KR102286025B1 - Mass spectrometry using dna polymerases with increased mutation specificity - Google Patents

Abstract

The present invention relates to mass spectrometry using DNA polymerase with increased specificity for genetic variation, and more particularly, to a gene using mass spectrometry, including Taq polymerase having increased specificity for genetic variation due to mutation at a specific amino acid position. A DNA polymerase for use in mutation detection, a kit comprising the same, and a method for detecting a gene mutation by mass spectrometry using the same.

Description

Mass spectrometry using DNA polymerase with increased gene mutation specificity {MASS SPECTROMETRY USING DNA POLYMERASES WITH INCREASED MUTATION SPECIFICITY}

The present invention relates to mass spectrometry using DNA polymerase with increased specificity for genetic variation, and more particularly, to a gene using mass spectrometry, including Taq polymerase having increased specificity for genetic variation due to mutation at a specific amino acid position. A DNA polymerase for use in mutation detection, a kit comprising the same, and a method for detecting a gene mutation by mass spectrometry using the same.

Since mass spectrometry was first used in the early 1900s, various ionization methods have been developed, and in general, EI (Electron Impact) is widely used as a standard ionization method. However, this method can be used only for volatile samples and has a disadvantage that it cannot be used for samples that are unstable to heat, so it is mainly applied limitedly to organic small molecules.

For this reason, various ionization methods have been developed for mass spectrometry of nonvolatile or thermally stable materials such as SIMS, FD, FAB, and MALDI. Among them, Matrix Assisted Laser Desorption Ionization (MALDI) is a method that can vaporize/ionize polymer materials without decomposition of the sample. In addition, combined with a TOF (Time of Flight) analyzer, it is the most popular mass spectrometry method for polymer research.

In the conventional method of amplifying a gene through PCR, when ddNTP (Dideoxynucleotide) is added, gene amplification stops at the place where ddNTP is added. Therefore, the existing method is to design and use a primer that complementarily binds up to (-1) just before the nucleotide with a mutation, and then performs PCR by adding ddNTP. By mass spectrometry of the PCR product using MALDI-TOF, the mass difference between the last added ddNTPs could be confirmed, and genetic mutations could be detected through this. However, the mass difference between ddNTPs was not large, and the number of mutant genes was very low compared to the number of normal genes present in the sample (tissue, blood, urine, etc.), so the accuracy or sensitivity of mutation detection was remarkably low.

Accordingly, the present inventors increased the mass difference between the PCR products of the normal gene and the mutant gene by inhibiting extension of the primer end due to mismatch using a mutation-specific DNA polymerase, thereby detecting mutations during mass spectrometry using MALDI-TOF. We developed a method to improve the accuracy and sensitivity of

On the other hand, Republic of Korea Patent Publication No. 10-2011-0008158 relates to a composition and method for mass spectrometry, with respect to a sample analyzed by reducing the formation of an adduct in a sample containing an analyte to be analyzed by mass spectrometry. A method capable of increasing accuracy, sensitivity, and throughput has been disclosed, but there is no known mass spectrometry method in which accuracy and sensitivity are improved by using a DNA polymerase having increased specificity for gene mutations.

An object of the present invention is to provide a DNA polymerase having increased specificity for genetic mutation and a kit comprising the same for use in gene mutation detection using mass spectrometry.

Another object of the present invention is to provide a method for detecting a gene mutation by mass spectrometry using the aforementioned DNA polymerase and/or kit.

In order to solve the above problems, in the present invention, in the amino acid sequence of SEQ ID NO: 1, glutamic acid (E), the 507th amino acid residue, is substituted with lysine (K), and the 536th amino acid residue, arginine (R), is lysine (K) It provides a DNA polymerase for use in gene mutation detection using mass spectrometry, comprising Taq polymerase in which arginine (R), which is the 660th amino acid residue, is substituted with valine (V).

According to a preferred embodiment of the present invention, the mass spectrometry is matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry, laser desorption mass spectrometry (LDMS), electrospray (ES) mass spectrometry, ion cyclo can be selected from the group consisting of Tron Resonance (ICR) Mass Spectrometry, Mass Array (MassARRAY) and Fourier Transform Mass Spectrometry.

The present invention also provides the above-mentioned DNA polymerase; and/or one or more matched primers, one or more mismatched primers, or both one or more matched primers and one or more mismatched primers; .

According to a preferred embodiment of the present invention, the one or more matched primers and one or more mismatched primers may hybridize with a target sequence.

According to another preferred embodiment of the present invention, the kit may further include dideoxynucleoside triphosphate.

According to another preferred embodiment of the present invention, the kit comprises 25 to 100 mM KCl; and 1 to 7 mM (NH ₄ ) ₂ SO ₄ ; and may further include a PCR buffer composition having a final pH of 8.0 to 9.5.

According to another preferred embodiment of the present invention, the kit comprises 40 to 90 mM KCl; 1-5 mM (NH ₄ ) ₂ SO ₄ ; and 10 to 40 mM of TMAC (Tetra methyl ammonium chloride), and may further include a PCR buffer composition having a final pH of 8.0 to 9.0.

The present invention also provides a method for detecting a gene mutation by mass spectrometry using the above-described DNA polymerase.

According to a preferred embodiment of the present invention, the method comprises the steps of: (a) extracting a nucleic acid from an isolated biological sample; (b) performing PCR by treating the extracted nucleic acid with the DNA polymerase of the present invention; and (c) analyzing the size or nucleotide sequence of the PCR amplification product.

According to a preferred embodiment of the present invention, the biological sample of step (a) is whole blood, serum, plasma, urine, stool, sputum, saliva (saliva), tissue, cell, cell extract, and may be any one or more selected from the group consisting of in vitro cell culture.

According to a preferred embodiment of the present invention, in step (b), one or more matched primers, one or more mismatched primers or both one or more matched primers and one or more mismatched primers may be treated, wherein the one or more The matched primer and one or more mismatched primers may hybridize to the target sequence.

According to another preferred embodiment of the present invention, step (c) may be to analyze the mass of the PCR amplification product by mass spectrometry.

According to another preferred embodiment of the present invention, the mass spectrometry is matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry, laser desorption mass spectrometry (LDMS), electrospray (ES) mass spectrometry, It may be selected from the group consisting of ion cyclotron resonance (ICR) mass spectrometry, mass array (MassARRAY) and Fourier transform mass spectrometry.

According to another preferred embodiment of the present invention, analyzing the mass of the PCR amplification product in step (c) is a dideoxynucleoside tree between the amplification product of the matched primer and the product in which the primer amplification does not occur due to mismatch. It may be to confirm the molecular weight difference as much as phosphate.

According to another preferred embodiment of the present invention, the method can be used for diagnosing a disease, predicting the prognosis of a disease, or predicting drug reactivity.

According to another preferred embodiment of the present invention, the method can simultaneously detect mutations of at least three or more different targets with a single PCR.

Mass spectrometry using DNA polymerase with increased gene mutation specificity of the present invention increases the mass difference between PCR products of normal and mutated genes by suppressing extension of primer ends due to mismatch, and mass spectrometry using MALDI-TOF It can significantly improve the accuracy and sensitivity of mutation detection. In addition, the conventional quantitative PCR method using a fluorescent probe has technical limitations in the multiplex for simultaneously observing multiple mutant targets. Multiplex technology that can detect mutations of up to 30-40 different targets simultaneously is possible.

1 shows the production process of Taq DNA polymerase containing R536K, R660V and R536K / R660V mutations, respectively, (a) is a schematic representation of fragment PCR and overlap PCR, (b) is amplified in fragment PCR It shows the result of confirming the product by electrophoresis, and (c) shows the result of confirming the amplified product by electrophoresis by amplifying the full length by overlap PCR.
2 is a result of electrophoresis confirming the overlap PCR product of FIG. 1(c) purified with the pUC19 vector treated with SAP after digestion with restriction enzymes EcoRI/XbaI for gel extraction.
Figure 3 schematically shows fragment PCR and overlap PCR during the production process of Taq DNA polymerase containing E507K, E507K / R536K, E507K / R660V and E507K / R536K / R660V mutations, respectively.
4 is a result of electrophoresis confirming the overlap PCR product of FIG. 3 purified with the pUC19 vector treated with SAP after digestion with restriction enzymes EcoRI/XbaI for gel extraction.
5 shows the principle of MALDI-TOF mass spectrometry using a DNA polymerase with increased genetic mutation specificity of the present invention in comparison with the conventional MALDI-TOF mass spectrometry method, (A) the conventional method, (B) represents the method of the present invention.
6 shows the results of detecting mutations by electrophoresis after single base extension in a sample containing the BRAF p.V600E (c.1799T>A) mutant template.
7a to 7e show the mutation detection results using MALDI-TOF mass spectrometry according to the concentration of the BRAF p.V600E (c.1799T>A) mutation template in the sample (0, 0.1, 0.5, 5.0 and 10%, respectively). , The first box corresponds to the loading control for each experiment, the second box indicates the amount of unextended primers, and the third box indicates the amount of extended primers.
8 shows the results of detecting mutations by electrophoresis after single base extension in a sample containing the EGFR p.T790M (c.2369C>T) mutation template, and changes in annealing temperature (59, 61.9 , 65.1 and 68°C) show the effect of mutation detection results.
9a to 9e show the mutation detection results using MALDI-TOF mass spectrometry according to the concentration of the EGFR p.T790M (c.2369C>T) mutation template in the sample (0, 0.1, 0.5, 5.0 and 10%, respectively). , The first box corresponds to the loading control for each experiment, the second box indicates the amount of unextended primers, and the third box indicates the amount of extended primers.
10 shows the results of detecting mutations by electrophoresis after single base extension in a sample containing the EGFR p.L858R (c.2573T>G) mutant template, and changes in annealing temperature (59, 61.9 , 65.1 and 68°C) show the effect of mutation detection results.
11A to 11E show the mutation detection results using MALDI-TOF mass spectrometry according to the concentration of the EGFR p.L858R (c.2573T>G) mutation template in the sample (0, 0.1, 0.5, 5.0 and 10%, respectively). , The first box corresponds to the loading control for each experiment, the second box indicates the amount of unextended primers, and the third box indicates the amount of extended primers.
12A to 12E show multiplexing of BRAF p.V600E (c.1799T>A), EGFR p.T790M (c.2369C>T) and EGFR p.L858R (c.2573T>G). As a result, the first box represents the amount of unextended primer for the EGFR p.T790M (c.2369C>T) mutation, and the second box represents the extended primer for the EGFR p.T790M (c.2369C>T) mutation. Indicates the amount of primer, the third box corresponds to the loading control for each experiment, the fourth box indicates the amount of unextended primer for the EGFR p.L858R(c.2573T>G) mutation, and the fifth box is the EGFR The amount of primer extended for the p.L858R (c.2573T>G) mutation, the sixth box indicates the amount of primer that was not extended for the BRAF p.V600E (c.1799T>A) mutation, the seventh Boxes indicate the amount of extended primer for the BRAF p.V600E (c.1799T>A) mutation.

