KR102074407B1 - Method for Diagnosing Alzheimer's disease Using microRNA-485-3p - Google Patents
Method for Diagnosing Alzheimer's disease Using microRNA-485-3p Download PDFInfo
- Publication number
- KR102074407B1 KR102074407B1 KR1020170147272A KR20170147272A KR102074407B1 KR 102074407 B1 KR102074407 B1 KR 102074407B1 KR 1020170147272 A KR1020170147272 A KR 1020170147272A KR 20170147272 A KR20170147272 A KR 20170147272A KR 102074407 B1 KR102074407 B1 KR 102074407B1
- Authority
- KR
- South Korea
- Prior art keywords
- mir
- hsa
- disease
- alzheimer
- brain
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
- G01N33/6896—Neurological disorders, e.g. Alzheimer's disease
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/46—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from vertebrates
- G01N2333/47—Assays involving proteins of known structure or function as defined in the subgroups
- G01N2333/4701—Details
- G01N2333/4709—Amyloid plaque core protein
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/28—Neurological disorders
- G01N2800/2814—Dementia; Cognitive disorders
- G01N2800/2821—Alzheimer
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biomedical Technology (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Pathology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- Urology & Nephrology (AREA)
- Hematology (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Neurology (AREA)
- Neurosurgery (AREA)
- Cell Biology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Food Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- General Physics & Mathematics (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
본 발명은 miR-485-3p를 이용한 알츠하이머병 또는 뇌 질환 진단을 위한 정보제공 방법, 알츠하이머병 또는 뇌 질환 진단용 조성물 및 진단용 키트에 관한 것이다. 본 발명에 따르면, 혈액 내 miR-485-3p의 발현량 측정에 의해 알츠하이머병 또는 뇌 질환의 진단에 대한 객관적인 데이터 분석이 가능하며, 타액 내 아밀로이드베타 42의 농도 측정에 의해 환자의 위험성을 최소화하며, 빠르고 정확한 진단이 가능하다. 따라서, 알츠하이머병 또는 뇌 질환의 예방에 매우 유용하다.The present invention relates to an information providing method for diagnosing Alzheimer's disease or brain disease using miR-485-3p, a composition for diagnosing Alzheimer's disease or brain disease, and a diagnostic kit. According to the present invention, objective data analysis for diagnosis of Alzheimer's disease or brain disease is possible by measuring the expression level of miR-485-3p in the blood, and minimizing the patient's risk by measuring the concentration of amyloid beta 42 in saliva. Fast, accurate diagnosis is possible. Therefore, it is very useful for the prevention of Alzheimer's disease or brain disease.
Description
본 발명은 miR-485-3p를 이용한 알츠하이머병 또는 뇌 질환 진단을 위한 정보제공 방법에 관한 것으로, 더욱 상세하게는 채취된 시료로부터 마이크로 RNA miR-485-3p의 발현량을 측정하는 단계를 포함하는 알츠하이머병 또는 뇌 질환 진단을 위한 정보제공 방법에 관한 것이다. 또한, miR-485-3p 또는 아밀로이드베타 42를 이용한 알츠하이머병 또는 뇌 질환 진단용 조성물 및 진단용 키트에 관한 것이다.The present invention relates to a method for providing information for diagnosing Alzheimer's disease or brain disease using miR-485-3p, and more particularly, comprising measuring the expression level of microRNA miR-485-3p from a sample collected. The present invention relates to a method for providing information for diagnosing Alzheimer's disease or brain disease. The present invention also relates to compositions and diagnostic kits for diagnosing Alzheimer's disease or brain disease using miR-485-3p or amyloid beta 42.
알츠하이머병에 대한 최근 치료 기조는 대뇌피질(cerebral cortex)과 해마 (hippocampus)에서 기능 손상된 콜린성 시그널링 및 전달(cholinergic signaling and transmission)에 의해 알츠하이머병이 유래 된다는 가능성에 중심을 두고 있다 (Bartus et al., Science. 217(4558): 408-14(1982) 및 Coyle et al., Science. 219(4589):1184-90(1983)).Recent treatment for Alzheimer's disease centers on the possibility that Alzheimer's disease is caused by impaired cholinergic signaling and transmission in the cerebral cortex and hippocampus (Bartus et al. , Science. 217 (4558): 408-14 (1982) and Coyle et al., Science. 219 (4589): 1184-90 (1983).
