KR102177130B1 - Use of miR-18b for preventing, treating or diagnosing muscular disease and neuromuscular disease - Google Patents

Abstract

The present invention relates to the use of miR-18b for preventing, treating, or diagnosing muscle diseases or neuromuscular diseases, and specifically, in a muscle disease model caused by gene mutation, a gene mutation reduces miR-18b expression, thereby transducing miR-18b It was confirmed that it induces impaired regulation of the pathway, thereby inducing calcium signaling, inhibition of cell differentiation, and apoptosis. Therefore, miR-18b of the present invention can be used as a target factor for diagnosis and treatment of muscle diseases caused by gene mutations such as ALS and DMD.

Description

Use of miR-18b for preventing, treating or diagnosing muscular disease and neuromuscular disease {Use of miR-18b for preventing, treating or diagnosing muscular disease and neuromuscular disease}

The present invention relates to the use of miR-18b for preventing, treating or diagnosing muscle diseases or neuromuscular diseases, and specifically, using a pharmaceutical composition for preventing or treating muscle diseases containing miR-18b as an active ingredient and miR-18b It relates to a method for diagnosing muscle diseases.

Muscle disease is a disease that complains of weakness in upper or lower extremity muscles due to inherited and degenerative, inflammatory, endocrine, and metabolic causes, resulting in general muscular atrophy, decreased muscle tone, muscle spasms, and muscle pain. In particular, due to hereditary and degenerative causes, muscle dystrophy, amyotrophic lateral sclerosis (ALS), spinal muscular amyotrophy, spinobular muscular atrophy, and Charcoal Maritus disease Charcot Marie Tooth disease (CMT), Pompe disease, sacopenia, Canavan disease, dystonia, sacopenia, and muscle degeneration.

For example, amyotrophic lateral sclerosis is caused by the following gene mutations: SOD1 (Cu / Zn superoxide dismutase 1), TAF15 (TATA-Box Binding Protein Associated Factor 15), EWSR1 (Ewing sarcoma breakpoint region 1), FUS. (Fused in Sarcoma) and TDP-43 (TAR DNA-binding protein 4). In addition, amyotrophic lateral sclerosis (ALS) is a degenerative disease of upper and lower motor neurons that initially progresses muscle dysfunction and ultimately leads to muscle paralysis.Unfortunately, it slows disease progression or improves quality of life in ALS patients. There are few options.

In addition, in the case of Duchenne-type and Becker-type muscular dystrophy, it is caused by an abnormality in the Dystrophin gene present in the X chromosome, and about 1/3 is caused by natural mutations, and the rest are due to remission, and muscle weakness and myocardial dysfunction appear.

In addition, spinal muscular dystrophy is caused by a mutation in the SMN1 gene that encodes the SMN (survival motor neuron) protein in eukaryotes, and a decrease in the SMN protein causes functional damage to the motor neurons existing between the spinal cord and the brainstem. Muscles are neglected because they do not receive signals that command the movements of the muscles, causing muscle weakness, muscle atrophy, and fibrous spasm.

Gene mutations responsible for the development of these muscle diseases are associated with various cellular processes such as autophagy, protein aggregation, mitochondrial stress and RNA metabolism.

Meanwhile, microRNA (microRNA or miRNA) is a small non-coding single-stranded RNA molecule that regulates protein synthesis through RNA-dependent transcriptional gene regulation, and miRNA is produced through a two-step process. Specifically, in the nucleus, Drosha and DGCR8 are made from the first transcript miRNA (pri-miRNA) to miRNAs precursors (pre-miRNA), and pre-miRNAs are exported to the cytoplasm and then made into miRNAs by Dicer. Recently, miRNA is also related to cellular processes such as mitochondrial gene expression, calcium signaling, cell differentiation, and apoptosis, and as it is known that gene mutations regulate miRNA biosynthesis, in the pathogenesis of diseases caused by gene mutations, Research is being conducted to discover the role of miRNA and use it for diagnosis or treatment of diseases. However, the mechanism of specific interaction between gene mutations and miRNAs in muscle diseases caused by genetic causes has not been fully elucidated.

Accordingly, as a result of the present inventors' efforts to discover miRNAs that can be used for diagnosing and treating muscle diseases, gene mutations in a muscle disease model caused by gene mutations reduce miR-18b expression, thereby reducing the regulation of the miR-18b signaling pathway. And induces calcium signaling, inhibition of cell differentiation, and apoptosis, and that miR-18b can be used as a target factor for diagnosis and treatment of muscle diseases caused by gene mutations such as ALS and DMD. By revealing, the present invention has been completed.

Rosen DR, Siddique T, Patterson D, Figlewicz DA, Sapp P, Hentati A, Donaldson D, Goto J, O'Regan JP, Deng HX, et al. Mutations in Cu/Zn superoxide dismutase gene are associated with familial amyotrophic lateral sclerosis. Nature. 1993 Mar 4;362(6415):59-62. Narozna B, Langwinski W, Szczepankiewicz A. Non-Coding RNAs in Pediatric Airway Diseases. Genes (Basel). 2017 Nov 27;8(12). Chen Z, Li Y, Zhang H, Huang P, Luthra R. Hypoxia-regulated microRNA-210 modulates mitochondrial function and decreases ISCU and COX10 expression. Oncogene. 2010 Jul 29;29(30):4362-8. Choi E, Cha MJ, Hwang KC. Roles of Calcium Regulating MicroRNAs in Cardiac Ischemia-Reperfusion Injury. Cells. 2014 Sep 11;3(3):899-913. Makeyev EV, Zhang J, Carrasco MA, Maniatis T. The MicroRNA miR-124 promotes neuronal differentiation by triggering brain-specific alternative pre-mRNA splicing. Mol Cell. 2007 Aug 3;27(3):435-48.

An object of the present invention is to provide a pharmaceutical composition for preventing or treating muscle diseases, containing miR-18b as an active ingredient.

Another object of the present invention is to provide a method for diagnosing muscle diseases using miR-18b.

In order to achieve the object of the present invention, the present invention provides a pharmaceutical composition for preventing or treating muscle diseases containing miR-18b as an active ingredient.

In addition, the present invention provides a method for diagnosing muscle disease, comprising measuring the expression level of miR-18b in a sample isolated from a subject and comparing it with a normal control.

The present invention confirms that in a muscle disease model caused by gene mutation, gene mutation decreases miR-18b expression, resulting in impaired regulation of the miR-18b signaling pathway, thereby inhibiting calcium signaling and cell differentiation and inducing apoptosis. I did. In addition, it was confirmed that apoptosis induced by gene mutation was suppressed by increasing miR-18b expression, and calcium signaling and cell differentiation were restored. Therefore, miR-18b of the present invention can be used as a target factor for diagnosis and treatment of muscle diseases caused by gene mutations such as ALS and DMD.

1 is an NSC-34 motor neuron (mtNSC-34 cell) expressing human SOD1 (G93A) according to an embodiment of the present invention and an NSC-34 motor neuron (wtNSC-34 cell) expressing human SOD1 as a control. ) In RNA biosynthesis, mtNSC-34 cells and wtNSC-34 cells, 4 genes with differences in expression, Hif1α (hypoxia inducible factor 1 alpha), Mef2c (myocyte specific enhancer factor 2c), Mctp1 (multiple C2 domains transmembrane protein) 1) and Rarb (retinoic acid receptor beta) expression changes.
Figure 2 shows the changes in intracellular calcium signaling, cell differentiation, and apoptosis in mtNSC-34 cells, wtNSC-34 cells, and motor neurons (NSC-34 cont cells) expressing mouse SOD1 according to an embodiment of the present invention. It is a confirmed degree.
3 is a diagram illustrating miR-18b as a target miRNA regulating Hif1α and miR-206 as a target miRNA regulating Mctp1 and Rarb.
FIG. 4 shows changes in Hif1α, Mef2c, Mctp1, Rarb and miR-206 expression, LDH release changes in NSC-34 cont cells with reduced miR-18b expression according to an embodiment of the present invention, and an implementation of the present invention This is a diagram confirming apoptosis changes in neural stem cells (NSC) with reduced miR-18b expression according to examples.
5 shows changes in Hif1α, Mef2c, Mctp1, Rarb and miR-206 expression in mtNSC-34 cells with increased miR-18b expression according to an embodiment of the present invention, changes in intracellular calcium signaling, cell differentiation and apoptosis. It is a confirmed degree.
6 is a diagram illustrating changes in Mef2c, Mctp1, Rarb and miR-206 expression and apoptosis in mtNSC-34 cells with reduced Hif1α expression according to an embodiment of the present invention.
7 is a diagram illustrating changes in the expression of Mctp1 and Rarb in NSC-34 cont cells with increased miR-206 expression according to an embodiment of the present invention.
8 shows intracellular calcium signaling and cell differentiation in NSC-34 cont cells with increased miR-206 expression according to an embodiment of the present invention, and increases miR-206 expression according to an embodiment of the present invention. It is a diagram confirming the apoptosis change in each of the NSC-34 cont cells and NSCs.
9 is a diagram illustrating changes in expression of Mctp1 and Rarb and changes in cell death in mtNSC-34 cells with reduced miR-206 expression according to an embodiment of the present invention.
10 is a diagram illustrating changes in intracellular calcium signaling and cell differentiation in NSC-34 cont cells having reduced Mctp1 and/or Rarb expression according to an embodiment of the present invention.
FIG. 11 is a diagram confirming apoptosis changes in NSC-34 cont cells and neural stem cells with reduced Mctp1 and/or Rarb expression according to an embodiment of the present invention.
12 is a diagram illustrating changes in intracellular calcium signaling, cell differentiation, and apoptosis in mtNSC-34 cells with increased Mctp1 and/or Rarb expression according to an embodiment of the present invention.
13 is a change in expression of Hif1α, Mef2c, Mctp1, Rarb, miR-18b and miR-206 in NSC-34 cont cells with increased expression of mutated SOD1 (G85R) and SOD1 (D90A) according to an embodiment of the present invention and This is a diagram confirming changes in cell death.
14 and 15 are Hif1α, Mef2c, in spinal cord tissue samples and familial ALS (fALS (G86S)) patient spinal cord samples of amyotrophic lateral sclerosis (ALS) disease mouse model according to an embodiment of the present invention. It is a diagram confirming changes in expression and apoptosis of Mctp1, Rarb, miR-18b and miR-206.
16 is a differentiation of neural stem cells (hNSCs) from hiPSCs derived from a blood sample of a SOD1 (G17S) fALS patient according to an embodiment of the present invention, and motor neurons (MNs) derived from the differentiated hNSCs It is a confirmed degree.
Figure 17 is a change in the expression of Hif1α, Mef2c, Mctp1, Rarb, miR-18b and miR-206 in hiPSC-derived MN of SOD1 (G17S) fALS patient according to an embodiment of the present invention, intracellular calcium signaling, cell differentiation and cell This is the figure confirming the change of death.
18 is a diagram illustrating changes in miR-18b expression in myoblasts with reduced Dystrophin expression according to an embodiment of the present invention.
FIG. 19 is a diagram illustrating changes in miR-18b expression in a mouse model of Ducian-type muscular dystrophy (DMD) according to an embodiment of the present invention.
Fig. 20 is a diagram schematically illustrating impaired regulation of the miR-18b signaling pathway caused by gene mutations.