As described above, in mass spectrometry using MALDI-TOF, the mass difference between ddNTPs is not large, and the number of mutant genes is very small compared to the number of normal genes present in the sample (tissue, blood, urine, etc.) The detection accuracy and sensitivity were remarkably low. Accordingly, the present inventors increased the mass difference between the PCR product of the normal gene and the mutant gene by suppressing extension of the primer end due to mismatch using a mutation-specific DNA polymerase, thereby detecting mutations in mass spectrometry using MALDI-TOF. By developing a method to improve accuracy and sensitivity, a solution to the above-mentioned problem was sought.

Hereinafter, the terms used herein will be described.

“Amino acid” refers to any monomeric unit that can be incorporated into a peptide, polypeptide, or protein. As used herein, the term “amino acid” includes the following 20 natural or genetically encoded alpha-amino acids: alanine (Ala or A), arginine (Arg or R), asparagine (Asn or N), aspart acid (Asp or D), cysteine (Cys or C), glutamine (Gln or Q), glutamic acid (Glu or E), glycine (Gly or G), histidine (His or H), isoleucine (Ile or I), leucine (Leu or L), lysine (Lys or K), methionine (Met or M), phenylalanine (Phe or F), proline (Pro or P), serine (Ser or S), threonine (Thr or T), tryptophan ( Trp or W), tyrosine (Tyr or Y), and valine (Val or V).

Amino acids are typically organic acids, which include substituted or unsubstituted amino groups, substituted or unsubstituted carboxy groups, and one or more side chains or groups, or any analogs of these groups. Exemplary side chains are, for example, thiol, seleno, sulfonyl, alkyl, aryl, acyl, keto, azido, hydroxyl, hydrazine, cyano, halo, hydrazide, alkenyl, alkynyl, ether, borate, boronate, phospho, phosphono, fosifine, heterocyclic, enone, imine, aldehyde, ester, thioacid, hydroxylamine, or any combination of these groups.

In the DNA polymerases of the present invention, the term "mutant" refers to a recombinant polypeptide comprising one or more amino acid substitutions relative to the corresponding naturally occurring or unmodified DNA polymerase.

The term "thermostable polymerase" (referring to an enzyme that is heat stable) is heat resistant, retains sufficient activity to achieve a subsequent polynucleotide extension reaction, and is subjected to elevated temperature for a period of time required to achieve denaturation of double-stranded nucleic acids. It is not irreversibly denatured (inactivated) when As used herein, it is suitable for use at a temperature cycling reaction such as PCR. Irreversible denaturation herein refers to permanent and complete loss of enzyme activity. For thermostable polymerases, enzymatic activity refers to catalyzing the combination of nucleotides in an appropriate manner to form a polynucleotide extension product complementary to the template nucleic acid strand. Thermostable DNA polymerases from thermophilic bacteria include, for example: Thermotoga maritima, Thermus aquaticus, Thermus thermophilus, Thermus flabus, Thermophylliformis, Thermus sp. DNA polymerases from Sps17, Thermos sp. Z05, Thermos caldophilus, Bacillus caldotenax, Thermotoga neopolitana, and Thermocypo africanus.

The term “thermoactive” refers to an enzyme that retains its catalytic properties at temperatures commonly used for reverse transcription or annealing/extension steps in RT-PCR and/or PCR reactions (ie, 45-80° C.). Thermostable enzymes are those that are irreversibly inactivated or not denatured when subjected to the elevated temperatures required for nucleic acid denaturation. A thermoactive enzyme may or may not be thermostable. The thermoactive DNA polymerase may be DNA or RNA dependent from a thermophilic or mesophilic species, including but not limited to:

The term “nucleotide” is a deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) that exists in single- or double-stranded form, unless specifically stated otherwise. It may contain analogs of natural nucleotides as long as they are not.

The term “nucleic acid” or “polynucleotide” refers to a polymer that may correspond to a DNA or RNA polymer, or an analog thereof. Nucleic acids are, for example, chromosomes or chromosomal segments, vectors (eg, expression vectors), expression cassettes, naked DNA or RNA polymers, products of polymerase chain reaction (PCR), oligonucleotides, probes, and primers. may or may include. A nucleic acid may be, for example, single-stranded, double-stranded, or triple-stranded, but is not limited to any particular length. Unless otherwise stated, a particular nucleic acid sequence comprises or encodes a complementary sequence in addition to any sequence specified.

The term “primer” refers to a polynucleotide capable of serving as an initiation point for nucleic acid synthesis in the template-direction when subjected to conditions in which polynucleotide extension is initiated. Primers can also be used in a variety of other oligonucleotide-mediated synthetic processes, including as initiators of de novo RNA synthesis and in vitro transcription-related processes. Primers are typically single-stranded oligonucleotides (eg, oligodeoxyribonucleotides). The appropriate length of the primer depends on the intended use, typically in the range of 6 to 40 nucleotides, more typically in the range of 15 to 35 nucleotides. Short primer molecules generally require lower temperatures to form sufficiently stable hybridization complexes with the template. Primers are not required to reflect the exact sequence of the template, but must be sufficiently complementary to hybridize with the template to be extended. In certain embodiments, the term "primer pair" includes 5'-sense primers that hybridize complementary to the 5'-end of the nucleic acid sequence being amplified, and 3'-antisense primers that hybridize to the 3'-end of the sequence to be amplified. It means a set of primers comprising Primers can be labeled, if desired, by incorporating a label that can be detected by spectroscopic, photochemical, biochemical, immunochemical or chemical means. For example, useful labels include: ³² P, fluorescent dyes, electron-dense reagents, enzymes (commonly used in ELISA assays), biotin, or haptens and proteins for which antisera or monoclonal antibodies can be used. .

The term "5'-nuclease probe" refers to an oligonucleotide comprising one or more luminescent label moieties used in a 5'-nuclease reaction to target nucleic acid detection. In some embodiments, for example, a 5'-nuclease probe comprises only a single luminescent moiety (eg, a fluorescent dye, etc.). In certain embodiments, the 5'-nuclease probe comprises a self-complementary region such that the probe can form a hairpin structure under selective conditions. In some embodiments, the 5'-nuclease probe comprises two or more label moieties and is released with increased radiation intensity after one of the two labels is separated from or degraded from the oligonucleotide. In certain embodiments, a 5'-nuclease probe is labeled with two different fluorescent dyes, eg, a 5'-terminal reporter dye and a 3'-terminal quencher dye or moiety. In some embodiments, the 5'-nuclease probe is labeled in addition to, or at one or more positions other than the terminal position. When the probe is intact, energy transfer typically occurs between the two fluorophores such that the fluorescence emission from the reporter dye is at least partially quenched. During the elongation step of the polymerase chain reaction, for example, a 5'-nuclease probe bound to the template nucleic acid has an activity such that the fluorescence emission of the reporter dye is no longer quenched, e.g. Taq polymerase or other It is degraded by the 5' to 3'-nuclease activity of the polymerase. In some embodiments, a 5'-nuclease probe may be labeled with two or more different reporter dyes and a 3'-terminal quencher dye or moiety.

The term "conventional" or "native" when referring to a nucleic acid base, nucleoside triphosphate, or nucleotide refers to that which occurs naturally in the polynucleotide being described (i.e., for DNA they are dATP, dGTP, dCTP and dTTP). In addition, dITP, and 7-deaza-dGTP are frequently used instead of dGTP and can be used instead of dATP in in vitro DNA synthesis reactions such as sequencing.

