KR102285906B1 - Composition for inducing large mouth bass sterility for management of disturbing fish species in aquatic ecosystem - Google Patents

Abstract

The present invention relates to a composition for inducing Micropterus salmoides infertility for management of disturbed fish species in aquatic ecosystems. Specifically, by producing sterile Micropterus salmoides in which a target region of a gene encoding a species-specific sperm-egg recognition protein of the Micropterus salmoides is cut, and applying the Micropterus salmoides to the aquatic ecosystems, it is possible to contribute to the protection of the ecosystems by promoting a decrease in the number of the Micropterus salmoides, which disturb the aquatic ecosystems of Korea.

Description

Composition for inducing large mouth bass sterility for management of disturbing fish species in aquatic ecosystem

The present invention relates to a composition for inducing largemouth bass infertility for the management of disturbed fish species in aquatic ecosystems.

Large Mouth Bass ( Micropterus) salmoides ) is native to North America, and 500 fry of 3~4 cm in size were first introduced to Korea in June 1973 from Louisiana, USA for test culture. Like the bluegill, it belongs to the family Centrachidae, and the English name was translated as it is, and in Korea, it was called the bigmouth bass. The carnivorous largemouth bass eats river prawns and fry of native fish from the time they are young, and it causes imbalance in the aquatic ecosystem by predation of various aquatic organisms including indigenous fish in Korea. Despite various attempts to eradicate and manage these largemouth bass, the adverse effect on the habitat of endemic species in Korea is becoming increasingly serious due to the artificial inflow by anglers and the lack of research on effective methods of extermination.

Until recently, various repelling methods based on research on the ecological and reproductive characteristics of largemouth bass, namely fishing method, throwing method, static net method, gillnetting method, pole method, pumping method, harpoon method, electric shock method, artificial spawning ground Although laws and natural enemy laws have been proposed, it can be said that the actual results of implementation and verification of realistic effects are insufficient.

Among the technical countermeasures for prevention and eradication, the artificial spawning field method uses the reproductive habits of largemouth bass to induce spawning and then removes fertilized eggs. is the only way to capture and remove them at once. However, even if an artificial spawning field is installed, it has a disadvantage that the effect of catching eggs is low if there is an appropriate spawning site (Bonggu Lim et al., 2012).

On the other hand, with the recent development of gene editing technology, DNA is cut with gene scissors to treat cancer, AIDS, and hemophilia, and it is used to block the spread of insect-borne diseases by using it to control disease-mediating pests. Gene editing is a technology that cures diseases by cutting and removing disease-causing DNA or modifying genes that add necessary DNA. . Current gene editing CRISPR / Cas9 receiving the most popular of the techniques (Clustered Regularly Interspaced Short Palindromic Repeats) is an immune system of the bacteria to resist the viruses pyogenic streptococci CRISPR Ⅱ system is most commonly known of (Streptococcus pyogenes), and the It has been developed and used as a third-generation gene scissors (Elaswad et al ., 2018; Gantz et al ., 2015; Hashimoto and Takemoto, 2015). When a virus invades a bacterium, the invading viral DNA is chopped, and the cut DNA fragment is inserted into the genome of the bacterium, which is called CRISPR. A small guide RNA (sgRNA) is made from the CRISPR part and then combined with Cas9 nuclease produced in bacteria. If the same virus invades again, the guide RNA finds and binds to the viral DNA, and Cas9 nuclease cuts the viral DNA, blocking the virus's growth. Active attempts are being made to prevent the spread of diseases by inducing and utilizing infertile individuals of mosquitoes that transmit fatal diseases such as dengue fever, microcephaly, and malaria to humans using these gene scissors.

Korean Patent Application Laid-Open No. 2020-0088446 discloses an invention related to endonuclease sex discrimination and infertility in insects, comprising the steps of integrating at least one nucleic acid sequence into the genome of a first insect, wherein the at least one nucleic acid sequence is a female- comprising at least one first guide polynucleotide targeting a female-essential genomic sequence necessary for specific viability; introducing an endonuclease into a second insect, wherein the second insect can be genetically crossed with the first insect; and genetically crossing the first insect and the second insect, wherein the crossing produces progeny comprising the endonuclease and the at least one nucleic acid sequence from which a male insect egg matures into an adult. Disclosed is a method for instructing male sex in the offspring of a genetically modified insect, and a genetically modified sterile male insect produced by the method, comprising:

Korean Patent Application Laid-Open No. 2016-0013219 discloses genetically engineered livestock animals, and methods for producing and using the same, including genetic manipulation to disrupt a target gene selectively involved in the process of germline formation, and the interference of the target gene is Prevents the formation of functional gametes in animals. The present invention discloses an animal producing a progeny having a donor genetic trait, and a method for producing and using the same. However, in this prior art, the configuration for managing fish species causing disturbance of the aquatic ecosystem in the rivers of Korea is not described.

Korean Patent Application Laid-Open No. 2020-0088446, Endonuclease Sex and Infertility in Insects, published on July 22, 2020. Korean Patent Application Laid-Open No. 2016-0013219, Genetic Infertile Animals, 2016. 02.03. open.

Vicens A., L. Lke, and E. R. S. Roldan. 2014. Proteins Involved in Motility and Sperm-Egg Interaction Evolve More Rapidly in Mouse Spermatozoa. PLos One 9(3):e91302. Li S., J. Bai, L. Cai, D. Ma, and F. Du. 2012. The complete mitochondrial genomes of largemouth bass of the northern subspecies (Micropterus salmoides salmoides) and Florida subspecies (Micropterus salmoides floridanus) and their applications in the identification of largemouth bass species. Mitochondrial DNA 23(2):92-9. Bong-Goo Lim, Asian Environmental Justice Research Institute. 2012. A study on the distribution characteristics of exotic fish species harmful to the Han River ecosystem and effective countermeasures to eradicate them. Han River Basin Environment Agency, Han River Water System Management Committee. Hanam. pp 20-29 Elaswad A., K. Khalil, D. Cline, PP McCaw, W. Chen, M. Michel, R. Cone, and R. Dunham. 2018. Microinjection of CRISPRCas9 Protein into Channel Catfish, Ictalurus punctatus, Embryos for Gene Editing. Journal of visualized experiments 20;(131):56275. Gantz VM, N. Jasinskiene, O. Tatarenkova, A. Fazekas, VM Macias, E. Bier, and AA James. 2015. Highly efficient Cas9-mediated gene drive for population modification of the malaria vector mosquito Anopheles stephensi. Proceedings of the National Academy of Sciences of the United States of America 112(49):E6736-43. Hashimoto M., and T. Takemoto. 2015. Electroporation enables the efficient mRNA delivery into the mouse zygotes and facilitates CRISPRCas9-based genome editing. Scientific reports 5:11315.

Vicens A., L. Lke, and ERS Roldan. 2014. Proteins Involved in Motility and Sperm-Egg Interaction Evolve More Rapidly in Mouse Spermatozoa. PLos One 9(3):e91302. Li S., J. Bai, L. Cai, D. Ma, and F. Du. 2012. The complete mitochondrial genomes of largemouth bass of the northern subspecies (Micopterus salmoides salmoides) and Florida subspecies (Micropterus salmoides floridanus) and their applications in the identification of largemouth bass species. Mitochondrial DNA 23(2):92-9.

