KR102109168B1 - A novel compound and a pharmaceutical composition for treating fungal infections - Google Patents

Abstract

The present invention relates to preparation of a novel compound, 9-deoxo-31-O-demethyl-prolylFK506, 9-deoxo-36,37-dihydro-FK506, 31-O-demethyl-36,37-dihydro-FK506, 9-deoxo-31-O-demethyl-36,37- dihydro-FK506, 9-deoxo-FK520, 31-O-demethyl-FK520, 9-deoxo-31-O-demethyl-FK520, 9-deoxo-FK523, or 9-deoxo-31-O-demethyl-FK523, which may be used as a main component of a composition for treating fungal infections; and to an anti-fungal use thereof.

Description

A novel compound and a pharmaceutical composition for treating fungal infection comprising the same {A novel compound and a pharmaceutical composition for treating fungal infections}

The present invention is a novel compound 9-deoxo-31- O- demethyl-prolyl-FK506 (9-deoxo-31- O -dimethyl-prolyl- which can be used as a main component of a pharmaceutical composition for preventing or treating fungal infection FK506), 9-deoxo-36,37-dihydro-FK506 (9-deoxo-36,37-dihydro-FK506), 31- O- demethyl-36,37-dihydro-FK506 (31- O -dimethyl- 36,37- dihydro -FK506), 9-deoxo-31- O -demethyl-36,37-dihydro-FK506 (9- Deoxo -31- O - dimethyl -36,37- dihydro -FK506), 9 -deoxo-FK520 (9-deoxo-FK520), 31- O- demethyl-FK520 (31- O -dimethyl-FK520), 9-deoxo-31- O -demethyl-FK520 (9-deoxo-31- O Preparation and utilization of -dimethyl-FK520), 9-deoxo-FK523 (9-deoxo-FK523), or 9-deoxo-31- O- demethyl-FK523 (9-deoxo-31- O -dimethyl-FK523) In particular, it relates to a pharmaceutical composition for preventing or treating fungal infection comprising the novel compound, a method for manufacturing the novel compound, and the novel compound as an active ingredient.

Opportunistic infectious fungal diseases occur mainly in patients with suppressed or reduced immunity and have a high mortality rate. Recently, due to the aging population, the proportion of immune-immune populations increases, and the number of patients with pathogenic fungi increases rapidly every year as the number of transplanted patients increases due to the development of organ transplant treatment methods. Systemic fungal disease is a disease that is not often caused by healthy people, but is often caused by opportunistic infections in people with weak immunity. Its types include Cryptococcosis, Candidiasis, and Aspergillosis. And so on. Cryptococcus disease is caused by infection of Cryptococcus neoformans and is infected in all parts of the human body, including the skin, in people with reduced immunity, such as AIDS, especially in the brain and meninges It causes meningitis, brain abscess and brain tumor. Candidiasis is a fungus caused by Candida albicans , which was first isolated from thrush patients and causes vaginitis in women and diaper rash in infants. Aspergillus fumigatus ( Aspergillus fumigatus ) is the most common causative agent and is mainly infected by people with reduced human immunity. The path of infection is that aspergillus spores (congenital hall seeds) present in the environment enter the body through the respiratory process and are mainly infected with the lungs, sinuses, and bronchi, causing respiratory diseases.

Recently, the incidence of systemic fungal infections has increased significantly with the increase in immunocompromised patients or AIDS patients due to chemotherapy or immunosuppressant administration after organ transplantation. In fact, if you have cancer or AIDS, the cause of the patient's death is known to be due to a fungal infection of the organ or blood rather than the disease itself. In addition, the causative agents of fungal infections are gradually diversified, and more types of fungi are expected to cause invasive infections in the future.

Since pathogenic fungi are composed of eukaryotic cells such as the human body, since most biochemical metabolic pathways in cells are similar, there are very few fungal specific drugs capable of exhibiting high efficacy without attacking the host. Currently, the most widely used polyene drugs (eg, Amphotericin B) and azole drugs (eg, Fluconazole) have serious side effects such as renal toxicity and liver toxicity, respectively. In terms of effectiveness, there is a need to develop antifungal drugs with improved effects. In particular, due to the increase in the aging population, it is expected that fungal infections due to the decline in immune function will gradually increase as the society enters an aging society, and infections that have been seen in only a few classes will spread to the general public in the future. It is said that the development of new antifungal drugs is very necessary because the infection caused by fungi is expected to increase more and more.

In addition, Korean Patent Publication No. 10-2005-0071491 (name of the invention: the use of a tacrolimus derivative in combination with a beta2-agonist for the treatment of asthma) is simultaneous to treat or prevent acute or chronic asthma, FK506 derivatives and β2-agonists for the preparation of a medicament for use in separate or sequential use are disclosed, but the FK506 derivatives, FK520 derivatives or FK523 derivatives disclosed in the present invention are applied to treat fungal infections. There is no case.

Accordingly, the present inventors, as a result of various efforts, a novel compound 9-deoxo-31- O- demethyl-prolyl-FK506, 9-deoxo-36, which can be used as a main component of a pharmaceutical composition for preventing or treating fungal infection 37-dihydro-FK506, 31- O- demethyl-36,37-dihydro-FK506, 9-deoxo-31- O- demethyl-36,37-dihydro-FK506, 9-deoxo-FK520, 31- O- demethyl- The antifungal effect of FK520, 9-deoxo-31- O- demethyl-FK520, 9-deoxo-FK523, and 9-deoxo-31- O- demethyl-FK523 (hereinafter collectively referred to as 'the nine new compounds') was investigated, Developing their manufacturing process, and further developing a pharmaceutical composition for the prevention or treatment of fungal infection using them as an active ingredient, and that the composition can be effectively used as a pharmaceutical composition for the prevention or treatment of fungal infection. The present invention was completed by confirming.

One object of the present invention is to provide the above nine new compounds, isomers thereof, or pharmaceutically acceptable salts thereof.

Another object of the present invention is to provide a pharmaceutical composition for the prevention or treatment of fungal infection comprising at least one selected from nine new compounds as an active ingredient.

Another object of the present invention is to provide a pharmaceutical composition for the prevention or treatment of fungal infection comprising at least one selected from isomers or pharmaceutically acceptable salts of 9 new compounds as an active ingredient.

Another object of the present invention is to provide a biological production method for each of the nine new compounds.

Another object of the present invention is a production strain that can be used in the biological manufacturing process of nine new compounds, Streptomyces kanamyceticus ΔfkbD-fkbM (Accession No. KCTC13581BP), Streptomyces kanamyceticus ΔfkbD, tcsD ( Accession No. KCTC13580BP), Streptomyces kanamyceticus ΔfkbM, tcsD (Accession No. KCTC13584BP), Streptomyces kanamyceticus ΔfkbD-fkbM, tcsD (Accession No. KCTC13585BP), Streptomyces kanamyseticos B Accession No. KCTC13579BP), Streptomyces kanamyceticus ΔfkbM, tcsB (Accession No. KCTC13583BP), and Streptomyces kanamyceticus ΔfkbD-fkbM, tcsB (Accession No. KCTC13582BP).

Another object of the present invention is to provide an antifungal composition comprising at least one selected from 9 new compounds, isomers thereof, or pharmaceutically acceptable salts thereof as an active ingredient.

In order to solve the above problems, the present invention is a pharmaceutical composition for the prevention or treatment of fungal infection, antifungal composition and the fungal infection comprising a new manufacturing process of the nine new compounds, each new compound prepared using the manufacturing process It provides a treatment method for fungal infection disease using a pharmaceutical composition for the prevention or treatment of.

As one aspect for achieving the above object, the present invention is a new compound, 9-deoxo-31- O- demethyl-prolyl-FK506 represented by the following [Formula 1], represented by the following [Formula 2] 9-deoxo-36,37-dihydro-FK506, 31- O- demethyl-36,37-dihydro-FK506 represented by the following [Formula 3], 9-deoxo-31- O -represented by the following [Formula 4] demethyl-36,37-dihydro-FK506, 9-deoxo-FK520 represented by the following [Formula 5], 31- O- demethyl-FK520 represented by the following [Formula 6], 9- represented by the following [Formula 7] deoxo-31- O- demethyl-FK520, 9-deoxo-FK523 represented by the following [Formula 8], 9-deoxo-31- O- demethyl-FK523 represented by the following [Formula 9], isomers or pharmaceuticals thereof Provide acceptable salts.

[Formula 1]

[Formula 2]

[Formula 3]

[Formula 4]

[Formula 5]

[Formula 6]

[Formula 7]

[Formula 8]

[Formula 9]

The term "FK506, tacrolimus, or fujimycin" as used in the present invention is a substance having immunosuppressive activity first isolated from various Streptomyces tsukubaensis, 23-membered (23 -membered) is a polyketide macrolide. Immunosuppressive action is stronger than cyclosporine, and is known to be used to suppress rejection, especially when transplanting the liver during organ transplantation. The FK506 can be synthesized by a PKS / NRPS (polyketide synthase / nonribosomal peptide synthetase) complex system, but the FK506 derivative of the present invention is a novel compound produced through a novel strain produced through a biosynthetic gene defect in Streptomyces genus. Can be

As used herein, the term "FK520 or ascomycin" is also an immunosuppressant, a compound of a macrolead structure formed of 23 carbons and an ethyl analogue of the C21 position of FK506.

As used herein, the term "FK523" is the methyl analog of the C21 position of FK506.

In one embodiment, the compounds of the present invention may include isomers or pharmaceutically acceptable salts thereof.

Isomer means the relationship of compounds having the same chemical formula but not the same, and may include, for example, structural isomers, geometric isomers, optical isomers (enantiomers), stereoisomers, diastereomers.

Pharmaceutically acceptable salts are concentrations that have a relatively non-toxic and harmless effect on the patient, and can mean any and all organic or inorganic addition salts whose side effects caused by these salts do not reduce the beneficial efficacy of the parent compound. . For example, the salt may be an acid addition salt formed by a pharmaceutically acceptable free acid. Acid addition salts can be prepared by conventional methods, for example, by dissolving the compound in an excess aqueous acid solution and precipitating the salt using a water miscible organic solvent such as methanol, ethanol, acetone or acetonitrile. It may be prepared by heating an equal molar amount of the compound and an acid or alcohol (eg, glycol monomethyl ether) in water, followed by evaporation of the mixture to dryness or suction filtration of the precipitated salt. At this time, organic and inorganic acids can be used as the free acid. The salt may be a pharmaceutically acceptable metal salt prepared using a base.

In another embodiment, the compounds of the present invention may be in the form of solvates or pro-drugs, which are included within the scope of the present invention. Solvates may preferably include hydrates and ethanolates.

The pharmaceutical composition of the present invention can also be used as a single preparation, and can be used as a pharmaceutical preparation that further includes a drug known to have an approved fungal infection treatment effect, and is formulated using a pharmaceutically acceptable carrier or excipient. By doing so, it can be manufactured in a unit dose form or can be manufactured by incorporating into a multi-dose container.

As used in the present invention, the term "pharmaceutically acceptable carrier" may mean a carrier or diluent that does not inhibit the biological activity and properties of the compound being injected without stimulating the organism. The type of the carrier that can be used in the present invention is not particularly limited, and any carrier that is commonly used in the art and pharmaceutically acceptable may be used. Non-limiting examples of the carrier, transcutol (Transcutol), polyethylene glycol (Polyethylene glycol), triacetin (Triacetin) and co-surfactants exemplified by mixtures thereof (Co-surfactant); Cremophor, Tween, Myrj, Poloxamer, Pluronic, Lutrol, Imwitor, Span, Labra Surfactant, which can be illustrated alone or in a mixture such as Labrafil; Oils which can be exemplified alone or as a mixture of Miglyol, Captex, Ethyl oleate, etc .; And organic acids that can be exemplified singly or in mixtures such as erythorobic acid and citric acid. These may be used alone or in combination of two or more.

In addition, if necessary, other conventional additives such as antioxidants, buffers, and / or bacteriostatic agents can be added and used, and diluents, dispersants, surfactants, binders, lubricants, etc. can be additionally added to form a solution such as aqueous solutions, suspensions, emulsions, etc. It can be formulated and used in dosage forms, pills, capsules, granules or tablets.

As another aspect for achieving the above object, the present invention provides a method of treating a fungal infection disease comprising the step of administering the pharmaceutical composition to an individual.

As used in the present invention, the term “individual” may mean any animal that has or is likely to develop a fungal infection.

The pharmaceutical composition of the present invention may include one or more selected from nine new compounds in a pharmaceutically effective amount, or isomers or salts thereof. In the present invention, the term "pharmaceutically effective amount" means an amount sufficient to treat the disease at a reasonable benefit / risk ratio applicable to medical treatment, and generally in an amount of 0.001 to 1000 mg / kg, preferably 0.05 It may be administered by dividing the amount of 200 to 200 mg / kg, more preferably 0.1 to 100 mg / kg once to several times a day. However, for the purposes of the present invention, a specific therapeutically effective amount for a particular patient may include a specific composition, the age, weight, general health status of the patient, including the type and extent of the response to be achieved, and, in some cases, whether other agents are used. It is desirable to apply differently depending on various factors, including sex and diet, time of administration, route of administration and composition, secretion rate of treatment, duration of treatment, drugs used with or concurrently with the specific composition, and similar factors well known in the pharmaceutical art.

The frequency of administration of the pharmaceutical composition of the present invention is not particularly limited, but may be administered once a day or divided into doses and administered several times.

The pharmaceutical composition of the present invention may be 0.001 ng / ml to 2000 ng / ml, preferably 10 ng / ml to 1000 ng / ml, but is not limited thereto.

The pharmaceutical composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, and may be administered sequentially or simultaneously with conventional therapeutic agents. And it can be administered single or multiple. Considering all of the above factors, it is important to administer an amount capable of obtaining the maximum effect in a minimum amount while minimizing the induction of side effects, and can be easily determined by those skilled in the art.

As used herein, the term "administration" refers to the introduction of the pharmaceutical composition of the present invention to a patient in any suitable way, and the route of administration of the pharmaceutical composition of the present invention is orally or as long as it can reach the target tissue It can be administered through a variety of parenteral routes.

The method of administration of the pharmaceutical composition according to the present invention is not particularly limited, and may be in accordance with a method commonly used in the art. As a non-limiting example of the above administration method, the pharmaceutical composition may be administered by oral administration or parenteral administration. The pharmaceutical composition according to the present invention may be prepared in various dosage forms depending on the desired mode of administration.

The pharmaceutical composition for preventing or treating fungal infection of the present invention may be used for the purpose of preventing or treating fungal infection. Since the compound of the present invention exhibits the killing activity of fungi, the fungus may be administered to an infected individual to slow, interrupt, or arrest infection progression.

The fungal infection here is Candida spp .; Aspergillus spp .; Cryptococcus neoformans; Sporothrixschenckii; Epidermophytonfloccosum; Microsporum spp .; Trichophyton spp; Fusarium spp .; Rhizomucor spp .; Mucorcircinelloides; Rhizopus spp .; Malasseziafurfur; Acremonium spp .; Paecilomyces; Scopulariopsis; Arthrographis spp .; Scytalidium; Scedosporium spp .; Trichoderma spp .; Penicillium spp .; Penicilliummarneffei; And Blastoschizomyces ; Infection may be caused by any one or more selected from, but is not limited thereto. Specifically, the fungal infection disease of the present invention may be a fungal infection caused by fungi of Cryptococcus, fungi of Candida and fungi of Aspergillus.

As used in the present invention, the term "prevention" is used to administer the pharmaceutical composition of the present invention to an individual who has or is suspected of developing a disease or a fungal infectious disease, thereby lowering the likelihood of developing a fungal infectious disease or Refers to the act of alleviating the symptoms or conditions.

As used in the present invention, the term "treatment" refers to all actions to improve or benefit the symptoms of a fungal infection by administering the pharmaceutical composition of the present invention to a suspected onset of fungal infection disease.

In one embodiment of the present invention, the immunosuppressive activity effect of the nine new compounds was confirmed by an in vitro T cell activity assay, thereby confirming a reduced immunosuppressive activity than FK506.

In addition, in another embodiment of the present invention, antifungal activity was confirmed by confirming the killing of the fungi of the genus Cryptococcus, fungus of Candida and fungus of Aspergillus of the nine new compounds.

In another embodiment of the present invention, it was confirmed that the fungal infection treatment effect of the nine new compounds was increased by increasing the survival rate of a disease animal model infected with a fungus of Cryptococcoccus spp. And a fungus of Candida.

The above results suggest that the nine new compounds have anti-fungal effects and therapeutic effects of fungal infections without side effects due to immunosuppressive activity, suggesting that they can be useful for the prevention or treatment of fungal infections.

As another aspect for achieving the above object, the present invention is 9 new compounds, 9-deoxo-31- O- demethyl-prolyl-FK506, 9-deoxo-36,37-dihydro-FK506, 31- O -demethyl-36,37-dihydro-FK506, 9-deoxo-31- O -demethyl-36,37-dihydro-FK506, 9-deoxo-FK520, 31- O -demethyl-FK520, 9-deoxo-31- Provides biological manufacturing processes of O- demethyl-FK520, 9-deoxo-FK523, and 9-deoxo-31- O- demethyl-FK523.