The term "unconventional" or "modified" when referring to a nucleic acid base, nucleoside, or nucleotide refers to a modification, derivative or include analogs. Certain unusual nucleotides are modified at the 2' position of the ribose sugar compared to conventional dNTPs. Thus, for RNA, although a naturally occurring nucleotide is a ribonucleotide (i.e., ATP, GTP, CTP, UTP, collective rNTP), since the nucleotide has a hydroxyl group at the 2' position of the sugar, it is comparatively free of dNTPs, As used herein, ribonucleotides are unconventional nucleotides as substrates for DNA polymerases. As used herein, unconventional nucleotides include, but are not limited to, compounds used as terminators for nucleic acid sequencing. Exemplary terminator compounds include, but are not limited to, compounds having a 2',3'-dideoxy structure, which are referred to as dideoxynucleoside triphosphates. Dideoxynucleoside triphosphates ddATP, ddTTP, ddCTP and ddGTP are collectively referred to as ddNTP. Further examples of terminator compounds include _{2'-PO 4 analogs of ribonucleotides.} Other uncommon nucleotides are phosphorothioate dNTPs ([[α]-S]dNTPs), 5′-[α]-borano-dNTPs, [α]-methyl-phosphonate dNTPs, and ribonucleosides. triphosphate (rNTP). Unconventional bases include radioactive isotopes such as ³² P, ³³ P, or ³⁵ S; fluorescent label; labeling of chemiluminescence; markers of bioluminescence; hapten labels such as biotin; or with an enzymatic label such as streptavidin or avidin. The fluorescent label may comprise a negatively charged dye, such as a dye of the fluorescein family, or a neutrally charged dye, such as a dye of the rhodamine family, or a positively charged dye, such as a dye of the cyanine family. Dyes of the Fluoxane family include, for example, FAM, HEX, TET, JOE, NAN and ZOE. Dyes of the rhodamine family include Texas Red, ROX, R110, R6G, and TAMRA. Various dyes or nucleotides labeled FAM, HEX, TET, JOE, NAN, ZOE, ROX, R110, R6G, Texas Red and TAMRA were obtained from Perkin-Elmer (Boston, MA), Applied Biosystems (Foster City, CA), or Invitrogen /Molecular Probes (Eugene, OR). Dyes of the cyanine family include Cy2, Cy3, Cy5, and Cy7 and are marketed by GE Healthcare UK Limited (Amersham Place, Little Chalfont, Buckinghamshire, England).

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

Hereinafter, the present invention will be described in more detail.

In the present invention, in the amino acid sequence of SEQ ID NO: 1, the 507th amino acid residue, glutamic acid (E), is substituted with lysine (K), the 536th amino acid residue, arginine (R) is substituted with lysine (K), and the 660th amino acid residue Provided is a DNA polymerase for use in gene mutation detection using mass spectrometry, comprising Taq polymerase in which phosphorus arginine (R) is substituted with valine (V).

The "Taq polymerase" is a thermostable DNA polymerase named after the thermophilic bacterium Thermos aquaticus and was first isolated from the bacterium. Thermos aquaticus is a bacterium that inhabits hot springs and hydrothermal vents, and Taq polymerase has been identified as an enzyme that can withstand the protein denaturation conditions (high temperature) required in the PCR process. The optimal activation temperature of Taq polymerase is 75-80 °C, and has a half-life of at least 2 hours at 92.5 °C, 40 minutes at 95 °C, and 9 minutes at 97.5 °C, and is capable of replicating 1000 base pairs of DNA within 10 seconds at 72 °C. can It lacks 3'→5' exonuclease-correcting activity, and the error rate is measured at about 1 out of 9,000 nucleotides. For example, using heat-resistant Taq, PCR can be performed at high temperatures (over 60 °C). The amino acid sequence shown in SEQ ID NO: 1 for Taq polymerase is used as a reference sequence.

In the present invention, in the amino acid sequence of SEQ ID NO: 1, the 507th amino acid residue is substituted from glutamic acid (E) to lysine (K), the 536th amino acid residue is substituted from arginine (R) to lysine (K), and the 660th amino acid is substituted. The Taq polymerase in which the residue was substituted from arginine (R) to valine (V) was named "E507K/R536K/R660V", and its amino acid sequence and nucleotide sequence are shown in SEQ ID NO: 2 and SEQ ID NO: 20, respectively.

According to a preferred embodiment of the present invention, the DNA polymerase of the present invention is matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry, laser desorption mass spectrometry (LDMS), and electrospray (ES) mass spectrometry. , ion cyclotron resonance (ICR) mass spectrometry, mass array (MassARRAY) and Fourier transform mass spectrometry.

The present invention also relates to the detection of gene mutations using mass spectrometry, comprising the aforementioned DNA polymerase and/or one or more matched primers, one or more mismatched primers or both one or more matched primers and one or more mismatched primers. kits for use are provided.

In the kit of the present invention, the one or more matched primers and the one or more mismatched primers can hybridize with a target sequence, and the mismatched primer includes a non-standard nucleotide at its 3' end with respect to the target sequence to be hybridized. can do.

The mismatched primer is a hybrid oligonucleotide that must be sufficiently complementary to hybridize with the target sequence, but does not reflect the exact sequence of the target sequence.

The “canonical nucleotide” or “complementary nucleotide” refers to canonical Watson-Crick base pairs, A-U, A-T and G-C.

The "non-canonical nucleotide" or "non-complementary nucleotide" refers to A-C, A-G, G-U, G-T, T-C, T-U, A-A, G-G, T-T, U-U, C-C, C-U in addition to Watson-Crick base pairs.

According to another preferred embodiment of the present invention, the kit for mass spectrometry may further include dideoxynucleoside triphosphate (ddNTP) such as ddATP, ddTTP, ddCTP or ddGTP.

The present invention also provides a method for detecting a gene mutation by mass spectrometry using the above-described DNA polymerase.

According to a preferred embodiment of the present invention, the method comprises the steps of: (a) extracting a nucleic acid from an isolated biological sample; (b) performing PCR by treating the extracted nucleic acid with the polymerase of the present invention; and (c) analyzing the size or nucleotide sequence of the PCR result amplification product.

In the method of the present invention, the biological sample of step (a) is whole blood, serum, plasma, urine, stool, sputum, saliva ), it may be any one or more selected from the group consisting of tissues, cells, cell extracts, and in vitro cell cultures.

In the method of the present invention, one or more matched primers, one or more mismatched primers or both one or more matched primers and one or more mismatched primers may be treated in step (b), wherein the one or more matched primers The primer and one or more mismatched primers may hybridize with the target sequence.

In the method of the present invention, the PCR buffer composition for increasing the activity of the DNA polymerase in step (b) may be treated.

According to a preferred embodiment of the present invention, the PCR buffer composition is 25 to 100 mM KCl; and 1 to 7 mM (NH ₄ ) ₂ SO ₄ ; and may further include a PCR buffer composition having a final pH of 8.0 to 9.5.

More preferably, the kit comprises 40 to 90 mM KCl; and 1 to 5 mM (NH ₄ ) ₂ SO ₄ ; and may further include a PCR buffer composition having a final pH of 8.0 to 9.0.

According to another preferred embodiment of the present invention, the kit comprises 25 to 100 mM KCl; 1-7 mM (NH ₄ ) ₂ SO ₄ ; and 5 to 50 mM of TMAC (Tetra methyl ammonium chloride), and may further include a PCR buffer composition having a final pH of 8.0 to 9.5.

More preferably, the kit comprises 40 to 90 mM KCl; 1-5 mM (NH ₄ ) ₂ SO ₄ ; and 10 to 40 mM of TMAC (Tetra methyl ammonium chloride), and may further include a PCR buffer composition having a final pH of 8.0 to 9.0.

The kit of the present invention may further include Tris·Cl (pH 8.0 to 9.5), MaCl ₂ , Tween 20, and BSA (Bovine serum albumin) in _{addition to KCl, (NH 4} ) ₂ SO _{4 , and TMAC, and these components} Concentrations of those skilled in the art can be used by adjusting the appropriate range.

The PCR buffer composition as described above enables reliable gene mutation-specific amplification by significantly improving the activity of the DNA polymerase of the present invention.

In the method of the present invention, step (b) may be performed as a single base extension (SBE). The single base extension reaction is a technique for attaching a primer close to the mutation position to be analyzed to a target gene and using DNA polymerase and ddNTP to identify the inserted base, and is effective for single nucleotide mutation analysis.

Therefore, the method of the present invention is useful for single nucleotide polymorphism (SNP) detection.

In the method of the present invention, step (c) may be to analyze the mass of the PCR amplification product by mass spectrometry.

In the method of the present invention, the mass spectrometry is matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry, laser desorption mass spectrometry (LDMS), electrospray (ES) mass spectrometry, ion cyclotron resonance ( ICR) mass spectrometry, mass array (MassARRAY), and Fourier transform mass spectrometry may be selected from the group consisting of.

In addition, the method of the present invention can be applied to various techniques for analyzing a nucleotide sequence using a PCR amplification product, for example, a microarray chip or various analysis devices capable of measuring mass, for example, a nucleotide sequence analysis technology such as LC-MS. It should be understood as a possible base technology.

Preferably, the method of the present invention can analyze the mass of the PCR amplification product by MALDI-TOF mass spectrometer. This is a multiplexing analysis method applicable to various genome studies such as genotyping. It can be used when you want to quickly analyze a large number of samples and targets at a low cost, or when you want to perform customized analysis for only a specific target. there is.