It is an object of the present invention to provide a composition for inducing largemouth bass infertility for the management of disturbed fish species in aquatic ecosystems.

For the above purpose, the present invention provides a composition for inducing largemouth bass infertility for managing disturbed fish species in aquatic ecosystems. The present invention provides Cas9 protein and Micropterus salmoides ) comprising a guide RNA comprising a targeting sequence that specifically binds to a target site of a gene encoding a species-specific sperm-egg recognition protein, wherein the guide RNA encodes a species-specific sperm-egg recognition protein A large mouth comprising a nucleic acid sequence capable of hybridizing to a continuous 17 bp to 23 bp target site located adjacent to the 5' end or 3' end of the proto-spacer-adjacent motif (PAM) sequence recognized by the Cas9 protein in the gene Bath ( Micropterus salmoides ) Provides a composition for infertility induction.

The gene encoding the species-specific sperm-egg recognition protein is Zona pellucida sperm-binding protein, Spermatogenesis-associated protein, Motile sperm domain-containing protein, Sperm-associated antigen, IZUMO1, Round spermatid basic protein, Sperm-tail PG- It may be a gene encoding one or more selected from rich repeat-containing protein, sperm acrosome membrane-associated protein, acrosomal vesicle, and sperm flagellum protein.

The gene encoding the species-specific sperm-egg recognition protein may be an IZUMO1 gene comprising one nucleic acid sequence selected from SEQ ID NOs: 1 to 3. IZUMO1 is a sperm cell surface protein required for fertilization and is essential for the binding and fusion of the oocyte to the plasma membrane.

The gene encoding the species-specific sperm-egg recognition protein may be a zona pellucida gene comprising the nucleic acid sequence of SEQ ID NO: 4. Zona pellucida is an important component of oocytes and oocytes, and is important in binding to sperm and initiating the acrosome reaction.

The guide RNA is characterized in that it is hybridizable to a target site comprising one or more nucleic acid sequences selected from SEQ ID NOs: 5 to 25.

In addition, the guide RNA of the present invention is characterized in that it comprises one nucleic acid sequence selected from SEQ ID NOs: 26 to 46.

The guide RNA may be a single-stranded guide RNA (sgRNA).

The present invention provides infertility-induced large-mouth bass ( Micropterus) salmoides ).

The production method of the infertility-induced large-mouth bass,

Collecting sperm of males and eggs of females during spawning of largemouth bass;

producing a fertilized egg by fertilizing the sperm and egg of the collected large-mouth bass;

Encrypted nucleotide sequence of the one in the manufacturing microinjector in embryos any one of claims 1 to 5 claim largemouth bass (Micropterus salmoides) the species-specific sperm or egg recognition of fertilized eggs by injecting a composition for sterility induced protein (Target sequence ) to edit the steps:

and incubating a fertilized egg having the edited species-specific sperm or egg recognition protein.

The present invention is the large mouth bath ( Micropterus salmoides ) provides an infertility large mouth bath produced by a composition for inducing infertility.

In addition, the present invention is the infertility-induced large-mouth bass ( Micropterus salmoides ) provides a sterile largemouth bass produced by the production method.

The present invention provides a method for removing largemouth bass, which is a disturbing fish species in an aquatic ecosystem.

The method of removing the largemouth bass, which is a disturbing fish species, in the aquatic ecosystem,

The largemouth bass ( Micropterus salmoides ) infertility large-mouth bath produced by the composition for infertility or the infertility-induced large-mouth bath ( Micropterus) salmoides ) is characterized in that the sterile largemouth bass produced by the production method is discharged into a river.

The present invention relates to a composition for inducing largemouth bass infertility for the management of disturbed fish species in aquatic ecosystems, and more specifically, by using a composition for inducing largemouth bass infertility for management of disturbed fish species in aquatic ecosystems, producing sterile largemouth bass and applying it to an aquatic ecosystem. It can contribute to the protection of the ecosystem by promoting the decrease in the number of largemouth bass, which disturbs the aquatic ecosystem of Korea.

1 is a large mouth bath used in the present invention ( Micropterus salmoides ) NJ tree.
2 is a schematic diagram showing GO terms classification as a result of functional annotation by applying Gene Ontology (GO) database to Unigene obtained in the present invention.
Figure 3 is a schematic diagram showing the analysis result of the biological process (BP) of the GO terms of Unigene obtained in the present invention.
4 is a schematic diagram showing the analysis result of the cellular component (CC) among the GO terms of Unigene obtained in the present invention.
5 is a schematic diagram showing the analysis result of molecular function (MF) among GO terms of Unigene obtained in the present invention.
6 is a candidate target sequence shown in the C69849_g1_i1 sequence (1,357 bp, SEQ ID NO: 1).
7 is a candidate target sequence shown in the C82233_g1_i1 sequence (531 bp, SEQ ID NO: 2).
8 is a candidate target sequence shown in the C183992_g1_i1 sequence (324 bp, SEQ ID NO: 3).
9 is a candidate target sequence shown in the C63950_g1_i1 sequence (2,850 bp, SEQ ID NO: 4).
10 is a photograph confirming the template for each sgRNA production for the final selected target sequence (21 types).
11 is a screening result of sgRNA against the target sequence of contig IZUMO1 (C69849_g1_i1) related to the sperm-egg recognition protein of large-mouth bass.
12 is a screening result of sgRNA against the target sequence of contig IZUMO1 (C82233_g1_i1) related to the sperm-egg recognition protein of large-mouth bass.
13 is a screening result of sgRNA against the target sequence of contig IZUMO1 (C183992_g1_i1) related to the sperm-egg recognition protein of large-mouth bass.
14 is a screening result of sgRNA against the target sequence of contig Zona pellucida sperm-binding protein (C63950_g1_i1) related to the sperm-egg recognition protein of largemouth bass.

In the fertilization process of animals, surface proteins that can recognize only germ cells of the same species must be expressed on the surface of germ cells, and then a series of processes such as fusion of cell membranes and influx of sperm nuclei into eggs by binding of surface proteins Fertilization is completed through fertilization and a fertilized egg is formed (Vincens et al ., 2014). The present invention uses this to block the series of fertilization processes that appear after recognition by inhibiting the expression of species-specific sperm-egg recognition sites on the surface of sperm and egg cells, which are germ cells of largemouth bass, despite the general spawning behavior of largemouth bass. Since fertilized eggs were not formed, it was attempted to induce the same effect as capturing and removing a large number of individuals at once. In addition, as it is a method of eradicating infertile individuals that do not express the species-specific sperm-egg recognition site of largemouth bass, it does not affect the habitat of native species belonging to the same aquatic ecosystem and is applied only to the target ecological disturbance species. It has the characteristic that a reduction effect can be expected.

Hereinafter, preferred embodiments of the present invention will be described in detail. However, the present invention is not limited to the embodiments described herein and may be embodied in other forms. Rather, it is provided so that this disclosure will be thorough and complete, and will fully convey the spirit of the invention to those skilled in the art.