In the biological manufacturing process, the culture temperature generally employed in the culture process of Streptomyces genus is used. As a culture temperature suitable for the implementation of the present invention, preferably, 23-30 ° C may be applied, and more preferably, a culture temperature of 25-28 ° C may be applied.

In addition, in the manufacturing process, the pH of the culture process is maintained between 6.5 and 9, preferably, the culture pH is maintained at 7-8.

On the other hand, in the manufacturing process, it is important to keep the dissolved oxygen level in the culture medium high. When the dissolved oxygen level at the beginning of the culture is 100%, it is important to maintain the dissolved oxygen level until the end of the culture at 30% or more. In order to implement this, it is generally desirable to stir at a level of 800-1,500 rpm.

Extraction of 9 new compounds produced from cultured cell bodies in the above manufacturing process is achieved through the implementation of the primary extraction process, the secondary extraction process and the tertiary extraction process. In the present invention, the organic solvent extraction method is used as the primary extraction process. In this case, ethyl acetate, methanol, acetone, etc. may be used as the solvent that can be used, but the use of ethyl acetate or methanol is preferred. In addition, silica gel chromatography is used as a secondary extraction process, and methanol and methylene chloride are preferable solvents that can be used. In addition, chromatography is used as the third extraction process. At this time, acetonitrile, ammonium acetate buffer, acetic acid, formic acid, etc. may be used as the solvent, but acetonitrile is preferred. The application of this method facilitates the recovery of 9 new compounds and also increases the yield.

As another aspect for achieving the above object, the present invention is a production strain that can be used for the production of 9 new compounds, Streptomyces kanamyceticus ΔfkbD-fkbM (Accession No. KCTC13581BP), Streptomyces Kanamyceticus ΔfkbD, tcsD (Accession No. KCTC13580BP), Streptomyces kanamyceticus ΔfkbM, tcsD (Accession No. KCTC13584BP), Streptomyces kanamyceticus ΔfkbD-fkbM, tcsD (Accession No. KTCTCD, 85BP CTC Kanamyceticus ΔfkbD, tcsB (Accession No. KCTC13579BP), Streptomyces kanamyceticus ΔfkbM, tcsB (Accession No. KCTC13583BP), and Streptomyces kanamyceticus ΔfkbD-fkbM, tcsB (Accession No. .

As another aspect for achieving the above object, the present invention provides an antifungal composition comprising 9 new compounds, isomers or pharmaceutically acceptable salts thereof. The nine new compounds, isomers, and pharmaceutically acceptable salts are the same as described above.

The nine new compounds, isomers thereof, or pharmaceutically acceptable salts can exhibit antifungal activity, and thus can be used as antifungal compositions.

In the above, the fungus is Candida spp .; Aspergillus spp .; Cryptococcus neoformans; Sporothrixschenckii; Epidermophytonfloccosum; Microsporum spp .; Trichophyton spp; Fusarium spp .; Rhizomucor spp .; Mucorcircinelloides; Rhizopus spp .; Malasseziafurfur; Acremonium spp .; Paecilomyces; Scopulariopsis; Arthrographis spp .; Scytalidium; Scedosporium spp .; Trichoderma spp .; Penicillium spp .; Penicilliummarneffei; And Blastoschizomyces ; It may be any one or more selected from, but is not limited thereto. Specifically, in one embodiment of the present invention, the antifungal activity may be, but is not limited to, antifungal activity by fungi of Cryptococcus, fungi of Candida and fungi of Aspergillus.

The pharmaceutical composition for the prevention or treatment of fungal infections comprising at least one selected from the nine new compounds according to the present invention as an active ingredient may provide a different mechanism of action compared to existing antifungal drugs, in addition to better drug safety Since it can provide, it can be effectively used as a substitute when the treatment effect by the existing antifungal drug is low or when there is a side effect during treatment by the existing antifungal drug.

1 is a high-performance liquid chromatography analysis results for 9-deoxo-31- O- demethyl-prolyl-FK506.
2 is a nuclear magnetic resonance analysis ( ¹ H-NMR) results for 9-deoxo-31- O- demethyl-prolyl-FK506.
3 is a nuclear magnetic resonance analysis ( ¹³ C-NMR) results for 9-deoxo-31- O- demethyl-prolyl-FK506.
4 is a nuclear magnetic resonance analysis (COSY-NMR) results for 9-deoxo-31- O- demethyl-prolyl-FK506.
5 is a nuclear magnetic resonance analysis (HSQC-NMR) results for 9-deoxo-31- O- demethyl-prolyl-FK506.
6 is a nuclear magnetic resonance analysis (HMBC-NMR) results for 9-deoxo-31- O- demethyl-prolyl-FK506.
7 is a high-performance liquid chromatography analysis results for 9-deoxo-36,37-dihydro-FK506.
8 is a nuclear magnetic resonance analysis ( ¹ H-NMR) results for 9-deoxo-36,37-dihydro-FK506.
9 is a nuclear magnetic resonance analysis ( ¹³ C-NMR) results for 9-deoxo-36,37-dihydro-FK506.
10 is a nuclear magnetic resonance analysis (COSY-NMR) results for 9-deoxo-36,37-dihydro-FK506.
11 is a nuclear magnetic resonance analysis (HSQC-NMR) results for 9-deoxo-36,37-dihydro-FK506.
12 is a nuclear magnetic resonance analysis (HMBC-NMR) results for 9-deoxo-36,37-dihydro-FK506.
13 is a high-performance liquid chromatography analysis results for 31- O- demethyl-36,37-dihydro-FK506.
14 is a nuclear magnetic resonance analysis ( ¹ H-NMR) results for 31- O- demethyl-36,37-dihydro-FK506.
15 is a nuclear magnetic resonance analysis ( ¹³ C-NMR) results for 31- O- demethyl-36,37-dihydro-FK506.
16 is a nuclear magnetic resonance analysis (COSY-NMR) results for 31- O- demethyl-36,37-dihydro-FK506.
FIG. 17 shows the results of nuclear magnetic resonance analysis (HSQC-NMR) for 31- O- demethyl-36,37-dihydro-FK506.
18 is a nuclear magnetic resonance analysis (HMBC-NMR) results for 31- O- demethyl-36,37-dihydro-FK506.
19 is a high-performance liquid chromatography analysis results for 9-deoxo-31- O- demethyl-36,37-dihydro-FK506.
20 is a nuclear magnetic resonance analysis ( ¹ H-NMR) results for 9-deoxo-31- O- demethyl-36,37-dihydro-FK506.
21 is a nuclear magnetic resonance analysis ( ¹³ C-NMR) results for 9-deoxo-31- O- demethyl-36,37-dihydro-FK506.
22 is a nuclear magnetic resonance analysis (COSY-NMR) results for 9-deoxo-31- O- demethyl-36,37-dihydro-FK506.
23 is a nuclear magnetic resonance analysis (HSQC-NMR) results for 9-deoxo-31- O- demethyl-36,37-dihydro-FK506.
24 is a nuclear magnetic resonance analysis (HMBC-NMR) results for 9-deoxo-31- O- demethyl-36,37-dihydro-FK506.
25 is a high-performance liquid chromatography analysis results for 9-deoxo-FK520.
26 is a nuclear magnetic resonance analysis ( ¹ H-NMR) results for 9-deoxo-FK520.
27 is a nuclear magnetic resonance analysis ( ¹³ C-NMR) results for 9-deoxo-FK520.
28 is a nuclear magnetic resonance analysis (COSY-NMR) results for 9-deoxo-FK520.
29 is a nuclear magnetic resonance analysis (HSQC-NMR) results for 9-deoxo-FK520.
30 is a nuclear magnetic resonance analysis (HMBC-NMR) results for 9-deoxo-FK520.
FIG. 31 shows the results of high performance liquid chromatography analysis for 31- O- demethyl-FK520.
FIG. 32 shows the results of nuclear magnetic resonance analysis ( ¹ H-NMR) for 31- O- demethyl-FK520.
FIG. 33 shows the results of nuclear magnetic resonance analysis ( ¹³ C-NMR) for 31- O- demethyl-FK520.
FIG. 34 is a nuclear magnetic resonance analysis (COSY-NMR) result for 31- O- demethyl-FK520.
35 shows nuclear magnetic resonance analysis (HSQC-NMR) results for 31- O- demethyl-FK520.
36 is a nuclear magnetic resonance analysis (HMBC-NMR) results for 31- O- demethyl-FK520.
37 is a high-performance liquid chromatography analysis results for 9-deoxo-31- O- demethyl-FK520.
38 is a nuclear magnetic resonance analysis ( ¹ H-NMR) results for 9-deoxo-31- O- demethyl-FK520.
FIG. 39 shows the results of nuclear magnetic resonance analysis ( ¹³ C-NMR) for 9-deoxo-31- O- demethyl-FK520.
40 shows nuclear magnetic resonance analysis (COSY-NMR) results for 9-deoxo-31- O- demethyl-FK520.
41 shows nuclear magnetic resonance analysis (HSQC-NMR) results for 9-deoxo-31- O- demethyl-FK520.
42 is a nuclear magnetic resonance analysis (HMBC-NMR) results for 9-deoxo-31- O- demethyl-FK520.
43 is a high-performance liquid chromatography analysis results for 9-deoxo-FK523.
FIG. 44 shows the results of nuclear magnetic resonance analysis ( ¹ H-NMR) for 9-deoxo-FK523.
FIG. 45 shows the results of nuclear magnetic resonance analysis ( ¹³ C-NMR) for 9-deoxo-FK523.
46 shows nuclear magnetic resonance analysis (COSY-NMR) results for 9-deoxo-FK523.
47 is a nuclear magnetic resonance analysis (HSQC-NMR) results for 9-deoxo-FK523.
48 shows nuclear magnetic resonance analysis (HMBC-NMR) results for 9-deoxo-FK523.
49 is a high-performance liquid chromatography analysis results for 9-deoxo-31- O- demethyl-FK523.
FIG. 50 shows the results of nuclear magnetic resonance analysis ( ¹ H-NMR) for 9-deoxo-31- O- demethyl-FK523.
FIG. 51 shows the results of nuclear magnetic resonance analysis ( ¹³ C-NMR) for 9-deoxo-31- O- demethyl-FK523.
52 shows nuclear magnetic resonance analysis (COSY-NMR) results for 9-deoxo-31- O- demethyl-FK523.
53 shows the results of nuclear magnetic resonance analysis (HSQC-NMR) for 9-deoxo-31- O- demethyl-FK523.
FIG. 54 shows the results of nuclear magnetic resonance analysis (HMBC-NMR) for 9-deoxo-31- O- demethyl-FK523.
55 is a result of investigating the degree of reduction in immunosuppressive activity of 9 novel compounds of the present invention.
56 shows the results of investigating antifungal activity against Aspergillus fumigatus.

Hereinafter, the present invention will be described in more detail by examples. However, the following examples are only for illustrating the present invention and the scope of the present invention is not limited to them.

Example 1: 9-deoxo-31- O -demethyl-prolyl-FK506 manufacture

Double cross-over homologous recombination according to the method described in Ban, YH et al. (J. Nat. Prod. 2013, 76, 1091-1098) for Streptomyces kanamyceticus, a strain producing FK506 ), Resulting in inactivation of the fkbD-fkbM gene using the in-frame deletion method by Streptomyces kanamyceticus ΔfkbD, a production strain of 9-deoxo-31- O- demethyl-prolyl-FK506 -fkbM (Accession No. KCTC13581BP) was produced.

Specifically, each gene was cloned into a pKC1139 vector, transferred to Escherichia coli ET12567 / pUZ8002, and then conjugated to produce a mutant of the fkbD and fkbM genes in a strain of Streptomyces kanamyceticus producing FK506, followed by conjugation ( Conjugation) was transformed into Streptomyces kanamyceticus, a FK506 production strain.

The method for producing a strain may be described in more detail as production of an in-frame gene deletion plasmid and production of a gene deletion strain.

The production of in-frame gene deletion plasmids ( E. coli - Streptomyces shuttle ) Vector pKC1139 was used for in-frame gene deletion. Plasmid production was accomplished by PCR amplification of left- and right-flanking fragments of target genes for deletion from Fosmid DNA derived from Streptomyces kanamyceticus. It was carried out. For deletion of the fkbD-fkbM gene, the primer pair FkbD-MLF / FkbD-MLR of the left-adjacent segment and the primer pair FkbD-MRF / FkbD-MRR of the right-adjacent segment were designed. All of the PCR fragments were separated, cut with HindIII-XbaI or XbaI-EcoRI, and cloned into pKC1139 vector. Information about the strains, plasmids and primers used in this Example are presented in Tables 1 and 2 below.

The plasmid used to construct the gene deletion strain is summarized in Table 1. The plasmid for removing C9 hydroxylase (Hydroxylase) and 31- O -methyltransferase together, pΔfkbD-fkbM, was transferred to E. coli ET12567 / pUZ8002 and introduced into Streptomyces kanamyceticus by conjugation to target genes. It was deleted by homologous recombination. Strains with a single cross between the deletion plasmid and the Streptomyces kanamyceticus chromosome were subdivided at 37 ° C with apramycin (non-proliferable temperature for pSG5-based replication unit (Replicon)). It was selected by cultivation of a pramycin-resistant transconjugant. The colonies thus secured were allowed to multiply three times without selection at 28 ° C to allow the second crossover. Two achieved double crossover mutations, ΔfkbD-fkbM, were selected as apramycin-sensitive expression traits, then confirmed by PCR, and optionally by Southern block analysis.

The produced fkbD-fkbM gene-deficient strain, Streptomyces kanamyceticus ΔfkbD-fkbM, was deposited with the Korea Institute of Bioscience and Biotechnology (Korean Collection for Type Cultures, KCTC) on July 17, 2018 (Accession No. KCTC13581BP ).

Strain and plasmid information used Strain / vector Reievant characteristic Bacterial strains Escherichia coli DH5α Host for general cloning ET12567 / pUZ8002 Donor strain for intergeneric conjugation between E.coli and streptomyces Streptomyces Streptomyces kanamyceticus Wild-type FK506 producing strain △ fkbD-fkbM Mutant of S. kanamyceticus with an in-frame deletion of fkbD-fkbM △ fkbD-fkbM, tcsB Mutant of S. kanamyceticus with an in-frame deletion of fkbD-fkbM, tcsB △ fkbD-fkbM, tcsD Mutant of S. kanamyceticus with an in-frame deletion of fkbD-fkbM, tcsD △ fkbD, tcsD Mutant of S. kanamyceticus with an in-frame deletion of fkbD, tcsD △ fkbD, tcsB Mutant of S. kanamyceticus with an in-frame deletion of fkbD, tcsB △ fkbM, tcsD Mutant of S. kanamyceticus with an in-frame deletion of fkbM, tcsD △ fkbM, tcsB Mutant of S. kanamyceticus with an in-frame deletion of fkbM, tcsB Plasmid pKC1139 High-copy-number temperature-sensitive E. coli - Streptomyces shuttle vector p △ fkbD Deletion plasmid with in-frame deletion of 51-bp internal fkbD fragment p △ fkbM Deletion plasmid with in-frame deletion of 507-bp internal fkbD fragment p △ fkbD-fkbM Deletion plasmid with in-frame deletion of 1100-bp internal fkbDM fragment p △ tcsB Deletion plasmid with in-frame deletion of 2090-bp internal tcsB fragment p △ tcsD Deletion plasmid with in-frame deletion of 1154-bp internal tcsD fragment

Primer information used Primer Sequence 5’to 3 ’(Restriction site underlined) Restriction enzyme FkbDLF TATA AAGCTT CGGAGCCCCGGTGGACCT HindIII FkbDLR TTAA TCTAGA CGTCGCCTCGTCGTCGCT XbaI FkbDRF GTAA TCTAGA GTCGGCTACTGCCTCTAC XbaI FkbDRR GAAT GAATTC CGACGAACAGCGGTTCCT EcoRI FkbMLF TACG AAGCTT TCTGTTCGGCATCCAGCA HindIII FkbMLR TAGC TCTAGA GTCACCCGGGAGCAGTTC XbaI FkbMRF TATA TCTAGA GACACCGAAGGCGCGCTC XbaI FkbMRR TTAA GAATTC GAACACCGAGGCCGTCCA EcoRI FkbD-MLF TATA AAGCTT CGGAGCCCCGGTGGACCT HindIII FkbD-MLR TTAA TCTAGA CGTCGCCTCGTCGTCGCT XbaI FkbD-MRF TATA TCTAGA GACACCGAAGGCGCGCTC XbaI FkbD-MRR TTAA GAATTC GAACACCGAGGCCGTCCA EcoRI TcsBLF GAC AAGCTT ATGCTGGCGGTGAAGGCG HindIII TcsBLR CCG TCTAGA CCAGAAGGAATCGAGCCGGAA XbaI TcsBRF CAG TCTAGA GTGATCCGTGCCCTGCACTCC XbaI TcsBRR GCC GAATTC GATGACGATGTCCGGGTCG EcoRI TcsDLF GCT AAGCTT CTCAGGCGTCTGCGGATGC HidIII TcsDLR ATC GGATCC TTCGCTCACCGGGGCTGCC BamHI TcsDRF AGC AGATCT GGCATGTTCTGGTCAGTCC BglI TcsDRR GTC GAATTC CATGCCACGAACGGGTCGA EcoRI

9-deoxo-31- O- demethyl-prolyl-FK506 was prepared through cultivation of the produced strain S. pneumoniae kanamyceticus ΔfkbD-fkbM (Accession No. KCTC13581BP). Specifically, it is as follows. 50 ml of R2YE medium (sucrose 103 g / L, glucose 10 g / L, potassium sulfate 0.25 g / L, magnesium chloride hexahydrate 10.12 g / L, cassamino in a 250 ml Baffled flask) Acid 0.1 g / L, yeast extract (10%) 50 ml / L, TES buffer (5.73%, pH 7.2) 100 ml / L, potassium phosphate (0.5%) 10 ml / L, calcium chloride dihydrate (3.68%) 80 ml / L, L-proline (20%) 15 ml / L, trace element solution 2 ml / L, sodium hydroxide (1 N) 5 ml / L) is added, and the production strain is inoculated, followed by rotary shaking Pre-incubation was performed for 2 days at 28 ° C. and 180 rpm in the incubator. Then, a 3 L Erlenmeyer flask to which 1 L of R2YE medium was added was inoculated with 10 ml of pre-cultured culture for two days. After inoculation, culture was performed for 6 days at 28 ° C and 180 rpm. After incubation for 6 days, 9-deoxo-31- O- demethyl-prolyl-FK506 produced through the primary recovery process was extracted. The primary recovery process was carried out as follows. First, the same amount of methanol was added to the culture medium, mixed for 30 minutes, and then centrifuged to remove the cells. Concentration using a rotary evaporator was performed on the extracts from which the cells were removed. Then, the concentrated extract was dissolved in water, and after adding twice the volume of ethyl acetate (Ethyl acetate), the mixture was well mixed and then allowed to stand until layer separation. After the layers were separated, the organic solvent layer on the upper layer was collected, concentrated using a rotary evaporator, and weighed after concentration. The extract obtained by performing the first recovery process was passed through a column filled with silica gel. At this time, the amount of silica gel was used 15 times the weight of the extract from the primary recovery process, and the mobile phase was composed of 5 ratios of methanol and methylene chloride (fraction 1. 0: 100, partition 2. 1: 100, partition 3. 1:10, Fraction 4. 1: 1 and fraction 5. 100: 0) were used. In fraction 3, 9-deoxo-31- O- demethyl-prolyl-FK506 was identified. The obtained fraction 3 was concentrated using a rotary evaporator and finally purified using HPLC.