In the method of the present invention, analyzing the mass of the PCR amplification product in step c) means the difference in molecular weight as much as dideoxynucleoside triphosphate between the amplification product of the matched primer and the product in which primer amplification does not occur due to mismatch. may be to check

As shown in FIG. 5, in the conventional MALDI-TOF molecular weight quantification method (A), in the gene amplification method through PCR, when ddNTP (Dideoxynecleotide) is added, gene amplification stops at the place where ddNTP is added. Therefore, in the existing method, a primer that complements up to (-1) immediately before the mutated nucleotide is designed and used, and PCR is performed by adding ddNTP. By mass spectrometry of the PCR product using MALDI-TOF, the mass difference between the last added ddNTPs could be confirmed, and genetic mutations could be detected through this. However, the mass difference between ddNTPs was not large, and the number of mutant genes was very low compared to the number of normal genes present in the sample (tissue, blood, urine, etc.), so the accuracy or sensitivity of mutation detection was remarkably low.

In contrast, in the conventional MALDI-TOF molecular weight quantification method of the present invention (FIG. 1(B)), the mutant gene is normally amplified and ddNTP can bind to the following position, but in the case of a normal gene, it is at the mutant nucleotide position. Since amplification is suppressed by the mismatch of

Therefore, the method of the present invention can be applied to various genome studies such as genotyping, as well as in-vitro diagnostics (IVD).

Specifically, the method of the present invention can be used for diagnosing a disease, predicting the prognosis of a disease, or predicting drug responsiveness. The disease may be cancer, but is not limited thereto, and any disease that can be diagnosed by detecting a genetic mutation related to a specific disease may be included without limitation.

In the present invention, the term “prognosis” refers to an act of predicting the course and outcome of a disease in advance. More specifically, prognosis prediction means that the course of disease after treatment may vary depending on the physiological or environmental condition of the patient, and it is interpreted to mean any act of predicting the course of the disease after treatment by comprehensively considering the condition of the patient. can be

The prognosis prediction may be interpreted as an act of predicting disease-free survival or survival rate of a patient by predicting in advance whether the disease will progress and be cured after treatment of a specific disease. For example, predicting “good prognosis” indicates that the patient has a high level of disease-free survival or survival rate after treatment of the disease, meaning that the patient is more likely to be cured, and predicting “poor prognosis” indicates that the disease has a high level of survival. The disease-free survival rate or survival rate of the patient after treatment of the drug shows a low level, which means that the disease is highly likely to recur or to die due to the disease.

As used herein, the term “disease-free survival rate” refers to the possibility that a patient can survive without recurrence of a disease after treatment for a specific disease.

As used herein, the term "survival rate" refers to the possibility that a patient can survive regardless of whether the disease recurs after treatment of a specific disease.

The method of the present invention can simultaneously detect at least three or more different target mutations with only one PCR by adjusting the length of the primers for each different target mutation, for example, 3 to 40 different target mutations. Target mutations can be detected simultaneously.

Hereinafter, the present invention will be described in more detail by way of Examples. These Examples are merely for illustrating the present invention in more detail, and thereby it will be apparent to those skilled in the art that the technical scope of the present invention is not limited to these Examples.

Mutagenesis of Taq Polymerase

1-1. fragment PCR

In this example, Taq DNA polymerase in which the 536th amino acid residue in the amino acid sequence of SEQ ID NO: 1 is substituted from arginine to lysine (hereinafter referred to as "R536K"), Taq DNA polymerase in which the 660th amino acid residue is substituted from arginine to valine (hereinafter referred to as "R660V") and Taq DNA polymerase in which the 536th amino acid residue was substituted from arginine to lysine and the 660th amino acid residue was substituted from arginine to valine (hereinafter referred to as "R536K/R660V") was prepared as follows did.

First, Taq DNA polymerase fragments (F1 to F5) were amplified by PCR using the mutation-specific primers shown in Table 1 as shown in (a) of FIG. 1 . Reaction conditions are shown in Table 2.

primer sequence (5'→3') SEQ ID NO: Eco-F GG GGTACC TCA TCA CCC CGG 3 R536K-R CTT GGT GAG CTC CTT GTA CTG CAG GAT 4 R536K-F ATC CTG CAG TAC AAG GAG CTC ACC AAG 5 R660V-R GAT GGT CTT GGC CGC CAC GCG CAT CAG GGG 6 R660V-F CCC CTG ATG CGC GTG GCG GCC AAG ACC ATC 7 Xba-R GC TCTAGA CTA TCA CTC CTT GGC GGA GAG CCA 8

10xpfu buffer (Solgent) 2.5 μl dNTPs (10 mM each) 1 μl F primer 1 μl R primer 1 μl Distilled water 18 μl pUC19-Taq (10 ng/μl) 1 μl Pfu polymerase 0.5 μl 30 cycles (Ta=60℃) 25 μl

As a result of confirming the PCR product on electrophoresis, as shown in FIG.

1-2. overlap PCR

Using each of the fragments amplified in 1-1 above as a template, the full length was amplified using primers at both ends (Eco-F and Xba-R primers). Reaction conditions are shown in Tables 3 and 4.

R660V or R536K 10xpfu buffer (Solgent) 5 μl 5x Enhancer (Solgent) 10 μl dNTPs (10 mM each) 1 μl Eco-F primer (10 pmol/μl) 2 μl Xba-R primer (10 pmol/μl) 2 μl Distilled water 27 μl Fragment 1 (or Fragment 3) 1 μl Fragment 2 (or Fragment 4) 1 μl Pfu polymerase 1 μl 40 cycles (Ta=62℃) 50 μl

R536K/R660V 10xpfu buffer (Solgent) 5 μl 5x Enhancer (Solgent) 10 μl dNTPs (10 mM each) 1 μl Eco-F primer (10 pmol/μl) 2 μl Xba-R primer (10 pmol/μl) 2 μl Distilled water 26 μl Fragment 2 1 μl Fragment 3 1 μl Fragment 5 1 μl Pfu polymerase 1 μl 40 cycles (Ta=62℃) 50 μl

As a result, it was confirmed that the Taq polymerase of "R536K", "R660V" and "R536K/R660V" was amplified as shown in FIG.

1-3. ligation

pUC19 was digested with restriction enzymes EcoRI/XbaI for 4 hours at 37°C under the conditions of Table 5 below, and then the DNA was purified, and the purified DNA was treated with SAP at 37°C for 1 hour under the conditions of Table 6 to prepare a vector. .

10xCutSmart Buffer (NEB) 2.5 μl pUC19 (500 ng/μl) 21.5 μl EcoRI-HF (NEB) 0.5 μl XbaI (NEB) 0.5 μl 25 μl

10xSAP buffer (Roche) 2 μl purified DNA 17 μl SAP (Roche) 1 μl 20 μl

In the case of insert, the overlap PCR product of Example 1-2 was purified, digested with restriction enzymes EcoRI/XbaI for 3 hours at 37°C under the conditions of Table 7, and then gel-extracted with the prepared vector (FIG. 2). ).

10xCutSmart Buffer (NEB) 2 μl Purified PCR product 17 μl EcoRI-HF (NEB) 0.5 μl XbaI (NEB) 0.5 μl 20 μl

After ligation at room temperature (RT) for 2 hours under the conditions shown in Table 8, E. coli DH5α was transformed and selected in a medium containing ampicillin. The plasmids prepared from the obtained colonies were sequenced to obtain Taq DNA polymerase mutants ("R536K", "R660V" and "R536K/R660V") into which the desired mutation was introduced.

vector sole vector+insert 10x ligase buffer (Solgent) 1 μl 1 μl vector 1 μl 1 μl insert - 3 μl Distilled water 7 μl 4 μl T4 DNA ligase (Solgent) 1 μl 1 μl 10 μl 10 μl

Introduction of E507K mutation

2-1. fragment PCR

As a result of testing the Taq polymerase activity of "R536K", "R660V" and "R536K / R660V" prepared in Example 1, it was confirmed that the activity was lowered (data not shown), R536K, R660V, R536K / R660V, respectively In addition to the E507K mutation (substitution of the 507th amino acid residue in the amino acid sequence of SEQ ID NO: 1 from glutamic acid to lysine) was introduced, and E507K mutation was also introduced in wild-type Taq DNA polymerase (WT) for use as a control. The preparation method of Taq DNA polymerase into which E507K mutation is introduced is the same as in Example 1.

Taq DNA polymerase fragments (F6 to F7) were amplified by PCR using the mutation-specific primers shown in Table 9 as shown in FIG. 3 . Reaction conditions are shown in Table 10.

primer sequence (5'→3') SEQ ID NO: Eco-F GG GGTACC TCA TCA CCC CGG 3 E507K-R CTT GCC GGT CTT TTT CGT CTT GCC GAT 9 E507K-F ATC GGC AAG ACG AAA AAG ACC GGC AAG 10 Xba-R GC TCTAGA CTA TCA CTC CTT GGC GGA GAG CCA 8

10xpfu buffer (Solgent) 2.5 μl dNTPs (10 mM each) 1 μl F primer (10 pmol/μl) 1 μl R primer (10 pmol/μl) 1 μl Distilled water 18 μl Template plasmid (10 ng/μl) 1 μl Pfu polymerase 0.5 μl 30 cycles (Ta=60℃) 25 μl

*Template plasmid: pUC19-Taq (WT)

pUC19-Taq (R536K)

pUC19-Taq (R660V)

pUC19-Taq (R536K/R660V)

2-2. overlap PCR

Using each of the fragments amplified in 2-1 above as a template, the full length was amplified using primers at both ends (Eco-F and Xba-R primers). Reaction conditions are shown in Table 11.