< Example One. bigmouth bass Create a Schematic>

Ecosystem disturbance through molecular biological experiments The study on the mating disturbance mechanism of fish species is the first attempt to target largemouth bass, and is the first to reproduce because there is no whole genome sequencing (WGS) data, which is essential for the target gene selection process prior to germline gene editing. Genetic searches related to the process were performed.

1.1 bigmouth bass DNA extraction

Largemouth Bass ( Micropterus) salmoides ) was collected from Mangwolji, Uksu-dong, Suseong-gu, Daegu, in June 2020. It was collected using a fishing net (net 6×6mm), a plastic fish tank for swimming fish, and a transparent plastic fish tank.

The experimental group was divided into B1 (Female, fins) and B2 (Male, fins), and the fins of the largemouth bass were quickly removed for each individual using a sterilized instrument. DNA extraction was performed using a DNeasy blood and tissue kit (Qiagen, USA).

1.2 bigmouth bass Create NJ(Neighbor joining) tree

For the phylogenetic analysis of the largemouth bass collected in Example 1.1, 796bp of 1,551bp of the COX1 gene of mitochondrial DNA was amplified by polymerase chain reaction (PCR), and a phylogenetic diagram was prepared using the nucleotide sequence obtained as the amplification product. Amplification of the COX1 gene in large-mouth bass was performed by preparing identical primer pairs as shown in Table 1 below according to the method of Li et al. (2012).

Primer name Primer Seq. cox1-F 5'-AGCATCCGTTGACCTAACCATC-3 cox1-R 5'-CAGGTGCTGTGGAGGGTGTATC-3

The PCR reaction was finalized by adding 1 μl of Genomic DNA (50ng/μl), 2 μl of each primer (10 pmol/μl), 0.25 μl of DNA Taq polymerase (solvent, korea), 5 μl of 10X buffer, 1 μl of 10mM dNTP, and distilled water. The reaction was carried out in a volume of 50 μl. The PCR conditions were repeated 34 times by performing initial denaturation at 95°C for 3 minutes, 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for 90 seconds as 1 cycle, followed by final extension at 72°C for 10 minutes. Stored at 8°C. The PCR product was confirmed by electrophoresis on 1.5% agarose gel. The obtained PCR product was purified using Gel and PCR clean-up kit (LaboPass, Korea), and then the analysis company Cosmogenetech (Korea) was requested for nucleotide sequence analysis, and Geneious Prime (version 11.0.4+11) was used to purify it. The nucleotide sequence was aligned, and an NJ tree was prepared using the Mega 6.06 program, which is shown in FIG. 1 .

After searching for mitochondrial DNA information of fish belonging to the family Centrarchidae with GenBank, the COX1 base sequence was obtained, and the COX1 gene (796bp) of the experimental group was compared with the COX1 gene (796bp). The largemouth bass used in the invention was GenBank Accession number HQ395639 Micropterus salmoides and salmoides were found to be the closest.

< Example 2. bigmouth bass Searching for genes encoding species-specific sperm-egg recognition proteins>

2.1 bigmouth bass brain and gonad (testis, ovaries) extraction and mRNA extraction

The experimental group was divided into B1-1 (Female, brain), B1-2 (Female, ovary), B2-1 (Male, brain), and B2-2 (Male, testis) mRNAs were extracted. The brain and gonads were rapidly removed using sterile instruments. The extracted organs were ground with 1 ml of Trizol reagent, 200 μl of Chloroform was added, mixed for 15 seconds, and centrifuged at 12,000 rpm at 4° C. for 15 minutes, and then the supernatant was collected. After adding and mixing 500 μl of isopropanol to the supernatant, centrifuged at 12,000 rpm for 10 minutes at 4° C., the supernatant was removed, the precipitate was dried, and 100 μl of nuclease-free water was added to the dried precipitate to dissolve. mRNA was obtained.

2.2 NGS used transcript analysis

Before performing transcriptome de novo sequencing, original sample QC of the extracted mRNA was performed to select a sample to be used in the analysis process, and library QC was performed to confirm whether it was suitable for analysis. After constructing a cDNA library with mRNA extracted using Illumina TruSeq Stranded mRNA LT sample Prep Kit, the nucleotide sequence was obtained by NGS method using NovaSeq 6000 system. As a result of Transcriptome de novo sequencing in the experimental group of largemouth bass, raw data were expressed as total read bases, total reads, and GC content. Table 2 shows the total read bases, total reads, and GC content of samples B1-2 (Female, ovary) and B2-1 (Male, brain) selected through Original sample QC and Library QC.

Index sample ID Total read bases Total reads GC (%) One B1-2 13,111,466,500 129,816,500 51.20 2 B2-1 11,372,780,992 112,601,792 48.46

After checking the calculated raw data, Trimmomatic program was used to calculate the trimming data from which the adapter sequence, low-quality read, and contaminated DNA were removed to derive accurate analysis results. Table 3 shows the trimming data for samples B1-2 (Female, ovary) and B2-1 (Male, brain). Trimming data with adapter sequence, low quality read, and contaminating DNA removed using Trimmomatic program were expressed as Total read bases, Total reads, and GC content.

Index sample ID Total read bases Total reads GC (%) One B1-2 12,854,708,436 128,492,724 51.15 2 B2-1 11,206,616,993 111,543,694 48.47

Using B2-1 among samples B1-2 (Female, ovary) and B2-1 (Male, brain) that passed QC as a reference, about 100 mil sequencing reads from each sample were de novo assembly and transcript datasets (Contig, Unigene, ORF) was obtained. Table 4 shows the transcript fragment, that is, the contig information, which was de novo assembly by the Trinity program by merging the trimmed reads.

Assembly #of
genes #of
transcripts GC (%) N50 Avg.
contig
length(bp) Total
assembled bases (bp) merge 189,512 243,117 45.39 2,278 969.19 235,627,133

Kyoto Encyclopedia of Genes and Genomes (KEGG), NCBI Nucleotide (NT), Pfam, Gene ontology (GO), NCBI using BLASTN of NCBI BLAST and BLASTX (E-value cut-off of 1.0E-5) of DIAMOND software. Annotation was performed with reference to a total of 7 databases of non-redundant protein (NR), UniProt, and EggNOG.

As a result of functional annotation by applying Gene Ontology (GO) database for functional annotation, GO terms are divided into biological process (BP), cellular component (CC) and molecular function (MF) and list them, which are shown in Figs. shown in

2.3 bigmouth bass Search for reproduction-related genes

As a result of de novo assembly of reads extracted from each sample, a total of 182,887 contigs were identified. Among the data obtained using Illumina paired-end sequencing, using the contig information organized in Excel, search for contigs with keywords 'Sperm', 'Zona Pellucida', 'IZUMO', and 'Acrosome' related to sperm-egg recognition proteins. The primary screening was performed and it is shown in Table 5.