This was lyophilized to obtain 9-deoxo-31- O- demethyl-prolyl-FK506, a substance represented by [Formula 1] in powder form.

Confirmation of the prepared 9-deoxo-31- O- demethyl-prolyl-FK506 was performed as follows. Specifically, high performance liquid chromatography analysis (Mass spectrometry), nuclear magnetic resonance analysis (Nuclear magnetic resonance analysis) was performed. The analysis results for 9-deoxo-31- O- demethyl-prolyl-FK506 are summarized in Table 3 and FIGS. 1 to 6, and the production strain Strepttomyces canaaceticus produced from these results was obtained from ΔfkbD-fkbM. It was confirmed that -deoxo-31- O- demethyl-prolyl-FK506 was produced.

The analysis results for 9-deoxo-31- O- demethyl-prolyl-FK506 (molecular formula C ₄₁ H ₅₇ NO ₁₁ , molecular weight 749.4714) are shown in Table 3 below.

Method Analysis High performance liquid chromatography analysis As a mobile phase of HPLC, 45-55% acetonitrile aqueous solution was used, the flow rate was 1 ml / min, and analyzed with a UV detector of 205 nm. The retention time of 9-deoxo-31- O- demethyl-prolyl-FK506 at this time was 22 minutes. Mass spectrometry (ESI-HR-MS) Calcd. for C ₄₂ H ₆₇ NNaO ₁₁ ⁺ : 784.4606, found: m / z 784.4611 Nuclear magnetic resonance analysis number carbon (ppm) proton (ppm) One 170.09 2 59.06 4.36 (1H, dd, J = 10.5, 3.5 Hz) 3 29.35 1.97 (1H, m) 2.19 (1H, m) 4 24.89 1.96 (1H, m) 1.98 (1H, m) 5 6 47.61 3.55 (1H, m) 3.64 (1H, m) 7 171.99 8 39.34 2.56 (1H, d, J = 15.0 Hz) 2.63 (1H, d, J = 15.0 Hz) 9 98.73 10 38.72 1.59 (1H, m) 11 32.86 1.56 (1H, m) 1.99 (1H, m) 12 74.73 3.43 (1H, m) 13 71.14 3.85 (1H, dd, J = 10.0, 5.0 Hz) 14 77.39 3.54 (1H, m) 15 36.57 1.34 (1H, m) 1.47 (1H, m) 16 25.72 1.61 (1H, m) 17 49.17 1.70 (1H, m) 2.35 (1H, m) 18 141.22 19 122.04 4.99 (1H, d, J = 5.0 Hz) 20 53.54 3.38 (1H, d, J = 5.0 Hz) 21 214.00 22 44.25 2.35 (1H, m) 2.67 (1H, m) 23 69.23 4.04 (1H, br d, J = 10.0 Hz) 24 41.26 1.83 (1H, dd, J = 10.0, 2.0 Hz) 25 78.28 5.18 (1H, d, J = 2.0 Hz) 26 132.64 27 129.79 5.01 (1H, d, J = 2.0 Hz) 28 35.23 2.35 (1H, m) 29 39.39 1.14 (1H, m) 1.90 (1H, m) 30 75.81 3.35 (1H, m) 31 75.28 3.44 (1H, m) 32 32.29 1.36 (1H, m) 1.98 (1H, m) 33 31.22 1.06 (1H, m) 1.61 (1H, m) 34 35.78 2.25 (1H, m) 2.45 (1H, m) 35 135.80 5.72 (1H, m) 36 116.84 5.00 (1H, dd, J = 15.0, 10.0 Hz) 5.03 (1H, dd, J = 15.0,5.0Hz) 37 17.20 0.96 (3H, d, J = 5 Hz) 38 19.10 0.77 (3H, d, J = 5 Hz) 39 15.90 1.67 (3H, s) 40 10.13 0.90 (3H, d, J = 5 Hz) 41 14.41 1.65 (3H, s) 42 56.48 3.38 (3H, s) 43 57.98 3.37 (3H, s)

Characteristic functional groups from ¹ H, ¹³ C-NMR, 1 ketone carbon (δ _C 214.00) and 2 carbonyl carbons (δ _C 171.99, 170.09), exomehtylene skeleton (δ _C 116.84, 135.80) and 2 olefine skeletons (δ _C 141.22, 122.04; δ _C 132.64, 129.79) were identified, dioxygenated quaternary carbon (δ _C 98.73), 7 oxygenated methine carbons (δ _C 78.28, 77.39, 75.28, 75.81, 74.73, 71.14, 69.23), 2 Methoxy carbon (δ _C 57.98, 56.48) was observed, 5 methyl carbons (δ _C 19.10, 17.20, 15.90, 14.41, 10.13) were observed, and all carbons were observed as 42 FK506 derivatives. In order to confirm the correct structure, 2D-NMR was confirmed. As a result of confirming the connection of the proton from gCOSY, it was confirmed from the coupling between H-2 and H-4 that this compound has a prolyl skeleton without CH ₂ functional groups, not FK506 of the pipecolyl skeleton. From the gHMBC data, H-9 (δ _H 2.56, 2.63) and C-8 (δ _C 171.99), C-10 (δ _C 98.73) and the correlation of this compound are reduced to C-9 instead of ketone, CH ₂ Was confirmed. Along with this, two methoxy functional groups were attached to C-13 and C-15, confirming that C-31 had no methoxy structure. Overall, it was confirmed that the present compound was 9-deoxo-31- O- demethyl-prolyl-FK506.

Example 2: Preparation of 9-deoxo-36,37-dihydro-FK506

Double cross-over homologous recombination according to the method described in Ban, YH et al. (J. Nat. Prod. 2013, 76, 1091-1098) for Streptomyces kanamyceticus, a strain producing FK506 Streptomyces kanamyceticus ΔfkbD, tcsD, a production strain of 9-deoxo-36,37-dihydro-FK506, resulting in inactivation of the fkbD and tcsD genes using the in-frame deletion method by) (Accession No. KCTC13580BP) was produced.

Specifically, each gene was cloned into a pKC1139 vector and transferred to Escherichia coli ET12567 / pUZ8002 to produce a deletion mutant of the fkbD and tcsD genes in the Streptomyces kanamyceticus strain producing FK506. Conjugation) was transformed into Streptomyces kanamyceticus, a FK506 production strain.

The method for producing a strain may be described in more detail as production of an in-frame gene deletion plasmid and production of a gene deletion strain.

The production of in-frame gene deletion plasmids ( E. coli - Streptomyces shuttle ) The vector pKC1139 was used for in-frame gene deletion. Plasmid production was accomplished by PCR amplification of left- and right-flanking fragments of target genes for deletion from Fosmid DNA derived from Streptomyces kanamyceticus. It was carried out. For deletion of the fkbD gene, the primer pair FkbDLF / FkbDLR of the left-neighbor segment and the primer pair FkbDRF / FkbDRR of the right-neighbor segment were designed, and for the deletion of the tcsD gene, the primer pair of the left-neighbor segment TcsDLF / TcsDLR, right- Primer pairs TcsDRF / TcsDRR of adjacent sections were designed. All of the PCR fragments were separated, cut with HindIII-XbaI or XbaI-EcoRI, and cloned into pKC1139 vector. Information about the strains, plasmids and primers used in this Example is presented in Table 1 and Table 2.

The plasmid used to construct the gene deletion strain is summarized in Table 1. The plasmid, pΔfkbD, for removing C9 hydroxylase (Hydroxylase) was transferred to Escherichia coli ET12567 / pUZ8002 and introduced into Streptomyces kanamyceticus by conjugation, thereby deleting the target gene by homologous recombination. Strains with a single cross between the deletion plasmid and the Streptomyces kanamyceticus chromosome were subdivided at 37 ° C with apramycin (non-proliferable temperature for pSG5-based replication unit (Replicon)). It was selected by cultivation of a pramycin-resistant transconjugant. The colonies thus secured were allowed to multiply three times without selection at 28 ° C to allow the second crossover. The two achieved double crossover mutations, ΔfkbD, were selected as apramycin-sensitive expression traits, then confirmed by PCR, and optionally confirmed by Southern block analysis.

The prepared fkbD gene was deleted by introducing pΔtcsD into ΔfkbD of Streptomyces kanamyceticus deficient, and the tcsD gene was deleted using the same method as the fkbD gene deletion method. ΔfkbD, tcsD was selected as apramycin-sensitive expression trait, then confirmed by PCR, and optionally confirmed by Southern block analysis.

The produced fkbD and tcsD gene-deficient strains, Streptomyces kanamyceticus ΔfkbD, tcsD, were deposited with the Korea Institute of Bioscience and Biotechnology (Korean Collection for Type Cultures, KCTC) on July 17, 2018 (Accession No. KCTC13580BP ).

9-deoxo-36,37-dihydro-FK506 was prepared through cultivation of the produced strain S. pneumoniae kanamyceticus ΔfkbD, tcsD (Accession No. KCTC13580BP). Specifically, it is as follows. 50 ml of R2YE medium (sucrose 103 g / L, glucose 10 g / L, potassium sulfate 0.25 g / L, magnesium chloride hexahydrate 10.12 g / L, cassamino in a 250 ml Baffled flask) Acid 0.1 g / L, yeast extract (10%) 50 ml / L, TES buffer (5.73%, pH 7.2) 100 ml / L, potassium phosphate (0.5%) 10 ml / L, calcium chloride dihydrate (3.68%) 80 ml / L, L-proline (20%) 15 ml / L, trace element solution 2 ml / L, sodium hydroxide (1 N) 5 ml / L) is added, and the production strain is inoculated, followed by rotary shaking Pre-incubation was performed for 2 days at 28 ° C. and 180 rpm in the incubator. Then, a 3 L Erlenmeyer flask to which 1 L of R2YE medium was added was inoculated with 10 ml of pre-cultured culture for two days. After inoculation, culture was performed for 6 days at 28 ° C and 180 rpm. After incubation for 6 days, 9-deoxo-36,37-dihydro-FK506 produced through the primary recovery process was extracted.

The primary recovery process was carried out as follows. First, the same amount of methanol was added to the culture medium, mixed for 30 minutes, and then centrifuged to remove the cells. Concentration using a rotary evaporator was performed on the extracts from which the cells were removed. Then, the concentrated extract was dissolved in water, and after adding twice the volume of ethyl acetate (Ethyl acetate), mixed well and left until layer separation. After the layers were separated, the organic solvent layer on the upper layer was collected, concentrated using a rotary evaporator, and weighed after concentration. The extract obtained by performing the first recovery process was passed through a column filled with silica gel. At this time, the amount of silica gel was used 15 times the weight of the extract from the primary recovery process, and the mobile phase was composed of 5 ratios of methanol and methylene chloride (fraction 1. 0: 100, partition 2. 1: 100, partition 3. 1:10, Fraction 4. 1: 1 and fraction 5. 100: 0) were used. In fraction 3, 9-deoxo-36,37-dihydro-FK506 was identified. The obtained fraction 3 was concentrated using a rotary evaporator and finally purified using HPLC.

This was lyophilized to obtain 9-deoxo-36,37-dihydro-FK506, a substance represented by [Formula 2] in powder form.

Confirmation of the prepared 9-deoxo-36,37-dihydro-FK506 was performed as follows. Specifically, high performance liquid chromatography analysis (Mass spectrometry), nuclear magnetic resonance analysis (Nuclear magnetic resonance analysis) was performed. The analysis results for 9-deoxo-36,37-dihydro-FK506 are summarized in Table 4 and FIGS. 7 to 12, and the production strain Strepttomyces canaaceticus ΔfkbD, tcsD from 9-deoxo produced from these results It was confirmed that -36,37-dihydro-FK506 was produced.

The results of the analysis for 9-deoxo-36,37-dihydro-FK506 (molecular formula C ₄₄ H ₇₃ NO ₁₁ , molecular weight 792.06) are shown in Table 4 below.

Method Analysis High performance liquid chromatography analysis As a mobile phase of HPLC, 45-55% acetonitrile aqueous solution was used, the flow rate was 1 ml / min, and analyzed with a UV detector of 205 nm. The retention time of 9-deoxo-36,37-dihydro-FK506 at this time was 51 minutes. Mass spectrometry (ESI-HR-MS) Calcd. for C ₄₄ H ₇₃ NNaO ₁₁ ⁺ : 814.5076, found: m / z 814.5083 Nuclear magnetic resonance analysis number carbon (ppm) proton (ppm) One 169.39 2 52.59 4.85 (1H, brd, J = 5.0 Hz) 3 26.58 1.70 (1H, m) 2.24 (1H, m) 4 20.70 1.31 (1H, m) 1.72 (1H, m) 5 24.42 1.51 (1H, m) 1.68 (1H, m) 6 42.65 3.19 (1H, m) 3.69 (1H, m) 7 173.96 8 36.25 2.49 (1H, d, J = 15.0 Hz) 2.66 (1H, d, J = 15.0 Hz) 9 98.50 10 38.39 1.56 (1H, m) 11 31.12 1.60 (1H, m) 1.94 (1H, m) 12 74.33 3.40 (1H, m) 13 70.6 3.84 (1H, dd, J = 10.0, 5.0 Hz) 14 77.11 3.53 (1H, m) 15 36.57 1.34 (1H, m) 1.47 (1H, m) 16 25.64 1.50 (1H, m) 17 48.49 1.65 (1H, m) 2.32 (1H, m) 18 140.82 19 122.20 5.05 (1H, d, J = 5.0 Hz) 20 53.45 3.21 (1H, d, J = 5.0 Hz) 21 215.35 22 41.74 2.21 (1H, br d, J = 15 Hz) 2.66 (1H, br d, J = 15 Hz) 23 69.64 3.97 (1H, m) 24 40.26 1.87 (1H, m) 25 76.50 5.19 (1H, br s) 26 132.42 27 128.71 4.97 (1H, d, J = 5.0 Hz) 28 34.81 2.35 (1H, m) 29 34.84 0.93 (1H, m) 2.01 (1H, m) 30 84.13 3.00 (1H, m) 31 73.58 3.39 (1H, m) 32 30.64 1.34 (1H, m) 1.98 (1H, m) 33 31.15 1.06 (1H, m) 1.61 (1H, m) 34 33.82 1.42 (1H, m) 1.65 (1H, m) 35 20.41 1.21 (2H, m) 36 13.91 0.88 (3H, t, J = 7.5 Hz) 37 16.87 0.93 (3H, d, J = 5 Hz) 38 18.84 0.76 (3H, d, J = 5 Hz) 39 15.45 1.63 (3H, s) 40 10.13 0.90 (3H, d, J = 5 Hz) 41 13.91 1.66 (3H, s) 42 56.10 3.35 (3H, s) 43 57.64 3.36 (3H, s) 44 56.56 3.39 (3H, s)

^A total of 44 carbon atoms from ¹ H, ¹³ C-NMR and gHSQC, with ¹ methoxy (δ _H 3.39, δ _C 56.56) and 1 CH ₂ (δ _H 2.24, δ _H 1.70, δ _C 20.70) added, respectively. , The functional group of exomethylene was not observed, and the methyl group (δ _H 0.88, δ _C 13.91) and CH ₂ (δ _H 1.21, δ _C 20.41) observed by triplet coupling were observed. In order to confirm the correct structure, 2D-NMR was confirmed. As a result of confirming the proton connection from gCOSY, it was confirmed from the coupling between H-2 and H-5 that this compound was FK506 of the pipecolyl skeleton, and one CH ₂ functional group (δ _H 2.24, δ _H 1.70, δ _C 20.70) It was confirmed that it was located in the pipecolyl skeleton. Three methoxy hydrogens (δ _H 3.39, 3.36, 3.35) from gHMBC were correlated with C-31 (δ _C 77.11), C-15 (δ _C 77.11) and C-13 (δ _C 74.33), respectively. The methyl group observed by triplet coupling (δ _H 0.88, δ _C 13.91) and CH ₂ (δ _H 1.21, δ _C 20.41) were able to confirm cross-correlation with C-21 / 33. Therefore, as a compound made from the strain from which tcsD was removed, the double bond existing between C-36 / 37 was structurally determined to be a reduced form of 9-deoxo-36,37-dihydro-FK506.