10xpfu buffer (Solgent) 5 μl 5x Enhancer (Solgent) 10 μl dNTPs (10 mM each) 1 μl Eco-F primer (10 pmol/μl) 2 μl Xba-R primer (10 pmol/μl) 2 μl Distilled water 27 μl Fragment 6 1 μl Fragment 7 1 μl Pfu polymerase 1 μl 40 cycles (Ta=62℃) 50 μl

2-3. ligation

pUC19 was digested with restriction enzymes EcoRI/XbaI for 4 hours at 37°C under the conditions of Table 5, and then the DNA was purified, and the purified DNA was treated with SAP at 37°C for 1 hour under the conditions of Table 6 to prepare a vector. .

In the case of insert, the overlap PCR product of Example 2-2 was purified, digested with restriction enzymes EcoRI/XbaI for 3 hours at 37°C under the conditions of Table 7, and then gel-extracted with the prepared vector (FIG. 4). ).

After ligation at room temperature (RT) for 2 hours under the conditions shown in Table 8, E. coli DH5α or DH10β was transformed and selected in a medium containing ampicillin. The plasmids prepared from the obtained colonies were sequenced to obtain Taq DNA polymerase mutants into which E507K mutations were introduced ("E507K/R536K", "E507K/R660V" and "E507K/R536K/R660V").

BRAF p.V600E (c.1799T>A) mutation detection

3-1. Preparation of primer sets

OligoAnalyzer Tool (https://sg.idtdna.com/calc/analyzer) to design primers that generate PCR products for the p.V600E (c.1799T>A) mutation of the BRAF gene but not the wild-type BRAF gene. ) using the program to check the primer size, Tm value, primer GC content, and whether or not there is a self-complementary sequence in the primer to exclude the possibility of forming a secondary structure. was designed.

Primer information used in this example is shown in Table 12.

mutant group primer sequence (5'-3') SEQ ID NO: length Tm Molecular Weight p.V600E (c.1799T>A) V600E Fmt24 AGG TGA TTT TGG TCT AGC TAC AG A 11 24nt 64.5℃ 7423 KDa

3-2. BRAF p.V600E (c.1799T>A) detection test

BRAF p.V600E ( BRAF p.V600E ( c.1799T>A) mutation was detected.

A single base extension reaction was performed under the conditions of Table 14, the composition of the 1X D-Taq buffer in Table 14 is shown in Table 15, and the sequence information of the WT and mutant template is shown in Table 16, PCR The cycle was performed 200 cycles under the conditions of Table 17.

group sample WT WT template alone (4 pmol/) WT+ mt 0.1% WT template alone (4 pmol/) + mutant template 0.1% (4 fmol) WT+ mt 0.25% WT template alone (4 pmol/) + mutant template 0.25% (10 fmol) WT+ mt 0.5% WT template alone (4 pmol/) + mutant template 0.5% (20 fmol)

1 rxn final concentration 4.55 ul NFW - 2 ul 5X D-Taq Buffer 1X 2 ul Forward primer (10 pmol/ul): V600E Fmt24 2 uM 0.25 ul ddGTP (4 nmol/ul) 100 uM 0.2 ul Mutation-specific polymerase, 2.5 U/ul 0.5 U/rxn 1 ul WT template DNA (4 pmol/ul) 400 nM 1 ul Mutant template DNA (4f, 10f, 20fmol/ul) 0.5, 1, 2 nM 10 ul total reaction volume

final concentration MMX ADPS buffer Tris Cl (pH 8.8) 50 mM MgCl ₂ 2.5 mM KCl 60 mM (NH ₄ ) ₂ SO ₄ 2.5 mM TMAC 25 mM Tween 20 0.1% BSA 0.01%

template order SEQ ID NO: V600E_wt_PE_tmp_+5R_55 ATTTC A CTGTAGCTAGACCAAAATCACCTATTTTACTGTGAGGTCTTCATGAAG 12 V600E_mt_PE_tmp_+5R_55 ATTTC T CTGTAGCTAGACCAAAATCACCTATTTTACTGTGAGGTCTTCATGAAG 13

step temperature time One 94℃ 10 seconds
2
94℃ 5 seconds 58.4℃ 30 seconds 68℃ 5 seconds

10 ul of 2X formamide loading buffer was added to 10 ul of the resultant, and then heated to 95° C. for 5 minutes. Then, after loading on 20% Aa, 8.3M urea gel, electrophoresis was performed at 250V for 1 hour. After separating the gel and staining with a gel red dyeing die for 30 minutes, a photograph of the gel taken under UV light is shown in FIG. 6. As can be seen in FIG. 6, there were 4 pmol of WT template in all 5 lanes, In the WT group without mutation, there was no extension to 25 nt. In the group to which 0.1% (4 fmol) of the mutant template was added, faint elongation began to be seen, but the group in which the distinction was clearly confirmed was the group to which 0.5% (20 fmol) of the mutant template was added.

3-3. Mass spectrometry using MassARRAY (agena)

For the sample obtained after the single base extension reaction in Example 3-2, mass spectrometry was performed with agena's MassARRAY instrument.

As a result, as shown in FIGS. 7a to 7e , it was possible to clearly distinguish from the group to which 0.1% of the mutation template was added from the WT group in which extension did not occur, and it was found that the mutation was accurately detected with high sensitivity.

EGFR p.T790M (c.2369C>T) mutation detection

4-1. Preparation of primer sets

OligoAnalyzer Tool (https://sg.idtdna.com/calc/analyzer) to design primers that generate PCR products for the p.T790M (c.2369C>T) mutation of the EGFR gene but not the wild-type EGFR gene. ) using the program to check the primer size, Tm value, primer GC content, and whether or not there is a self-complementary sequence in the primer to exclude the possibility of forming a secondary structure. was designed.

Primer information used in this example is shown in Table 18.

mutant group primer sequence (5'-3') SEQ ID NO: length Tm Molecular Weight p.T790M
(c.2369C>T) T790M Fmt20 TC CAC CGT GCA GCT CAT CA T 14 20nt 69.5℃ 6013 KDa

4-2. EGFR p.T790M (c.2369C>T) detection test according to annealing temperature

EGFR p.T790M (c.2369C>T) using the Taq polymerase (SEQ ID NO: 2) each containing the "E507K/R536K/R660V" mutation obtained in Example 2 and the primer set of Example 4-1 Mutations were detected.

A single base extension reaction was performed on a sample containing 2 pmol of the WT template and a sample in which 0.2 pmol of a mutant template was added to 2 pmol of the WT template. The conditions of the single base extension reaction were the same as in Example 3-2, and the annealing temperature was changed to 59° C., 61.9° C., 65.1° C. and 68° C., respectively. The sequence information of the WT and mutant templates is shown in Table 19.

template order SEQ ID NO: T790M_wt_PE_tmpl_+5R_55 GCTGC G TGATGAGCTGCACGGTGGAGGTGAGGCAGATGCCCAGCAGGCGGCACAC 15 T790M_mt_PE_tmpl_+5R_55 GCTGC A TGATGAGCTGCACGGTGGAGGTGAGGCAGATGCCCAGCAGGCGGCACAC 16

As a result, as shown in FIG. 8 , in the case of the WT group, it was confirmed that an error occurred within a level that could be confirmed with the naked eye at each annealing temperature, and it was confirmed that a single base extension reaction occurred in the group to which the mutant template was added. Therefore, even if the optimized annealing temperature range for various types of targets is widened through the results of this Example, there is a problem in constructing a kit that simultaneously identifies multiple targets when using the DNA polymerase of the present invention It can be confirmed that there is no

4-3. Mass spectrometry using MassARRAY (agena)

For the sample obtained after the single base extension reaction in Example 4-2, mass spectrometry was performed with agena's MassARRAY instrument.

As a result, as shown in FIGS. 9a to 9e, it was possible to clearly distinguish the WT group in which extension did not occur from the group to which 0.1% of the mutation template was added, and it was found that the mutation was accurately detected with high sensitivity.

EGFR p.L858R(c.2573T>G) mutation detection

5-1. Preparation of primer sets

OligoAnalyzer Tool (https://sg.idtdna.com/calc/analyzer) to design primers that generate PCR products for the p.L858R (c.2573T>G) mutation of the EGFR gene but not the wild-type EGFR gene. ) using the program to check the primer size, Tm value, primer GC content, and whether or not there is a self-complementary sequence in the primer to exclude the possibility of forming a secondary structure. was designed.

Primer information used in this example is shown in Table 20.

mutant group primer sequence (5'-3') SEQ ID NO: length Tm Molecular Weight p.L858R
(c.2573T>G) L858R Fmt23 GT CAA GAT CAC AGA TTT TGG GC G 17 23nt 65.1℃ 7104 KDa

5-2. EGFR p.L858R (c.2573T>G) detection test according to annealing temperature

EGFR p.L858R (c.2573T>G) using Taq polymerase (SEQ ID NO: 2) each containing the "E507K/R536K/R660V" mutation obtained in Example 2 and the primer set of Example 5-1 Mutations were detected.