Hereinafter, the present invention will be described in more detail.

The present invention provides a pharmaceutical composition for preventing or treating muscle diseases, containing miR-18b as an active ingredient.

In the present invention, the miR-18b may be derived from animals including humans, for example, monkeys, chimpanzees, pigs, horses, cows, sheep, dogs, cats, mice, rabbits, and the like.

In the present invention, the nucleic acid molecule constituting the miR-18b may have a length of 18 to 100 nt (nucleotide). Specifically, the nucleic acid molecule may be in the form of a mature miRNA of 19 to 25 nt in length, more specifically 21, 22 or 23 nt in length. Further, the nucleic acid molecule may be in the form of a precursor miRNA having a length of 50 to 100 nt, more specifically 65 to 95 nt.

In addition, the mature miRNA form of miR-18b may be specifically miR-18b-5p or miR-18b-3p, and more specifically miR-18b-5p.

In the mature miRNA or precursor miRNA form of miR-18b, the nucleotide sequence information of the nucleic acid molecule can be found in known genetic databases such as NIH GenBank and miRBASE (http://www.mirbase.org/). I can. For example, the nucleotide sequence of the mature form of human miR-18b is registered as the gene registration number MIMAT0001412 (SEQ ID NO: 1) or MIMAT0004751 (SEQ ID NO: 2), and the precursor form is MI0001518 (SEQ ID NO: 3).

gene Sequence information hsa-miR-18b Mature form miR-18b-5p UAAGGUGCAUCUAGUGCAGUUAG (SEQ ID NO: 1) miR-18b-3p UGCCCUAAAUGCCCCUUCUGGC (SEQ ID NO: 2) Precursor form UGUGUUAAGGUGCAUCUAGUGCAGUUAGUGAAGCAGCUUAGAAUCUACUGCCCUAAAUGCCCCUUCUGGCA (SEQ ID NO: 3)

In addition, miR-18b used in the present invention is functional equivalent of the nucleic acid molecule constituting it, for example, functionally equivalent to the miRNA nucleic acid molecule even if some nucleotide sequences of the miRNA nucleic acid molecule are modified by deletion, substitution or insertion. It is a concept that includes variants that can act. For example, miR-18b of the present invention may exhibit 80% or more homology with the nucleotide sequence of each corresponding sequence number, and specifically may include 90% or more specifically 95% or more homology. Such homology can be readily determined by comparing the sequence of a nucleotide with a corresponding portion of a target gene using computer algorithms well known in the art, for example Align or BLAST algorithms.

Further, miR-18b used in the present invention may exist in a single-stranded or double-stranded form. Mature miRNA molecules exist primarily as single strands, but precursor miRNA molecules may contain partially self-complementary structures (eg stem-loop structures) capable of forming double strands. In addition, the nucleic acid molecule of the present invention may be constructed in the form of RNA or peptide nucleic acids (PNA).

In addition, miR-18b used in the present invention may be isolated or prepared using standard molecular biology techniques, such as chemical synthesis or recombinant methods, or commercially available ones may be used.

In the present invention, the miR-18b itself may be included, but may include a fragment functionally equivalent thereto, and the fragment of the miRNA may be a polynucleotide including the seed sequence of the miRNA. The seed sequence refers to the nucleotide sequence of a partial region of the miRNA that binds with complete complementarity when the miRNA recognizes the target, and this is an essential part for the miRNA to bind to the target.

In addition, the miR-18b may be used in the form of a variety of miRNA derivatives (miRNA mimics) that generate its biologically equivalent efficacy, and a modified miRNA including a miRNA sequence including the same seed region may be used. . The miRNA derivative for the miRNA may partially include a phosphorothiolate structure in which the RNA phosphate backbone structure is substituted with another element such as sulfur, and instead of RNA, DNA and PNA ( Petide nucleic acids) molecules can be used in the form of a full or partial substitution, and can also be used in the form of substitution of the 2'hydroxyl group of an RNA sugar with various functional structures, including methylation, methoxylation, fluorination, etc. However, it is not limited to these variations.

In the present invention, the miR-18b may be provided in a form included in a vector or introduced into a cell.

Specifically, the miR-18b may be included in an expression vector for intracellular delivery and provided. Both viral vectors and non-viral vectors can be used as the expression vector. As a viral vector, for example, a lentivirus, retrovirus, adenovirus, herpes virus, or abipox virus vector may be used. It is not limited thereto.

The expression vector may further include a selection marker to facilitate selection of the transduced cells. Markers that confer selectable phenotypes, such as, for example, drug resistance, auxotrophic, resistance to cytotoxic agents or expression of surface proteins, e.g. green fluorescent protein, puromycin, neomycin, hygromycin, Histidinoldihydrogenase (hisD), guanine phosphoribosyltransferase (Gpt), and the like can be illustrated.

In addition, the miR-18b may be provided in a form introduced into cells. These cells are able to express miR-18b at high levels. As a method of introducing into cells, for example, G-fectin, Mirus TrasIT-TKO lipophilic reagent, lipofectin, lipofectamine, cellfectin, cationic phospholipid nanoparticles, cationic polymer, cationic micelle , It can be introduced into cells together with a delivery reagent including a cationic emulsion or liposome, or by conjugating a biocompatible polymer such as polyethylene glycol to increase intracellular absorption.

In the present invention, the muscle disease may be a muscle disease caused by a gene mutation, but is not limited thereto.

In addition, the muscle diseases are myasthenia gravis, progressive muscular dystrophy, myotonic muscular dystrophy, Duchenne muscular dystrophy, Becker-type muscular dystrophy, and backer muscular dystrophy. Limb Girdle muscular dystrophy, facioscapulohumeral muscular dystrophy, spinal muscular amyotrophy, muscle atrophy, amyotrophic lateral muscular dystrophy, spinal cord muscular dystrophy (spinobulbar muscular atrophy), Charcot Marie Tooth disease (CMT), Pompe disease, Canavan disease, dystonia, sacopenia, or muscle degeneration However, it is not limited thereto.

In a specific embodiment of the present invention, the present inventors have shown that a gene mutation in amyotrophic axonal sclerosis decreases miR-18b expression in a muscle disease model caused by gene mutation, resulting in impaired regulation of the miR-18b signaling pathway, and miR-18b Dysregulation induces upregulation of Hif1α, upregulated Hif1α upregulates Mef2c, Mef2c induces miR-206 expression, and miR-206 is directly involved in the post-transcriptional regulation of Mctp1 and Rarb, resulting in calcium signaling and It was confirmed that it inhibits neuronal differentiation and induces apoptosis. In addition, it was confirmed that apoptosis induced by gene mutation was suppressed by increasing miR-18b expression, and calcium signaling and cell differentiation were restored.

In addition, the present inventors have confirmed that the regulation of the miR-18b signaling pathway is caused by gene mutations in Ducian-type muscular dystrophy as a muscle disease model caused by gene mutation.

Therefore, the present inventors have found that in a muscle disease model caused by gene mutation, a gene mutation decreases miR-18b expression, resulting in impaired regulation of the miR-18b signaling pathway, thereby inhibiting calcium signaling and cell differentiation and inducing apoptosis. It was confirmed that apoptosis induced by gene mutation was suppressed by increasing the expression of miR-18b, and calcium signaling and cell differentiation were restored. Therefore, the miR-18b of the present invention can be used for preventing or treating muscle diseases.

The composition of the present invention may further include a pharmaceutically acceptable carrier, and may be formulated with a carrier.

The pharmaceutically acceptable carrier refers to a carrier or diluent that does not stimulate an organism and does not inhibit the biological activity and properties of the administered compound. For example, as acceptable pharmaceutical carriers in a composition formulated as a liquid solution, as sterilization and biocompatible, saline, sterile water, Ringer's solution, buffered saline, albumin injection solution, dextrose solution, maltodextrin solution, Glycerol, ethanol, and one or more of these components may be mixed and used, and other conventional additives such as antioxidants, buffers, and bacteriostatic agents may be added as needed. It can also be formulated in the form of a solution or suspension (eg, microparticles, liposomes, or integrated with cells).

The composition of the present invention may be applied in any formulation containing it as an active ingredient, and may be prepared and administered in an oral or parenteral formulation. Administration refers to the introduction of the composition of the present invention into a patient by any suitable method, and includes delivery of a nucleic acid molecule by viral or non-viral techniques or implantation of cells expressing the nucleic acid molecule. The route of administration of the composition of the present invention may be administered through various routes, either oral or parenteral, as long as it can reach the target tissue. For example, oral administration, intraperitoneal administration, intravenous administration, intramuscular administration, subcutaneous administration, intradermal administration, intranasal administration, intrapulmonary administration, rectal administration, intranasal administration, intraperitoneal administration, intrathecal administration, It is not limited thereto.

The compositions and treatment methods of the present invention are applicable to any animal capable of developing muscle diseases, and the animals include humans and primates, as well as livestock such as cattle, pigs, sheep, horses, dogs and cats.