Example 3: 31- O -demethyl-36,37-dihydro-FK506 production

Double cross-over homologous recombination according to the method described in Ban, YH et al. (J. Nat. Prod. 2013, 76, 1091-1098) for Streptomyces kanamyceticus, a strain producing FK506 Streptomyces kanamyceticus ΔfkbM, a production strain of 31- O- demethyl-36,37-dihydro-FK506, resulting in inactivation of the fkbM and tcsD genes using the in-frame deletion method by) , tcsD (Accession No. KCTC13584BP) was produced.

Specifically, each gene was cloned into a pKC1139 vector and transferred to Escherichia coli ET12567 / pUZ8002 in order to construct a mutant of the fkbM and tcsD genes in a strain of Streptomyces kanamyceticus producing FK506, and then transferred to a conjugation ( Conjugation) was transformed into Streptomyces kanamyceticus, a FK506 production strain.

The method for producing a strain may be described in more detail as production of an in-frame gene deletion plasmid and production of a gene deletion strain.

The production of in-frame gene deletion plasmids ( E. coli - Streptomyces shuttle ) The vector pKC1139 was used for in-frame gene deletion. Plasmid production is accomplished by PCR amplification of left- and right-flanking fragments of target genes for deletion from Fosmid DNA derived from Streptomyces kanamyceticus. It was carried out. For deletion of the fkbM gene, the primer pair FkbMLF / FkbMLR of the left-neighbor segment and the primer pair FkbMRF / FkbMRR of the right-neighbor segment were designed, and for the deletion of the tcsD gene, the primer pair of the left-neighbor segment TcsDLF / TcsDLR, right- Primer pairs TcsDRF / TcsDRR of adjacent sections were designed. All of the PCR fragments were separated, cut with HindIII-XbaI or XbaI-EcoRI, and then cloned into the pKC1139 vector. Information about the strains, plasmids and primers used in this Example is presented in Table 1 and Table 2.

The plasmid used to construct the gene deletion strain is summarized in Table 1. The plasmid for removing 31- O -methyltransferase, pΔfkbM, was transferred to E. coli ET12567 / pUZ8002 and introduced into Streptomyces kanamyceticus by conjugation, thereby deleting the target gene by homologous recombination. Strains with a single cross between the deletion plasmid and the Streptomyces kanamyceticus chromosome were subdivided at 37 ° C with apramycin (non-proliferable temperature for pSG5-based replication unit (Replicon)). It was selected by cultivation of a pramycin-resistant transconjugant. The colonies thus secured were allowed to multiply three times without selection at 28 ° C to allow the second crossover. Two achieved double crossover mutations, ΔfkbM, were selected as apramycin-sensitive expression traits, then confirmed by PCR, and optionally confirmed by Southern block analysis.

The prepared fkbM gene was introduced into pΔtcsD in ΔfkbM of Streptomyces kanamyceticus deficient, and the tcsD gene was deleted using the same method as the fkbM gene deletion method. ΔfkbM, tcsD was selected as the expression trait of apramycin-sensitivity, and then confirmed by PCR, and optionally confirmed by Southern block analysis.

The produced fkbM and tcsD gene-deficient strains, Streptomyces kanamyceticus ΔfkbM, tcsD, were deposited with the Korea Institute of Biotechnology and Biotechnology Resource Center (Korean Collection for Type Cultures, KCTC) on July 17, 2018 (Accession number KCTC13584BP ).

31- O- demethyl-36,37-dihydro-FK506 was prepared through cultivation of the produced strain S. pneumoniae kanamyceticus ΔfkbM, tcsD (Accession No. KCTC13584BP). Specifically, it is as follows. 50 ml of R2YE medium (sucrose 103 g / L, glucose 10 g / L, potassium sulfate 0.25 g / L, magnesium chloride hexahydrate 10.12 g / L, cassamino in a 250 ml Baffled flask) Acid 0.1 g / L, yeast extract (10%) 50 ml / L, TES buffer (5.73%, pH 7.2) 100 ml / L, potassium phosphate (0.5%) 10 ml / L, calcium chloride dihydrate (3.68%) 80 ml / L, L-proline (20%) 15 ml / L, trace element solution 2 ml / L, sodium hydroxide (1 N) 5 ml / L) is added, and the production strain is inoculated, followed by rotary shaking Pre-incubation was performed for 2 days at 28 ° C. and 180 rpm in the incubator. Then, a 3 L Erlenmeyer flask to which 1 L of R2YE medium was added was inoculated with 10 ml of pre-cultured culture for two days. After inoculation, culture was performed for 6 days at 28 ° C and 180 rpm. After incubation for 6 days, 31- O- demethyl-36,37-dihydro-FK506 produced through the primary recovery process was extracted.

The primary recovery process was carried out as follows. First, the same amount of methanol was added to the culture medium, mixed for 30 minutes, and then centrifuged to remove the cells. Concentration using a rotary evaporator was performed on the extracts from which the cells were removed. Then, the concentrated extract was dissolved in water, and after adding twice the volume of ethyl acetate (Ethyl acetate), the mixture was well mixed and then allowed to stand until layer separation. After the layers were separated, the organic solvent layer on the upper layer was collected, concentrated using a rotary evaporator, and weighed after concentration. The extract obtained by performing the first recovery process was passed through a column filled with silica gel. At this time, the amount of silica gel was used 15 times the weight of the extract from the primary recovery process, and the mobile phase was composed of 5 ratios of methanol and methylene chloride (fraction 1. 0: 100, partition 2. 1: 100, partition 3. 1:10, Fraction 4. 1: 1 and fraction 5. 100: 0) were used. In fraction 3, 31- O- demethyl-36,37-dihydro-FK506 was identified. The obtained fraction 3 was concentrated using a rotary evaporator and finally purified using HPLC.

This was lyophilized to obtain 31- O- demethyl-36,37-dihydro-FK506, a substance represented by [Formula 3] in powder form.

Confirmation of the prepared 31- O- demethyl-36,37-dihydro-FK506 was performed as follows. Specifically, high performance liquid chromatography analysis (Mass spectrometry), nuclear magnetic resonance analysis (Nuclear magnetic resonance analysis) was performed. The analysis results for 31- O- demethyl-36,37-dihydro-FK506 are summarized in Table 5 and FIGS. 13 to 18, and from the results, the production strain Streptomyces canaaceticus ΔfkbM, tcsD 31 -It was confirmed that O- demethyl-36,37-dihydro-FK506 was produced.

The analysis results for 31- O- demethyl-36,37-dihydro-FK506 (molecular formula C ₄₃ H ₆₉ NO ₁₂ , molecular weight 792.02) are shown in Table 5 below.

Method Analysis High performance liquid chromatography analysis As a mobile phase of HPLC, 45-55% acetonitrile aqueous solution was used, the flow rate was 1 ml / min, and analyzed with a UV detector of 205 nm.
The retention time of 31- O- demethyl-36,37-dihydro-FK506 at this time was 43 minutes. Mass spectrometry (ESI-HR-MS) Calcd. for C ₄₃ H ₆₉ NNaO ₁₂ ⁺ : 814.4712, found: m / z 814.4715 Nuclear magnetic resonance analysis number carbon (ppm) proton (ppm) One 169.35 2 56.64 4.58 (1H, brd, J = 5.0 Hz) 3 27.92 2.05 (1H, m) 1.90 (1H, m) 4 21.42 1.38 (1H, m) 1.74 (1H, m) 5 24.80 1.51 (1H, m) 1.68 (1H, m) 6 39.58 3.03 (1H, m) 4.44 (1H, m) 7 165.08 8 196.54 9 97.42 10 35.28 2.32 (1H, m) 11 33.01 1.52 (1H, m) 2.16 (1H, m) 12 74.03 3.39 (1H, m) 13 73.22 3.68 (1H, dd, J = 10.0, 5.0 Hz) 14 75.21 3.39 (1H, m) 15 35.79 1.35 (1H, m) 1.56 (1H, m) 16 26.67 1.66 (1H, m) 17 49.02 1.80 (1H, m) 2.17 (1H, m) 18 138.80 19 123.64 5.03 (1H, d, J = 5.0 Hz) 20 53.34 3.28 (1H, d, J = 5.0 Hz) 21 213.76 22 43.64 2.10 (1H, br d, J = 15 Hz) 2.77 (1H, br d, J = 15 Hz) 23 70.36 3.92 (1H, m) 24 39.97 1.89 (1H, m) 25 77.82 5.33 (1H, br s) 26 132.63 27 130.03 5.09 (1H, d, J = 5.0 Hz) 28 34.93 2.18 (1H, m) 29 39.36 1.14 (1H, m) 1.91 (1H, m) 30 75.79 3.59 (1H, m) 31 75.58 3.36 (1H, m) 32 32.36 1.35 (1H, m) 1.98 (1H, m) 33 31.23 1.06 (1H, m) 1.61 (1H, m) 34 33.34 1.42 (1H, m) 1.66 (1H, m) 35 20.76 1.27 (2H, m) 36 14.37 0.90 (3H, t, J = 7.5 Hz) 37 16.54 1.00 (3H, d, J = 5 Hz) 38 20.75 0.93 (3H, d, J = 5 Hz) 39 16.18 1.59 (3H, s) 40 9.79 0.87 (3H, d, J = 5 Hz) 41 14.43 1.62 (3H, s) 42 56.64 3.40 (3H, s) 43 57.32 3.30 (3H, s)

^{From 1} H, ¹³ C-NMR and gHSQC, ketone carbon (δ _C 196.54) was further observed with 43 carbons in total, and 2 methoxys were observed, resulting from 31- O- demethyl made from the ΔfkbM gene. I could infer. From gHMBC, it was confirmed that two methoxy hydrogens (δ _H 3.40, 3.30) were correlated with C-15 (δ _C 75.21) and C-13 (δ _C 74.03), respectively, and this compound was also made from a strain in which tcsD was removed. As, the structure of the double bond existing between C-36 / 37 was reduced to 31- O- demethyl-35,37-dihydro-FK506.

Example 4: 9-deoxo-31- O -demethyl-36,37-dihydro-FK506 production

Double cross-over homologous recombination according to the method described in Ban, YH et al. (J. Nat. Prod. 2013, 76, 1091-1098) for Streptomyces kanamyceticus, a strain producing FK506 Streptomym, a production strain of 9-deoxo-31- O- demethyl-36,37-dihydro-FK506, resulting in inactivation of the fkbD-fkbM and tcsD genes using the in-frame deletion method by Seth kanamyceticus ΔfkbD-fkbM, tcsD (Accession No. KCTC13585BP) was produced.

Specifically, each gene was cloned into a pKC1139 vector and transferred to Escherichia coli ET12567 / pUZ8002, in order to prepare a deletion mutant of the fkbD-fkbM and tcsD genes in the Streptomyces kanamyceticus strain producing FK506, and then transferred to Escherichia coli ET12567 / pUZ8002, It was transformed into the FK506 production strain Streptomyces kanamyceticus through conjugation.

The method for producing a strain may be described in more detail as production of an in-frame gene deletion plasmid and production of a gene deletion strain.

The production of in-frame gene deletion plasmids ( E. coli - Streptomyces shuttle ) The vector pKC1139 was used for in-frame gene deletion. Plasmid production was accomplished by PCR amplification of left- and right-flanking fragments of target genes for deletion from Fosmid DNA derived from Streptomyces kanamyceticus. It was carried out. For deletion of the fkbD-fkbM gene, the primer pair FkbD-MLF / FkbD-MLR of the left-adjacent segment and the primer pair FkbD-MRF / FkbD-MRR of the right-adjacent segment were designed, and the left-adjacent for deletion of the tcsD gene. The primer pair TcsDLF / TcsDLR of the fragment and the primer pair TcsDRF / TcsDRR of the right-adjacent fragment were designed. All of the PCR fragments were separated, cut with HindIII-XbaI or XbaI-EcoRI, and then cloned into the pKC1139 vector. Information about the strains, plasmids and primers used in this Example is presented in Table 1 and Table 2.

The plasmid used to construct the gene deletion strain is summarized in Table 1. The plasmid for removing C9 hydroxylase (Hydroxylase) and 31- O -methyltransferase together, pΔfkbD-fkbM, was transferred to E. coli ET12567 / pUZ8002 and introduced into Streptomyces kanamyceticus by conjugation to target genes. It was deleted by homologous recombination. Strains with a single cross between the deletion plasmid and the Streptomyces kanamyceticus chromosome were subdivided at 37 ° C with apramycin (non-proliferable temperature for pSG5-based replication unit (Replicon)). It was selected by cultivation of a pramycin-resistant transconjugant. The colonies thus secured were allowed to multiply three times without selection at 28 ° C to allow the second crossover. Two achieved double crossover mutations, ΔfkbD-fkbM, were selected as apramycin-sensitive expression traits, then confirmed by PCR, and optionally confirmed by Southern block analysis.

The prepared fkbD-fkbM gene was deleted by introducing pΔtcsD into ΔfkbD-fkbM of Streptomyces kanamyceticus, and the tcsD gene was deleted using the same method as the fkbD-fkbM gene deletion method. ΔfkbD-fkbM, tcsD was selected as apramycin-sensitive expression trait, then confirmed by PCR, and optionally confirmed by Southern block analysis.

The produced fkbD-fkbM and tcsD gene-deficient strains, Streptomyces kanamyceticus ΔfkbD-fkbM, tcsD, were deposited on July 17, 2018 at the Korean Collection for Type Cultures (KCTC). (Accession number KCTC13585BP).

9-deoxo-31- O- demethyl-36,37-dihydro-FK506 was prepared through cultivation of the produced strain Strepttomyces kanamyceticus ΔfkbD-fkbM, tcsD (Accession No. KCTC13585BP). Specifically, it is as follows. 50 ml of R2YE medium (sucrose 103 g / L, glucose 10 g / L, potassium sulfate 0.25 g / L, magnesium chloride hexahydrate 10.12 g / L, cassamino in a 250 ml Baffled flask) Acid 0.1 g / L, yeast extract (10%) 50 ml / L, TES buffer (5.73%, pH 7.2) 100 ml / L, potassium phosphate (0.5%) 10 ml / L, calcium chloride dihydrate (3.68%) 80 ml / L, L-proline (20%) 15 ml / L, trace element solution 2 ml / L, sodium hydroxide (1 N) 5 ml / L) is added, and the production strain is inoculated, followed by rotary shaking Pre-incubation was performed for 2 days at 28 ° C. and 180 rpm in the incubator. Then, a 3 L Erlenmeyer flask to which 1 L of R2YE medium was added was inoculated with 10 ml of pre-cultured culture for two days. After inoculation, culture was performed for 6 days at 28 ° C and 180 rpm. After incubation for 6 days, 9-deoxo-31- O- demethyl-36,37-dihydro-FK506 produced through the primary recovery process was extracted.

The primary recovery process was carried out as follows. First, the same amount of methanol was added to the culture medium, mixed for 30 minutes, and then centrifuged to remove the cells. Concentration using a rotary evaporator was performed on the extracts from which the cells were removed. Then, the concentrated extract was dissolved in water, and after adding twice the volume of ethyl acetate (Ethyl acetate), the mixture was well mixed and then allowed to stand until layer separation. After the layers were separated, the organic solvent layer on the upper layer was collected, concentrated using a rotary evaporator, and weighed after concentration. The extract obtained by performing the first recovery process was passed through a column filled with silica gel. At this time, the amount of silica gel was used 15 times the weight of the extract from the primary recovery process, and the mobile phase was composed of 5 ratios of methanol and methylene chloride (fraction 1. 0: 100, partition 2. 1: 100, partition 3. 1:10, Fraction 4. 1: 1 and fraction 5. 100: 0) were used. In fraction 3, 9-deoxo-31- O- demethyl-36,37-dihydro-FK506 was identified. The obtained fraction 3 was concentrated using a rotary evaporator and finally purified using HPLC.

