0.56 1.21 2.03 2.98 4.12 5.89 6.65

[Example 3] Analysis of types of active ingredients

In order to confirm the active ingredient produced from Senedesmus genus HS4 of the present invention, 55 g of the extract was obtained from 1,000 g of the culture medium of the microalgae and the components were analyzed. Through the process of centrifuging the cultured microalgae, the supernatant, the culture medium, was removed, and only microalgal cells were obtained and lyophilized at -70° C. to remove moisture. And cell extraction was performed from the lyophilized biomass using ethyl acetate, and after cell extraction, the organic solvent was distilled using a rotary vacuum evaporator to obtain an extract. The extract sample was dissolved in a solvent and fractions were divided by performing silica gel column chromatography and high performance liquid chromatography (HPLC), and the fraction showing activity among the fractions was concentrated to perform preparative ODS MPLC purified through. The purified sample _{was dissolved in CD 3} OD, and the chemical structure of the compound present in the extract was determined by measuring ¹ H NMR, ¹³ C NMR, ¹ H- ^{1 H COSY, HMQC and HMBC spectra.}

As a result, the chemical structure of the substance contained in the Senedesmus genus HS4 extract sample was found to be a loliolide, and the literature (Journal of the Korean Chemical Society, Vol. 48, No 4, 394-398) , 2004) as a result of comparison with the NMR data of loliolide reported in, it could be determined that the active ingredient contained in the extract extracted from microalgae of the present invention was (-)-loriolide ( FIGS. 4a to 4e ). .

In addition, in order to further confirm the chemical structure of the active ingredient identified as described above, the molecular weight of the ingredient was measured by ESI-mass spectrum.

As a result, peaks were observed at [M+H] ⁺ at m/z 197.2, [2M+H] ⁺ at m/z 393.2, and [2M+Na] ⁺ + at m/z 415.2, confirming that the molecular weight was 196. Therefore, it was confirmed once again that the chemical structure analyzed by the NMR spectroscopic analysis result was loliolide (FIGS. 5a and 5b).

[Example 4] Analysis of Loriolide Content

As clarified in Example 3, the extract of Senedesmus genus HS4 of the present invention contains loliolide, how much more Loriolide can be produced by the Senedesmus HS4 compared to other microalgae? I checked if it can. First, the purified Loriolide extract was mixed with methanol to a concentration of 200 ppm and diluted again to make a quantitative line of Loriolide (FIG. 6a). Then, LC analysis was performed on the Senedesmus genus HS4 extract of the present invention obtained by extraction in the same manner as in Example 3, and the Senedesmus genus JD052 extract extracted by the same method, to perform LC analysis, and the quantitative The content of loliolide in the two microalgal extracts was analyzed through a line (FIG. 6b).

As a result, in 10,000 ppm of the ethyl acetate extract of Senedesmus genus HS4 of the present invention cultured through mixotrophic culture, 18.7 ppm of loliolide, 10,000 ppm of extract of HS4 cultured through heterotrophic culture It was confirmed that 14.3 ppm of loliolide was included. In comparison, it was confirmed that 10,000 ppm of the ethyl acetate extract of senedesmus genus JD052 contained 17.6 ppm of loliolide.

From the above results, it was confirmed that, based on the extract at the same concentration, the HS4 extract of the genus Senedesmus of the present invention contained a similar level of content as compared to the conventional JD052 microalgae extract.

[Example 5] Confirmation of the effect of improving productivity of loliolide of HS4 in Senedesmus

In order to confirm whether the loliolide productivity of HS4 microalgae of the genus Senedesmus of the present invention is more improved than that of conventional microalgae, biomass productivity and lolio content contained therein for JD052 and HS4 microalgae of the genus Senedesmus of the present invention Rides were compared.

First, since the Senedesmus genus JD052 corresponds to microalgae with a very low organic carbon catabolism efficiency, 350 ml of the sterilized culture solution (pH 7.1) composed of the composition of Table 1 above was placed in a 1L flask at 25 ° C., light quantity 50 It was irradiated with light of μmol·m ^-2 ·s ^-1 and cultured for 7 days, and the initial inoculation amount of the JD052 was 0.2 g/L. The HS4 microalgae of the present invention were each cultured under the conditions of a mixed culture providing both light and organic carbon and a subculture in which only organic carbon was given without light. Specifically, biomass productivity was confirmed by measuring the weight per biomass volume of each microalgae cultured as described above, and Lori of each microalgae using the loliolide content value in the microalgal extract analyzed in Example 5 above. Auride productivity was confirmed.