It is obvious to those skilled in the art that the range of the effective amount of the composition of the present invention or a suitable total daily use amount can be determined by the treating physician within the range of correct medical judgment. The specific therapeutically effective amount for a particular patient is the type and extent of the reaction to be achieved, the specific composition, including whether or not other agents are used in some cases, the patient's age, weight, general health status, sex and diet, administration time, It is preferable to apply differently depending on various factors including the route of administration and the secretion rate of the composition, the treatment period, and the amount of radiation to be irradiated, and similar factors well known in the medical field. For example, it may be used as 0.001 μg/kg-100 mg/kg (body weight) per day, but is not limited thereto. It is preferable to determine the effective amount of a pharmaceutical composition suitable for the purposes of the present invention in consideration of the above.

In addition, the present invention provides a method of providing diagnostic information for muscle disease, comprising measuring the expression level of miR-18b in a sample isolated from a subject and comparing it with a normal control.

In the method of the present invention, the sample may be tissue, cells, plasma, serum, blood, saliva, or urine, but is not limited thereto.

In the method of the present invention, the expression level is RT-PCR (Reverse transcription polymerase chain reaction), quantitative RT-PCR, real-time RT-PCR, Northern blotting (Northern blotting) or using a transcriptome analysis method It can be measured, but is not limited thereto.

In the method of the present invention, it can be confirmed that the expression level of miR-18b in the sample decreases compared to the normal control group to diagnose muscle disease.

In addition, the expression level of Hif1α, Mef2c, Mctp1, Rarb or miR-206 in the sample may be additionally measured and compared with a normal control group to diagnose muscle disease. Specifically, muscle disease can be diagnosed by confirming that the expression level of Hif1α, Mef2c, or miR-206 in the sample increases compared to the normal control, and that the expression level of Mctp1 or Rarb decreases compared to the normal control. You can diagnose muscle disease by checking.

In the method of the present invention, the muscle disease may be a muscle disease caused by a gene mutation, but is not limited thereto.

In addition, the muscle diseases are myasthenia gravis, progressive muscular dystrophy, myotonic muscular dystrophy, Duchenne muscular dystrophy, Becker-type muscular dystrophy, and backer muscular dystrophy. Limb Girdle muscular dystrophy, facioscapulohumeral muscular dystrophy, spinal muscular amyotrophy, muscle atrophy, amyotrophic lateral muscular dystrophy, spinal cord muscular dystrophy (spinobulbar muscular atrophy), Charcot Marie Tooth disease (CMT), Pompe disease, Canavan disease, dystonia, sacopenia, or muscle degeneration However, it is not limited thereto.

In the present inventors, in a muscle disease model caused by gene mutations, gene mutations induce miR-18b expression to decrease miR-18b signaling pathway, and miR-18b dysregulation induces upregulation of Hif1α, and upregulated It was confirmed that Hif1α upregulates Mef2c, Mef2c induces miR-206 expression, and miR-206 is directly involved in the post-transcriptional regulation of Mctp1 and Rarb to induce calcium signaling, neuronal differentiation, and apoptosis. The factors regulated by miR-18b and miR-18b of the present invention can be used as target factors for diagnosing muscle diseases.

Hereinafter, the present invention will be described in detail by examples.

However, the following examples are merely illustrative of the present invention, and the contents of the present invention are not limited by the following examples.

<Example 1> Cell culture

<1-1> SOD1 Mutation Motor neuron culture

As a muscle disease caused by a gene mutation, amyotrophic lateral sclerosis (ALS) is well known to be caused by the SOD1 mutation and the loss of motor neurons. Therefore, in order to investigate the target miRNA that can be used for diagnosis and treatment of ALS, SOD1 mutant motor neurons were cultured as follows.

Specifically, NSC-34 cont cells, a motor neuron cell line expressing mouse SOD1, NSC-34 hSOD1 cells (wtNSC-34), a motor neuron cell line expressing human SOD1, and a SOD1 mutant motor neuron cell line expressing a human SOD1 G93A mutation Phosphorus NSC-34 hSOD1 (G93A) cells (mtNSC-34) were obtained from the Korea Institute of Science and Technology (KIST). Then, it was cultured in DMEM medium (Hyclone) to which 10% FBS (Gibco), 100 U/ml penicillin, and 100 μg/ml streptomycin (Invitrogen Life Tech) were added. In addition, it differentiated in DMEM medium (Hyclone) to which 1% FBS, 100 U/ml penicillin, 100 μg/ml streptomycin, and 20 uM all-trans-RA (Sigma) were added.

<1-2> Neural stem cells Isolation and culture

In order to investigate the target miRNA that can be used for diagnosis and treatment of ALS, neural stem cells (NSC) were isolated and cultured as follows.

Specifically, animal experiments were performed according to the guidelines of the Institutional Animal Care and Use Committee (IACUC) of Seoul National University for the protection and use of experimental animals. After extracting the brain tissue of the subventricular zone of 9 main mice, it was crushed in a plate containing HBSS, and the cells were cultured for 15 minutes at 37°C after trypsin treatment. Thereafter, centrifugation and containing 1% PSA (penicillin-streptomycin-amphotericin, Invitrogen), 2% B27 supplement (Gibco BRL), 10 ng/mL EGF (Invitrogen) and 10 ng/mL bEGF (Invitrogen) After resuspending in DMEM/F12 (Invitrogen) medium, the cells were seeded in a 6-well plate to culture NSCs. In order to induce cell differentiation, when the cells form neurospheres of about 50-100 μm in diameter, resuspended and transferred to a sterile 15-ml tube. Centrifugation at room temperature for 5 minutes at 100 xg to obtain a pellet containing neurospheres, and culture by resuspending the pellet in differentiation culture medium (DMEM/F12, 1% PSA, 2% B27 and 5% FBS) I did.

<1-3> Dystrophin Suppression of expression Myoblastic culture

Duchenne muscular dystrophy (DMD), a muscle disease caused by a gene mutation, is well known to be caused by a Dystrophin deficiency caused by a mutation in the Dystrophin gene. Accordingly, in order to investigate the target miRNA that can be used for diagnosis and treatment of muscular dystrophy, Dystrophin expression-inhibiting myoblasts were produced and cultured as follows.

Specifically, mouse myoblasts (C2C12 cell line) were cultured in DMEM medium (10% FBS added) to which antibiotics were added. Inhibit Dystrophin expression by transducing mouse siDystrophin (5'-GGCCUUACAGGGCAAAAACTT-3', SEQ ID NO: 4) produced by COSMO GENETECH into cultured C2C12 cells according to the manufacturer's procedure using RNAiMax transfection reagent (Invitrogen). C2C12 Cells were prepared and cultured.

<Example 2> Confirmation of abnormal gene expression in SOD1 mutant motor neurons

Since gene mutations are related to RNA biosynthesis, miRNAs involved in RNA biosynthesis can be used as target factors for diagnosis and treatment of ALS as muscle diseases caused by gene mutations. Accordingly, in order to investigate the changes in RNA biosynthesis due to SOD1 mutation, mtNSC-34 cells were fractionated into nucleus and cytoplasm, and transcriptome analysis was performed using the nuclear fraction and cytoplasmic fraction, and then the mtNSC-34 cells Expression of genes with differences in expression between the nucleus and cytoplasm was confirmed by performing RT-PCR and qRT-PCR.

Specifically, after culturing each of the mtNSC-34 cells and wtNSC-34 cells obtained in Example <1-1> in 3 sets in a 10 cm dish, 450 μl of cold buffer A (10 mM HEPES (pH 7.9)) , 10 mM KCl, 1 mM DTT and 0.1 mM EDTA (pH 8.0)). Each of mtNSC-34 cells and wtNSC-34 cells was resuspended and reacted on ice for 25 minutes. Then, 5 μl of 10% NP-40 was added and reacted on ice for 2 minutes, followed by centrifugation at 5000 rpm for 3 minutes at 4°C. The pellet was separated to obtain a nuclear fraction, and the supernatant was separated to obtain a cytoplasmic fraction. RNA-seq analysis was performed using the transcriptome of a total of 12 samples requested by Macrogen Inc. (Fig. 1A).

In addition, four genes with differences in expression between mtNSC-34 cells and wtNSC-34 cells, Hif1α (hypoxia inducible factor 1 alpha), Mef2c (myocyte specific enhancer factor 2c), Mctp1 (multiple C2 domains transmembrane protein 1) and Rarb (retinoic acid receptor beta) mRNA expression was confirmed by RT-PCR and quantitative RT-PCR (qRT-PCR). Specifically, in order to confirm the change in the expression of two kinds of genes, Mctp1 and Rarb mRNA, which have a difference in expression between the nucleus and cytoplasm, the nuclear fraction and the cytoplasmic fraction were obtained from each of mtNSC-34 cells and wtNSC-34 cells by the same method as above. Thereafter, total RNA was extracted using TRIzol reagent (MRC), and RT-PCR was performed using the primers in Table 2 below (FIG. 1B). In addition, in order to confirm the changes in Hif1α, Mef2c, Mctp1 and Rarb mRNA expression in mtNSC-34 cells, mtNSC-34 cells and wtNSC-34 cells were each extracted total RNA using TRIzol reagent (MRC), and 50 ng RNA As a template, qRT-PCR was performed according to the manufacturer's procedure using the primers of Table 3 below and SYBR Green Real-time PCR Master Mix (Toyobo). Mouse GAPDH was used as a control (FIGS. 1C and 1D ).