This was lyophilized to obtain 9-deoxo-31- O- demethyl-36,37-dihydro-FK506, a substance represented by [Formula 4] in powder form.

Confirmation of the prepared 9-deoxo-31- O- demethyl-36,37-dihydro-FK506 was performed as follows. Specifically, high performance liquid chromatography analysis (Mass spectrometry), nuclear magnetic resonance analysis (Nuclear magnetic resonance analysis) was performed. Analysis results for 9-deoxo-31- O- demethyl-36,37-dihydro-FK506 are summarized in Table 6 and FIGS. 19 to 24, and the production strain Streptomyces kanamyceticus ΔfkbD produced from these results It was confirmed that 9-deoxo-31- O- demethyl-36,37-dihydro-FK506 was produced from -fkbM, tcsD.

The analysis results for 9-deoxo-31- O- demethyl-36,37-dihydro-FK506 (molecular formula C ₄₃ H ₇₁ NO ₁₁ , molecular weight 778.04) are shown in Table 6 below.

Method Analysis High performance liquid chromatography analysis As a mobile phase of HPLC, 45-55% acetonitrile aqueous solution was used, the flow rate was 1 ml / min, and analyzed with a UV detector of 205 nm.
The retention time of 9-deoxo-31- O- demethyl-36,37-dihydro-FK506 at this time was 34 minutes. Mass spectrometry (ESI-HR-MS) Calcd. for C ₄₃ H ₇₁ NNaO ₁₁ ⁺ : 800.4919, found: m / z 800.4924 Nuclear magnetic resonance analysis number carbon (ppm) proton (ppm) One 169.73 2 52.59 4.85 (1H, brd, J = 5.0 Hz) 3 26.94 1.70 (1H, m) 2.23 (1H, m) 4 21.03 1.32 (1H, m) 1.72 (1H, m) 5 24.77 1.52 (1H, m) 1.68 (1H, m) 6 42.97 3.19 (1H, m) 3.70 (1H, m) 7 174.37 8 37.54 2.49 (1H, d, J = 15.0 Hz) 2.67 (1H, d, J = 15.0 Hz) 9 98.85 10 38.78 1.56 (1H, m) 11 32.86 1.60 (1H, m) 1.94 (1H, m) 12 74.69 3.40 (1H, m) 13 70.99 3.84 (1H, dd, J = 10.0, 5.0 Hz) 14 77.21 3.53 (1H, m) 15 36.57 1.34 (1H, m) 1.47 (1H, m) 16 26.94 1.63 (1H, m) 17 48.49 1.64 (1H, m) 2.33 (1H, m) 18 141.15 19 122.53 5.05 (1H, d, J = 5.0 Hz) 20 53.84 3.20 (1H, d, J = 5.0 Hz) 21 215.35 22 42.20 2.20 (1H, br d, J = 15 Hz) 2.64 (1H, br d, J = 15 Hz) 23 69.96 3.97 (1H, m) 24 40.05 1.85 (1H, m) 25 76.90 5.20 (1H, br s) 26 132.82 27 129 4.97 (1H, d, J = 5.0 Hz) 28 35.29 2.32 (1H, m) 29 39.45 1.12 (1H, m) 1.88 (1H, m) 30 75.22 3.53 (1H, m) 31 75.22 3.40 (1H, m) 32 32.32 1.33 (1H, m) 1.95 (1H, m) 33 31.19 1.04 (1H, m) 1.59 (1H, m) 34 34.14 1.46 (1H, m) 1.62 (1H, m) 35 20.73 1.22 (2H, m) 36 14.25 0.88 (3H, t, J = 7.5 Hz) 37 17.22 0.94 (3H, d, J = 5 Hz) 38 19.17 0.76 (3H, d, J = 5 Hz) 39 15.82 1.63 (3H, s) 40 10.07 0.85 (3H, d, J = 5 Hz) 41 14.77 1.65 (3H, s) 42 56.45 3.35 (3H, s) 43 57.99 3.35 (3H, s)

^{From 1} H, ¹³ C-NMR and gHSQC, the total number of carbon atoms is 43, but due to the effect of ΔfkbD, CH ₂ functional groups appearing in place of ketone (δ _H 2.67, 2.49, like substances 1 and 2) δ _C 37.54) was observed. As a result of analyzing 2D-NMR data, compound 4 was structured with 9-deoxo-31- O- demethyl-35,37-dihydro-FK506 made from the ΔfkbD-fkbM gene.

Example 5: Preparation of 9-deoxo-FK520

Double cross-over homologous recombination according to the method described in Ban, YH et al. (J. Nat. Prod. 2013, 76, 1091-1098) for Streptomyces kanamyceticus, a strain producing FK506 Streptomyces kanamyceticus ΔfkbD, tcsB (producing strain of 9-deoxo-FK520, resulting in inactivation of fkbD and tcsB genes or fkbD and tcsD genes using in-frame deletion method by) Accession No. KCTC13579BP) or Streptomyces kanamyceticus ΔfkbD, tcsD (Accession No. KCTC13580BP) was prepared.

Specifically, each gene was cloned into a pKC1139 vector and Escherichia coli in order to produce a deletion mutant of the fkbD and tcsB genes or a deletion mutant of the fkbD and tcsD genes in the Streptomyces kanamyceticus strain producing FK506. After transfer to ET12567 / pUZ8002, it was transformed into FK506 producing strain Streptomyces kanamyceticus through conjugation.

The method for producing a strain may be described in more detail as production of an in-frame gene deletion plasmid and production of a gene deletion strain.

The production of in-frame gene deletion plasmids ( E. coli - Streptomyces shuttle ) The vector pKC1139 was used for in-frame gene deletion. Plasmid production was accomplished by PCR amplification of left- and right-flanking fragments of target genes for deletion from Fosmid DNA derived from Streptomyces kanamyceticus. It was carried out. For deletion of the fkbD gene, the primer pair FkbDLF / FkbDLR of the left-adjacent segment and the primer pair FkbDRF / FkbDRR of the right-adjacent segment were designed, and for the deletion of the tcsB gene, the primer pair of the left-adjacent segment TcsBLF / TcsBLR, right- Primer pairs TcsBRF / TcsBRR of adjacent sections were designed. For deletion of the tcsD gene, the primer pair TcsDLF / TcsDLR of the left-adjacent segment and the primer pair TcsDRF / TcsDRR of the right-adjacent segment were designed. All of the PCR fragments were separated, cut with HindIII-XbaI or XbaI-EcoRI, and cloned into pKC1139 vector. Information about the strains, plasmids and primers used in this Example is presented in Table 1 and Table 2.

The plasmid used to construct the gene deletion strain is summarized in Table 1. The plasmid, pΔfkbD, for removing C9 hydroxylase (Hydroxylase) was transferred to Escherichia coli ET12567 / pUZ8002 and introduced into Streptomyces kanamyceticus by conjugation, thereby deleting the target gene by homologous recombination. Strains with a single cross between the deletion plasmid and the Streptomyces kanamyceticus chromosome were subdivided at 37 ° C with apramycin (non-proliferable temperature for pSG5-based replication unit (Replicon)). It was selected by cultivation of a pramycin-resistant transconjugant. The colonies thus secured were allowed to multiply three times without selection at 28 ° C to allow the second crossover. The two achieved double crossover mutations, ΔfkbD, were selected as apramycin-sensitive expression traits, then confirmed by PCR, and optionally confirmed by Southern block analysis.

The prepared fkbD gene was introduced into pΔtcsB or pΔtcsD in ΔfkbD of Streptomyces kanamyceticus deficient, and the tcsB gene or tcsD gene was deleted using the same method as the fkbD gene deletion method. ΔfkbD, tcsB or ΔfkbD, tcsD was selected as apramycin-sensitive expression trait, then confirmed by PCR, and optionally by Southern block analysis.

The produced fkbD and tcsB gene-deficient strains, Streptomyces kanamyceticus ΔfkbD, tcsB, were deposited with the Korea Institute of Biotechnology and Biotechnology Resource Center (Korean Collection for Type Cultures, KCTC) on July 17, 2018 (Accession No. KCTC13579BP ), fkbD and tcsD gene-deficient strains, Streptomyces kanamyceticus ΔfkbD, tcsD, were also deposited with the Korea Institute of Biotechnology and Biotechnology Resource Center (Korean Collection for Type Cultures, KCTC) on July 17, 2018 (Accession number KCTC13580BP ).

9-deoxo-FK520 was prepared by culturing the production strain of Streptomyces kanamyceticus ΔfkbD, tcsB (Accession No. KCTC13579BP) or Streptomyces kanamyceticus ΔfkbD, tcsD (Accession No. KCTC13580BP). Specifically, it is as follows. 50 ml of R2YE medium (sucrose 103 g / L, glucose 10 g / L, potassium sulfate 0.25 g / L, magnesium chloride hexahydrate 10.12 g / L, cassamino in a 250 ml Baffled flask) Acid 0.1 g / L, yeast extract (10%) 50 ml / L, TES buffer (5.73%, pH 7.2) 100 ml / L, potassium phosphate (0.5%) 10 ml / L, calcium chloride dihydrate (3.68%) 80 ml / L, L-proline (20%) 15 ml / L, trace element solution 2 ml / L, sodium hydroxide (1 N) 5 ml / L) is added, and the production strain is inoculated, followed by rotary shaking Pre-incubation was performed for 2 days at 28 ° C. and 180 rpm in the incubator. Then, a 3 L Erlenmeyer flask to which 1 L of R2YE medium was added was inoculated with 10 ml of pre-cultured culture for two days. After inoculation, culture was performed for 6 days at 28 ° C and 180 rpm. After incubation for 6 days, 9-deoxo-FK520 produced through the primary recovery process was extracted.

The primary recovery process was carried out as follows. First, the same amount of methanol was added to the culture medium, mixed for 30 minutes, and then centrifuged to remove the cells. Concentration using a rotary evaporator was performed on the extracts from which the cells were removed. Then, the concentrated extract was dissolved in water, and after adding twice the volume of ethyl acetate (Ethyl acetate), mixed well and left until layer separation. After the layers were separated, the organic solvent layer on the upper layer was collected, concentrated using a rotary evaporator, and weighed after concentration. The extract obtained by performing the first recovery process was passed through a column filled with silica gel. At this time, the amount of silica gel was used 15 times the weight of the extract from the primary recovery process, and the mobile phase was composed of 5 ratios of methanol and methylene chloride (fraction 1. 0: 100, partition 2. 1: 100, partition 3. 1:10, Fraction 4. 1: 1 and fraction 5. 100: 0) were used. In fraction 3, 9-deoxo-FK520 was identified. The obtained fraction 3 was concentrated using a rotary evaporator and finally purified using HPLC.

This was lyophilized to obtain 9-deoxo-FK520, a substance represented by [Formula 5] in powder form.

Confirmation of the prepared 9-deoxo-FK520 was performed as follows. Specifically, high performance liquid chromatography analysis (Mass spectrometry), nuclear magnetic resonance analysis (Nuclear magnetic resonance analysis) was performed. The results of the analysis for 9-deoxo-FK520 are summarized in Table 7 and FIGS. 25 to 30, and the production strains Streptomyces kanamyceticus ΔfkbD, tcsB or Streptomyces kanamyceticus ΔfkbD produced from these results, It was confirmed that 9-deoxo-FK520 was produced from tcsD.

The results of the analysis for 9-deoxo-FK520 (molecular formula C ₄₃ H ₇₁ NO ₁₁ , molecular weight 778.04) are shown in Table 7 below.

Method Analysis High performance liquid chromatography analysis As a mobile phase of HPLC, 45-55% acetonitrile aqueous solution was used, the flow rate was 1 ml / min, and analyzed with a UV detector of 205 nm.
The retention time of 9-deoxo-FK520 at this time was 35 minutes. Mass spectrometry (ESI-HR-MS) Calcd. for C ₄₃ H ₇₁ NNaO ₁₁ ⁺ : 800.4919, found: m / z 800.4927 Nuclear magnetic resonance analysis number carbon (ppm) proton (ppm) One 169.62 2 52.84 4.87 (1H, brd, J = 5.0 Hz) 3 26.85 1.71 (1H, m) 2.25 (1H, m) 4 20.97 1.24 (1H, m) 1.73 (1H, m) 5 24.69 1.52 (1H, m) 1.71 (1H, m) 6 42.86 3.19 (1H, m) 3.69 (1H, m) 7 174.25 8 36.25 2.49 (1H, d, J = 15.0 Hz) 2.66 (1H, d, J = 15.0 Hz) 9 98.75 10 38.72 1.58 (1H, m) 11 31.12 1.60 (1H, m) 1.94 (1H, m) 12 74.62 3.40 (1H, m) 13 70.92 3.84 (1H, dd, J = 10.0, 5.0 Hz) 14 77.32 3.53 (1H, m) 15 36.57 1.34 (1H, m) 1.47 (1H, m) 16 25.93 1.63 (1H, m) 17 48.75 1.68 (1H, m) 2.35 (1H, m) 18 141.35 19 122.25 5.05 (1H, d, J = 5.0 Hz) 20 55.65 3.21 (1H, d, J = 5.0 Hz) 21 215.46 22 42.11 2.21 (1H, br d, J = 15 Hz) 2.66 (1H, br d, J = 15 Hz) 23 69.83 3.97 (1H, m) 24 40.59 1.87 (1H, m) 25 76.77 5.19 (1H, br s) 26 132.68 27 128.99 4.97 (1H, d, J = 5.0 Hz) 28 35.12 2.27 (1H, m) 29 35.12 0.95 (1H, m) 2.02 (1H, m) 30 84.44 3.00 (1H, m) 31 73.62 3.39 (1H, m) 32 31.44 1.34 (1H, m) 1.98 (1H, m) 33 30.92 1.03 (1H, m) 1.61 (1H, m) 34 25.12 1.52 (1H, m) 1.72 (1H, m) 35 12.01 0.88 (3H, t, J = 7.5 Hz) 36 17.14 0.93 (3H, d, J = 5 Hz) 37 19.09 0.78 (3H, d, J = 5 Hz) 38 15.76 1.66 (3H, s) 39 10.02 0.89 (3H, d, J = 5 Hz) 40 14.75 1.69 (3H, s) 41 56.37 3.37 (3H, s) 42 57.91 3.37 (3H, s) 43 56.81 3.41 (3H, s)

^{From 1} H, ¹³ C-NMR and gHSQC data, a total of 43 carbon atoms were identified in a very similar form, but methoxy (δ _H 3.41, δ _C 56.81) was additionally observed, and a structure in which one CH ₂ functional group was observed less is observed. It was confirmed that it is isomer. As a result of confirming the connection of the proton from gCOSY, the pipecolyl skeleton of the compound was observed from the coupling between H-2 and H-5, and methyl groups (δ _H 0.88, δ _C 12.01) and CH ₂ (observed by triplet coupling from gHMBC) and CH ₂ ( Since δ _H 1.72, 1.52, δ _C 20.41) cross-correlate between C-21 (δ _H 1.72, 1.52, δ _C 20.41), ethyl in the form of FK520 rather than the propyl group of FK506 exists in C-21. Was confirmed. From this, compound 5 was structured with 9-deoxo-FK520.

Example 6: 31- O -demethyl-FK520 manufacture

Double cross-over homologous recombination according to the method described in Ban, YH et al. (J. Nat. Prod. 2013, 76, 1091-1098) for Streptomyces kanamyceticus, a strain producing FK506 ) is by-frame (in-frame) and the fkbM tcsB gene or fkbM and to lead to inactivation of the gene tcsD 31- O -demethyl-FK520-producing strain of Streptomyces by using the deletion method Kana Mai Shetty kusu ΔfkbM, tcsB (Accession No. KCTC13583BP) or Streptomyces kanamyceticus ΔfkbM, tcsD (Accession No. KCTC13584BP) was prepared.

Specifically, each gene was cloned into a pKC1139 vector and Escherichia coli in order to produce a deletion mutant of the fkbM and tcsB genes or a deletion mutant of the fkbM and tcsD genes in the Streptomyces kanamyceticus strain producing FK506. After transfer to ET12567 / pUZ8002, it was transformed into FK506 producing strain Streptomyces kanamyceticus through conjugation.

The method for producing a strain may be described in more detail as production of an in-frame gene deletion plasmid and production of a gene deletion strain.

The production of in-frame gene deletion plasmids ( E. coli - Streptomyces shuttle ) The vector pKC1139 was used for in-frame gene deletion. Plasmid production was accomplished by PCR amplification of left- and right-flanking fragments of target genes for deletion from Fosmid DNA derived from Streptomyces kanamyceticus. It was carried out. For deletion of the fkbM gene, the primer pair FkbMLF / FkbMLR of the left-neighbor segment and the primer pair FkbMRF / FkbMRR of the right-neighbor segment were designed, and for the deletion of the tcsB gene, the primer pair of the left-neighbor segment TcsBLF / TcsBLR, right- Primer pairs TcsBRF / TcsBRR of adjacent sections were designed. For deletion of the tcsD gene, the primer pair TcsDLF / TcsDLR of the left-adjacent segment and the primer pair TcsDRF / TcsDRR of the right-adjacent segment were designed. All of the PCR fragments were separated, cut with HindIII-XbaI or XbaI-EcoRI, and cloned into pKC1139 vector. Information about the strains, plasmids and primers used in this Example is presented in Table 1 and Table 2.