Specifically, in the case of subculture conditions, other conditions were the same as those of the JD052, but a culture solution having a composition in which 10 g/L of glucose and 1 g/L of yeast extract was added was used and no light was irradiated. In the case of the mixed culture condition, in addition to the same conditions as in the case of the subculture condition, the culture was performed by irradiating light with an ^{amount of light of 50 μmol·m -2} ·s ^{-1 .} The initial inoculation amount of the HS4 was 0.2 g/L.

As a result, in the case of the photocultured senedesmus genus JD052, the biomass productivity was 0.26 g/L/day, and it was confirmed that the loliolide productivity was 11.9 ng/L/day. In the case of the subcultured senedesmus genus HS4 of the present invention, the biomass productivity was 0.81 g/L/day, and the loliolide productivity was confirmed to be 28 ng/L/day, and in the case of the mixed culture HS4, the biomass productivity was 0.92 g/L/day, and it was confirmed that the loliolide productivity was 43 ng/L/day (FIG. 7).

In view of the above results, the HS4 microalga of the genus Senedesmus of the present invention compared with the conventional JD052 microalgae, the biomass productivity was improved by about 3 times and 3.4 times, respectively, in the case of subculture and mixed culture, It was confirmed that the loliolide productivity was improved by about 2.4 times and 3.6 times, respectively. Therefore, the novel Senedesmus genus HS4 microalgae of the present invention has an excellent growth rate even under culture conditions without light compared to conventional microalgae, so that the productivity of biomass and loliolide is remarkably increased. Confirmed.

[Example 6] Confirmation of cytotoxicity to human dermal fibroblasts of Loriolide produced and purified from HS4 of Senedesmus genus

In order to confirm the effect of the loliolide, an active ingredient produced from HS4 of the Senedesmus genus of the present invention, on the skin, the produced loliolide is purified and treated with human dermal fibroblasts (HDFs), and thus effect was confirmed.

Purification of the loliolide was performed in the same manner as in Example 3, and the extract was obtained using ethyl acetate from the freeze-dried culture medium of HS4 microalgae of the genus Senedesmus of the present invention and subjected to a fractionation/concentration process to obtain the loliolide. was purified. For culturing of human dermal cells, using a medium further containing 10% FBS (fetal bovine serum, S1480, Biowest, France) in DMEM medium (Dulbecco's modified Eagle's medium, L0103-500, Biowest, France), Lonza Human dermal fibroblasts purchased from (Basel, Switzerland) _{were cultured in a 5% CO 2} cell incubator at 37 °C.

First, it was confirmed through WST-1 assay whether loliolide has cytotoxicity against human dermal fibroblasts. The human dermal fibroblasts cultured as described above ^{were dispensed in a 96-well plate by 4×10 3} cells/well and cultured for 24 hours, and then, 0 and 2, respectively, of loliolide purified from HS4 microalgae of the genus Senedesmus. , 5, 10 and 20 μg/ml were treated. After 24 hours of loliolide treatment, the solution was treated in the medium using a WST-1 assay kit (EZ-cytox cell viability kit, Itshio, Korea), and then a microplate reader (iMark microplate reader, Bio- Rad, USA) to measure the absorbance at a wavelength of 450 nm.

As a result, as can be seen in FIG. 8 , even when the loliolide was treated up to a concentration of 20 μg/ml, the relative viability of the cells did not decrease compared to the control group not treated with the loliolide. Therefore, it was confirmed that the concentration of loliolide produced from HS4 of Senedesmus genus of the present invention was not toxic to human dermal fibroblasts up to 20 μg/ml.

[Example 7] Confirmation of cell viability recovery effect of loliolide on human dermal fibroblasts with reduced cell viability by UV irradiation

Cells, including human dermal fibroblasts, have a reduced survival rate when irradiated with ultraviolet rays such as UVB. Accordingly, it was confirmed how the cell viability changes when the loriolide purified as described above was treated in human dermal fibroblasts and irradiated with UVB.