A single base extension reaction was performed on a sample containing 2 pmol of the WT template and a sample in which 0.2 pmol of a mutant template was added to 2 pmol of the WT template. The conditions of the single base extension reaction were the same as in Example 3-2, and the annealing temperature was changed to 59° C., 61.9° C., 65.1° C. and 68° C., respectively. The sequence information of the WT and mutant templates is shown in Table 21.

template order SEQ ID NO: T790M_wt_PE_tmpl_+5R_55 GCTGC G TGATGAGCTGCACGGTGGAGGTGAGGCAGATGCCCAGCAGGCGGCACAC 18 T790M_mt_PE_tmpl_+5R_55 GCTGC A TGATGAGCTGCACGGTGGAGGTGAGGCAGATGCCCAGCAGGCGGCACAC 19

As a result, as shown in FIG. 10 , in the case of the WT group, it was confirmed that errors barely visible to the naked eye occurred at each annealing temperature, and it was confirmed that a single base extension reaction occurred in the group to which the mutant template was added. Therefore, even if the optimized annealing temperature range for various types of targets is widened through the results of this Example, there is a problem in constructing a kit that simultaneously identifies multiple targets when using the DNA polymerase of the present invention It can be confirmed that there is no

5-3. Mass spectrometry using MassARRAY (agena)

The result of Example 5-2 confirmed that a single base extension reaction occurred in the group to which the mutant template was added, but it was difficult to determine the maximum sensitivity with the naked eye. Therefore, in this Example, in order to confirm the sensitivity by detecting the mutation by mass spectrometry using MALDI-TOF, mass spectrometry was performed on the sample obtained after the single base extension reaction in Example 5-2 with a MassARRAY instrument from agena. .

As a result, as confirmed in FIGS. 11a to 11e , it was possible to clearly distinguish from the group to which 0.1% of the mutation template was added from the WT group in which extension did not occur, and it was found that the mutation was accurately detected with high sensitivity.

Multiplex for 3 different targets

In this example, multiplexing was performed on the three target mutations performed in Examples 3 to 5 above. The experimental procedure is the same as in Examples to 5, but the section representing the amount of the unextended primer of BRAF.V600E and the section representing the amount of the extended primer of EGFR.L868R overlap between 7400-7500, so the BRAF p.V600E mutation By extending T to the target primer, the section representing the amount of the unextended primer of BRAF.V600E and the section representing the amount of the extended primer of BRAF.V600E are shifted to the right by 305 molecular weight to confirm all three targets together. made to be

As a result, as shown in FIGS. 12A to 12E , it was possible to clearly distinguish the WT group in which extension did not occur from the group in which 0.1% of the mutation template was added, and it was found that three different target mutations were simultaneously and accurately detected. In addition, it can be seen that by adjusting the length of the primers through this example, it is possible to simultaneously detect up to 30 to 40 different target mutations at a time.