이런 뇌의 영역은 기억 및 지능과 연결되어 있으므로, 뇌의 이들 부분의 기능적인 결함은 기억 및 판단에 대한 손상을 주고 지적 능력을 상실케 한다. 신경 신호전달(neuronal signaling)에 손상이 이루어지는 정확한 과정이 논쟁 대상이 되고 있지만, 노인성 플라크(senile plaque) 및 신경원 섬유 농축체(neurofibrillary tangle: NFT)가 병리학적으로 주 현상으로 여겨진다.Since these areas of the brain are linked to memory and intelligence, functional deficiencies in these parts of the brain damage memory and judgment and cause loss of intellectual ability. While the exact process of impairment in neuronal signaling is controversial, senile plaques and neurofibrillary tangles (NFTs) are considered pathologically the main phenomena.
특히 아밀로이드 베타(Aβ)의 축적으로 인한 노인성 플라크는 이병의 가장 큰 특징으로, 알츠하이머병은 사후 부검으로 확진이 가능하다(Khachaturian, Arch. Neurol. 42(11):1097-105(1985)).In particular, senile plaques due to the accumulation of amyloid beta (Aβ) are the most characteristic of the disease, Alzheimer's disease can be confirmed by postmortem autopsy (Khachaturian, Arch. Neurol. 42 (11): 1097-105 (1985)).
알츠하이머병의 경우, 콜린성 신경 전달의 손상을 억제할 수 있도록 아세틸콜린의 양을 증가시키거나, 아세틸콜린이 장기간 존재할 수 있도록 하거나 또는 신경세포의 전달에 아세틸콜린이 더욱 효과적으로 작용하도록 하는 약물과 치료법이 제시되고 있어서, 알츠하이머병 환자들의 아세틸콜린 활성도를 높이는 다양한 화합물들이 사용되고 있다.In Alzheimer's disease, drugs and therapies that increase the amount of acetylcholine to suppress the damage to cholinergic neurotransmission, allow long-term presence of acetylcholine, or make acetylcholine work more effectively in the delivery of neurons. As suggested, various compounds for increasing the acetylcholine activity of Alzheimer's disease patients have been used.
현재 가장 효과적인 접근 방법은 시냅스에서 아세틸콜린을 빠르게 분해하여 신경 신호 전달을 막는 아세틸콜린에스테라아제의 활성을 억제하는 방법이다. 실제로 이런 저해제 (예: tacrine, donepezil, galantamine 및 rivastigmine)들은 현재 FDA에서 인정한 알츠하이머병 치료 약물로 시장에서 유통되고 있지만, 많은 경우 상기 약물들은 병의 진행을 완화하는데 유효하나, 완치에는 잘 적용되지 않고 있다.Currently, the most effective approach is to inhibit the activity of acetylcholinesterase, which rapidly breaks down acetylcholine at synapses, preventing neuronal signal transduction. Indeed, these inhibitors (e.g. tacrine, donepezil, galantamine and rivastigmine) are currently on the market as FDA-approved drugs for treating Alzheimer's disease, but in many cases they are effective for slowing the progression of the disease, have.
또한, 어떤 화합물들은 신경의 일반적인 건강 상태를 개선하여 나이가 들어감에 따른 세포의 기능을 정상적으로 유지하는데 목적을 두고 있다. 예를 들어, NGF와 에스트로겐 같은 몇몇 약물들은 신경의 퇴화를 늦추어 주는 신경보호 역할을 하며, 항산화제와 같은 다른 약물들은 세포의 산화를 감소시켜 정상적인 노화의 결과로 나타나는 해로운 세포의 손상의 증가를 감소시킨다.In addition, some compounds aim to improve the general state of health of the nerves to maintain normal cell function as they age. For example, some drugs, such as NGF and estrogen, play a neuroprotective role in slowing neuronal degeneration, while others, such as antioxidants, reduce the oxidation of cells, reducing the increase in harmful cell damage that results from normal aging. Let's do it.