The plasmid used to construct the gene deletion strain is summarized in Table 1. The plasmid for removing 31- O -methyltransferase, pΔfkbM, was transferred to E. coli ET12567 / pUZ8002 and introduced into Streptomyces kanamyceticus by conjugation, thereby deleting the target gene by homologous recombination. Strains with a single cross between the deletion plasmid and the Streptomyces kanamyceticus chromosome were subdivided at 37 ° C with apramycin (non-proliferable temperature for pSG5-based replication unit (Replicon)). It was selected by cultivation of a pramycin-resistant transconjugant. The colonies thus secured were allowed to multiply three times without selection at 28 ° C to allow the second crossover. Two achieved double crossover mutations, ΔfkbM, were selected as apramycin-sensitive expression traits, then confirmed by PCR, and optionally confirmed by Southern block analysis.

The prepared fkbM gene was introduced into pΔtcsB or pΔtcsD in ΔfkbM of Streptomyces kanamyceticus deficient, and the tcsB gene or tcsD gene was deleted using the same method as the fkbM gene deletion method. ΔfkbM, tcsB or ΔfkbM, tcsD was selected as apramycin-sensitive expression trait, then confirmed by PCR, and optionally confirmed by Southern block analysis.

The produced fkbM and tcsB gene-deficient strains, Streptomyces kanamyceticus ΔfkbM, tcsB, were deposited with the Korea Institute of Bioscience and Biotechnology (Korean Collection for Type Cultures, KCTC) on July 17, 2018 (Accession No. KCTC13583BP ), fkbM and tcsD gene-deficient strains, Streptomyces kanamyceticus ΔfkbM, tcsD, were also deposited with the Korea Institute of Biotechnology and Biotechnology Resource Center (Korean Collection for Type Cultures, KCTC) on July 17, 2018 (Accession No. KCTC13584BP ).

31- O- demethyl-FK520 was prepared by culturing the above-produced production strain Streptomyces kanamyceticus ΔfkbM, tcsB (Accession No. KCTC13583BP) or Streptomyces kanamyceticus ΔfkbM, tcsD (Accession No. KCTC13584BP). . Specifically, it is as follows. 50 ml of R2YE medium (sucrose 103 g / L, glucose 10 g / L, potassium sulfate 0.25 g / L, magnesium chloride hexahydrate 10.12 g / L, cassamino in a 250 ml Baffled flask) Acid 0.1 g / L, yeast extract (10%) 50 ml / L, TES buffer (5.73%, pH 7.2) 100 ml / L, potassium phosphate (0.5%) 10 ml / L, calcium chloride dihydrate (3.68%) 80 ml / L, L-proline (20%) 15 ml / L, trace element solution 2 ml / L, sodium hydroxide (1 N) 5 ml / L) is added, and the production strain is inoculated, followed by rotary shaking Pre-incubation was performed for 2 days at 28 ° C. and 180 rpm in the incubator. Then, a 3 L Erlenmeyer flask to which 1 L of R2YE medium was added was inoculated with 10 ml of pre-cultured culture for two days. After inoculation, culture was performed for 6 days at 28 ° C and 180 rpm. After incubation for 6 days, 31- O- demethyl-FK520 produced through the primary recovery process was extracted.

The primary recovery process was carried out as follows. First, the same amount of methanol was added to the culture medium, mixed for 30 minutes, and then centrifuged to remove the cells. Concentration using a rotary evaporator was performed on the extracts from which the cells were removed. Then, the concentrated extract was dissolved in water, and after adding twice the volume of ethyl acetate (Ethyl acetate), the mixture was well mixed and then allowed to stand until layer separation. After the layers were separated, the organic solvent layer on the upper layer was collected, concentrated using a rotary evaporator, and weighed after concentration. The extract obtained by performing the first recovery process was passed through a column filled with silica gel. At this time, the amount of silica gel was used 15 times the weight of the extract from the primary recovery process, and the mobile phase was composed of 5 ratios of methanol and methylene chloride (fraction 1. 0: 100, partition 2. 1: 100, partition 3. 1:10, Fraction 4. 1: 1 and fraction 5. 100: 0) were used. In fraction 3, 31- O- demethyl-FK520 was identified. The obtained fraction 3 was concentrated using a rotary evaporator and finally purified using HPLC.

This was lyophilized to obtain 31- O- demethyl-FK520, a substance represented by [Formula 6] in powder form.

Confirmation of the prepared 31- O- demethyl-FK520 was performed as follows. Specifically, high performance liquid chromatography analysis (Mass spectrometry), nuclear magnetic resonance analysis (Nuclear magnetic resonance analysis) was performed. The analysis results for 31- O- demethyl-FK520 are summarized in Table 8 and FIGS. 31 to 36, and the production strains Streptomyces kanamyceticus ΔfkbM, tcsB or Streptomyces kanamyceticus produced from these results It was confirmed that 31- O- demethyl-FK520 was produced from ΔfkbM, tcsD.

The analysis results for 31- O- demethyl-FK520 (molecular formula C ₄₂ H ₆₇ NO ₁₂ , molecular weight 777.99) are shown in Table 8 below.

Method Analysis High performance liquid chromatography analysis As a mobile phase of HPLC, 45-55% acetonitrile aqueous solution was used, the flow rate was 1 ml / min, and analyzed with a UV detector of 205 nm.
The retention time of 31- O- demethyl-FK520 at this time was 34 minutes. Mass spectrometry (ESI-HR-MS) Calcd. for C ₄₂ H ₆₇ NNaO ₁₂ ⁺ : 800.4555, found: m / z 800.4561 Nuclear magnetic resonance analysis number carbon (ppm) proton (ppm) One 169.30 2 56.64 4.58 (1H, brd, J = 5.0 Hz) 3 27.92 2.05 (1H, m) 1.90 (1H, m) 4 21.42 1.38 (1H, m) 1.74 (1H, m) 5 24.54 1.51 (1H, m) 1.68 (1H, m) 6 39.58 3.03 (1H, m) 4.42 (1H, m) 7 165.03 8 196.50 9 97.36 10 35.28 2.32 (1H, m) 11 33.01 1.52 (1H, m) 2.16 (1H, m) 12 73.92 3.39 (1H, m) 13 73.09 3.68 (1H, dd, J = 10.0, 5.0 Hz) 14 75.06 3.42 (1H, m) 15 35.79 1.35 (1H, m) 1.56 (1H, m) 16 26.67 1.66 (1H, m) 17 49.02 1.80 (1H, m) 2.17 (1H, m) 18 138.99 19 123.33 5.01 (1H, d, J = 5.0 Hz) 20 53.34 3.28 (1H, d, J = 5.0 Hz) 21 213.69 22 43.64 2.10 (1H, br d, J = 15 Hz) 2.77 (1H, br d, J = 15 Hz) 23 70.22 3.92 (1H, m) 24 39.97 1.89 (1H, m) 25 77.80 5.33 (1H, br s) 26 132.47 27 130.07 5.09 (1H, d, J = 5.0 Hz) 28 34.93 2.18 (1H, m) 29 39.36 1.14 (1H, m) 1.91 (1H, m) 30 75.64 3.57 (1H, m) 31 75.50 3.36 (1H, m) 32 32.36 1.35 (1H, m) 1.98 (1H, m) 33 31.23 1.06 (1H, m) 1.61 (1H, m) 34 24.78 1.45 (1H, m) 1.72 (1H, m) 35 11.91 0.86 (3H, t, J = 7.5 Hz) 36 16.41 0.99 (3H, d, J = 5 Hz) 37 20.66 0.93 (3H, d, J = 5 Hz) 38 16.02 1.59 (3H, s) 39 9.71 0.90 (3H, d, J = 5 Hz) 40 14.20 1.62 (3H, s) 41 56.55 3.38 (3H, s)

Compound 6 identified with a molecular weight of 800.4563 showed very similar molecular weights of 800.4924 and 800.4927, but from ¹ H, ¹³ C-NMR and gHSQC data, it was confirmed that the total number of carbon atoms was 42 and the less methoxy group was one carbon. And ketone carbon (δ _C 196.50). As a result of synthesizing 2D-NMR data, the structure was determined with 31- O- demethyl-FK520.

Example 7: 9-deoxo-31- O -demethyl-FK520 manufacture

Double cross-over homologous recombination according to the method described in Ban, YH et al. (J. Nat. Prod. 2013, 76, 1091-1098) for Streptomyces kanamyceticus, a strain producing FK506 Strepto, a production strain of 9-deoxo-31- O- demethyl-FK520, resulting in inactivation of the fkbD-fkbM and tcsB genes or the fkbD-fkbM and tcsD genes using the in-frame deletion method by Myces kanamyceticus ΔfkbD-fkbM, tcsB (Accession No. KCTC13582BP) or Streptomyces kanamyceticus ΔfkbD-fkbM, tcsD (Accession No. KCTC13585BP) was prepared.

More specifically, the cloning of the respective genes to pKC1139 vector to from Streptomyces Kana Mai Shetty kusu strain producing FK506 to produce a defect mutant of defect or fkbD-fkbM and tcsD genes fkbD-fkbM and tcsB gene After transferring to Escherichia coli ET12567 / pUZ8002, it was transformed into the FK506 producing strain Streptomyces kanamyceticus through conjugation.

The method for producing a strain may be described in more detail as production of an in-frame gene deletion plasmid and production of a gene deletion strain.

The production of in-frame gene deletion plasmids ( E. coli - Streptomyces shuttle ) The vector pKC1139 was used for in-frame gene deletion. Plasmid production was accomplished by PCR amplification of left- and right-flanking fragments of target genes for deletion from Fosmid DNA derived from Streptomyces kanamyceticus. It was carried out. For deletion of the fkbD-fkbM gene, the primer pair FkbD-MLF / FkbD-MLR of the left-adjacent segment and the primer pair FkbD-MRF / FkbD-MRR of the right-adjacent segment were designed. For deletion of the tcsB gene, the primer pair TcsBLF / TcsBLR of the left-neighbor segment and the primer pair TcsBRF / TcsBRR of the right-neighbor segment were designed, and for the deletion of the tcsD gene, the primer pair TcsDLF / TcsDLR of the left-neighbor segment, right- Primer pairs TcsDRF / TcsDRR of adjacent sections were designed. All of the PCR fragments were separated, cut with HindIII-XbaI or XbaI-EcoRI, and cloned into pKC1139 vector. Information about the strains, plasmids and primers used in this Example is presented in Table 1 and Table 2.

The plasmid used to construct the gene deletion strain is summarized in Table 1. The plasmid for removing C9 hydroxylase (Hydroxylase) and 31- O -methyltransferase together, pΔfkbD-fkbM, was transferred to E. coli ET12567 / pUZ8002 and introduced into Streptomyces kanamyceticus by conjugation to target genes. It was deleted by homologous recombination. Strains with a single cross between the deletion plasmid and the Streptomyces kanamyceticus chromosome were subdivided at 37 ° C with apramycin (non-proliferable temperature for pSG5-based replication unit (Replicon)). It was selected by cultivation of a pramycin-resistant transconjugant. The colonies thus secured were allowed to multiply three times without selection at 28 ° C to allow the second crossover. Two achieved double crossover mutations, ΔfkbD-fkbM, were selected as apramycin-sensitive expression traits, then confirmed by PCR, and optionally confirmed by Southern block analysis.

The prepared fkbD-fkbM gene was deleted by introducing pΔtcsB or p △ tcsD into ΔfkbD-fkbM of Streptomyces kanamyceticus, and the tcsB gene or tcsD gene was deleted using the same method as the fkbD-fkbM gene deletion method. . ΔfkbD-fkbM, tcsB or ΔfkbD-fkbM, tcsD was selected as apramycin-sensitive expression trait, then confirmed by PCR, and optionally by Southern block analysis.

The produced fkbD-fkbM and tcsB gene-deficient strains, Streptomyces kanamyceticus ΔfkbD-fkbM, tcsB, were deposited with the Korean Collection for Type Cultures (KCTC) on July 17, 2018. (Accession No. KCTC13582BP), fkbD-fkbM and tcsD gene-deficient strains Streptomyces kanamyceticus ΔfkbD-fkbM, tcsD were also published at the Korea Collection for Type Cultures (KCTC) on July 17, 2018. Deposited on the date (Accession No. KCTC13585BP).

9-deoxo-31-through culture of the above-produced production strain Streptomyces kanamyceticus ΔfkbD-fkbM, tcsB (Accession No. KCTC13582BP) or Streptomyces kanamyceticus ΔfkbD-fkbM, tcsD (Accession No. KCTC13585BP) O- demethyl-FK520 was prepared. Specifically, it is as follows. 50 ml of R2YE medium (sucrose 103 g / L, glucose 10 g / L, potassium sulfate 0.25 g / L, magnesium chloride hexahydrate 10.12 g / L, cassamino in a 250 ml Baffled flask) Acid 0.1 g / L, yeast extract (10%) 50 ml / L, TES buffer (5.73%, pH 7.2) 100 ml / L, potassium phosphate (0.5%) 10 ml / L, calcium chloride dihydrate (3.68%) 80 ml / L, L-proline (20%) 15 ml / L, trace element solution 2 ml / L, sodium hydroxide (1 N) 5 ml / L) is added, and the production strain is inoculated, followed by rotary shaking Pre-incubation was performed for 2 days at 28 ° C. and 180 rpm in the incubator. Then, a 3 L Erlenmeyer flask to which 1 L of R2YE medium was added was inoculated with 10 ml of pre-cultured culture for two days. After inoculation, culture was performed for 6 days at 28 ° C and 180 rpm. After incubation for 6 days, 9-deoxo-31- O- demethyl-FK520 produced through the primary recovery process was extracted.

The primary recovery process was carried out as follows. First, the same amount of methanol was added to the culture medium, mixed for 30 minutes, and then centrifuged to remove the cells. Concentration using a rotary evaporator was performed on the extracts from which the cells were removed. Then, the concentrated extract was dissolved in water, and after adding twice the volume of ethyl acetate (Ethyl acetate), the mixture was well mixed and then allowed to stand until layer separation. After the layers were separated, the organic solvent layer on the upper layer was collected, concentrated using a rotary evaporator, and weighed after concentration. The extract obtained by performing the first recovery process was passed through a column filled with silica gel. At this time, the amount of silica gel was used 15 times the weight of the extract from the primary recovery process, and the mobile phase was composed of 5 ratios of methanol and methylene chloride (fraction 1. 0: 100, partition 2. 1: 100, partition 3. 1:10, Fraction 4. 1: 1 and fraction 5. 100: 0) were used. In fraction 3, 9-deoxo-31- O- demethyl-FK520 was identified. The obtained fraction 3 was concentrated using a rotary evaporator and finally purified using HPLC.

This was lyophilized to obtain 9-deoxo-31- O- demethyl-FK520, a substance represented by [Formula 7] in powder form.

Confirmation of the prepared 9-deoxo-31- O- demethyl-FK520 was performed as follows. Specifically, high performance liquid chromatography analysis (Mass spectrometry), nuclear magnetic resonance analysis (Nuclear magnetic resonance analysis) was performed. The results of the analysis for 9-deoxo-31- O- demethyl-FK520 are summarized in Table 9 and FIGS. 37 to 42, and the production strains Streptomyces kanamyceticus ΔfkbD-fkbM, tcsB or strepto produced from these results It was confirmed that 9-deoxo-31- O- demethyl-FK520 was produced from ΔfkbD-fkbM, tcsD of Myces Kanamyceticus.

The results of the analysis for 9-deoxo-31- O- demethyl-FK520 (molecular formula C ₄₂ H ₆₉ NO ₁₁ , molecular weight 764.01) are shown in Table 9 below.