Protein Function contig
Count One Zona pellucida sperm-binding protein . Receptors expressed on egg surface
. Sperm surface protein recognition 23 2 Spermatogenesis-associated protein . Spermatogenesis-Related Proteins
. fertility control 63 3 Motile sperm domain-containing protein . Formation of membrane contact sites
. promote egg maturation
. contraction of the fallopian tube wall, migration of oocytes to the fertilization site 5 4 sperm-associated antigen . spermatogenesis
. Modulation of GTP signaling pathways involved in fertilization 7 5 IZUMO1 . Proteins expressed on the surface of sperm
. Binds to receptors on the egg surface 3 6 Round spermatid basic protein . sperm maturation 6 7 sperm-tail
PG-rich repeat-containing protein . Testicular descent (person) 2 8 sperm acrosome
membrane-associated protein . Acrosome, normal sperm morphogenesis
. sperm surface membrane protein
. sperm-egg plasma membrane contact and fusion 4 9 Acrosomal vesicles . expression in the sperm head
. Fusion of sperm plasma membrane and acrosomal vesicles
→ induce expression of receptors that bind to the surface of the egg 2 10 Sperm flagellum . sperm motility 7

Contigs retrieved from all seven types of databases for primary selection information and contigs having a similarity of 80% or more with the Blast reference gene sequence were secondarily selected, and the results are shown in Table 6.

Protein Contig No. Annotation on GO IZUMO1 SEQ ID NO: 1 C69849_g1_i1
(1,357 bp)

SEQ ID NO: 2
C82233_g1_i1
(531 bp)

SEQ ID NO: 3
C183992_g1_i1
(324 bp) BP . cellular process
. reproductive process
. cellular component organization
or biogenesis CC . membrane
. organelle part
. cell part MF . binding Zona pellucida sperm-binding protein SEQ ID NO: 4
C63950_g1_i1
(2,850 bp) BP . cellular process
. reproductive process
. biological process CC . extracellular region part MF . binding * GO terms: biological process (BP), cellular component (CC), molecular function (MF)

2.4 CRISPR / Cas9 Search target sequence to apply system

When the CRISPR / Cas9 system is applied to the nucleotide sequence constituting each Contig obtained in Example 2.3, the editable sequence (Target sequence), that is, the PAM (5'-NGG-3'), which is a site recognized by Cas9 nuclease A nucleotide sequence of 20 bp with a nucleotide sequence was selected as a target sequence and shown in FIGS. 6 to 9 . The candidate sequences were 27 of C69849_g1_i1 of IZUMO1, 7 of C82233_g1_i1, 2 of C183992_g1_i1, and 15 of C63950_g1_i1 of Zona pellucida sperm-binding protein.

The CRISPR/Cas9 system is an editing technology applied to DNA, and the nucleotide sequence used for gene search is the result of transcriptome analysis. In order to confirm , a primer was prepared as shown in Table 7 based on each candidate sequence (Target sequence), and then PCR was performed to select the final target sequence and shown in Table 8.

Target seq.
Name Primer F. Primer R. T1 GACAGACCTCTACATGCTTTGG ACCAACACCAGCAACATCTC T2 GTTCCTAGCAGGAAGTTAAGGG TATCTGGCTGGTCTCTCTGTAG T3 TACAGAGAGACCAGCCAGATAC CAGAAGGAGAGGGACAGATGTA T4 TCATCCGTGATGGATTTGTGTC GGAGTGTGGTACTCTGGTCTT T5 CTTCCATGGCATCGTCTACTG TGACAGGTCGGTGAATTTGG T6 GGAACGTATCGCTGCTCTTT CCAGGACAACTGTAATGCCTAC T7 CCAGTCATCGCCGTGTTTA CTCCCTGTCTTTAGAGTGTGTG TGCCTCATGGAAACAACTACTC GTCTCCATCACACCGTGTTT T8 CATGTTCACTACTCGCAGATGT TGTGTGTTTAAGTGGGTGTGT T9 GCGTGACACACCCACTTAAA TTCGGGATTGATTGGATGGC CATAACAAAGCGTGACACACC AATCCGGGAGATTTACCTCATC T10 CCCTGAATGGAGCGATGG GACTAAACATTCAAAGAAACCCTGA T11 GGAAGTGGGAGCATGAAGAA ACTGAGCTGGATATTGTAGACATC T12 TGTCGGTGATGAGGAAATGAAG GCTTTGAGCACATCTCAAGAGTA T13 CACGGCTCAGATGGTTTACT CCAAACAGGTCAGCTTTGATAAC T14 CAGACTTGCTGGAGATCGTTAT AGGCCACAGGAGAGTATATGA T15 TCGTTGTTGGATTAGTGGACTG GCAGCTTGGGTAGACATGAA T16 GTTCTTCGCTCCTGCCTAC CACACAGCTGCTCACAAATAC T17 GTCAGAGTTGGGTATCACATGG CATTTACTGGCACAGCATTCAG T18 TCAGGACACAGGATGACAAAC TTGGATTCAGCCACCTTACC T19 TGGCCAAACCCACCATAA GCAGTCCCATCTCGTCTTT T20 CCAGTGGAGAGGTGGAATAAC AGCAGTTGTGTTTGACAGTTTAG T21 TGGACCCTAACGGCACAG CAGTTGATTTACATCAGATAAACAGGGA T22 TCTGAGGTCTAATTGGCAGTAAAG CTAGGCAGGTTGAGTATGAAGTG T23 TGAACACACTTCATACTCAACCT GAGCACACCTGACAGACAAT T24 TGGAAGTCCTGAGATGTTCAAA CACGGGAGTTTGGAAGTCTAAA T25 GGTGTCCTTTGTGTCTGTGT TCATCCTTTGTGATGCCATTGTA T26 GAACAGTCAGTGCTGGTGAT GTTGCGACAACATTGACATACA T27 AGCTGAAAGCTACCTCTGAAAT TGACTGTAATCTTGTCTACTTGCT

Protein Contig No. Target No. Target Sequence (5’→3’) Seq. No. IZUMO1 C69849_g1_i1
(1,357 bp) 2 AGTCCTCTCTGCTCCCACTG 5 3 GAAAATCTTAGAGAAACACT 6 5 CAGCTGCATGTGGATGAACA 7 6 ACTCTGCCCTCCCTGCCTCA 8 C82233_g1_i1
(531 bp) 8 AGGATTGCCGATGTGAACTA 9 9 CACGATCACTGATCTGACCC 10 10 AATCCCGAATAATCCCCTGT 11 C183992_g1_i1
(324 bp) 11 GGCAGGGCAGATTTGAATGT 12 12 TCCAGCTCAGTTAGAATCAC 13 Zona pellucida sperm-binding protein C63950_g1_i1
(2,850 bp) 13 CACTCCAAATACACTGTGCA 14 14 GATGTTGATGAGATACGCCT 15 15 CCTCCTCATATACTCTCCTG 16 16 AGCTCTAACGTGTTTTACTT 17 18 TGATGCAGAGGCACCAAATA 18 20 TGCTGCATCTCTAGAAAGGT 19 21 TTTGCTTTCTGAGGTCTAAT 20 22 GTTCAAGTTTTCACTTAAAT 21 23 ACCATTATGCTTTAAAGTTTA 22 24 TTTTGAGGCAGTGAAAAATG 23 25 TGCGGACTCCTCCATGATTG 24 26 TGAAAGCTACCTCTGAAATG 25

For PCR reaction, 1 μl of Genomic DNA (50ng/μl), 2 μl of each primer (10 pmol/μl), 0.25 μl of DNA Taq polymerase (solvent, Korea), 5 μl of 10X buffer, 1 μl of 10mM dNTP, and distilled water were added to the final 50 The reaction was performed in a μl dose. The PCR conditions were repeated 30 times by performing initial denaturation at 94°C for 5 minutes, 94°C for 30 seconds, 62°C for 30 seconds, and 72°C for 90 seconds as 1 cycle, followed by final extension at 72°C for 10 minutes. Stored at 8°C. The PCR product was confirmed by electrophoresis on 1.5% agarose gel.