gene Primer for mouse (5'→3') Mctp1 intron Forward direction GACTCCAACATACCCATTTCTG (SEQ ID NO: 5) Reverse port TAATATCTCTTCCCGCTCCTTC (SEQ ID NO: 6) Mctp1 exon Forward direction TCATCCTTACGCCTAAGGAAG (SEQ ID NO: 7) Reverse CCGGAACTTCACATATGGATC (SEQ ID NO: 8) Rarb intron Forward direction CACCTGAAGGTGAATGTTGG (SEQ ID NO: 9) Reverse CACTTGAACTTGGGGTCAAG (SEQ ID NO: 10) Rarb exon Forward direction GATCTACACTTGCCATCGAGA (SEQ ID NO: 11) Reverse CTTTCCGGATCTTCTCAGTGA (SEQ ID NO: 12) GAPDH
intron Forward direction TGGTGCAACAGTATTCCACT (SEQ ID NO: 13) Reverse CTGGAACATGTAGACCATGTAG (SEQ ID NO: 14) GAPDH
exon Forward direction CATGTTTGTGATGGGTGTGA (SEQ ID NO: 15) Reverse GATGCAGGGATGATGTTCTG (SEQ ID NO: 16)

gene Primer for mouse (5'→3') Hif1α Forward direction GTTCACCAAAGTTGAATCAGAGG (SEQ ID NO: 17) Reverse port CGATGAAGGTAAAGGAGACATTG (SEQ ID NO: 18) Mef2c Forward direction AGGATAATGGATGAGCGTAACAG (SEQ ID NO: 19) Reverse port AGCAACACCTTATCCATGTCAGT (SEQ ID NO: 20) Mctp1 Forward direction CGTTGTGTCATAGTGCTTGTAAA (SEQ ID NO: 21) Reverse port ATCATGTAGAGCTCAAAGTTCCA (SEQ ID NO: 22) Rarb Forward direction TTTCTCTGATGGCCTTACACTAA (SEQ ID NO: 23) Reverse AGATTAAACAGATGGCACTGAGA (SEQ ID NO: 24) GAPDH Forward direction ATAGCTGATGGCTGCAGGTT (SEQ ID NO: 25) Reverse AATCTCCACTTTGCCACTGC (SEQ ID NO: 26)

As a result, as shown in FIG. 1, it was confirmed that Mef2c regulated by Hif1α and Hif1α increased in the nucleus and cytoplasm of mtNSC-34 cells (FIG. 1A ). In addition, it was confirmed that Mctp1 and Rarb levels related to cell differentiation, known to be related to calcium signaling in mtNSC-34 cells, were changed, and in particular, Mctp1 and Rarb mRNA were upregulated in the nucleus, but significantly downregulated in the cytoplasm (Fig. 1B). In addition, it was confirmed that Hif1α and Mef2c mRNA expression levels were increased in mtNSC-34 cells, and Mctp1 and Rarb mRNA expression levels were decreased (FIGS. 1C and 1D).

Through the above results, it was confirmed that Hif1α and Mef2c were up-regulated and Mctp1 and Rarb were down-regulated by SOD1 mutation, and in particular, Mctp1 and Rarb were regulated after transcription in the cytoplasm.

<Example 3> Confirmation of the effect of SOD1 mutation on cells in SOD1 mutant motor neurons

In order to investigate the effect of SOD1 mutation on cells, changes in intracellular calcium signaling, cell differentiation, and apoptosis were confirmed in mtNSC-34 cells.

Since Mctp1 is known to be related to calcium signaling, intracellular Ca ²⁺ analysis was performed to investigate the effect of changes in Mctp1 expression by SOD1 mutation on intracellular calcium signaling. Specifically, each of the mtNSC-34 cells and wtNSC-34 cells obtained in Example <1-1> was treated in a 96-well plate at 4×10 ⁴ to 8×10 ⁴ cells/well and cultured in a growth medium for one day. I did. After 48 hours, the FLUOFORTE Dye-Loading Solution was treated in each well, and incubated at 37°C for 45 minutes and at room temperature for 15 minutes. Then, fluorescence was measured at 490/525 nm using a fluorescence meter (Fig. 2A, right, top).

In addition, since it is known that Rarb is related to cell differentiation, axonal generation analysis was performed to determine the effect of the SOD1 mutation on the cell differentiation of the Rarb expression change caused by the SOD1 mutation. Specifically, each of the mtNSC-34 cells and wtNSC-34 cells obtained in Example <1-1> was treated in a 96-well plate at 4×10 ⁴ to 8×10 ⁴ cells/well and cultured in a growth medium for one day. I did. Then, after visualization using immunofluorescence staining and a confocal microscope, axon formation was confirmed (Fig. 2A, right, bottom).

In addition, Western blotting and qRT-PCR were performed to determine the effect of the SOD1 mutation on apoptosis, to confirm the expression of apoptosis-related factors, and to confirm changes in LDH (Lactate dehydrogenase) release. Specifically, in order to perform Western blotting, mtNSC-34 cells, wtNSC-34 cells, and NSC-34 cont cells obtained in Example <1-1> were subjected to a lysis buffer (10 mM Tris at pH 7.4) for 30 minutes on ice. , pH 8.0 1mM EDTA, 500 mM NaCl, and 0.5% TritonX-100) were treated and lysed, and the protein lysate of the cells was electrophoresed by SDS-PAGE, and then nitrocellulose membranes (PALL Life Sciences ). Then, as primary antibodies, mouse anti-Hif1α antibody (NOVUS), rabbit anti-Mef2c antibody (LSBio), mouse anti-Mctp1 antibody (abcam), rabbit anti-Rarb antibody (LSBio), rabbit anti-Bax antibody (Cell signaling) ), rabbit anti-Bcl2 antibody (abcam), and mouse anti-β-actin (Millipore), rabbit anti-SOD1 (Enzo) antibody, and then reacted with HRP-conjugated secondary antibody to the primary antibody attached to the membrane. Attached, it was confirmed using ECL (Pierce chemical co, USA) (Fig. 2B). In addition, RNA was extracted from each of mtNSC-34 cells, wtNSC-34 cells, and NSC-34 cont cells by the same method as described in <Example 2>, and qRT-PCR was performed using the primers in Table 4 below. (Fig. 2C).

gene Primer for mouse (5'→3') Bax Forward direction AAGCTGAGCGAGTGTCTCCG (SEQ ID NO: 27) Reverse GGAGGAAGTCCAGTGTCCAG (SEQ ID NO: 28) Bcl2 Forward direction AACCCAATGCCCGCTGTGCA (SEQ ID NO: 29) Reverse ACCGAACTCAAAGAAGGCCACAA (SEQ ID NO: 30)

In addition, in order to confirm the change in LDH (Lactate dehydrogenase) release, the cell culture medium of the mtNSC-34 cells and wtNSC-34 cells obtained in Example <1-1> was recovered and centrifuged to obtain a supernatant. -Transferred to a well plate. Equal amounts of LDH assay substrate (SIGMA), enzyme and dye solutions were mixed. Half volume of the mixture was added to 1 volume of the medium supernatant. After reacting at room temperature for 30 minutes, 1/10 volume of 1N HCl was added to each well to terminate the reaction. Then, the absorbance was measured at a wavelength of 490 nm/690 nm using a spectrophotometer (FIG. 2D).

As a result, as shown in FIG. 2, it was confirmed that the intracellular Ca ²⁺ level was increased in mtNSC-34 cells, and total neurite growth was significantly decreased with the aggregation of SOD1 (G93A) protein (FIG. 2A ). . In addition, it was confirmed that the protein levels of Hif1α and Mef2c were significantly increased in mtNSC-34 cells, and the protein levels of Mctp1 and Rarb were significantly decreased (FIG. 2B). In addition, in mtNSC-34 cells, Bax protein and mRNA levels increased, Bcl2 protein and mRNA levels decreased (FIGS. 2B and 2C), and LDH release increased (FIG. 2D), confirming that cell death was induced. I did.

Through the above results, it was confirmed that apoptosis was induced by the SOD1 mutation, and the levels of Mctp1 and Rarb were down-regulated to induce changes in calcium signaling and cell differentiation, respectively.

<Example 4> Identification of target miRNAs regulating Hif1α, Mef2c, Mctp1 and Rarb

miRNA is well known as one of the most representative post-transcriptional regulators. Accordingly, it was confirmed that Hif1α and Mef2c are up-regulated and Mctp1 and Rarb are down-regulated in mtNSC-34 cells. TargetScan analysis was performed.

Specifically, miRNAs having a common base sequence with Hif1α, and miRNAs having a common base sequence with Mctp1 and Rarb were analyzed using TargetScan (http://www.targetscan.org) (FIGS. 3A and 3B).

In addition, in order to confirm the expression change of the target miRNA identified by TargetScan in mtNSC-34 cells and wtNSC-34 cells, mtNSC-34 cells, wtNSC-34 cells and NSC- RNA was extracted from each of the 34 cont cells, and qRT-PCR was performed using each of the primers (GenoSensor) for mmu-miR-18b and mmu-miR-206 (FIGS. 3C and 3D ).

As a result, as shown in Fig. 3, it was confirmed that miR-206 can be a post-transcriptional regulator of Mctp1 and Rarb (Fig. 3A), and it was confirmed that miR-206 is significantly upregulated in mtNSC-34 cells ( Figure 3C). In addition, it was confirmed that miR-18b can target Hif1α (FIG. 3B), and it was confirmed that miR-18b was significantly reduced in mtNSC-34 cells (FIG. 3D).

It is known that Mef2c acts as a transcriptional regulator of miR-206. From the above results, miR-18b dysregulation in which miR-18b expression decreases by SOD1 mutation is induced, and Hif1α, Mef2c by miR-18b dysregulation , it was confirmed that miR-206, Mctp1 and Rarb expression can be sequentially regulated.

<Example 5> Confirmation of Hif1α regulation and apoptosis change by miR-18b

<5-1> Confirmation of Hif1α upregulation and apoptosis induction by inhibition of miR-18b expression

To find out whether miR-18b dysregulation caused by SOD1 mutation is related to sub-mechanism regulation and apoptosis, miR-18b was reduced in wtNSC-34 cells using a locked nucleic acid inhibitor (LNA) method, followed by Western blotting. And qRT-PCR was performed to confirm the expression of related factors, and changes in cell death were confirmed.

Specifically, the NSC-34 cont cells obtained in Example <1-1> were transfected with miR-18b LNA (anti-18b, COSMOGENTECH) according to the manufacturer's procedure using RNAiMax transfection reagent (Invitrogen), , Recovered after 48 hours. Then, Western blotting (Fig. 4A), qRT-PCR (Fig. 4B to Fig. 4G, Fig. 4I and Fig. 4J), LDH release analysis by the same method as described in the above <Example 2> to <Example 4> (Figure 4H) was carried out. NSC-34 cont cells were used as a control.