Human dermal fibroblasts cultured in the same manner as in Example 6 ^{were dispensed in 96-well plates at 4×10 3} cells/well, and loliolide was added at a concentration of 2, 5, 10, and 20 μg/ml 6 treated for hours. Then, the medium was irradiated with UVB at 10 mJ/cm 2 and further cultured for 24 hours, and cell viability was measured by performing the WST-1 assay in the same manner as in Example 6.

As a result, as can be seen in FIG. 9 , based on the viability of the cells without any treatment, in the case of the control cells irradiated only with UVB without treatment with loliolide, the cell viability decreased by 35% to 65%, unlike the , In the case of cells treated with each concentration of loliolide, cell viability was measured to be higher, and cell viability, which had been reduced by UVB irradiation, was restored. The cells that had the highest recovery effect of cell viability were cells treated with loliolide at a concentration of 5 μg/ml or 10 μg/ml, in which case the cell viability was 88% to 89%.

Judging from the above results, loliolide has an excellent effect of restoring the survival rate of human dermal fibroblasts reduced by UVB and increasing it again, and even with only 2 μg/ml treatment, the viability of cells is significantly increased compared to the control group. As it was confirmed, it was confirmed that the Loriolide separated and purified from HS4 of the genus Senedesmus of the present application can help in the recovery and improvement of skin damaged by light.

[Example 8] Confirmation of the effect of promoting the expression of the collagen gene (Col1A1) by the loliolide and the effect of inhibiting the expression of the collagenase gene (MMP1)

Collagen is one of the main proteins constituting the skin, and a decrease in collagen can adversely affect the elasticity and moisture of the skin. ColA1 , a gene related to the synthesis of collagen as described above, can be suppressed by irradiation with ultraviolet rays such as UVB, and collagenase gene MMP1 , a protein that decomposes collagen, can be increased by UVB irradiation. , which can eventually lead to a decrease in collagen production. Accordingly, changes in the expression level of the genes were measured when treated with Loriolide separated and purified from HS4 of Senedesmus genus.

^{First, 4×10 3} cells/well of human dermal fibroblasts cultured in the same manner as in Example 6 were dispensed in a 96-well plate, and UVB was irradiated to the medium at 10 mJ/cm 2 . Then, the medium of the human dermal fibroblasts irradiated with ultraviolet light was treated with loliolide at a concentration of 5 and 10 μg/ml, which had the best cell viability recovery effect, as in the result of Example 7, and cultured for 24 hours. Thereafter, changes in the expression levels of the ColA1 gene and the MMP1 gene were measured through quantitative real time-PCR (qRT-PCR). In this process, a fluorescent material, SYBR green I (SYBR green I, Invitrogen) was used to check the amount of DNA product amplified by PCR in real time. Specifically, 0.2 μM of the primer prepared with the sequence shown in Table 3 below is put in a PCR tube, 50 mM KCl, 20 mM Tris/HCl (pH 8.4), 0.8 mM dNTP, 0.5U DNA polymerase (Extaq DNA polymerase), A reaction solution was prepared by mixing 3 mM MgCl _{2 and 1ХSYBR Green I.} Then, PCR was performed using a PCR device (Linegene K, BioER, China) (PCR conditions: primary denaturation at 3 minutes, denaturation at 94°C for 30 seconds, annealing at 58°C for 30 seconds, polymerization at 72°C 30 sec, total 40 cycles) The fluorescence intensity was measured every cycle.

SEQ ID NO: sequence name base sequence (5'-> 3') One COL1A1 forward primer AGGGCCAAGACGAAGACATC 2 COL1A1 reverse primer AGATCACGTCATCGCACAACA 3 MMP1 forward primer TCTGACGTTGATCCCAGAGAGCAG 4 MMP1 reverse primer CAGGGTGACACCAGTGACTGCAC 5 β-actin forward primer GGATTCCTATGTGGGCGACGA 6 β-actin reverse primer CGCTCGGTGAGGATCTTCATG

Measurement results of ColA1 gene expression level, when based on the expression level of the cell, as shown in FIG. 10 is not any treatment, Laurie five rides a process to measure the results of ColA1 gene expression levels, as shown in FIG. 10, no Based on the expression level of the untreated cells, in the case of the control cells irradiated with UVB only and not treated with the loliolide, the ColA1 gene expression level decreased by 70% to only 30%, whereas the loliolide was administered at 5 μg/ In the case of cells treated with a concentration of ml, the ColA1 gene expression level was measured to be 55%, and for the cells treated with a concentration of 10 μg/ml, the ColA1 gene expression level was measured to be 65%, and the expression level decreased by UVB irradiation was recovered.