< Example 3. bigmouth bass Inhibition of expression of species-specific sperm-egg recognition protein>

3.1 sgRNA design and manufacture

The sgRNA was designed so that the gene editing technology could be applied to the target sequence finally selected in Example 2.4 and shown in Table 9, which was produced using the Guide-it sgRNA In Vitro Transcription kit (Takarabio, USA). Primers required for sgRNA production are shown in Table 10. First, a template for sgRNA production was created, sgRNA was produced, and then the produced sgRNA was purified using the Guide-it IVT RNA Clean-Up kit (Takarabio, USA) and confirmed, and the amount of sgRNA synthesis was confirmed.

Protein Contig No. Target No. sgRNA sequence (5’→3’) Seq. No. IZUMO1 C69849_g1_i1
(1,357 bp) 2 AGUCCUCUCUGCUCCCACUG 26 3 GAAAAUCUUAGAGAAACACU 27 5 CAGCUGCAUGUGGAUGAACA 28 6 ACUCUGCCCUCCCUGCCUCA 29 C82233_g1_i1
(531 bp) 8 AGGAUUGCCGAUGUGAACUA 30 9 CACGAUCACUGAUCUGACCC 31 10 AAUCCCGAAUAAUCCCCUGU 32 C183992_g1_i1
(324 bp) 11 GGCAGGGCAGAUUUGAAUGU 33 12 UCCAGCUCAGUUAGAAUCAC 34 Zona pellucida sperm-binding protein C63950_g1_i1
(2,850 bp) 13 CACUCCAAAUACACUGUGCA 35 14 GAUGUUGAGUGAGAUACGCCU 36 15 CCUCCUCAUAUACUCUCCUG 37 16 AGCUCUAACGUGUUUUACUU 38 18 UGAUGCAGAGGCACCAAAUA 39 20 UGCUGCAUCUCUAGAAAGGU 40 21 UUUGCUUUCUGAGGUCUAAU 41 22 GUUCAAGUUUUCACUUAAAU 42 23 ACCAUUAUGCUUUAAAGUUA 43 24 UUUUGAGGGCAGUGAAAAAUG 44 25 UGCGGACUCCUCCAUGAUUG 45 26 UGAAAGCUACCUCUGAAAUG 46

Protein Contig No. Target No. Primer Sequence (5’→3’) size
(bp) IZUMO1 C69849
2 CCTCTAATACGACTCACTATAGGAGTCCTCTCTGCTCCCACTGGTTTAAGAGCTATGC 58 3 CCTCTAATACGACTCACTATAGGAAAATCTTAGAGAAACACTGTTTAAGAGCTATGC 57 5 CCTCTAATACGACTCACTATAGGCAGCTGCATGTGGATGAACAGTTTAAGAGCTATGC 58 6 CCTCTAATACGACTCACTATAGGACTCTGCCCTCCCTGCCTCAGTTTAAGAGCTATGC 58 C82233
8 CCTCTAATACGACTCACTATAGGAGGATTGCCGATGTGAACTAGTTTAAGAGCTATGC 58 9 CCTCTAATACGACTCACTATAGGCACGATCACTGATCTGACCCGTTTAAGAGCTATGC 58 10 CCTCTAATACGACTCACTATAGGAATCCCGAATAATCCCCTGTGTTTAAGAGCTATGC 58 C1839921
11 CCTCTAATACGACTCACTATAGGCAGGGCAGATTTGAATGTGTTTAAGAGCTATGC 56 12 CCTCTAATACGACTCACTATAGGTCCAGCTCAGTTAGAATCACGTTTAAGAGCTATGC 58 Zona pellucida sperm-
binding protein C63950
13 CCTCTAATACGACTCACTATAGGCACTCCAAATACACTGTGCAGTTTAAGAGCTATGC 58 14 CCTCTAATACGACTCACTATAGGATTGTTGATGAGATACGCCTGTTTAAGAGCTATGC 57 15 CCTCTAATACGACTCACTATAGGCCTCCTCATATACTCTCCTGGTTTAAGAGCTATGC 58 16 CCTCTAATACGACTCACTATAGGAGCTCTAACGTGTTTTACTTGTTTAAGAGCTATGC 58 18 CCTCTAATACGACTCACTATAGGTGATGCAGAGGCACCAAATAGTTTAAGAGCTATGC 58 20 CCTCTAATACGACTCACTATAGGTGCTGCATCTCTAGAAAGGTGTTTAAGAGCTATGC 58 21 CCTCTAATACGACTCACTATAGGTTTGCTTTCTGAGGTCTAATGTTTAAGAGCTATGC 58 22 CCTCTAATACGACTCACTATAGGTTCAAGTTTTCACTTAAATGTTTAAGAGCTATGC 57 23 CCTCTAATACGACTCACTATAGGACCATTATGCTTTAAAGTTAGTTTAAGAGCTATGC 58 24 CCTCTAATACGACTCACTATAGGTTTTGAGGCAGTGAAAAATGGTTTAAGAGCTATGC 58 25 CCTCTAATACGACTCACTATAGGTGCGGACTCCTCCATGATTGGTTTAAGAGCTATGC 58 26 CCTCTAATACGACTCACTATAGGTGAAAGCTACCTCTGAAATGGTTTAAGAGCTATGC 58

After making a template for sgRNA production according to the manual, purify the prepared sgRNA using the Guide-it IVT RNA Clean-Up kit (Takarabio, USA) after making the sgRNA. It is shown in Figure 10.

Protein Contig No. Target No. Synthesis amount (ng/μl) IZUMO1 C69849_g1_i1
(1,357 bp) 2 833.15 3 766.32 5 825.95 6 715.55 C82233_g1_i1
(531 bp) 8 1004.30 9 841.43 10 902.29 C183992_g1_i1
(324 bp) 11 914.12 12 601.95 Zona pellucida sperm-binding protein C63950_g1_i1
(2,850 bp) 13 912.21 14 866.14 15 789.30 16 1027.20 18 828.77 20 653.07 21 364.87 22 364.79 23 729.56 24 323.55 25 666.42 26 827.10

3.2 sgRNA screening

In order to confirm whether the sgRNA prepared in Example 3.1 can recognize the target sequence, the PCR product of the large-mouth bass target sequence and the Guide-it sgRNA Screening kit (Takarabio, USA) were used as an in vitro experiment to edit the gene, i.e., the target sequence. Cleavage was confirmed by agarose electrophoresis. At this time, in order to check whether the target sequence was recognized by the sgRNA, a PCR product (uncleaved fragment) was obtained from the entire genome of the large-mouth bass by combining appropriate primers to include each target sequence. Electrophoresis was performed on 2.0% agarose gel using 100bp marker (DNA ladder) and 5 μl of PCR product.