In addition, Annexin V-FITC and PI analysis were additionally performed to confirm changes in apoptosis. Specifically, the NSC cultured in Example <1-2> was seeded in a 6-well tissue culture plate, treated with LNA (anti-18b) of miR-18b, and the attached cells after 48 hours were separated by TripleExpress. Trypsin was inactivated by adding culture medium. Then, centrifugation was performed at 1,500 x g for 5 minutes, and the supernatant was removed. Cells were stained with Annexin V-FITC and PI according to the manufacturer's procedure using Annexin-V-FITC and PI Apoptosis Detection Kit (BD Bisosciences). After staining, it was analyzed using FACSCalibur (BD Biosciences). Fluorescence was used as a green or red channel, and data was analyzed using Flowwing Software (Version 2.5.1, Unversity of Turku, Filand) (Fig. 4K).

As a result, as shown in Figure 4, it was confirmed that the LNA (anti-18b) of miR-18b increased the protein and mRNA expression of Hif1α and Mef2c, and reduced the protein and mRNA expression of Mctp1 and Rarb (FIG. 4A To Figure 4E). In addition, it was confirmed that miR-206 is rapidly induced under miR-18b deficiency (Figs. 4I and 4J). In addition, it was confirmed that apoptosis was increased under miR-18b deficiency (FIGS. 4A, 4F to 4H, and 4K).

Through the above results, it was confirmed that Hif1α was upregulated due to miR-18b regulation disorder by SOD1 mutation, and then apoptosis was induced by a sub-mechanism, and thus miR-18b could be used as a target miRNA for ALS diagnosis. I did.

<5-2> Confirmation of Hif1α down-regulation and inhibition of apoptosis by miR-18b overexpression

To investigate whether overexpression of miR-18b can inhibit Hif1α upregulation and apoptosis induced by SOD-1 mutation, miR-18b was overexpressed in mtNSC-34 cells, followed by Western blotting and qRT-PCR. Was carried out to confirm the expression of related factors. In addition, changes in intracellular calcium signaling, cell differentiation, and cell death were confirmed.

Specifically, cDNA was obtained from the NSC-34 cont cells obtained in Example <1-1>, and miR-18b was amplified by PCR using the cDNA as a template using the primers shown in Table 5 below. The amplified miR-18b PCR product was cloned into a pCDNA3 vector (Invitrogen) having BamH I and Xho I ( NEW ENGLAND BioLabs) restriction enzyme sites to prepare a miR-18b plasmid construct.

gene Primer for mouse (5'→3') miR-18b Forward direction CGCGGATCCACCATGGTGATTTAATCAGA (SEQ ID NO: 31) Reverse CCGCTCGAGCCGTTCAAATCATTTCTCAA (SEQ ID NO: 32)

To prepare mtNSC-34 cells overexpressing miR-18b, the miR-18b plasmid construct was transfected into mtNSC-34 cells according to the manufacturer's procedure using Lipofectamine 2000 (Invitorgen), and recovered after 48 hours. I did. Then, Western blotting (Fig. 5A), qRT-PCR (Fig. 5B to Fig. 5F), intracellular Ca ^{2 +} analysis (Fig. 5H) in the same manner as described in the above <Example 2> to <Example 4> , Right, upper), axonal analysis (Fig. 5H, right, lower), LDH release analysis (Fig. 5G) was performed. As a control, mtNSC-34 cells were used.

As a result, as shown in FIG. 5, it was confirmed that Hif1α and Mef2c expression decreased by miR-18b overexpression in mtNSC-34 cells, whereas Mctp1 and Rarb expression increased (FIGS. 5A to 5C ). In addition, it was confirmed that miR-206 is down-regulated by overexpressed miR-18b (FIGS. 5E and 5F). In addition, it was confirmed that overexpressed miR-18b inhibits apoptosis in mtNSC-34 cells (Fig. 5A, Fig. 5D, Fig. 5G). On the other hand, despite the SOD1 aggregation in mtNSC-34 cells, it was confirmed that intracellular Ca ²⁺ levels were reduced by overexpressed miR-18b and neuronal differentiation was activated (FIG. 5H).

Through the above results, it was confirmed that apoptosis induced by the SOD-1 mutation was suppressed through overexpression of miR-18b, and thus it was confirmed that miR-18b can be used for ALS prevention and treatment.

<Example 6> Confirmation of Mef2c regulation and apoptosis change by Hif1α

It was confirmed that miR-18b acts as a target miRNA of Hif1α, and that Hif1α expression is upregulated by miR-18b dysregulation.In order to investigate the next mechanism of Hif1α upregulation in the miR-18b pathway, RNAi was used. After reducing Hif1α expression in mtNSC-34 cells, Western blotting and qRT-PCR were performed to confirm the expression of related factors and changes in cell death.

Specifically, siHif1α (5'-AAGCAUUUCUCUCAUUUCCUCAUGG-3', SEQ ID NO: 33) for mice produced by requesting COSMO GENETECH to the mtNSC-34 cells obtained in Example <1-1> was added to RNAiMax transfection reagent (Invitrogen) Was used, transfected according to the manufacturer's procedure, and recovered after 48 hours. Then, Western blotting (Fig. 6A), qRT-PCR (Fig. 6B to Fig. 6H), and LDH release analysis (Fig. 6I) are performed in the same manner as described in <Example 2> to <Example 4>. I did. As a control, mtNSC-34 cells were used.

As a result, it was confirmed that, as shown in FIG. 6, Mef2c protein and mRNA levels were decreased under Hif1α deficiency in mtNSC-34 cells (FIGS. 6A to 6C ), and Mctp1 and Rarb proteins and mRNA levels were increased (FIG. 6A , Figure 6D, Figure 6E). In addition, it was confirmed that inhibition of Mef2c expression by Hif1α deficiency reduced miR-206 levels (Fig. 6H). In addition, it was confirmed that apoptosis was inhibited in the Hif1α deficient state (FIGS. 6F, 6G, 6I).

From the above results, it was confirmed that miR-18b dysregulation caused by SOD1 mutation induces upregulation of Hif1α, and upregulated Hif1α upregulates Mef2c to induce apoptosis.

<Example 7> Post-transcriptional regulation of Mctp1 and Rarb by miR-206 and confirmation of apoptosis change

<7-1> Confirmation of Mctp1 and Rarb downregulation and apoptosis induction by miR-206 overexpression

In order to investigate the role of miR-206 under SOD1 mutation conditions, luciferase reporter analysis was performed in NSC-34 cont cells overexpressing miR-206 using 3'UTR of Mctp1 and Rarb. In addition, Western blotting and qRT-PCR were performed to confirm the expression of related factors. In addition, changes in intracellular calcium signaling, cell differentiation and cell death were confirmed.

Specifically, cDNA was obtained from the NSC-34 cont cells obtained in Example <1-1>, and miR-206 was amplified by PCR using the cDNA as a template using the primers shown in Table 7 below. The miR-206 PCR product was cloned into a pCDNA3 vector (Invitrogen) having BamH I and Xho I ( NEW ENGLAND BioLabs) restriction sites to prepare a miR-206 plasmid construct. In addition, PCR was performed using the primers in Table 6 below to amplify each of the 3'UTRs of Mctp1 and Rarb. Each of the amplified Mctp1 3'UTR and Rarb 3'UTR PCR products was cloned into a pmirGLO double-luciferase vector (Promega) having Xho I and Xba I ( NEW ENGLAND BioLabs) restriction sites, and a Mctp1 3'UTR plasmid construct. And Rarb 3'UTR plasmid constructs were prepared.

gene Primer for mouse (5'→3') miR-206 Forward direction CGCGGATCCATTCTTCACACTTCTCACTT (SEQ ID NO: 34) Reverse CCGCTCGAG ACGAAGAAGTCAACAGCATA (SEQ ID NO: 35) Mctp1 3'UTR Forward direction CCGCTCGAGAAAGCTTGAATAATAGAAAT (SEQ ID NO: 36) Reverse CTAGTCTAGAATACATGGGTTTTTTGTTTG (SEQ ID NO: 37) Rarb 3'UTR Forward direction CCGCTCGAGAACGTGTAATTACCTTGAAA (SEQ ID NO: 38) Reverse CTAGTCTAGACAAAGTCTTCAGAAACTTAA (SEQ ID NO: 39)

Then, the miR-206 plasmid construct, Mctp1 3'UTR plasmid construct, and Rarb 3'UTR plasmid construct were transfected into NSC-34 cont cells using Lipofectamine 2000 (Invitorgen) according to the manufacturer's procedure. After infection, it was recovered 48 hours later, and luciferase activity was measured (FIGS. 7A and 7C ). In addition, Western blotting (Fig. 7E), qRT-PCR (Fig. 7B, Fig. 7D, Fig. 7F, Fig. 8C), intracellular Ca ² by the same method as described in the above <Example 2> to <Example 4> ⁺ Analysis (Fig. 8A, right, top), axonal analysis (Fig. 8A, right, bottom), LDH release analysis (Fig. 8D) was performed. NSC-34 cont cells were used as a control.

In addition, the miR-206 plasmid construct was transfected into the NSC cultured in Example <1-2>, and Annexin-V-FITC and PI were used in the same manner as described in Example <5-1>. Analysis (Figure 8E) was performed. NSC was used as a control.

As a result, as shown in Figs. 7 and 8, it was confirmed that the level of Mctp1 decreased by the overexpressed miR-206 and the level of Ca ^{2+ in the} cell increased. In addition, it was confirmed that the level of Rarb was reduced by the overexpressed miR-206, and neuronal differentiation was inhibited (FIGS. 7A to 7E, 8A). In addition, it was confirmed that apoptosis was induced by overexpression of miR-206 (FIGS. 8B to 8E ).

<7-2> Confirmation of upregulation of Mctp1 and Rarb and inhibition of apoptosis by inhibition of miR-206 expression

To find out the role of miR-206 under SOD1 mutation conditions, after reducing miR-206 expression in mtNSC-34 cells using the LNA method, Western blotting and qRT-PCR were performed to confirm the expression of related factors. , Cell death change was confirmed.