SEQUENCE LISTING <110> GeneCast Co., Ltd. <120> MASS SPECTROMETRY USING DNA POLYMERASES WITH INCREASED MUTATION SPECIFICITY <130> 1066885 <150> KR 10-2019-0004225 <151> 2019-01-11 <160> 20 <170> PatentIn version 3.2 <210> 1 <211> 832 <212> PRT <213> <220> <223> Thermus aquaticus DNA polymerase (Taq) <400> 1 Met Arg Gly Met Leu Pro Leu Phe Glu Pro Lys Gly Arg Val Leu Leu 1 5 10 15 Val Asp Gly His His Leu Ala Tyr Arg Thr Phe His Ala Leu Lys Gly 20 25 30 Leu Thr Thr Ser Arg Gly Glu Pro Val Gln Ala Val Tyr Gly Phe Ala 35 40 45 Lys Ser Leu Leu Lys Ala Leu Lys Glu Asp Gly Asp Ala Val Ile Val 50 55 60 Val Phe Asp Ala Lys Ala Pro Ser Phe Arg His Glu Ala Tyr Gly Gly 65 70 75 80 Tyr Lys Ala Gly Arg Ala Pro Thr Pro Glu Asp Phe Pro Arg Gln Leu 85 90 95 Ala Leu Ile Lys Glu Leu Val Asp Leu Leu Gly Leu Ala Arg Leu Glu 100 105 110 Val Pro Gly Tyr Glu Ala Asp Asp Val Leu Ala Ser Leu Ala Lys Lys 115 120 125 Ala Glu Lys Glu Gly Tyr Glu Val Arg Ile Leu Thr Ala Asp Lys Asp 130 135 140 Leu Tyr Gln Leu Leu Ser Asp Arg Ile His Val Leu His Pro Glu Gly 145 150 155 160 Tyr Leu Ile Thr Pro Ala Trp Leu Trp Glu Lys Tyr Gly Leu Arg Pro 165 170 175 Asp Gln Trp Ala Asp Tyr Arg Ala Leu Thr Gly Asp Glu Ser Asp Asn 180 185 190 Leu Pro Gly Val Lys Gly Ile Gly Glu Lys Thr Ala Arg Lys Leu Leu 195 200 205 Glu Glu Trp Gly Ser Leu Glu Ala Leu Leu Lys Asn Leu Asp Arg Leu 210 215 220 Lys Pro Ala Ile Arg Glu Lys Ile Leu Ala His Met Asp Asp Leu Lys 225 230 235 240 Leu Ser Trp Asp Leu Ala Lys Val Arg Thr Asp Leu Pro Leu Glu Val 245 250 255 Asp Phe Ala Lys Arg Arg Glu Pro Asp Arg Glu Arg Leu Arg Ala Phe 260 265 270 Leu Glu Arg Leu Glu Phe Gly Ser Leu Leu His Glu Phe Gly Leu Leu 275 280 285 Glu Ser Pro Lys Ala Leu Glu Glu Ala Pro Trp Pro Pro Glu Gly 290 295 300 Ala Phe Val Gly Phe Val Leu Ser Arg Lys Glu Pro Met Trp Ala Asp 305 310 315 320 Leu Leu Ala Leu Ala Ala Ala Arg Gly Gly Arg Val His Arg Ala Pro 325 330 335 Glu Pro Tyr Lys Ala Leu Arg Asp Leu Lys Glu Ala Arg Gly Leu Leu 340 345 350 Ala Lys Asp Leu Ser Val Leu Ala Leu Arg Glu Gly Leu Gly Leu Pro 355 360 365 Pro Gly Asp Asp Pro Met Leu Leu Ala Tyr Leu Leu Asp Pro Ser Asn 370 375 380 Thr Thr Pro Glu Gly Val Ala Arg Arg Tyr Gly Gly Glu Trp Thr Glu 385 390 395 400 Glu Ala Gly Glu Arg Ala Ala Leu Ser Glu Arg Leu Phe Ala Asn Leu 405 410 415 Trp Gly Arg Leu Glu Gly Glu Glu Arg Leu Leu Trp Leu Tyr Arg Glu 420 425 430 Val Glu Arg Pro Leu Ser Ala Val Leu Ala His Met Glu Ala Thr Gly 435 440 445 Val Arg Leu Asp Val Ala Tyr Leu Arg Ala Leu Ser Leu Glu Val Ala 450 455 460 Glu Glu Ile Ala Arg Leu Glu Ala Glu Val Phe Arg Leu Ala Gly His 465 470 475 480 Pro Phe Asn Leu Asn Ser Arg Asp Gln Leu Glu Arg Val Leu Phe Asp 485 490 495 Glu Leu Gly Leu Pro Ala Ile Gly Lys Thr Glu Lys Thr Gly Lys Arg 500 505 510 Ser Thr Ser Ala Ala Val Leu Glu Ala Leu Arg Glu Ala His Pro Ile 515 520 525 Val Glu Lys Ile Leu Gln Tyr Arg Glu Leu Thr Lys Leu Lys Ser Thr 530 535 540 Tyr Ile Asp Pro Leu Pro Asp Leu Ile His Pro Arg Thr Gly Arg Leu 545 550 555 560 His Thr Arg Phe Asn Gln Thr Ala Thr Ala Thr Gly Arg Leu Ser Ser 565 570 575 Ser Asp Pro Asn Leu Gln Asn Ile Pro Val Arg Thr Pro Leu Gly Gln 580 585 590 Arg Ile Arg Arg Ala Phe Ile Ala Glu Glu Gly Trp Leu Leu Val Ala 595 600 605 Leu Asp Tyr Ser Gln Ile Glu Leu Arg Val Leu Ala His Leu Ser Gly 610 615 620 Asp Glu Asn Leu Ile Arg Val Phe Gin Glu Gly Arg Asp Ile His Thr 625 630 635 640 Glu Thr Ala Ser Trp Met Phe Gly Val Pro Arg Glu Ala Val Asp Pro 645 650 655 Leu Met Arg Arg Ala Ala Lys Thr Ile Asn Phe Gly Val Leu Tyr Gly 660 665 670 Met Ser Ala His Arg Leu Ser Gln Glu Leu Ala Ile Pro Tyr Glu Glu 675 680 685 Ala Gln Ala Phe Ile Glu Arg Tyr Phe Gln Ser Phe Pro Lys Val Arg 690 695 700 Ala Trp Ile Glu Lys Thr Leu Glu Glu Gly Arg Arg Arg Gly Tyr Val 705 710 715 720 Glu Thr Leu Phe Gly Arg Arg Arg Tyr Val Pro Asp Leu Glu Ala Arg 725 730 735 Val Lys Ser Val Arg Glu Ala Ala Glu Arg Met Ala Phe Asn Met Pro 740 745 750 Val Gln Gly Thr Ala Ala Asp Leu Met Lys Leu Ala Met Val Lys Leu 755 760 765 Phe Pro Arg Leu Glu Glu Met Gly Ala Arg Met Leu Leu Gln Val His 770 775 780 Asp Glu Leu Val Leu Glu Ala Pro Lys Glu Arg Ala Glu Ala Val Ala 785 790 795 800 Arg Leu Ala Lys Glu Val Met Glu Gly Val Tyr Pro Leu Ala Val Pro 805 810 815 Leu Glu Val Glu Val Gly Ile Gly Glu Asp Trp Leu Ser Ala Lys Glu 820 825 830 <210> 2 <211> 832 <212> PRT <213> <220> <223> Taq E507K/R536K/R660V <400> 2 Met Arg Gly Met Leu Pro Leu Phe Glu Pro Lys Gly Arg Val Leu Leu 1 5 10 15 Val Asp Gly His His Leu Ala Tyr Arg Thr Phe His Ala Leu Lys Gly 20 25 30 Leu Thr Thr Ser Arg Gly Glu Pro Val Gln Ala Val Tyr Gly Phe Ala 35 40 45 Lys Ser Leu Leu Lys Ala Leu Lys Glu Asp Gly Asp Ala Val Ile Val 50 55 60 Val Phe Asp Ala Lys Ala Pro Ser Phe Arg His Glu Ala Tyr Gly Gly 65 70 75 80 Tyr Lys Ala Gly Arg Ala Pro Thr Pro Glu Asp Phe Pro Arg Gln Leu 85 90 95 Ala Leu Ile Lys Glu Leu Val Asp Leu Leu Gly Leu Ala Arg Leu Glu 100 105 110 Val Pro Gly Tyr Glu Ala Asp Asp Val Leu Ala Ser Leu Ala Lys Lys 115 120 125 Ala Glu Lys Glu Gly Tyr Glu Val Arg Ile Leu Thr Ala Asp Lys Asp 130 135 140 Leu Tyr Gln Leu Leu Ser Asp Arg Ile His Val Leu His Pro Glu Gly 145 150 155 160 Tyr Leu Ile Thr Pro Ala Trp Leu Trp Glu Lys Tyr Gly Leu Arg Pro 165 170 175 Asp Gln Trp Ala Asp Tyr Arg Ala Leu Thr Gly Asp Glu Ser Asp Asn 180 185 190 Leu Pro Gly Val Lys Gly Ile Gly Glu Lys Thr Ala Arg Lys Leu Leu 195 200 205 Glu Glu Trp Gly Ser Leu Glu Ala Leu Leu Lys Asn Leu Asp Arg Leu 210 215 220 Lys Pro Ala Ile Arg Glu Lys Ile Leu Ala His Met Asp Asp Leu Lys 225 230 235 240 Leu Ser Trp Asp Leu Ala Lys Val Arg Thr Asp Leu Pro Leu Glu Val 245 250 255 Asp Phe Ala Lys Arg Arg Glu Pro Asp Arg Glu Arg Leu Arg Ala Phe 260 265 270 Leu Glu Arg Leu Glu Phe Gly Ser Leu Leu His Glu Phe Gly Leu Leu 275 280 285 Glu Ser Pro Lys Ala Leu Glu Glu Ala Pro Trp Pro Pro Glu Gly 290 295 300 Ala Phe Val Gly Phe Val Leu Ser Arg Lys Glu Pro Met Trp Ala Asp 305 310 315 320 Leu Leu Ala Leu Ala Ala Ala Arg Gly Gly Arg Val His Arg Ala Pro 325 330 335 Glu Pro Tyr Lys Ala Leu Arg Asp Leu Lys Glu Ala Arg Gly Leu Leu 340 345 350 Ala Lys Asp Leu Ser Val Leu Ala Leu Arg Glu Gly Leu Gly Leu Pro 355 360 365 Pro Gly Asp Asp Pro Met Leu Leu Ala Tyr Leu Leu Asp Pro Ser Asn 370 375 380 Thr Thr Pro Glu Gly Val Ala Arg Arg Tyr Gly Gly Glu Trp Thr Glu 385 390 395 400 Glu Ala Gly Glu Arg Ala Ala Leu Ser Glu Arg Leu Phe Ala Asn Leu 405 410 415 Trp Gly Arg Leu Glu Gly Glu Glu Arg Leu Leu Trp Leu Tyr Arg Glu 420 425 430 Val Glu Arg Pro Leu Ser Ala Val Leu Ala His Met Glu Ala Thr Gly 435 440 445 Val Arg Leu Asp Val Ala Tyr Leu Arg Ala Leu Ser Leu Glu Val Ala 450 455 460 Glu Glu Ile Ala Arg Leu Glu Ala Glu Val Phe Arg Leu Ala Gly His 465 470 475 480 Pro Phe Asn Leu Asn Ser Arg Asp Gln Leu Glu Arg Val Leu Phe Asp 485 490 495 Glu Leu Gly Leu Pro Ala Ile Gly Lys Thr Lys Lys Thr Gly Lys Arg 500 505 510 Ser Thr Ser Ala Ala Val Leu Glu Ala Leu Arg Glu Ala His Pro Ile 515 520 525 Val Glu Lys Ile Leu Gln Tyr Lys Glu Leu Thr Lys Leu Lys Ser Thr 530 535 540 Tyr Ile Asp Pro Leu Pro Asp Leu Ile His Pro Arg Thr Gly Arg Leu 545 550 555 560 His Thr Arg Phe Asn Gln Thr Ala Thr Ala Thr Gly Arg Leu Ser Ser 565 570 575 Ser Asp Pro Asn Leu Gln Asn Ile Pro Val Arg Thr Pro Leu Gly Gln 580 585 590 Arg Ile Arg Arg Ala Phe Ile Ala Glu Glu Gly Trp Leu Leu Val Ala 595 600 605 Leu Asp Tyr Ser Gln Ile Glu Leu Arg Val Leu Ala His Leu Ser Gly 610 615 620 Asp Glu Asn Leu Ile Arg Val Phe Gin Glu Gly Arg Asp Ile His Thr 625 630 635 640 Glu Thr Ala Ser Trp Met Phe Gly Val Pro Arg Glu Ala Val Asp Pro 645 650 655 Leu Met Arg Val Ala Ala Lys Thr Ile Asn Phe Gly Val Leu Tyr Gly 660 665 670 Met Ser Ala His Arg Leu Ser Gln Glu Leu Ala Ile Pro Tyr Glu Glu 675 680 685 Ala Gln Ala Phe Ile Glu Arg Tyr Phe Gln Ser Phe Pro Lys Val Arg 690 695 700 Ala Trp Ile Glu Lys Thr Leu Glu Glu Gly Arg Arg Arg Gly Tyr Val 705 710 715 720 Glu Thr Leu Phe Gly Arg Arg Arg Tyr Val Pro Asp Leu Glu Ala Arg 725 730 735 Val Lys Ser Val Arg Glu Ala Ala Glu Arg Met Ala Phe Asn Met Pro 740 745 750 Val Gln Gly Thr Ala Ala Asp Leu Met Lys Leu Ala Met Val Lys Leu 755 760 765 Phe Pro Arg Leu Glu Glu Met Gly Ala Arg Met Leu Leu Gln Val His 770 775 780 Asp Glu Leu Val Leu Glu Ala Pro Lys Glu Arg Ala Glu Ala Val Ala 785 790 795 800 Arg Leu Ala Lys Glu Val Met Glu Gly Val Tyr Pro Leu Ala Val Pro 805 810 815 Leu Glu Val Glu Val Gly Ile Gly Glu Asp Trp Leu Ser Ala Lys Glu 820 825 830 <210> 3 <211> 20 <212> DNA <213> <220> <223> Eco-F <400> 3 ggggtacctc atcaccccgg 20 <210> 4 <211> 27 <212> DNA <213> <220> <223> R536K-R <400> 4 cttggtgagc tccttgtact gcaggat 27 <210> 5 <211> 27 <212> DNA <213> <220> <223> R536K-F <400> 5 atcctgcagt acaaggagct caccaag 27 <210> 6 <211> 30 <212> DNA <213> <220> <223> R660V-R <400> 6 gatggtcttg gccgccacgc gcatcagggg 30 <210> 7 <211> 30 <212> DNA <213> <220> <223> R660V-F <400> 7 cccctgatgc gcgtggcggc caagaccatc 30 <210> 8 <211> 32 <212> DNA <213> <220> <223> Xba-R <400> 8 gctctagact atcactcctt ggcggagagc ca 32 <210> 9 <211> 27 <212> DNA <213> <220> <223> E507K-R <400> 9 cttgccggtc tttttcgtct tgccgat 27 <210> 10 <211> 27 <212> DNA <213> <220> <223> E507K-F <400> 10 atcggcaaga cgaaaaagac cggcaag 27 <210> 11 <211> 24 <212> DNA <213> <220> <223> V600E Fmt24 <400> 11 aggtgatttt ggtctagcta caga 24 <210> 12 <211> 55 <212> DNA <213> <220> <223> V600E_wt_PE_tmp_+5R_55 <400> 12 atttcactgt agctagacca aaatcaccta tttttactgt gaggtcttca tgaag 55 <210> 13 <211> 55 <212> DNA <213> <220> <223> V600E_mt_PE_tmp_+5R_55 <400> 13 atttctctgt agctagacca aaatcaccta tttttactgt gaggtcttca tgaag 55 <210> 14 <211> 20 <212> DNA <213> <220> <223> T790M Fmt20 <400> 14 tccaccgtgc agctcatcat 20 <210> 15 <211> 55 <212> DNA <213> <220> <223> T790M_wt_PE_tmpl_+5R_55 <400> 15 gctgcgtgat gagctgcacg gtggaggtga ggcagatgcc cagcaggcgg cacac 55 <210> 16 <211> 55 <212> DNA <213> <220> <223> T790M_mt_PE_tmpl_+5R_55 <400> 16 gctgcatgat gagctgcacg gtggaggtga ggcagatgcc cagcaggcgg cacac 55 <210> 17 <211> 23 <212> DNA <213> <220> <223> L858R Fmt23 <400> 17 gtcaagatca cagatttgg gcg 23 <210> 18 <211> 55 <212> DNA <213> <220> <223> T790M_wt_PE_tmpl_+5R_55 <400> 18 gctgcgtgat gagctgcacg gtggaggtga ggcagatgcc cagcaggcgg cacac 55 <210> 19 <211> 55 <212> DNA <213> <220> <223> T790M_mt_PE_tmpl_+5R_55 <400> 19 gctgcatgat gagctgcacg gtggaggtga ggcagatgcc cagcaggcgg cacac 55 <210> 20 <211> 2499 <212> DNA <213> <220> <223> Taq E507K/R536K/R660V <400> 20 atgaggggga tgctgcccct ctttgagccc aagggccggg tcctcctggt ggacggccac 60 cacctggcct accgcacctt ccacgccctg aagggcctca ccaccagccg gggggagccg 120 gtgcaggcgg tctacggctt cgccaagagc ctcctcaagg ccctcaagga ggacggggac 180 gcggtgatcg tggtctttga cgccaaggcc ccctccttcc gccacgaggc ctacgggggg 240 tacaaggcgg gccgggcccc cacgccggag gactttcccc ggcaactcgc cctcatcaag 300 gagctggtgg acctcctggg gctggcgcgc ctcgaggtcc cgggctacga ggcggacgac 360 gtcctggcca gcctggccaa gaaggcggaa aaggagggct acgaggtccg catcctcacc 420 gccgacaaag acctttacca gctcctttcc gaccgcatcc acgtcctcca ccccgagggg 480 tacctcatca ccccggcctg gctttgggaa aagtacggcc tgaggcccga ccagtgggcc 540 gactaccggg ccctgaccgg ggacgagtcc gacaaccttc ccggggtcaa gggcatcggg 600 gagaagacgg cgaggaagct tctggaggag tgggggagcc tggaagccct cctcaagaac 660 ctggaccggc tgaagcccgc catccgggag aagatcctgg cccacatgga cgatctgaag 720 ctctcctggg acctggccaa ggtgcgcacc gacctgcccc tggaggtgga cttcgccaaa 780 aggcgggagc ccgaccggga gaggcttagg gcctttctgg agaggcttga gtttggcagc 840 ctcctccacg agttcggcct tctggaaagc cccaaggccc tggaggaggc cccctggccc 900 ccgccggaag gggccttcgt gggctttgtg ctttcccgca aggagcccat gtgggccgat 960 cttctggccc tggccgccgc cagggggggc cgggtccacc gggcccccga gccttataaa 1020 gccctcaggg acctgaagga ggcgcggggg cttctcgcca aagacctgag cgttctggcc 1080 ctgagggaag gccttggcct cccgcccggc gacgacccca tgctcctcgc ctacctcctg 1140 gacccttcca acaccacccc cgagggggtg gcccggcgct acggcgggga gtggacggag 1200 gaggcggggg agcgggccgc cctttccgag aggctcttcg ccaacctgtg ggggaggctt 1260 gagggggagg agaggctcct ttggctttac cgggaggtgg agaggcccct ttccgctgtc 1320 ctggcccaca tggaggccac gggggtgcgc ctggacgtgg cctatctcag ggccttgtcc 1380 ctggaggtgg ccgaggagat cgcccgcctc gaggccgagg tcttccgcct ggccggccac 1440 cccttcaacc tcaactcccg ggaccagctg gaaagggtcc tctttgacga gctagggctt 1500 cccgccatcg gcaagacgaa aaagaccggc aagcgctcca ccagcgccgc cgtcctggag 1560 gccctccgcg aggcccaccc catcgtggag aagatcctgc agtacaagga gctcaccaag 1620 ctgaagagca cctacattga ccccttgccg gacctcatcc accccaggac gggccgcctc 1680 cacacccgct tcaaccagac ggccacggcc acgggcaggc taagtagctc cgatcccaac 1740 ctccagaaca tccccgtccg caccccgctt gggcagagga tccgccgggc cttcatcgcc 1800 gaggaggggt ggctattggt ggccctggac tatagccaga tagagctcag ggtgctggcc 1860 cacctctccg gcgacgagaa cctgatccgg gtcttccagg aggggcggga catccacacg 1920 gagaccgcca gctggatgtt cggcgtcccc cgggaggccg tggaccccct gatgcgcgtg 1980 gcggccaaga ccatcaactt cggggtcctc tacggcatgt cggcccaccg cctctcccag 2040 gagctagcca tcccttacga ggaggcccag gccttcattg agcgctactt tcagagcttc 2100 cccaaggtgc gggcctggat tgagaagacc ctggaggagg gcaggaggcg ggggtacgtg 2160 gagaccctct tcggccgccg ccgctacgtg ccagacctag aggcccgggt gaagagcgtg 2220 cgggaggcgg ccgagcgcat ggccttcaac atgcccgtcc agggcaccgc cgccgacctc 2280 atgaagctgg ctatggtgaa gctcttcccc aggctggagg aaatgggggc caggatgctc 2340 cttcaggtcc acgacgagct ggtcctcgag gccccaaaag agagggcgga ggccgtggcc 2400 cggctggcca aggaggtcat ggagggggtg tatcccctgg ccgtgcccct ggaggtggag 2460 gtggggatag gggaggactg gctctccgcc aaggagtga 2499