The results of sgRNA screening for each target sequence of each contig constituting the sperm-egg recognition protein are shown in FIGS. 11 to 14 .

In the case of IZUMO1 (C69849_g1_i1), the sgRNA recognizing target sequences 3 and 5 worked normally and the sequence was cut, and the sgRNA recognizing target sequences 2 and 6 did not work normally, so no sequence cleavage was observed.

In the case of IZUMO1 (C82233_g1_i1), sgRNA recognizing target sequences 8, 9, and 10 worked normally, resulting in sequence cleavage. In target sequences 8 and 10, it was confirmed that 550bp of the uncleaved fragment was cleaved, but one of the two cleaved fragments was less than 200bp, so it was estimated that the gel band, the result of electrophoresis, could not be visually identified.

In the case of IZUMO1 (C183992_g1_i1), sgRNA recognizing target sequences 11 and 12 worked normally, resulting in sequence cleavage. In target sequences 11 and 12, it was confirmed that the uncleaved fragment was cleaved by 300bp, but since one of the two cleaved fragments was less than 200bp, it was estimated that the gel band, the result of electrophoresis, could not be visually identified.

In the case of Zona pellucida sperm-binding protein (C63950_g1_i1), sgRNA recognizing all target sequences 13, 14, 15, 16, 18, 20, 21, 22, 23, 24, 25, 26 works normally, confirmed that. It was confirmed that 2000bp of the uncleaved fragment was cut from target sequences 23, 24, and 25, but one of the two cleaved fragments was estimated to be 1975bp in the case of Target sequence 23, 1650bp in the case of Target sequence 24, and 1550bp in the case of Target sequence 25. Uncleaved fragment It was assumed that the visual distinction could not be made with the naked eye.

3.3 Cas9 - sgRNA ribonucleoprotein ( RNP ) complex production

A Cas9-sgRNA ribonucleoprotein (RNP) complex that recognizes and cuts the target sequence was prepared using the Guide-it Recombinant Cas9 kit (Takarabio, USA).

3.4 Cas9 - sgRNA ribonucleoprotein ( RNP ) complex injection and infertile produce

The Cas9-sgRNA ribonucleoprotein (RNP) complex prepared in Example 3.3 was injected into the fertilized eggs after collecting male sperm and female eggs during the spawning period of the large-mouth bass. The fertilized egg injected with the Cas9-sgRNA ribonucleoprotein (RNP) complex edits the coded target sequence of the species-specific sperm or egg recognition protein of the fertilized egg during development, and the protein expression required for sperm-egg recognition is reduced. Infertile largemouth bass individuals are created by hatching in a suppressed state.