Specifically, the mtNSC-34 cells obtained in Example <1-1> were transfected with miR-206 LNA (anti-206, COSMOGENTECH) according to the manufacturer's procedure using RNAiMax transfection reagent (Invitrogen), Recovered after 48 hours. Then, Western blotting (Fig. 9A), qRT-PCR (Fig. 9B to Fig. 9E, Fig. 9G), LDH release analysis (Fig. 9F) in the same manner as described in the above <Example 2> to <Example 4>. ) Was performed. As a control, mtNSC-34 cells were used.

As a result, as shown in FIG. 9, it was confirmed that the amount of protein and mRNA of Mctp1 and Rarb significantly increased by suppressing miR-206 expression in mtNSC-34 cells (FIGS. 9A to 9C ). In addition, it was confirmed that apoptosis was suppressed by inhibition of miR-206 expression (FIGS. 9D to 9F).

Through the above results, miR-18b regulation disorder caused by SOD1 mutation induces upregulation of Hif1α, upregulated Hif1α upregulates Mef2c, and Mef2c acts as an electron regulator of miR-206 to induce miR-206 expression. And, it was confirmed that miR-206 induces apoptosis by directly involved in the pre-regulation of Mctp1 and Rarb.

<Example 8> Confirmation of the effect of Mctp1 and Rarb post-transcriptional regulation on cells

<8-1> Confirmation of induction of apoptosis by decreasing Mctp1 and Rarb expression

Through the above examples, expression of Hif1α is induced by impaired regulation of miR-18b, Mef2c expression is induced by Hif1α, miR-206 expression is induced by Mef2c, and Mctp1 and Rarb are induced by miR-206. It was confirmed that it was regulated after transcription. In order to find out whether Mctp1 and Rarb deficiency directly induce apoptosis, RNAi was used to reduce Mctp1 and/or Rarb expression in NSC-34 cont cells, followed by Western blotting and qRT-PCR to express related factors. Was confirmed. In addition, changes in intracellular calcium signaling, cell differentiation, and cell death were confirmed.

Specifically, siMctp1 for mice (5'-GCCACUAUAUAUCAAGGUATT-3', SEQ ID NO: 40) and/or siRarb for mice produced by requesting COSMO GENETECH to the NSC-34 cont cells obtained in Example <1-1> ( 5'-GGAGCCUUCAAAGCAGGAATT-3', SEQ ID NO: 41) was transfected according to the manufacturer's procedure using RNAiMax transfection reagent (Invitrogen), and recovered after 48 hours. Then, Western blotting (Fig. 10A), qRT-PCR (Fig. 10B, Fig. 10C, Fig. 11A, Fig. 11B), intracellular Ca in the same method as described in the above <Example 2> to <Example 4> ^{2 +} analysis (Fig. 10D, left, above), the axon generated analysis (Fig. 10D, left, below), and LDH release assay (Figure 11C) was performed. NSC-34 cont cells were used as a control.

In addition, the siMctp1 and siRarb were transfected into the NSC cultured in Example <1-2>, and Annexin-V-FITC and PI analysis (Fig. 11D) in the same manner as described in Example <5-1>. ) Was performed. NSC was used as a control.

As a result, as shown in Figs. 10 and 11, it was confirmed that the expression of Mctp1 was suppressed to increase the intracellular Ca ^{2 +} concentration, but did not affect the expression of Bax and Bcl2. In addition, it was confirmed that Rarb expression was inhibited to inhibit cell differentiation, whereas no significant changes in Bax and Bcl2 expression were observed. On the other hand, when Mctp1 and Rarb expression were simultaneously inhibited, it was confirmed that Bax expression increased, Bx12 expression decreased, and LDH release increased, leading to apoptosis (FIGS. 10A to 10D, FIGS. 11A to 11D).

<8-2> Confirmation of inhibition of apoptosis by increasing Mctp1 and Rarb expression

In order to find out whether apoptosis is directly inhibited by induction of Mctp1 and Rarb expression, after overexpressing Mctp1 and/or Rarb in mtNSC-34 cells, Western blotting and qRT-PCR were performed to confirm the expression of related factors. . In addition, changes in intracellular calcium signaling, cell differentiation, and cell death were confirmed.

Specifically, cDNA was obtained from the NSC-34 cont cells obtained in Example <1-1>, and PCR was performed using the primers in Table 7 below using the cDNA as a template to amplify Mctp1 and Rarb. The amplified Mctp1 PCR product was cloned into mCherry C1 (Clontech) having a Hind III ( NEW ENGLAND BioLabs) restriction enzyme site to prepare a Mctp1 plasmid construct. As for the amplified Rarb PCR product, the restriction enzyme sites of Nhe I and Age I ( NEW ENGLAND BioLabs) were cloned into eGFP N1 (Clontech) to prepare a Rarb plasmid construct.

gene Primer for mouse (5'→3') Mctp1 Forward direction CCCAAGCTTATGTACCAGTTGGATATCACACTA (SEQ ID NO: 42) Reverse CCCAAGCTTGCCAAGGTTGTTTTTTCTTCC (SEQ ID NO: 43) Rarb Forward direction CCGCTAGCATGAGCACCAGCAGCCACGC (SEQ ID NO: 44) Reverse CCACCGGTCTGCAGCAGTGGTGACTGAC (SEQ ID NO: 45)

In order to prepare mtNSC-34 cells overexpressing Mctp1 and/or Rarb, the Mctp1 plasmid construct and/or Rarb plasmid construct were added to mtNSC-34 cells according to the manufacturer's procedure using Lipofectamine 2000 (Invitorgen). Transfection and recovery after 48 hours. Then, Western blotting (Fig. 12A), qRT-PCR (Fig. 12B, Fig. 12C, Fig. 12E, right, Fig. 12F, right) in the same method as described in the above <Example 2> to <Example 4>. , Intracellular Ca ^{2 +} analysis (Fig. 12E, left), axon generation analysis (Fig. 12F, left), LDH release analysis (Fig. 12D) was performed. As a control, mtNSC-34 cells were used.

As a result, as shown in Fig. 12, it was confirmed that apoptosis was reduced when Mctp1 and Rarb were simultaneously overexpressed (FIGS. 12A to 12D). In addition, in mtNSC-34 cells, it was confirmed that the intracellular Ca ^{2 +} level was decreased by an increase in Mctp1 expression, and neuronal differentiation was activated by an increase in Rarb expression (FIGS. 12E to 12G ).

From the above results, it was confirmed that post-transcriptional regulation of Mctp1 and Rarb is induced due to the impairment of miR-18b regulation caused by the SOD1 mutation, resulting in decrease of Mctp1 and Rarb, thereby inhibiting calcium signaling and neuronal differentiation, and inducing apoptosis. I did.

<Example 9> Confirmation of impaired regulation of miR-18b signaling pathway by SOD1 mutation

In order to investigate whether the SOD1 mutation plays a pivotal role in disturbance of miR-18b signaling pathway regulation regardless of the type of mutation, the Western label was overexpressed in NSC-34 cont cells, respectively, mutated SOD1 (G85R) and SOD1 (D90A) Routing and qRT-PCR were performed to confirm the expression of related factors and changes in cell death.

Specifically, each of the plasmid construct containing the SOD1 (G85R) mutant gene and the plasmid construct containing the SOD1 (D90A) mutant gene was added to the NSC-34 cont cells cultured in Example <1-1> Lipofectamine 2000 (Invitorgen). Was transfected according to the manufacturer's procedure, and recovered after 48 hours. Then, Western blotting (Fig. 13A) and qRT-PCR (Fig. 13B to Fig. 13G) analysis were performed in the same manner as described in <Example 2> to <Example 4>. NSC-34 cont cells were used as a control.

As a result, as shown in Figure 13, it was confirmed that the protein and mRNA levels of Hif1α and Mef2c increased, and the protein and mRNA levels of Mctp1 and Rarb decreased in NSC-34 cont cells overexpressed with mutated SOD1 (Fig. 13A-13C). In addition, it was confirmed that miR-18b was decreased in NSC-34 cont cells overexpressed with mutated SOD1, thereby upregulating miR-206 (FIGS. 13E to 13G ). In addition, it was confirmed that apoptosis was increased in NSC-34 cont cells overexpressing mutated SOD1 (FIG. 13D).

From the above results, regardless of the type of SOD1 mutation, the SOD1 mutation causes a dysregulation of the miR-18b signaling pathway, miR-18b dysregulation induces the upregulation of Hif1α, the upregulated Hif1α upregulates Mef2c, and Mef2c It was confirmed that miR-206 acts as an electronic regulator of miR-206 and induces miR-206 expression, and miR-206 is directly involved in the post-transcriptional regulation of Mctp1 and Rarb, thereby inhibiting calcium signaling, neuronal differentiation and inducing apoptosis .

<Example 10> Confirmation of dysregulation of miR-18b signaling pathway in ALS

<10-1> Identification of dysregulation of miR-18b signaling pathway in ALS animal models and familial ALS patients

In order to find out whether the regulation of the miR-18b signaling pathway is caused by a gene mutation in ALS, an ALS mouse model and a familial ALS (fALS) patient sample were taken, and Western blotting and qRT-PCR were performed to miR-18b. Changes in the expression of signaling pathway-related factors and cell death were confirmed.