아밀로이드 베타 펩타이드가 축적되는 정도가 많으면 알츠하이머병이 심각해지는데, 신경염 공간(neuritic space)에 아밀로이드 베타의 축적을 낮추어 주면 알츠하이머병의 진행을 늦추게 될 것으로 생각되고 있다. 또한, 아밀로이드 전구체 단백질(Amyloid precursor protein: APP)이 α-, β-, γ-세크레타아제들과 같은 세포내의 단백질 분해효소들과 조합으로 많은 다양한 형태들로 진행되는 것으로 생각된다. 하지만, 아밀로이드 베타의 형성 과정이 실제 과학적으로 완전히 규명되지 않았기 때문에, 아밀로이드 베타의 형성을 조절하는 것은 아직은 가능하지 않다.If the amount of amyloid beta peptide is accumulated, Alzheimer's disease becomes serious. If the accumulation of amyloid beta is reduced in the neuritic space, it is thought that the progression of Alzheimer's disease will be slowed down. In addition, amyloid precursor protein (APP) is thought to proceed in many different forms in combination with intracellular proteolytic enzymes such as α-, β- and γ-secretases. However, since the formation process of amyloid beta has not been fully scientifically identified, it is not yet possible to control the formation of amyloid beta.
아밀로이드 베타의 축적이 신경신호 전달에 이상을 주는 과정은 명확하지 않으며, APP가 이상하게 절단되어 아밀로이드 베타가 많이 생성되어 신경염 공간에 축적되게 되면 플라크 형성이 유발된다. 따라서 이런 절단 반응에 관여하는 많은 다른 요인들(예: 염증반응 등)은 타우(tau) 단백질의 인산화를 증가시키고, NFT들과 쌍나선형 필라멘트(paired helical filament: PHF)들의 축적을 증가시켜서 결국 신경의 손상을 증가시킨다. 이런 요인들 모두 신경의 기능 장애를 유발하고 궁극적으로 알츠하이머병의 치매로 진행을 가속시킨다.The process by which amyloid beta accumulates abnormal neuronal signal transmission is not clear. Plaque formation is induced when APP is abnormally cleaved and amyloid beta is generated and accumulated in neuritis space. Thus, many other factors involved in this cleavage reaction (such as inflammatory reactions) increase the phosphorylation of tau protein, increase the accumulation of NFTs and paired helical filaments (PHFs) and eventually nerves. Increases the damage. All of these factors cause nerve dysfunction and ultimately accelerate progression to Alzheimer's disease.
비록 알츠하이머병의 영향을 줄이기 위한 치료 방법의 개발이 활발히 진행되고 있으나, 현재로는 일시적인 증상의 개선을 제공하는 것이다. 결론적으로 현재 알츠하이머병 치료는 병의 진행 과정을 되돌리는 것이 아니라 병의 증상을 개선하는데 초점을 두고 있으며, 병의 생물학적인 지식에 대하여 보다 많이 알고 있으나, 임상에로의 적용 결과는 아직 성공적이지는 않다.Although treatments are being actively developed to reduce the effects of Alzheimer's disease, they are currently providing temporary improvement of symptoms. In conclusion, the current treatment of Alzheimer's disease focuses on improving the symptoms of the disease, rather than reversing the course of the disease, and knows more about the biological knowledge of the disease. not.
이와 관련하여 미국 등록특허 제5,532,219호는 4,4 '-디아미노디페닐술폰 등을 포함하는 알츠하이머병 치료용 조성물을 개시하고 있고, 미국 등록특허 제5,506,097호는 파라-아미디노페닐메탄술포닐 플루오리드 또는 에베락톤 A를 포함하는 알츠하이머병 치료용 조성물을 개시하고 있으며, 미국 등록특허 제6,136,861호는 비시클로[2.2.1]헵탄을 포함하는 알츠하이머병 치료용 조성물을 개시하고 있다.In this regard, US Patent No. 5,532,219 discloses a composition for treating Alzheimer's disease, including 4,4'-diaminodiphenyl sulfone, and US Patent No. 5,506,097 discloses para-amidinophenylmethanesulfonyl fluorine. Disclosed is a composition for treating Alzheimer's disease, including Reed or Eberlactone A. US Pat. No. 6,136,861 discloses a composition for treating Alzheimer's disease, including bicyclo [2.2.1] heptane.