Method Analysis High performance liquid chromatography analysis As a mobile phase of HPLC, 45-55% acetonitrile aqueous solution was used, the flow rate was 1 ml / min, and analyzed with a UV detector of 205 nm. The retention time of 9-deoxo-31- O- demethyl-FK520 at this time was 24 minutes. Mass spectrometry (ESI-HR-MS) Calcd. for C ₄₂ H ₆₉ NNaO ₁₁ ⁺ : 786.4763, found: m / z 786.4769 Nuclear magnetic resonance analysis number carbon (ppm) proton (ppm) One 169.65 2 52.86 4.87 (1H, brd, J = 5.0 Hz) 3 26.86 1.70 (1H, m) 2.23 (1H, m) 4 20.95 1.32 (1H, m) 1.72 (1H, m) 5 24.69 1.52 (1H, m) 1.68 (1H, m) 6 42.97 3.19 (1H, m) 3.70 (1H, m) 7 174.27 8 37.54 2.49 (1H, d, J = 15.0 Hz) 2.67 (1H, d, J = 15.0 Hz) 9 98.76 10 38.78 1.56 (1H, m) 11 32.86 1.60 (1H, m) 1.94 (1H, m) 12 74.61 3.41 (1H, m) 13 70.92 3.86 (1H, dd, J = 10.0, 5.0 Hz) 14 77.21 3.53 (1H, m) 15 36.57 1.34 (1H, m) 1.47 (1H, m) 16 25.93 1.63 (1H, m) 17 48.49 1.64 (1H, m) 2.33 (1H, m) 18 141.30 19 122.26 5.05 (1H, d, J = 5.0 Hz) 20 55.66 3.20 (1H, d, J = 5.0 Hz) 21 215.35 22 42.20 2.20 (1H, br d, J = 15 Hz) 2.64 (1H, br d, J = 15 Hz) 23 69.82 3.98 (1H, m) 24 40.05 1.85 (1H, m) 25 76.90 5.20 (1H, br s) 26 132.76 27 128.90 4.97 (1H, d, J = 5.0 Hz) 28 35.29 2.32 (1H, m) 29 39.45 1.12 (1H, m) 1.88 (1H, m) 30 75.22 3.53 (1H, m) 31 75.22 3.40 (1H, m) 32 32.32 1.33 (1H, m) 1.95 (1H, m) 33 31.19 1.04 (1H, m) 1.59 (1H, m) 34 25.13 1.52 (1H, m) 1.68 (1H, m) 35 12.00 0.88 (3H, t, J = 7.5 Hz) 36 17.14 0.95 (3H, d, J = 5 Hz) 37 19.09 0.77 (3H, d, J = 5 Hz) 38 15.77 1.65 (3H, s) 39 9.98 0.86 (3H, d, J = 5 Hz) 40 14.68 1.67 (3H, s) 41 56.37 3.38 (3H, s)

^{From 1} H, ¹³ C-NMR and gHSQC data, a total of 42 carbon atoms showed similar results to 31- O- demethyl-FK520, but a CH ₂ functional group made from the ΔfkbD-fkbM gene (δ _H 2.67, 2.49, δ _C 37.54 ) Was observed. As a result of synthesizing 2D-NMR data, compound 7 was structurally determined to be 9-deoxo-31- O- demethyl-FK520.

Example 8: Preparation of 9-deoxo-FK523

Double cross-over homologous recombination according to the method described in Ban, YH et al. (J. Nat. Prod. 2013, 76, 1091-1098) for Streptomyces kanamyceticus, a strain producing FK506 Streptomyces kanamyceticus ΔfkbD, tcsB (Accession No. KCTC13579BP), a production strain of 9-deoxo-FK523, is caused by inactivation of the fkbD and tcsB genes using the in-frame deletion method by). It was produced.

Specifically, each gene was cloned into a pKC1139 vector and transferred to Escherichia coli ET12567 / pUZ8002 in order to construct a mutant of the fkbD and tcsB genes in a strain of Streptomyces kanamyceticus producing FK506, and then transferred to a conjugation ( Conjugation) was transformed into Streptomyces kanamyceticus, a FK506 production strain.

The method for producing a strain may be described in more detail as production of an in-frame gene deletion plasmid and production of a gene deletion strain.

The production of in-frame gene deletion plasmids ( E. coli - Streptomyces shuttle ) The vector pKC1139 was used for in-frame gene deletion. Plasmid production was accomplished by PCR amplification of left- and right-flanking fragments of target genes for deletion from Fosmid DNA derived from Streptomyces kanamyceticus. It was carried out. For deletion of the fkbD gene, the primer pair FkbDLF / FkbDLR of the left-adjacent segment and the primer pair FkbDRF / FkbDRR of the right-adjacent segment were designed, and for the deletion of the tcsB gene, the primer pair of the left-adjacent segment TcsBLF / TcsBLR, right- Primer pairs TcsBRF / TcsBRR of adjacent sections were designed. All of the PCR fragments were separated, cut with HindIII-XbaI or XbaI-EcoRI, and cloned into pKC1139 vector. Information about the strains, plasmids and primers used in this Example is presented in Table 1 and Table 2.

The plasmid used to construct the gene deletion strain is summarized in Table 1. The plasmid, pΔfkbD, for removing C9 hydroxylase (Hydroxylase) was transferred to Escherichia coli ET12567 / pUZ8002 and introduced into Streptomyces kanamyceticus by conjugation, thereby deleting the target gene by homologous recombination. Strains with a single cross between the deletion plasmid and the Streptomyces kanamyceticus chromosome were subdivided at 37 ° C with apramycin (non-proliferable temperature for pSG5-based replication unit (Replicon)). It was selected by cultivation of a pramycin-resistant transconjugant. The colonies thus secured were allowed to multiply three times without selection at 28 ° C to allow the second crossover. The two achieved double crossover mutations, ΔfkbD, were selected as apramycin-sensitive expression traits, then confirmed by PCR, and optionally confirmed by Southern block analysis.

By introducing a p △ tcsB the produced fkbD gene defect Streptomyces Kana Mai Shetty kusu ΔfkbD, using the same method as fkbD gene-deficient deletion method was the tcsB gene. ΔfkbD, tcsB was selected as the expression trait of apramycin-sensitivity, then confirmed by PCR, and optionally confirmed by Southern block analysis.

The produced fkbD and tcsB gene-deficient strains, Streptomyces kanamyceticus ΔfkbD, tcsB, were deposited with the Korea Institute of Bioscience and Biotechnology (Korean Collection for Type Cultures, KCTC) on July 17, 2018 (Accession No. KCTC13579BP ).

9-deoxo-FK523 was prepared through cultivation of the produced strain Strepttomyces kanamyceticus ΔfkbD, tcsB (Accession No. KCTC13579BP). Specifically, it is as follows. 50 ml of R2YE medium (sucrose 103 g / L, glucose 10 g / L, potassium sulfate 0.25 g / L, magnesium chloride hexahydrate 10.12 g / L, cassamino in a 250 ml Baffled flask) Acid 0.1 g / L, yeast extract (10%) 50 ml / L, TES buffer (5.73%, pH 7.2) 100 ml / L, potassium phosphate (0.5%) 10 ml / L, calcium chloride dihydrate (3.68%) 80 ml / L, L-proline (20%) 15 ml / L, trace element solution 2 ml / L, sodium hydroxide (1 N) 5 ml / L) is added, and the production strain is inoculated, followed by rotary shaking Pre-incubation was performed for 2 days at 28 ° C. and 180 rpm in the incubator. Then, a 3 L Erlenmeyer flask to which 1 L of R2YE medium was added was inoculated with 10 ml of pre-cultured culture for two days. After inoculation, culture was performed for 6 days at 28 ° C and 180 rpm. After incubation for 6 days, 9-deoxo-FK523 produced through the primary recovery process was extracted.

The primary recovery process was carried out as follows. First, the same amount of methanol was added to the culture medium, mixed for 30 minutes, and then centrifuged to remove the cells. Concentration using a rotary evaporator was performed on the extracts from which the cells were removed. Then, the concentrated extract was dissolved in water, and after adding twice the volume of ethyl acetate (Ethyl acetate), mixed well and left until layer separation. After the layers were separated, the organic solvent layer on the upper layer was collected, concentrated using a rotary evaporator, and weighed after concentration. The extract obtained by performing the first recovery process was passed through a column filled with silica gel. At this time, the amount of silica gel was used 15 times the weight of the extract from the primary recovery process, and the mobile phase was composed of 5 ratios of methanol and methylene chloride (fraction 1. 0: 100, partition 2. 1: 100, partition 3. 1:10, Fraction 4. 1: 1 and fraction 5. 100: 0) were used. In fraction 3, 9-deoxo-FK523 was identified. The obtained fraction 3 was concentrated using a rotary evaporator and finally purified using HPLC.

This was lyophilized to obtain 9-deoxo-FK523, a substance represented by [Formula 8] in powder form.

Confirmation of the prepared 9-deoxo-FK523 was performed as follows. Specifically, high performance liquid chromatography analysis (Mass spectrometry), nuclear magnetic resonance analysis (Nuclear magnetic resonance analysis) was performed. The analysis results for 9-deoxo-FK523 are summarized in Table 10 and FIGS. 43 to 48, and it is confirmed that 9-deoxo-FK523 is produced from the production strain Streptomyces kanamyceticus ΔfkbD, tcsB produced from these results. Could.

The results of the analysis for 9-deoxo-FK523 (molecular formula C ₄₂ H ₆₉ NO ₁₁ , molecular weight 764.01) are shown in Table 10 below.

Method Analysis High performance liquid chromatography analysis As a mobile phase of HPLC, 45-55% acetonitrile aqueous solution was used, the flow rate was 1 ml / min, and analyzed with a UV detector of 205 nm. The retention time of 9-deoxo-FK523 at this time was 24 minutes. Mass spectrometry (ESI-HR-MS) Calcd. for C ₄₂ H ₆₉ NNaO ₁₁ ⁺ : 786.4763, found: m / z 786.4769 Nuclear magnetic resonance analysis number carbon (ppm) proton (ppm) One 169.61 2 52.59 4.85 (1H, brd, J = 5.0 Hz) 3 26.87 1.70 (1H, m) 2.24 (1H, m) 4 20.70 1.31 (1H, m) 1.72 (1H, m) 5 24.42 1.51 (1H, m) 1.68 (1H, m) 6 42.65 3.19 (1H, m) 3.69 (1H, m) 7 174.23 8 36.25 2.51 (1H, d, J = 15.0 Hz) 2.70 (1H, d, J = 15.0 Hz) 9 98.70 10 38.72 1.58 (1H, m) 11 32.84 1.60 (1H, m) 1.94 (1H, m) 12 74.60 3.40 (1H, m) 13 70.90 3.86 (1H, dd, J = 10.0, 5.0 Hz) 14 77.11 3.53 (1H, m) 15 36.48 1.34 (1H, m) 1.47 (1H, m) 16 26.30 1.50 (1H, m) 17 48.49 1.65 (1H, m)
2.32 (1H, m) 18 140.43 19 123.48 5.17 (1H, d, J = 5.0 Hz) 20 53.45 3.21 (1H, d, J = 5.0 Hz) 21 215.35 22 41.74 2.21 (1H, br d, J = 15 Hz) 2.66 (1H, br d, J = 15 Hz) 23 69.99 4.01 (1H, m) 24 40.68 1.90 (1H, m) 25 76.62 5.22 (1H, br s) 26 132.71 27 128.92 4.98 (1H, d, J = 5.0 Hz) 28 35.13 2.35 (1H, m) 29 35.13 0.93 (1H, m) 2.01 (1H, m) 30 84.43 3.00 (1H, m) 31 73.80 3.39 (1H, m) 32 32.87 1.34 (1H, m) 1.98 (1H, m) 33 31.44 1.06 (1H, m) 1.61 (1H, m) 34 17.13 1.18 (3H, d, J = 5 Hz) 35 17.13 0.96 (3H, d, J = 5 Hz) 36 18.87 0.78 (3H, d, J = 5 Hz) 37 16.08 1.63 (3H, s) 38 10.12 0.90 (3H, d, J = 5 Hz) 39 14.79 1.66 (3H, s) 40 56.38 3.37 (3H, s) 41 57.90 3.37 (3H, s)

9-deoxo-31- O -demethyl-FK520 It has the same molecular weight as the molecular weight. From ¹ H, ¹³ C-NMR and gHSQC data, a total of 42 carbon atoms was confirmed in a very similar form, but 9-deoxo-31- O Unlike -demethyl-FK520, methoxy (δ _H 3.41, δ _C 56.81) was additionally observed, and it was confirmed that less than one CH ₂ functional group was a structural isomer. As a result of confirming the connection of the proton from gCOSY, the pipecolyl backbone was identified from the coupling between H-2 and H-5, and the methyl group (δ _H 1.18, δ _C 17.13) observed by doublet coupling from gHMBC was C-21. From the correlation between (δ _H 3.21 and δ _C 53.45), it was confirmed that methyl in the form of FK523 exists in C-21. From this, the structure was determined with 9-deoxo-FK523.

Example 9: 9-deoxo-31- O -demethyl-FK523 manufacture

Double cross-over homologous recombination according to the method described in Ban, YH et al. (J. Nat. Prod. 2013, 76, 1091-1098) for Streptomyces kanamyceticus, a strain producing FK506 frame (in-frame) by using a deletion method fkbD-fkbM and to lead to inactivation of the gene tcsB 9-deoxo-31- O -demethyl- FK523 -producing strain of Streptomyces Kana Mai Shetty kusu ΔfkbD of -) by the -fkbM, tcsB (Accession No. KCTC13582BP) was produced.

Specifically, each gene was cloned into a pKC1139 vector and transferred to Escherichia coli ET12567 / pUZ8002, in order to prepare a deletion mutant of the fkbD-fkbM and tcsB genes in a strain of Streptomyces kanamyceticus producing FK506, and then transferred to Escherichia coli ET12567 / pUZ8002, It was transformed into the FK506 production strain Streptomyces kanamyceticus through conjugation.

The method for producing a strain may be described in more detail as production of an in-frame gene deletion plasmid and production of a gene deletion strain.

The production of in-frame gene deletion plasmids ( E. coli - Streptomyces shuttle ) The vector pKC1139 was used for in-frame gene deletion. Plasmid production was accomplished by PCR amplification of left- and right-flanking fragments of target genes for deletion from Fosmid DNA derived from Streptomyces kanamyceticus. It was carried out. For deletion of the fkbD-fkbM gene, the primer pair FkbD-MLF / FkbD-MLR of the left-adjacent segment and the primer pair FkbD-MRF / FkbD-MRR of the right-adjacent segment were designed. For deletion of the tcsB gene, a primer pair TcsBLF / TcsBLR of the left-adjacent segment and a primer pair TcsBRF / TcsBRR of the right-adjacent segment were designed. All of the PCR fragments were separated, cut with HindIII-XbaI or XbaI-EcoRI, and cloned into pKC1139 vector. Information about the strains, plasmids and primers used in this Example is presented in Table 1 and Table 2.

The plasmid used to construct the gene deletion strain is summarized in Table 1. The plasmid for removing C9 hydroxylase (Hydroxylase) and 31- O -methyltransferase together, pΔfkbD-fkbM, is transferred to Escherichia coli ET12567 / pUZ8002 and introduced into Streptomyces kanamyceticus by conjugation to target genes. It was deleted by homologous recombination. Strains with a single cross between the deletion plasmid and the Streptomyces kanamyceticus chromosome were subdivided at 37 ° C with apramycin (non-proliferable temperature for pSG5-based replication unit (Replicon)). It was selected by cultivation of a pramycin-resistant transconjugant. The colonies thus secured were allowed to multiply three times without selection at 28 ° C to allow the second crossover. Two achieved double crossover mutations, ΔfkbD-fkbM, were selected as apramycin-sensitive expression traits, then confirmed by PCR, and optionally confirmed by Southern block analysis.

The prepared fkbD-fkbM gene was introduced into pΔtcsB into ΔfkbD-fkbM of Streptomyces kanamyceticus deficient, and the tcsB gene was deleted using the same method as the fkbD-fkbM gene deletion method. ΔfkbD-fkbM, tcsB was selected as the expression trait of apramycin-sensitivity, then confirmed by PCR, and optionally confirmed by Southern block analysis.

The produced fkbD-fkbM and tcsB gene-deficient strains, Streptomyces kanamyceticus ΔfkbD-fkbM, tcsB, were deposited with the Korean Collection for Type Cultures (KCTC) on July 17, 2018. (Accession number KCTC13582BP).

9-deoxo-31- O- demethyl-FK523 was prepared through cultivation of the produced strain S. pneumoniae kanamyceticus ΔfkbD-fkbM, tcsB (Accession No. KCTC13582BP). Specifically, it is as follows. 50 ml of R2YE medium (sucrose 103 g / L, glucose 10 g / L, potassium sulfate 0.25 g / L, magnesium chloride hexahydrate 10.12 g / L, cassamino in a 250 ml Baffled flask) Acid 0.1 g / L, yeast extract (10%) 50 ml / L, TES buffer (5.73%, pH 7.2) 100 ml / L, potassium phosphate (0.5%) 10 ml / L, calcium chloride dihydrate (3.68%) 80 ml / L, L-proline (20%) 15 ml / L, trace element solution 2 ml / L, sodium hydroxide (1 N) 5 ml / L) is added, and the production strain is inoculated, followed by rotary shaking Pre-incubation was performed for 2 days at 28 ° C. and 180 rpm in the incubator. Then, a 3 L Erlenmeyer flask to which 1 L of R2YE medium was added was inoculated with 10 ml of pre-cultured culture for two days. After inoculation, culture was performed for 6 days at 28 ° C and 180 rpm. After incubation for 6 days, 9-deoxo-31- O- demethyl-FK523 produced through the primary recovery process was extracted.

The primary recovery process was carried out as follows. First, the same amount of methanol was added to the culture medium, mixed for 30 minutes, and then centrifuged to remove the cells. Concentration using a rotary evaporator was performed on the extracts from which the cells were removed. Then, the concentrated extract was dissolved in water, and after adding twice the volume of ethyl acetate (Ethyl acetate), the mixture was well mixed and then allowed to stand until layer separation. After the layers were separated, the organic solvent layer on the upper layer was collected, concentrated using a rotary evaporator, and weighed after concentration. The extract obtained by performing the first recovery process was passed through a column filled with silica gel. At this time, the amount of silica gel was used 15 times the weight of the extract from the primary recovery process, and the mobile phase was composed of 5 ratios of methanol and methylene chloride (fraction 1. 0: 100, partition 2. 1: 100, partition 3. 1:10, Fraction 4. 1: 1 and fraction 5. 100: 0) were used. In fraction 3, 9-deoxo-31- O- demethyl-FK523 was identified. The obtained fraction 3 was concentrated using a rotary evaporator and finally purified using HPLC.