Specifically, SOD1-G93A transgenic mice (B6SJL-Tg(SOD1-G93A)1Gur/J) expressing the human G93A mutant SOD1 gene were provided and used by Jsackson Laboratory, Bar Harbor, Me, USA. As a control, normal (B6) normal mice (WT) were used. At 120 days after birth, spinal cord tissues of each of the WT and SOD1-G93A transgenic mice were excised to obtain samples of spinal cord tissues from mice. In addition, each of the spinal cord samples from normal and familial ALS (fALS (G86S)) patients were provided by NBB. Then, using each of the spinal cord tissue sample (Fig. 14) and spinal cord sample (Fig. 15), Western blotting (Fig. 14A, Fig. 15A) in the same manner as described in the above <Example 2> to <Example 4> ) And qRT-PCR (Fig. 14B, Fig. 14C, Fig. 15B, Fig. 15C) were performed. For spinal cord samples, qRT-PCR was performed using the primers shown in Table 8 below. In addition, qRT-PCR was performed using primers (GenoSensor) for hsa-miR-18b and hsa-miR-206, respectively.

gene Human Primer (5'→3') Hif1α Forward direction AGATAGCAAGACTTTCCTCAGTC (SEQ ID NO: 46) Reverse port CTGTGGTGACTTGTCCTTTAGTA (SEQ ID NO: 47) Mef2c Forward direction CTACTTTACCAGGACAAGGAATG (SEQ ID NO: 48) Reverse CTGAGATAAATGAGTGCTAGTGC (SEQ ID NO: 49) Mctp1 Forward direction AGGAATAGTCAGCATCACCTTGA (SEQ ID NO: 50) Reverse CAATGACTCCTCCTCTTTCTTCA (SEQ ID NO: 51) Rarb Forward direction CTTCTCAGTGCCATCTGCTTAAT (SEQ ID NO: 52) Reverse AATTACACGCTCTGCACCTTTAG (SEQ ID NO: 53) Bax Forward direction AAGCTGAGCGAGTGTCTCAA (SEQ ID NO: 54) Reverse AGTAGAAAAGGGCGACAACC (SEQ ID NO: 55) Bcl2 Forward direction ACGCCCCATCCAGCCGCATC (SEQ ID NO: 56) Reverse CACACATGACCCCACCGAACTCA (SEQ ID NO: 57) GAPDH Forward direction CTGCATTCGCCCTCTTAATG (SEQ ID NO: 58) Reverse TGAGGTCAATGAAGGGGTCA (SEQ ID NO: 59) SOD1 Forward direction GTGGGGAAGCATTAAAGGACTGAC (SEQ ID NO: 60) Reverse CAATTACACCACAAGCCAAACGAC (SEQ ID NO: 61)

As a result, as shown in FIGS. 14 and 15, protein and mRNA expressions of Hif1α and Mef2c in the ALS mouse model were significantly increased in G93A Tg mice, whereas protein and mRNA expressions of Mctp1 and Rarb were significantly decreased. Confirmed. In addition, it was confirmed that apoptosis was induced in G93A Tg mice through increased Bax and decreased Bcl2 expression (FIGS. 14A and 14B). In addition, it was confirmed that miR-18b was down-regulated and miR-206 was up-regulated in G93A Tg mice (FIG. 14C). The same results as described above were also confirmed in the fALS (G86S) patient's spinal cord sample (FIGS. 15A to 15C).

<10-2> Identification of impaired regulation of miR-18b signaling pathway in hiPSC-derived motor neurons in SOD1 (G17S) fALS patients

In order to find out if the miR-18b signaling pathway plays a pivotal role in human motor neurons (MN), blood from a patient with familial ALS (fALS (G17S)) was collected, and human induced pluripotent stem cells (human cells) were collected from the blood. Induced pluripotent stem cells, hiPSCs), differentiate into motor neurons after differentiation of human neural stem cells (hNSCs) from the hiPSCs, and perform qRT-PCR to confirm the expression of miR-18b signaling pathway related factors. I did. In addition, changes in intracellular calcium signaling, cell differentiation, and cell death were confirmed.

Specifically, in order to induce hiPSC from blood, blood samples from normal individuals and fALS SOD1 (G17S) patients were donated from the Neurology Department of Seoul National University Hospital (IRB number 1009-059-332). Then, Peripheral blood mononuclear cells (PBMC) were isolated from whole blood using Ficoll-Paque (GE Healthcare Life Sciences), and 1% penicillin-streptomycin, hSCF 100 ng/mL, hFLT-3 100 It was cultured and propagated in StemPro-34 medium containing ng/mL, 20 ng/mL hIL-3, and 20 ng/mL hIL-6. Transformation of 1×10 ⁶ PBMCs using Sendai virus (MOI (multiplicity of infection) = 5) containing Oct3/4, Sox2, Klf4 and cMyc (CytoTune ^® -iPS Sendai Reprogramming Kit, Life technologies) Introduced. After 3 days, the transduced cells were seeded with HFF (Human Scrotum foreskin fibrin) treated with a cytokine-free StemPro-34 medium and treated with 20 ug/ml mitomycin C at a concentration of 1.5×10 ⁵ cells/dish in a dish. Start-coated 35 mm dishes were treated, and the medium was changed daily until hiPSC started to metastasize. Then, based on DMEM F/12 containing 15% knockout SR, 40 ng/ml bFGF, 1% non-essential amino acids, 50 U/ml penicillin, 50 μg/ml streptomycin and 0.1 mM 2-mercaptoethanol The iPSC medium and 1/2 volume of the cytokine-free StemPro-34 medium were replaced. To complete the metastasis, iPSC medium was changed daily. On or after 30 days, colonies were harvested and hiPSCs were propagated by subculture to new mitotically inactivated HFFs. In addition, it was confirmed that normal hiPSC and fALS SOD1 (G17S) hiPSC were induced by performing immunocytochemical staining and RT-PCR analysis using a pluripotent marker (FIGS. 16A and 16B ).

Then, in order to generate neural stem cells (NSC), the colonies were separated using 2 mg/ml dispase (Gibco), treated on a 60-mm incoated bacterial plate, and 5-7 days It was replaced daily with EB (embryoid body) medium containing Essential 6 medium containing 15% knockout SR (Gibco), 50 U/ml penicillin, 50 ug/ml streptomycin at 37°C. Then, the formed EB was transferred to a Cell Start coated 35mm culture dish. After 2-3 days, when EB is attached to the dish, DMEM/F12 with 0.5% N2 supplement (1% non-essential amino acids, 50 U/ml penicillin, 50 ug/ml streptomycin and 0.1) until neural structure appears. DMEM/F12 (1% non-essential amino acids, 50 U/ml penicillin, 50 ug/ml streptomycin, and 0.1 mM 2-mercaptoethanol) with 1% N2 supplement and 40 bFGF in medium containing mM 2-mercaptoethanol Included) was replaced twice a day with medium. Then, the nerve structure was separated and cultured in a floating state to obtain a neurosphere. The obtained neurospheres were fragmented, cultured in a cell start-coated culture dish for 1 day, and treated with Accutase (Gibco) for 1 hour at 37°C. DMEM/F12 with 1% non-essential amino acids, 50 U/ml penicillin, 50 ug/ml streptomycin and 0.1 mM 2-mercaptoethanol plus 0.5% N2 NSC and 40 ng/ml b-fibroblast growth factor Cultured in medium. In addition, it was confirmed that normal NSC and fALS SOD1 (G17S) NSC were generated by performing immunocytochemical staining using the NSC marker (FIG. 16C).

In order to differentiate from NSC into motor neurons (MN), NSCs were converted to non-essential amino acids, penicillin/streptomycin, 2-mercaptoethanol for 2 days at Cell Start containing 1 μg/ml laminin and 5 ug/ml heparin coated plate. , Incubated in DMEM/F12 to which N2 and b-FGF were added, followed by incubation with DMEM/F12 medium containing 0.1 mM 2-mercaptoethanol, 0.5% N2 supplement and 40 ng/ml bFGF, and DMEM/F12 medium And nerve fiber medium (0.1 mM 2-mercaptoethanol, 0.5% N2 supplement, 40 ng/ml bFGF, 10 ng/ml neural growth factor, 10 ng/ml sonic hedgehog, R&D Systems ), 10 μM forskolin (Sigma) and 1 μM retinoic acid (Sigma), 10 ng/ml glial cell-derived neurotrophic factor (GDNF), 10 ng/ml brain-derived neurotrophic factor (BDNF), A mixture of 10 ng/ml ciliary neurotrophic factor, 10 ng/ml insulin-like growth factor 1 and 10 ng/ml NT3 (neurotrophin-3) daily or for a week It was administered daily. In addition, immunocytochemical staining was performed using the MN marker to confirm that it was differentiated into normal MN and fALS SOD1 (G17S) MN (FIG. 16D).

Using the differentiated normal MN and fALS SOD1 (G17S) MN, respectively, qRT-PCR (Figs. 17A to 17D, Fig. 17F), intracellular Ca ^{2 +} by the same method as described in Example <10-1> Analysis (FIG. 17C), axon formation analysis (FIG. 17D), and LDH release analysis (FIG. 17G) were performed.

As a result, as shown in FIG. 17, it was confirmed that mRNA expressions of Hif1α and Mef2c were significantly increased in fALS SOD1 (G17S) MN, whereas mRNA levels of Mctp1 and Rarb were significantly decreased (FIGS. 17A and 17B. ). In addition, the levels of miR-18b and miR-206 were measured in fALS SOD1 (G17S) MNs, and it was confirmed that miR-18b significantly decreased and miR-206 significantly increased (FIG. 17D). In addition, it was confirmed that Ca ²⁺ was accumulated in fALS SOD1 (G17S) MNs, neuronal differentiation was inhibited, and cell death was induced (FIGS. 17C, 17E to 17G).

Through the above results, it was confirmed that the miR-18b signaling pathway is involved in SOD1 mutation-associated ALS, and cell death is induced by impaired regulation of the miR-18b signaling pathway in SOD1 mutation-associated ALS.

<Example 11> Confirmation of miR-18 control disorder in Duchenn muscular dystrophy (DMD)

<11-1> Dystrophin expression inhibition confirmed miR-18 regulation impairment in myoblasts

In order to investigate whether miR-18b regulation disorder is caused by genetic mutation in DMD as another muscle disease caused by gene mutation, it was confirmed by qRT-PCR for miR-18 expression in Dystrophin expression suppressing myoblasts.

Specifically, Dystrophin expression-inhibiting C2C12 cells obtained in Example <1-3> were recovered, and qRT-PCR was performed in the same manner as described in Example 2 (FIG. 18). As a control, C2C12 cells transduced with siControl were used.

As a result, as shown in FIG. 18, it was confirmed that miR-18 expression decreased in Dystrophin expression-inhibited C2C12 cells (FIG. 18).

<11-2> Confirmation of miR-18 dysregulation in DMD animal model

In order to determine whether miR-18b regulation disorder is caused by genetic mutation in DMD, it was confirmed by qRT-PCR for miR-18 expression in a DMD animal model.

Specifically, a DMD animal model, mdx mice (2-4 weeks of age), was provided from Jackson laboratory. Muscle tissue was removed from mdx mice, and qRT-PCR was performed in the same manner as described in <Example 2> (FIG. 19).