As a result of the measurement of the expression level of the MMP1 gene, as shown in FIG. 11 , based on the expression level of the cells without any treatment, the MMP1 gene expression level was 2.4 times in the case of the control cells irradiated only with UVB without treatment with loliolide. than otherwise, is measured Lowry O fluoride in a 25% amount of MMP1 gene expression for cells treated with a concentration of 5 ㎍ / ㎖, 46% the amount of MMP1 gene expression for cells treated at a concentration of 10 ㎍ / ㎖ expression increased amount was reduced.

In view of the above results, loliolide has the effect of restoring the ColA1 gene expression level in human dermal fibroblasts, which is reduced by UVB irradiation, and increasing it again, and reducing the MMP1 gene expression level. has the effect of increasing the amount of collagen produced in It was confirmed that it can help maintain and moisturize.

In the above, the present invention has been described in detail only with respect to the described embodiments, but it is obvious to those skilled in the art that various changes and modifications are possible within the scope of the technical spirit of the present invention, and it is natural that such variations and modifications belong to the appended claims.

Korea Institute of Bioscience and Biotechnology KCTC13784BP 20190104

<110> Korea Research Institute of Bioscience and Biotechnology <120> Novel microalgae having high productivity for loliolide <130> 2019DPA3466 <150> KR 10-2019-0013108 <151> 2019-01-31 <160> 6 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> COL1A1 forward primer <400> 1 agggccaaga cgaagacatc 20 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> COL1A1 reverse primer <400> 2 agatcacgtc atcgcacaac a 21 <210> 3 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> MMP1 forward primer <400> 3 tctgacgttg atcccagaga gcag 24 <210> 4 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> MMP1 reverse primer <400> 4 cagggtgaca ccagtgactg cac 23 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> beta-actin forward primer <400> 5 ggattcctat gtgggcgacg a 21 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> beta-actin reverse primer <400> 6 cgctcggtga ggatcttcat g 21

Claims (13)

HS4 of the genus Senedesmus deposited with accession number KCTC 13784BP ( Scenedesmus sp. HS4). The method according to claim 1,
The Senedesmus genus HS4 is capable of producing loliolide, Senedesmus genus HS4. A pharmaceutical composition for preventing and improving skin aging, comprising, as an active ingredient, an extract or a fraction thereof of Senedesmus genus HS4 deposited with accession number KCTC 13784BP. 4. The method according to claim 3,
The extract of HS4 of the Senedesmus genus is at least one organic solvent selected from the group consisting of lower alcohols having 1 to 5 carbon atoms, acetone, acetonitrile, ethyl acetate, chloroform, dichloromethane, ethyl ether, xylene and hexane, water or A pharmaceutical composition for preventing and improving skin aging, which is extracted with a mixture thereof. 5. The method according to claim 4,
The extract of the Senedesmus genus HS4 is to be extracted with ethyl acetate, a pharmaceutical composition for preventing and improving skin aging. 4. The method according to claim 3,
The skin aging is caused by ultraviolet rays, a pharmaceutical composition for preventing and improving skin aging. 4. The method according to claim 3,
The skin aging improvement is skin wrinkle improvement, skin aging prevention and improvement pharmaceutical composition. A cosmetic composition for preventing and improving skin aging, comprising an extract of Senedesmus genus HS4 deposited with accession number KCTC 13784BP or a fraction thereof as an active ingredient. 9. The method of claim 8,
The skin aging improvement is skin wrinkle improvement, skin aging prevention and improvement cosmetic composition. 9. The method of claim 8,
The cosmetic composition is a solution, suspension, emulsion, gel, lotion, essence, cream, powder, soap, shampoo, rinse, pack mask, surfactant-containing cleansing, cleansing foam, cleansing water, oil, liquid foundation, cream foundation, A cosmetic composition for preventing and improving skin aging, which has any one formulation selected from the group consisting of a spray. delete delete delete

Images