<110> NAP Co., Ltd. Ecological Space Research Institute Co., Ltd. LEE, Yoon Jeong <120> Composition for inducing large mouth bass sterility for management of disturbing fish species in aquatic ecosystem <130> DPC-21-0027 <160> 46 <170> KoPatentIn 3.0 <210> 1 <211> 1357 <212> DNA <213> Micropterus salmoides <400> 1 ttgaagtgta cctatgataa aaatgacaga cctctacat ctttggtgaa ctgtggggtg 60 aacagtgaca gtactgttgc agtttgtggc agaatctgac tggcaggctg gcacatgaac 120 aaaattgcaa aactgttcag aacatactac agagaacctg ctctgacaga ggagcaaaag 180 tgactcatcc tagttcctag caggaagtta agggtaccga ggggagatgt tgctggtgtt 240 ggtgtccctg ctttgctgtg tccctgctgc caaggcctgt ttgcagtgtg acctcagggt 300 caggctccta catgaggact tagtcctctc tgctcccact gtggacaacc agattgaatt 360 gaaaaagatt tgtgaccatg cctatgtgac ctacagagag accagccaga tacgaaaggg 420 agtcattgat cccaccactc tgtacagagc cacaactgag taccagagtg aatttgaccg 480 cttcttgaaa accaaggaca ctggatctgt aacattcgaa gccattcaga tcatggagaa 540 gggcaggaaa atcttagaga aacacttgga cacatcatc cgtgatggat tgtgtcccaa 600 caagtgtggg cttttgaaac agagagtaat ggattgcatc tcttgccact acaagatata 660 catctgtccc tctccttctg gccaacagga ttgcggtgag tatccagtgc aggctgagga 720 gggaggccag gcagtgttga actgtttcct tccatggcat cgtctactgt tgggaagacc 780 agagtaccac tactcctggg cccctggtgt gccagaaacg gaaaagctga ctgagagcaa 840 cttcaaagcc ttggtagtga cagacgactc atctgtggtc ttaaatcagc tgcatgtgga 900 tgaacaagga acgtatcgct gctctttgca ggacgaaaat ggaaccgtct tctaccgagt 960 cactttcctg ctcgctgtca cccctttgcc tgtccaaatt caccgacctg tcatcactct 1020 gccctccctg cctcatggaa acaactactc accttttcta cctactgagg agggcctgct 1080 gatgccagtc atcgccgtgt ttactgctct gagtctggca gcctgcgtag gcattacagt 1140 tgtcctgggg tgagagacaa tttattataa atcagaggag agctgtgaac aagccgagaa 1200 gaaagaggaa ggaggaaaac cacacacaaa acacggtgtg atggagacac tgcgcacagt 1260 aaacacacac tctaaagaca gggaggtttt actcatttca ggttggacat ttctctctgt 1320 ggctaaataa atttccaagc acaaagtgcc aagtcat 1357 <210> 2 <211> 531 <212> DNA <213> Micropterus salmoides <400> 2 tttcatgtaa gtgtgaaaac atgttcacta ctcgcagatg tggctctgcg aagcgtataa 60 tgtgtttaga tgtttttgaa atatattgat taacttaaaa caaaaacata aaaacttaag 120 gattgccgat gtgaactatg gtgatgaaaa cacagagatc tcactcataa aaagaaagtt 180 tgtggtgcaa cataacaaag cgtgacacac ccacttaaac acacacaaaa tcccccagaa 240 agcactcaac tttccatagc attaagcacc agcttgcctt aaacacgatc actgatctga 300 ccctggcagg gacacgttcc ccctgaatgg agcgatggca tggtcacgtg ggtgtttatg 360 agaggaatca gggatgaggt aaatctcccg gattacagtt tttttcagag attaacagcc 420 ccagccatcc aatcaatccc gaataatccc ctgttggagg aggagggaga caggaggggt 480 aaaaagatag cagcagatgt tttcatcagg gtttctttga atgtttagtc a 531 <210> 3 <211> 324 <212> DNA <213> Micropterus salmoides <400> 3 agggtgagaa gggaagtggg agcatgaaga aagtggagtc agaggtttga gtgggagaca 60 tttgcggcag ggcagatttg aatgtcggtg atgaggaaat gaagacaaag acgtcagatt 120 acaccttaac tattccacac cgcacataaa gtataatttc ctgtgtgtaa ctgagtgtcc 180 tgtatccagg ggtggaaaga tgtctacaat atccagctca gttagaatca ctggtgtttg 240 acttaaatat tacaaatgca gaattgaaaa ctactcacat aaaaatgcaa aaaaagacta 300 ctcttgagat gtgctcaaag cccc 324 <210> 4 <211> 2850 <212> DNA <213> Micropterus salmoides <400> 4 ccacggctca gatggtttac tgcctagtgg gtcagatggg accttttgca gtctgaactg 60 ggttgctgtt ttgagtggca ttcatggaga ccttgtattt ttgggtttat gtcctagttg 120 gactcttgtt gccagggatc tgcctcaggc catcttttgc atttccacac aaacgtcaca 180 gacaacatga ttcctttcta agggctccct tcacggggca ctccaaatac actgtgcatg 240 ggcaccaaaa ggctccagct gaggaacgag agcaggtgaa cactgtcaga gtgacctgcc 300 acccagactt gctggagatc gttatcaaag ctgacctgtt tggagtcgga gctcctgttg 360 atgttgatga gatacgcctc ggagtgaagc ccgatgagtt ctgtagagct gcagcatctt 420 cagaagatga gtacaagatc gttgttggat tagtggactg cgggaccaaa cactggatgg 480 atgaatccgt tctggcctac acaaacctcc tcatatactc tcctgtggcc tccccaggtg 540 gggtgactcg aatggatgag gctgtaattc caattgagtg ttattacaaa aggaaataca 600 atttgtctag ttcttcgctc ctgcctacct ggatcccctt catgtctacc caagctgcag 660 tggaaacctt ggagtttaac ttgagaatta tgacaaatga ctggcagtat aaaagaagct 720 ctaacgtgtt ttacttcggg gatctcatcg gcctcgaagc ctctgtcaga gttgggtatc 780 acatggggct cagagtattt gtgagcagct gtgtggccac acttgaccca gacataaact 840 ctgttcccag atatgtcttc attgaaaacg ggtgcttggt tgactccatg gttccaggtt 900 caaagtctca ctacttagtc aggacacagg atgacaaact ccacttgatg attgatgcct 960 ttaaatttca taatgaggac agagcagagc tctacatcac atgtcaactg aatgctgtgc 1020 cagtaaatga tgcagaggca ccaaataagg cgtgcacttt tgtcaatgat agatggagat 1080 cggcagatgg taacgactac ttatgccagt attgtacaaa tcaaaatata ggtggccaaa 1140 cccaccataa gcccagcagc tctggcaagt ttggtaaggt ggctgaatcc aaaaccttct 1200 gggagagcgg actgaagcgc aatgaagtgt ggcatcagga ggcaagactg ggtccaatgc 1260 tggtcttgcc aggtaaacag aagactgagc atctacctgt agaagagctt cctcccgttc 1320 ccaataaaag cagcagacct gcactgtatg gcagccagtg gagaggtgga ataactttca 1380 gaaaagacga gatgggactg cttccaccta caccagacca ggtggctgag acgttttctt 1440 ctgaacagaa agatgtcaaa actgaaacgg atctaaaaga tgaagatgca gaaagtgaag 1500 ttgctgcatc tctagaaagg ttgggtcctg aggttgactt gaaagcgata gaggcagcac 1560 tggaccctaa cggcacagca gccctcagtg atgtcatccc cacggctcag tttacgatgg 1620 atgtgactaa actgtcaaac acaactgcta cagaatctga cctttcagct gcaaatgacc 1680 caaagagtga atgaacaatt aaaaatagtt tgctttctga ggtctaattg gcagtaaagt 1740 cctgatgttg cacaggtttt tttttttttt ttttccctgt ttatctgatg taaatcaact 1800 gaaactttaa aatgccactc taaaattaaa ctttggagaa agcaaaatgt ttgcatttat 1860 gagccactga cttttatttg aatgtctttt tttttaagtt caagttttca cttaaattgg 1920 caatctctag tatgcatcct gtcttttcca gtgtgaacac acttcatact caacctgcct 1980 agaattggta attatgtggg acacaacagt catcactact atggaaaact ataaatacaa 2040 gcgtttgcat gaaaaatggt tctatggctt aaagcatgtg cactgagtaa cagtaaaatg 2100 taaataaact tgtctgctgt ttccacctac tgggaatgta cattagtgaa accattatgc 2160 tttaaagtta tggaagtcct gagatgttca aaatgtttga ctctcatact aaatgtgcat 2220 tgtctgtcag gtgtgctcac aatctcctga atgatttttg aggcagtgaa aaatgaggaa 2280 ggccagattg caaagactaa gtgaatgcaa atagacggtg tcctttgtgt ctgtgttcag 2340 tagattaaaa gctagtttag cagatgggac tgtttagact tccaactccc gtgtgtattg 2400 cggactcctc catgattgtg gtgaaggctg gcggtacaac aacggatgtt actcctagag 2460 agctttactt gggagaagca gaacagtcag tgctggtgat gctgactgct agttacaatg 2520 gcatcacaag gatgacatgc tgtagttcgt gtttcctgcc tctctaaaag tctgccttct 2580 cactcaagct gatgacagat ttatatcaca tgccagctga aagctacctc tgaaatgtgg 2640 agcagcagtc ccatcaacaa ggtcttcaat tatgtacatt caagatggga aaatgtggat 2700 gggggagatg atgtatgtca atgttgtcgc aacacttaga aagatgagac aaatctgaga 2760 cgtctgatcc ctgaagatac catggcatgt gacaccgtaa ccctttgatt ttccccagca 2820 agtagacaag attacagtca taaacagtgc 2850 <210> 5 <211> 20 <212> DNA <213> Micropterus salmoides <400> 5 agtcctctct gctcccactg 20 <210> 6 <211> 20 <212> DNA <213> Micropterus salmoides <400> 6 gaaaatctta gagaaacact 20 <210> 7 <211> 20 <212> DNA <213> Micropterus salmoides <400> 7 cagctgcatg tggatgaaca 20 <210> 8 <211> 20 <212> DNA <213> Micropterus salmoides <400> 8 actctgccct ccctgcctca 20 <210> 9 <211> 20 <212> DNA <213> Micropterus salmoides <400> 9 aggattgccg atgtgaacta 20 <210> 10 <211> 20 <212> DNA <213> Micropterus salmoides <400> 10 cacgatcact gatctgaccc 20 <210> 11 <211> 20 <212> DNA <213> Micropterus salmoides <400> 11 aatcccgaat aatcccctgt 20 <210> 12 <211> 20 <212> DNA <213> Micropterus salmoides <400> 12 ggcagggcag atttgaatgt 20 <210> 13 <211> 20 <212> DNA <213> Micropterus salmoides <400> 13 tccagctcag ttagaatcac 20 <210> 14 <211> 20 <212> DNA <213> Micropterus salmoides <400> 14 cactccaaat acactgtgca 20 <210> 15 <211> 20 <212> DNA <213> Micropterus salmoides <400> 15 gatgttgatg agatacgcct 20 <210> 16 <211> 20 <212> DNA <213> Micropterus salmoides <400> 16 cctcctcata tactctcctg 20 <210> 17 <211> 20 <212> DNA <213> Micropterus salmoides <400> 17 agctctaacg tgttttactt 20 <210> 18 <211> 20 <212> DNA <213> Micropterus salmoides <400> 18 tgatgcagag gcaccaaata 20 <210> 19 <211> 20 <212> DNA <213> Micropterus salmoides <400> 19 tgctgcatct ctagaaaggt 20 <210> 20 <211> 20 <212> DNA <213> Micropterus salmoides <400> 20 tttgctttct gaggtctaat 20 <210> 21 <211> 20 <212> DNA <213> Micropterus salmoides <400> 21 gttcaagttt tcacttaaat 20 <210> 22 <211> 20 <212> DNA <213> Micropterus salmoides <400> 22 accattatgc tttaaagtta 20 <210> 23 <211> 20 <212> DNA <213> Micropterus salmoides <400> 23 ttttgaggca gtgaaaaatg 20 <210> 24 <211> 20 <212> DNA <213> Micropterus salmoides <400> 24 tgcggactcc tccatgattg 20 <210> 25 <211> 20 <212> DNA <213> Micropterus salmoides <400> 25 tgaaagctac ctctgaaatg 20 <210> 26 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> sgRNA for C69849_g1_i1 of IZUMO1 <400> 26 aguccucucu gcucccacug 20 <210> 27 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> sgRNA for C69849_g1_i1 of IZUMO1 <400> 27 gaaaaucuua gagaaacacu 20 <210> 28 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> sgRNA for C69849_g1_i1 of IZUMO1 <400> 28 caggugcaug uggaugaaca 20 <210> 29 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> sgRNA for C69849_g1_i1 of IZUMO1 <400> 29 acucugcccu cccugccuca 20 <210> 30 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> sgRNA for C82233_g1_i1 of IZUMO1 <400> 30 aggauugccg augugaacua 20 <210> 31 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> sgRNA for C82233_g1_i1 of IZUMO1 <400> 31 cacgaucacu gaucugaccc 20 <210> 32 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> sgRNA for C82233_g1_i1 of IZUMO1 <400> 32 aaucccgaau aauccccugu 20 <210> 33 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> sgRNA for C183992_g1_i1 of IZUMO1 <400> 33 ggcagggcag auuugaaugu 20 <210> 34 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> sgRNA for C183992_g1_i1 of IZUMO1 <400> 34 uccagcucag uuagaaucac 20 <210> 35 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> sgRNA for C63950_g1_i1 of Zona pellucida sperm-binding protein <400> 35 cacuccaaau acacugugca 20 <210> 36 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> sgRNA for C63950_g1_i1 of Zona pellucida sperm-binding protein <400> 36 gauguugaug agauacgccu 20 <210> 37 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> sgRNA for C63950_g1_i1 of Zona pellucida sperm-binding protein <400> 37 ccuccucaua uacucuccug 20 <210> 38 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> sgRNA for C63950_g1_i1 of Zona pellucida sperm-binding protein <400> 38 agcucuaacg uguuuuacuu 20 <210> 39 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> sgRNA for C63950_g1_i1 of Zona pellucida sperm-binding protein <400> 39 ugaugcagag gcaccaaaua 20 <210> 40 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> sgRNA for C63950_g1_i1 of Zona pellucida sperm-binding protein <400> 40 ugcugcaucu cuagaaaggu 20 <210> 41 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> sgRNA for C63950_g1_i1 of Zona pellucida sperm-binding protein <400> 41 uuugcuuucu gagguuaau 20 <210> 42 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> sgRNA for C63950_g1_i1 of Zona pellucida sperm-binding protein <400> 42 guucaaguuu ucacuuaaau 20 <210> 43 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> sgRNA for C63950_g1_i1 of Zona pellucida sperm-binding protein <400> 43 accauuaugc uuuaaaguua 20 <210> 44 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> sgRNA for C63950_g1_i1 of Zona pellucida sperm-binding protein <400> 44 uuuugaggca gugaaaaaug 20 <210> 45 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> sgRNA for C63950_g1_i1 of Zona pellucida sperm-binding protein <400> 45 ugcggacucc uccaugauug 20 <210> 46 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> sgRNA for C63950_g1_i1 of Zona pellucida sperm-binding protein <400> 46 ugaaagcuac cucugaaaug 20