As a result, it was confirmed that miR-18 expression decreased in DMD mice as shown in FIG. 19 (FIG. 19 ).

Through the above results, it was confirmed that the dystrophin mutation-associated DMD is caused to impair the regulation of the miR-18b signaling pathway, and thus miR-18b can be used as a target miRNA for DMD diagnosis, and that it can be used for the prevention and treatment of DMD. Confirmed.

According to the results of <Example 1> to <Example 11>, as shown in the schematic diagram of FIG. 20, gene mutations decrease miR-18b expression, resulting in impaired regulation of the miR-18b signaling pathway, and impaired miR-18b regulation. Induces upregulation of Hif1α, upregulated Hif1α upregulates Mef2c, Mef2c induces miR-206 expression, and miR-206 is directly involved in the post-transcriptional regulation of Mctp1 and Rarb, resulting in calcium signaling and neuronal cells. It was confirmed to inhibit differentiation and induce apoptosis. Therefore, miR-18b can be used as a target factor in the diagnosis and treatment of muscle diseases caused by gene mutations such as ALS and DMD.

<110> Seoul national university hospital <120> Use of miR-18b for preventing, treating or diagnosing muscular disease and neuromuscular disease <130> PB2018-093 <150> KR 10-2017-0105029 <151> 2017-08-18 <160> 61 <170> KoPatentIn 3.0 <210> 1 <211> 23 <212> RNA <213> Homo sapiens <400> 1 uaaggugcau cuagugcagu uag 23 <210> 2 <211> 22 <212> RNA <213> Homo sapiens <400> 2 ugcccuaaau gccccuucug gc 22 <210> 3 <211> 71 <212> RNA <213> Homo sapiens <400> 3 uguguuaagg ugcaucuagu gcaguuagug aagcagcuua gaaucuacug cccuaaaugc 60 cccuucuggc a 71 <210> 4 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> mouse siDystrophin <400> 4 ggccuuacag ggcaaaaact t 21 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> mouse Mctp1 intron forward primer <400> 5 gactccaaca tacccatttc tg 22 <210> 6 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> mouse Mctp1 intron reverse primer <400> 6 taatatctct tcccgctcct tc 22 <210> 7 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> mouse Mctp1 exon forward primer <400> 7 tcatccttac gcctaaggaa g 21 <210> 8 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> mouse Mctp1 exon reverse primer <400> 8 ccggaacttc acatatggat c 21 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mouse Rarb intron forward primer <400> 9 cacctgaagg tgaatgttgg 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mouse Rarb intron reverse primer <400> 10 cacttgaact tggggtcaag 20 <210> 11 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> mouse Rarb exon forward primer <400> 11 gatctacact tgccatcgag a 21 <210> 12 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> mouse Rarb exon reverse primer <400> 12 ctttccggat cttctcagtg a 21 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mouse GAPDH intron forward primer <400> 13 tggtgcaaca gtattccact 20 <210> 14 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> mouse GAPDH intron reverse primer <400> 14 ctggaacatg tagaccatgt ag 22 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mouse GAPDH exon forward primer <400> 15 catgtttgtg atgggtgtga 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mouse GAPDH exon reverse primer <400> 16 gatgcaggga tgatgttctg 20 <210> 17 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> mouse Hif1a forward primer <400> 17 gttcaccaaa gttgaatcag agg 23 <210> 18 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> mouse Hif1a reverse primer <400> 18 cgatgaaggt aaaggagaca ttg 23 <210> 19 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> mouse Mef2c forward primer <400> 19 aggataatgg atgagcgtaa cag 23 <210> 20 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> mouse Mef2c reverse primer <400> 20 agcaacacct tatccatgtc agt 23 <210> 21 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> mouse Mctp1 forward primer <400> 21 cgttgtgtca tagtgcttgt aaa 23 <210> 22 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> mouse Mctp1 reverse primer <400> 22 atcatgtaga gctcaaagtt cca 23 <210> 23 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> mouse Rarb forward primer <400> 23 tttctctgat ggccttacac taa 23 <210> 24 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> mouse Rarb reverse primer <400> 24 agattaaaca gatggcactg aga 23 <210> 25 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mouse GAPDH forward primer <400> 25 atagctgatg gctgcaggtt 20 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mouse GAPDH reverse primer <400> 26 aatctccact ttgccactgc 20 <210> 27 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mouse Bax forward primer <400> 27 aagctgagcg agtgtctccg 20 <210> 28 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mouse Bax reverse primer <400> 28 ggaggaagtc cagtgtccag 20 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mouse Bcl2 forward primer <400> 29 aacccaatgc ccgctgtgca 20 <210> 30 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> mouse Bcl2 reverse primer <400> 30 accgaactca aagaaggcca caa 23 <210> 31 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> mouse miR-18b forward primer <400> 31 cgcggatcca ccatggtgat ttaatcaga 29 <210> 32 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> mouse miR-18b reverse primer <400> 32 ccgctcgagc cgttcaaatc atttctcaa 29 <210> 33 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> mouse siHif1a <400> 33 aagcauuucu cucauuuccu caugg 25 <210> 34 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> mouse miR-206 forward primer <400> 34 cgcggatcca ttcttcacac ttctcactt 29 <210> 35 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> mouse miR-206 reverse primer <400> 35 ccgctcgaga cgaagaagtc aacagcata 29 <210> 36 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> mouse Mctp1 3UTR forward primer <400> 36 ccgctcgaga aagcttgaat aatagaaat 29 <210> 37 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> mouse Mctp1 3UTR reverse primer <400> 37 ctagtctaga atacatgggt tttttgtttg 30 <210> 38 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> mouse Rarb 3UTR forward primer <400> 38 ccgctcgaga acgtgtaatt accttgaaa 29 <210> 39 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> mouse Rarb 3UTR reverse primer <400> 39 ctagtctaga caaagtcttc agaaacttaa 30 <210> 40 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> mouse siMctp1 <400> 40 gccacuauau aucaagguat t 21 <210> 41 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> mouse siRarb <400> 41 ggagccuuca aagcaggaat t 21 <210> 42 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> mouse Mctp1 forward primer <400> 42 cccaagctta tgtaccagtt ggatatcaca cta 33 <210> 43 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> mouse Mctp1 reverse primer <400> 43 cccaagcttg ccaaggttgt tttttcttcc 30 <210> 44 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> mouse Rarb forward primer <400> 44 ccgctagcat gagcaccagc agccacgc 28 <210> 45 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> mouse Rarb reverse primer <400> 45 ccaccggtct gcagcagtgg tgactgac 28 <210> 46 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> human Hif1a forward primer <400> 46 agatagcaag actttcctca gtc 23 <210> 47 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> human Hif1a reverse primer <400> 47 ctgtggtgac ttgtccttta gta 23 <210> 48 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> human Mef2c forward primer <400> 48 ctactttacc aggacaagga atg 23 <210> 49 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> human Mef2c reverse primer <400> 49 ctgagataaa tgagtgctag tgc 23 <210> 50 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> human Mctp1 forward primer <400> 50 aggaatagtc agcatcacct tga 23 <210> 51 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> human Mctp1 reverse primer <400> 51 caatgactcc tcctctttct tca 23 <210> 52 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> human Rarb forward primer <400> 52 cttctcagtg ccatctgctt aat 23 <210> 53 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> human Rarb reverse primer <400> 53 aattacacgc tctgcacctt tag 23 <210> 54 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> human Bax forward primer <400> 54 aagctgagcg agtgtctcaa 20 <210> 55 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> human Bax reverse primer <400> 55 agtagaaaag ggcgacaacc 20 <210> 56 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> human Bcl2 forward primer <400> 56 acgccccatc cagccgcatc 20 <210> 57 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> human Bcl2 reverse primer <400> 57 cacacatgac cccaccgaac tca 23 <210> 58 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> human GAPDH forward primer <400> 58 ctgcattcgc cctcttaatg 20 <210> 59 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> human GAPDH reverse primer <400> 59 tgaggtcaat gaaggggtca 20 <210> 60 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> human SOD1 forward primer <400> 60 gtggggaagc attaaaggac tgac 24 <210> 61 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> human SOD1 reverse primer <400> 61 caattacacc acaagccaaa cgac 24

Claims (12)

It is selected from the group consisting of Duchenne muscular dystrophy, Backer muscular dystrophy, muscular atrophy and amyotrophic lateral sclerosis containing miR-18b as an active ingredient. Pharmaceutical composition for preventing or treating muscle disease.
The pharmaceutical composition for preventing or treating muscle diseases according to claim 1, wherein the miR-18b is included in a vector or provided in a form introduced into cells.
The pharmaceutical composition for preventing or treating muscle disease according to claim 1, wherein the miR-18b is a mature miR-18b or a precursor miR-18b.
The method of claim 3, wherein the mature form of miR-18b is represented by SEQ ID NO: 1 or SEQ ID NO: 2, and the precursor form of miR-18b is represented by SEQ ID NO: 3, for preventing or treating muscle diseases Pharmaceutical composition.
delete delete In samples isolated from the subject, miR-18b, Hif1α (hypoxia inducible factor 1 alpha), Mef2c (myocyte specific enhancer factor 2c), Mctp1 (multiple C2 domains transmembrane protein 1), Rarb (retinoic acid receptor beta), and miR-206 Duchenne muscular dystrophy, Becker muscular dystrophy, muscular atrophy, and muscle comprising the step of measuring the expression level of three or more selected from the group consisting of and comparing it with a normal control group. As a method of providing diagnostic information of a muscle disease selected from the group consisting of atrophic lateral sclerosis,
Herein, when the expression level of miR-18b, Mctp1 or Rarb decreases compared to the normal control, and the expression level of Hif1α, Mef2c or miR-206 increases compared to the normal control, it is determined as a muscle disease.
The method of claim 7, wherein the sample is any one selected from the group consisting of tissue, cells, plasma, serum, blood, saliva, and urine.
The method of claim 7, wherein the expression level is selected from the group consisting of Reverse transcription polymerase chain reaction (RT-PCR), quantitative RT-PCR, real-time RT-PCR, Northern blotting, and transcriptome analysis. A method of providing diagnostic information of a muscle disease, characterized in that the measurement is performed by any one or more methods. delete delete delete

Images