This was lyophilized to obtain 9-deoxo-31- O- demethyl-FK523, a substance represented by [Formula 9] in powder form.

Confirmation of the prepared 9-deoxo-31- O- demethyl-FK523 was performed as follows. Specifically, high performance liquid chromatography analysis (Mass spectrometry), nuclear magnetic resonance analysis (Nuclear magnetic resonance analysis) was performed. The analysis results for 9-deoxo-31- O- demethyl-FK523 are summarized in Table 11 and FIGS. 49 to 54, and the production strains Streptomyces kanamyceticus ΔfkbD-fkbM, tcsB produced from these results are 9 It was confirmed that -deoxo-31- O -demethyl-FK523 was produced.

The results of the analysis for 9-deoxo-31- O- demethyl-FK523 (molecular formula C ₄₁ H ₆₇ NO ₁₁ , molecular weight 752.01) are shown in Table 11 below.

Method Analysis High performance liquid chromatography analysis As a mobile phase of HPLC, 45-55% acetonitrile aqueous solution was used, the flow rate was 1 ml / min, and analyzed with a UV detector of 205 nm. The retention time of 9-deoxo-31- O- demethyl-FK523 at this time was 17 minutes. Mass spectrometry (ESI-HR-MS) Calcd. for C ₄₁ H ₆₇ NNaO ₁₁ ⁺ : 772.4606, found: m / z 772.4612 Nuclear magnetic resonance analysis number carbon (ppm) proton (ppm) One 169.63 2 52.83 4.90 (1H, brd, J = 5.0 Hz) 3 26.88 1.70 (1H, m) 2.24 (1H, m) 4 20.70 1.31 (1H, m) 1.72 (1H, m) 5 24.70 1.51 (1H, m) 1.68 (1H, m) 6 42.89 3.21 (1H, m) 3.72 (1H, m) 7 174.26 8 36.25 2.51 (1H, d, J = 15.0 Hz) 2.70 (1H, d, J = 15.0 Hz) 9 98.70 10 38.72 1.58 (1H, m) 11 32.86 1.60 (1H, m) 1.94 (1H, m) 12 74.59 3.40 (1H, m) 13 70.90 3.86 (1H, dd, J = 10.0, 5.0 Hz) 14 77.11 3.53 (1H, m) 15 36.48 1.34 (1H, m) 1.47 (1H, m) 16 26.30 1.50 (1H, m) 17 48.37 1.65 (1H, m) 2.32 (1H, m) 18 140.38 19 123.50 5.17 (1H, d, J = 5.0 Hz) 20 48.04 3.21 (1H, d, J = 5.0 Hz) 21 215.35 22 41.79 2.21 (1H, br d, J = 15 Hz) 2.66 (1H, brd, J = 15 Hz) 23 69.99 4.01 (1H, m) 24 40.60 1.90 (1H, m) 25 76.70 5.22 (1H, br s) 26 132.80 27 128.83 4.98 (1H, d, J = 5.0 Hz) 28 35.21 2.35 (1H, m) 29 39.38 1.17 (1H, m) 1.91 (1H, m) 30 75.71 3.43 (1H, m) 31 75.17 3.36 (1H, m) 32 32.24 1.34 (1H, m) 1.98 (1H, m) 33 31.20 1.06 (1H, m) 1.61 (1H, m) 34 17.09 1.18 (3H, d, J = 5 Hz) 35 17.13 0.96 (3H, d, J = 5 Hz) 36 18.86 0.78 (3H, d, J = 5 Hz) 37 16.09 1.66 (3H, s) 38 10.08 0.88 (3H, d, J = 5 Hz) 39 14.73 1.67 (3H, s) 40 56.38 3.37 (3H, s) 41 57.90 3.37 (3H, s)

^{From the 1} H, ¹³ C-NMR and gHSQC data, it was found that, unlike 9-deoxo-FK523, with a total of 41 carbon atoms, 1 methoxy was lacking. Along with this, a CH ₂ functional group (δ _H 2.70, 2.51, δ _C 36.25) made from the ΔfkbD-fkbM gene was observed. As a result of synthesizing 2D-NMR data, the structure was determined to be 9-deoxo-31- O- demethyl-FK523.

Example 10: Investigation of immunosuppressive activity of 9 new compounds

The degree of immunosuppressive activity reduction of 9 novel compounds was investigated using a conventional in vitro T-cell activity assay (J. Immunol. 143: 718-726, 1989). Cleavage of CD4 + T cells is an indicator that an immune response is taking place. CD4 + T cells are stained with Cell Trace ^TM Violet (CTV), and when cells divide according to the immune response, CTV of each cell proliferates. As a phenomenon in which the retention amount decreases, the degree of immunosuppressive activity was investigated using this as an indicator.

Single cells were detached from spleens of 6-8 weeks old B6J experimental mice and CD4 + T cells were separated using MagniSort ^® Mouse CD4 T cell Enrichment Kit (eBioscience). CD4 + T cells were stained with Cell Trace ^TM Violet (CTV) Cell Proliferation Kit (Molecular Probes) and FK506 or 9 new compounds were 0.01 ng / ml, 0.1 ng / ml, 1 ng / ml, 10 ng / ml, 100 ng / ml, added to a concentration of 1000 ng / ml, and then incubated for 72 hours. For activation of T cells, Dynabeads ^® Mouse T-Activator CD3 / CD28 (Gibco) was used. As a control, inactivated T cells were used. After incubation, CTV intensity was analyzed by flow cytometry.

Table 12 and FIG. 55 show the degree of T cell proliferation by measuring CTV intensity using a flow cytometer, and show the degree of immunosuppressive activity of FK506 and nine new compounds. As shown in Table 12 and FIG. 55, all the new compounds proposed in the present invention showed reduced immunosuppressive activity than FK506.

Structural analogs Immunosuppression
IC ₅₀ (ng / ml) FK506 0.027 9-deoxo-prolyl-FK506 268.3 9-deoxo-FK506 0.513 31- O- demethyl-FK506 0.246 9-deoxo-31- O -demethyl-FK506 15.09 9-deoxo-31- O -demethyl-prolyl-FK506 886.5 9-deoxo-36,37-dihydro-FK506 14.1 31- O- demethyl-36,37-dihydro-FK506 1.723 9-deoxo-31- O -demethyl-36,37-dihydro-FK506 45.87 9-deoxo-FK520 24.98 31- O- demethyl-FK520 3.273 9-deoxo-31- O -demethyl-FK520 258.1 9-deoxo-FK523 1985 9-deoxo-31- O -demethyl-FK523 3378

From these results, it was confirmed that 9 new compounds according to the present invention significantly reduced immunosuppressive activity compared to FK506, and as 9 new compounds showed a concentration of IC ₅₀ (ng / ml) of at least 100 times or more, It was confirmed that the immunosuppressive activity was significantly reduced. From this, it was determined that a pharmaceutical composition for preventing or treating fungal infections containing at least one selected from 9 new compounds as an active ingredient can be used without concern for side effects due to immunosuppressive activity.

Example 11: Investigation of antifungal activity of 9 new compounds ( in vitro )

The antifungal activity of 9 novel compounds of the present invention was investigated. Specifically, each of the nine new compounds was dissolved in 1 ml of castor oil solution [dehydrated ethanol: PEG40 castor oil (80: 20, v / v) (Sigma-Aldrich)] to prepare a test sample, which was used to investigate antifungal activity. Used. As a method for confirming the antifungal activity of 9 new compounds, 1) an EUCAST broth microdilution assay and 2) a test method for confirming growth inhibition were used. In detail, a microdilution method was used to investigate the degree of killing of fungi of Cryptococcus, fungi of Candida, and fungi of Aspergillus. Did. On the other hand, to assist the understanding of the present invention, a castor oil solution was used as a formulation example, but the above formulation examples are provided only to more easily understand the present invention, and the contents of the present invention are not limited by the formulation examples. .

1) EUCAST broth microdilution assay

A single colony of Cryptococcus neoformans and Aspergillus fumigatus grown in YPD agar medium at 30 ° C. for 20 hours was suspended in RPMI1640 medium, and a single colony of Candida albicans grown under the same conditions was FBS. Suspended in the medium. RPMI1640 medium suspension or FBS medium suspension containing 0.01 OD / ml of fungus was seeded in a 96-well micro dilution plate and then 100 μl volume of FK506 or 9 new compounds was added. The 96-well fine dilution plate was incubated at 35 ° C or 37 ° C for 48 hours, and then the degree of cell growth was measured by absorbance (OD ₆₀₀ ) to compare and evaluate antifungal activity. Table 13 shows the experimental results.

Structural analogs Cryptococcus neoformans Candida albicans Aspergillus fumigatus IC ₅₀
(μg / ml) 9-deoxo-31- O -demethyl-prolyl-FK506 221.1 3444 > 50 9-deoxo-36,37-dihydro-FK506 0.151 0.817 14.07 31-O-demethyl-36,37-dihydro-FK506 0.033 0.059 0.415 9-deoxo-31- O -demethyl-36,37-dihydro-FK506 8.846 4.264 > 50 9-deoxo-FK520 0.355 0.662 7.822 31- O -demethyl-FK520 0.027 0.079 12.21 9-deoxo-31- O -demethyl-FK520 3.297 2.847 306 9-deoxo-FK523 2.466 6.073 230 9-deoxo-31- O -demethyl-FK523 54.54 837 > 50

As a result of the above, it was found that 9 new compounds effectively inhibited the growth of Cryptococcus neoformans, Aspergillus fumigatus, and Candida albicans.

2) Test method for confirming the degree of growth inhibition

5,000 spores of Aspergillus fumigatus were suspended in 2 μl of YPD liquid medium, and then dropped 2 μl of the suspension on YPD agar medium containing FK506 or 9 new compounds at a concentration of 1 mg / L. Incubated for 2 days at ℃.

The results are presented in Figure 56. As can be seen in Figure 56, 9 new compounds of the present invention were able to inhibit the growth of Aspergillus fumigatus bacteria very effectively.

As a result of the above, 9 new compounds of the present invention can be said to have excellent antifungal activity, and from these conclusions, the composition for preventing or treating fungal infection including at least one of the 9 new compounds of the present invention as an active ingredient is a fungal infection disease. It was judged that it can be effectively used for treatment.

Example 12: Effect of 9 new compounds for fungal infection treatment ( in vivo )

The therapeutic effect of fungal infection of 9 new compounds prepared according to the present invention was investigated using a disease animal model. The disease animal model was created by infecting a 7-week-old ICR mouse with fungi of Cryptococcus and fungi of Candida, respectively, as in the conventional method (Table 14).

Fungi Strain Infection route Number of infected cells In Cryptococcus Cryptococcus neoformans Intravenous injection 1.0Х 10 ⁶ CFU / head Candida Candida albicans Intravenous injection 0.16Х 10 ⁶ CFU / head

9 new compounds to be administered to the diseased animal model are dissolved in 1 ml of castor oil solution [dehydrated ethanol: PEG40 castor oil (80: 20 v / v) (Sigma-Aldrich)] and 4 times at a dose of 5 mpk (1 Once daily). As an excipient control, castor oil solution was administered. The fungal infection treatment effect was investigated by examining the survival rate of mice for 14 days after fungal infection. On the other hand, although castor oil solution was used as a formulation example, the above formulation example is provided only for easier understanding of the present invention, and the contents of the present invention are not limited by the formulation example.

The antifungal activity in the disease animal model of 9 new compounds caused by infection of Cryptococcus fungi or Candida fungus is shown in Table 15.

Fungal infection model Strain Substance administered Survival rate (%) Average number of days of survival (days) In Cryptococcus Cryptococcus neoformans Excipient group 20 10.50 ± 0.97 9-deoxo-31- O -demethyl-prolyl-FK506 90 13.40 ± 0.60 9-deoxo-36,37-dihydro-FK506 80 13.70 ± 0.21 31- O -demethyl-36,37-dihydro-FK506 80 13.80 ± 0.13 9-deoxo-31- O -demethyl-36,37-dihydro-FK506 80 13.90 ± 0.10 9-deoxo-FK520 80 13.60 ± 0.50 31- O -demethyl-FK520 90 13.70 ± 0.21 9-deoxo-31- O -demethyl-FK520 80 13.80 ± 0.13 9-deoxo-FK523 90 13.40 ± 0.60 9-deoxo-31- O -demethyl-FK523 80 13.80 ± 0.13 Candida Candida albicans Excipient group 10 9.80 ± 0.89 9-deoxo-31-O-demethyl-prolyl-FK506 80 13.10 ± 0.64 9-deoxo-36,37-dihydro-FK506 70 11.60 ± 1.33 31-O-demethyl-36,37-dihydro-FK506 80 13.00 ± 0.20 9-deoxo-31-O-demethyl-36,37-dihydro-FK506 90 13.90 ± 0.10 9-deoxo-FK520 80 12.90 ± 0.90 31-O-demethyl-FK520 80 13.90 ± 0.70 9-deoxo-31-O-demethyl-FK520 70 11.60 ± 1.58 9-deoxo-FK523 80 13.60 ± 0.50 9-deoxo-31-O-demethyl-FK523 80 13.80 ± 0.13

From these results, it was found that the nine new compounds of the present invention are very effective in treating fungal infections. On the other hand, through Kaplan-Meier analysis, it was investigated whether 9 new compound administrations (treatment group) had statistically significant antifungal efficacy compared to administration of excipients (control group). Was analyzed. From the above description, those skilled in the art to which the present invention pertains will appreciate that the present invention may be implemented in other specific forms without changing its technical spirit or essential features. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of the present invention should be construed as including all changes or modifications derived from the meaning and scope of the following claims rather than the above detailed description and equivalent concepts thereof.

Korea Research Institute of Bioscience and Biotechnology (KCTC) KCTC13581BP 20180717 Korea Research Institute of Bioscience and Biotechnology (KCTC) KCTC13580BP 20180717 Korea Research Institute of Bioscience and Biotechnology (KCTC) KCTC13584BP 20180717 Korea Research Institute of Bioscience and Biotechnology (KCTC) KCTC13585BP 20180717 Korea Research Institute of Bioscience and Biotechnology (KCTC) KCTC13579BP 20180717 Korea Research Institute of Bioscience and Biotechnology (KCTC) KCTC13583BP 20180717 Korea Research Institute of Bioscience and Biotechnology (KCTC) KCTC13582BP 20180717

Claims (14)

9-deoxo-31- O- demethyl-prolyl-FK506 (9-deoxo-31- O -dimethyl-prolyl-FK506) represented by Formula 1 below, 9-deoxo-FK523 represented by Formula 8 below (9-deoxo-FK523), and any one selected from the group consisting of 9-deoxo-31- O- demethyl-FK523 (9-deoxo-31- O -dimethyl-FK523) represented by the following formula (9) A compound, or a pharmaceutical composition for preventing or treating fungal infection comprising a pharmaceutically acceptable salt thereof as an active ingredient:
[Formula 1]

[Formula 8]

[Formula 9]

.
The method according to claim 1, wherein the 9-deoxo-31- O- demethyl-prolyl-FK506 is produced through culture using Streptomyces kanamyceticus ΔfkbD-fkbM (Accession No. KCTC13581BP) as a production strain. Pharmaceutical composition for the prevention or treatment of fungal infections.
delete delete delete delete delete delete The method of claim 1, wherein the 9-deoxo-FK523 is produced by cultivation using Streptomyces kanamyceticus ΔfkbD, tcsB (Accession No. KCTC13579BP) as a production strain, pharmaceutical treatment for the prevention or treatment of fungal infections. Ever composition.
The method according to claim 1, wherein the 9-deoxo-31- O- demethyl-FK523 is produced by culturing Streptomyces kanamyceticus ΔfkbD-fkbM, tcsB (Accession No. KCTC13582BP) as a production strain. Pharmaceutical composition for the prevention or treatment of fungal infections.
The fungal infection of claim 1, wherein the fungi is one of Cryptococcus neoformans , Candida albicans , and Aspergillus fumigatus . Pharmaceutical composition for prevention or treatment.
9-deoxo-31- O- demethyl-prolyl-FK506 represented by Formula 1 below, 9-deoxo-FK523 represented by Formula 8 below, and 9-deoxo-31- O represented by Formula 9 below Demethyl-FK523 comprising the step of administering any one compound selected from the group consisting of, or a pharmaceutical composition for the prevention or treatment of fungal infection comprising a pharmaceutically acceptable salt thereof as an active ingredient Characterized in that, fungal infection treatment method:
[Formula 1]

[Formula 8]

[Formula 9]

.
9-deoxo-31- O- demethyl-prolyl-FK506 represented by Formula 1 below, 9-deoxo-FK523 represented by Formula 8 below, and 9-deoxo-31- O represented by Formula 9 below An antifungal composition comprising any compound selected from the group consisting of demethyl-FK523, or a pharmaceutically acceptable salt thereof as an active ingredient:
[Formula 1]

[Formula 8]

[Formula 9]

.
The antifungal composition according to claim 13, wherein the fungus is one of Cryptococcus neoformans , Candida albicans , and Aspergillus fumigatus .

Images