Claims (16)

delete delete In the amino acid sequence of SEQ ID NO: 1, the 507th amino acid residue, glutamic acid (E), is substituted with lysine (K), the 536th amino acid residue, arginine (R) is substituted with lysine (K), and the 660th amino acid residue, arginine ( R) Taq polymerase in which valine (V) is substituted; and/or
one or more matched primers, one or more mismatched primers, or both one or more matched primers and one or more mismatched primers;
A kit for use in gene mutation detection using mass spectrometry, comprising a. The kit of claim 3 , wherein the one or more matched primers and one or more mismatched primers hybridize with a target sequence. The kit for use in gene mutation detection using mass spectrometry according to claim 3, further comprising dideoxynucleoside triphosphate. 4. The method of claim 3, comprising 25-100 mM KCl; and 1 to 7 mM (NH ₄ ) ₂ SO ₄ ; and a PCR buffer composition having a final pH of 8.0 to 9.5. A kit for use in gene mutation detection using mass spectrometry. 4. The method of claim 3, comprising 40 to 90 mM KCl; 1-5 mM (NH ₄ ) ₂ SO ₄ ; and 10 to 40 mM of TMAC (Tetra methyl ammonium chloride), and further comprising a PCR buffer composition having a final pH of 8.0 to 9.0, a kit for use in gene mutation detection using mass spectrometry. In the amino acid sequence of SEQ ID NO: 1, the 507th amino acid residue, glutamic acid (E), is substituted with lysine (K), the 536th amino acid residue, arginine (R) is substituted with lysine (K), and the 660th amino acid residue, arginine ( R) A method for detecting gene mutations by mass spectrometry using Taq polymerase in which valine (V) is substituted. 9. The method of claim 8,
(a) extracting nucleic acids from the isolated biological sample;
(b) glutamic acid (E), which is the 507th amino acid residue in the amino acid sequence of SEQ ID NO: 1, is substituted with lysine (K), and arginine (R), which is the 536th amino acid residue, is substituted with lysine (K) in the extracted nucleic acid, performing PCR by treating Taq polymerase in which arginine (R), which is the 660th amino acid residue, is substituted with valine (V); and
(c) a method of detecting a gene mutation by mass spectrometry, comprising the step of analyzing the size or nucleotide sequence of the PCR result amplification product. 10. The method of claim 9, wherein the biological sample of step (a) is whole blood, serum, plasma, urine, feces, sputum, saliva (saliva) , any one or more selected from the group consisting of tissues, cells, cell extracts and in vitro cell cultures, a method for detecting gene mutations by mass spectrometry. 10. The method of claim 9, wherein in step (b) one or more matched primers, one or more mismatched primers or both one or more matched primers and one or more mismatched primers are treated, wherein the one or more matched primers and one A method of detecting a gene mutation by mass spectrometry, wherein the mismatched primers are hybridized with the target sequence. The method of claim 9, wherein step (c) is to analyze the mass of the PCR amplification product by mass spectrometry. 13. The method of claim 12, wherein the mass spectrometry is matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry, laser desorption mass spectrometry (LDMS), electrospray (ES) mass spectrometry, ion cyclotron resonance (ICR). ) is selected from the group consisting of mass spectrometry, mass array (MassARRAY) and Fourier transform mass spectrometry, a method for detecting a gene mutation by mass spectrometry. 13. The method of claim 12, wherein analyzing the mass of the PCR amplification product in step (c) comprises a difference in molecular weight as much as dideoxynucleoside triphosphate between the amplification product of the matched primer and the product in which primer amplification does not occur due to mismatch. A method of detecting a gene mutation by mass spectrometry to confirm the. The method according to claim 8, wherein the method is used for diagnosing a disease, predicting a prognosis of a disease, or predicting drug reactivity. The method according to claim 8, wherein the method simultaneously detects at least three or more different target mutations in a single PCR process.

Images