ELAVL2는 ELAVL like neuron-specific RNA binding protein 2로 nELAVL2의 1가지 형태이다. nELAVL2는 뇌특이적으로 발현되는 RNA binding protien으로 Neurodegenerative disease에 관련이 있다고 알려져 있다. 알츠하이머병 환자 사후부검 후 뇌 조직을 이용해 high-throughput RNA sequence를 실시한 결과 ELAVL2가 저발현되어 있는 것이 알려져 있다.ELAVL2 is an ELAVL like neuron-specific
알츠하이머병은 치매의 가장 흔한 형태이며 75%의 치매 환자가 알츠하이머병이다. 대부분의 경우 알츠하이머병은 65세가 넘어 발병하지만, 드물게 그 이전에 발병할 수 있다. 미국에서는 65~74세 인구의 약 3%, 75~84세 인구의 약 19%, 85세 이상 인구의 50%가 이 병을 앓고 있다. 한국에서는 최근 한 농촌 지역을 중심으로 한 연구 보고에 의하면, 농촌 지역 60세 이상의 인구에서 약 21%가 치매 양상을 보이고, 이 중 63%가 알츠하이머형 치매인 것으로 보고되고 있다. 2006년 전 세계 26.6만명이 가진 질병이다. 2050년에는 85명중 1명꼴로 발병될 것으로 예측된다.Alzheimer's disease is the most common form of dementia and 75% of dementia patients have Alzheimer's disease. In most cases, Alzheimer's disease develops beyond age 65, but rarely can occur before it. In the United States, about 3% of people aged 65-74, about 19% of people aged 75-84, and 50% of people over 85 years of age have the disease. In Korea, a recent research report focusing on a rural area shows that about 21% of people over 60 years old have dementia, and 63% of them have Alzheimer's disease. It is a disease of 26.6 million people worldwide in 2006. It is predicted that in 2050, 1 in 85 people will develop.
알츠하이머성 치매는 치료제가 없고 진단에 이은 증상 완화제 처방이 유일한 방법이다. 또한, 조기 진단 시스템도 전무한 상황이다. 기존 진단의 경우 다양한 방법으로 진행되고 있으나, 많은 단점이 존재한다. 문진법은 인지차이에 의한 오류가 있을 수 있고, 구조적 뇌영상은 고비용, 핵의학적 뇌영상은 방사성 동위원소의 사용 및 고비용의 단점이 있다. 뇌척수액 분석을 통한 타우 단백질 측정은 침습적 방법 및 뇌척수액 추출에 따른 위험성이 있다.Alzheimer's dementia does not have a cure and the only remedy for symptomatic relief following diagnosis is the only option. In addition, there is no early diagnosis system. In the case of the existing diagnosis, there are various methods, but there are many disadvantages. Paperweighting may have errors due to cognitive differences, structural brain imaging has high cost, and nuclear medical brain imaging has disadvantages of using radioisotopes and high cost. Tau protein measurement through cerebrospinal fluid analysis presents a risk due to invasive methods and cerebrospinal fluid extraction.
이에, 본 발명자들은 알츠하이머병 등의 뇌신경 질환을 진단할 수 있는 마커를 선정함과 동시에 보다 정확한 진단법을 개발하고자 예의 노력한 결과, 혈액으로부터 추출한 miR-485-3p의 발현량이 증가하는 것을 확인하고 본 발명을 완성하였다.Accordingly, the present inventors have made efforts to select markers for diagnosing cerebral neurological diseases such as Alzheimer's disease, and at the same time, to develop a more accurate diagnostic method, confirming that the expression level of miR-485-3p extracted from blood is increased and the present invention is improved. To complete.
본 배경기술 부분에 기재된 상기 정보는 오직 본 발명의 배경에 대한 이해를 향상시키기 위한 것이며, 이에 본 발명이 속하는 기술분야에서 통상의 지식을 가지는 자에게 있어 이미 알려진 선행기술을 형성하는 정보를 포함하지 않을 수 있다.The above information described in this Background section is only for improving the understanding of the background of the present invention, and therefore does not include information forming prior art that is known to those of ordinary skill in the art. You may not.
본 발명의 목적은 miR-485-3p의 발현량을 측정하여 알츠하이머병 또는 뇌 질환의 조기진단을 위한 정보제공 방법을 제공하는 데 있다. 또한, 알츠하이머병 또는 뇌 질환 진단 방법, 진단용 조성물 및 진단용 키트를 제공하는 데 있다.An object of the present invention to provide an information providing method for the early diagnosis of Alzheimer's disease or brain disease by measuring the expression level of miR-485-3p. The present invention also provides a method for diagnosing Alzheimer's disease or brain disease, a diagnostic composition, and a diagnostic kit.