Claims (7)

and a guide RNA comprising a targeting sequence that specifically binds to a target site of a gene encoding a Cas9 protein and a species-specific sperm-egg recognition protein of Micropterus salmoides, wherein the guide RNA is a species-specific sperm. -Nucleic acid capable of hybridizing to a continuous target site of 17 bp to 23 bp in length located adjacent to the 5' end or 3' end of the proto-spacer-adjacent motif (PAM) sequence recognized by the Cas9 protein in the gene encoding the egg recognition protein In the composition for inducing infertility of the big mouth bass (Micropterus salmoides) comprising the sequence,
The gene encoding the species-specific sperm-egg recognition protein is an IZUMO1 gene comprising one or more nucleic acid sequences selected from SEQ ID NOs: 1 to 3; delete delete and a guide RNA comprising a targeting sequence that specifically binds to a target site of a gene encoding a Cas9 protein and a species-specific sperm-egg recognition protein of Micropterus salmoides, wherein the guide RNA is a species-specific sperm. -Nucleic acid capable of hybridizing to a continuous target site of 17 bp to 23 bp in length located adjacent to the 5' end or 3' end of the proto-spacer-adjacent motif (PAM) sequence recognized by the Cas9 protein in the gene encoding the egg recognition protein In the composition for inducing infertility of the big mouth bass (Micropterus salmoides) comprising the sequence,
The gene encoding the species-specific sperm-egg recognition protein is a zona pellucida sperm-binding protein gene comprising the nucleic acid sequence of SEQ ID NO: 4. A composition for inducing infertility of Micropterus salmoides. delete 5. The method of claim 1 or 4,
The guide RNA is a composition for inducing infertility of large-mouth bass (Micropterus salmoides), characterized in that it comprises one nucleic acid sequence selected from SEQ ID NOs: 27, 28 and 30 to 46. Collecting sperm of males and eggs of females during spawning of largemouth bass;
producing a fertilized egg by fertilizing the sperm and egg of the collected large-mouth bass;
Species-specific sperm or egg of a fertilized egg by injecting a composition for inducing infertility of a largemouth bass (Micropterus salmoides) comprising at least one guide RNA comprising a Cas9 protein and one nucleic acid sequence selected from SEQ ID NOs: 27, 28 and 30 to 46 Editing the encoded nucleotide sequence of the recognition protein (Target sequence); and
Infertility-induced largemouth bass (Micropterus salmoides) production method comprising the; incubating a fertilized egg having the edited species-specific sperm or egg recognition protein.

Images