상기 목적을 달성하기 위하여, 본 발명은 채취된 시료로부터 miR-485-3p의 발현량을 측정하는 단계를 포함하는 알츠하이머병 또는 뇌 질환 진단을 위한 정보제공 방법 및 진단 방법을 제공한다.In order to achieve the above object, the present invention provides an information providing method and diagnostic method for diagnosing Alzheimer's disease or brain disease comprising measuring the expression level of miR-485-3p from the sample collected.
본 발명은 또한, miR-485-3p의 발현량 또는 아밀로이드베타 42의 농도를 측정하는 알츠하이머병 등의 뇌 질환 진단용 조성물 및 진단용 키트를 제공한다.The present invention also provides a composition for diagnosing brain diseases such as Alzheimer's disease and a diagnostic kit for measuring the expression level of miR-485-3p or the concentration of amyloid beta 42.
본 발명에 따르면, 혈액 내 miR-485-3p의 발현량 측정에 의해 알츠하이머병 또는 뇌 질환의 진단에 대한 객관적인 데이터 분석이 가능하며, 추가로 타액 내 아밀로이드베타 42의 농도 측정에 의해 환자의 위험성을 최소화하며, 빠르고 정확한 진단이 가능하다. 따라서, 본 발명에 따르면, 알츠하이머병 또는 뇌 질환의 조기 진단으로 알츠하이머병 또는 뇌 질환의 예방에 매우 유용하다.According to the present invention, it is possible to analyze objective data on the diagnosis of Alzheimer's disease or brain disease by measuring the expression level of miR-485-3p in the blood, and further measure the risk of the patient by measuring the concentration of amyloid beta 42 in saliva. Minimized, fast and accurate diagnosis is possible. Therefore, according to the present invention, it is very useful for the prevention of Alzheimer's disease or brain disease by early diagnosis of Alzheimer's disease or brain disease.
도 1은 (A)는 정상군 대비 환자군에서 miRNA발현 패턴 분석(volcano blot) 결과이며, (B)는 정상군 대비 환자군에서 miR-485-3p의 발현을 비교한 그래프이다.
도 2는 5xFAD의 3'-비번역 부위(UTR)mRNA와 miR-485-3p의 Seed 서열이다.
도 3은 (A)는 hippocampus 및 cortex에서 miR-485-3p의 발현을 비교한 그래프이며, (B) 및 (C)는 5xFAD의 해마 및 대뇌피질에서 ELAVL2의 발현 및 관련 단백질 발현 비교 결과이다.
도 4는 (A)는 5xFAD의 대뇌피질에서 Aβ 42의 정량 비교 분석 그래프이며, (B)는 해마에서 Aβ 42의 정량 비교 분석 그래프이다.
도 5는 자성입자 모음 장치의 모식도이다. 항원, 항체, 자성입자 그리고 형광물질이 콤플렉스를 이루는 과정을 보여준다.
도 6은 자성입자 모음 장치를 이용한 타액 유래 Aβ 정량화 결과이다.
도 7은 자성입자 모음 장치를 이용한 타액 유래 Aβ 농도 측정을 통하여 치매 환자를 구별할 수 있음을 보여준다.
도 8은 아밀로이드베타(Aβ) 42를 발현하는 핵산 레벨 측정 과정의 모식도이다.
도 9는 Hippocampal primary cell에서 AM485-3p transfection에 따른 ELAVL2 발현을 비교한 결과이다.
도 10은 AM485-3p를 비강내 처리한 5xFAD에서 ELAVL2포함 관련 단백질 및 Aβ 42 정량 비교 분석 결과이다.
도 11은 AM485-3p를 비강내 처리한 5xFAD에서 인지 기능 여부를 비교한 그래프이다.Figure 1 (A) is a result of miRNA expression pattern analysis (volcano blot) in the patient group compared to the normal group, (B) is a graph comparing the expression of miR-485-3p in the patient group compared to the normal group.
Figure 2 shows the 3'-untranslated region (UTR) mRNA of 5xFAD and the Seed sequence of miR-485-3p.
Figure 3 (A) is a graph comparing the expression of miR-485-3p in hippocampus and cortex, (B) and (C) is a result of comparison of ELAVL2 expression and related protein expression in the hippocampus and cerebral cortex of 5xFAD.
Figure 4 (A) is a quantitative comparative analysis of Aβ 42 in the cerebral cortex of 5xFAD, (B) is a quantitative comparative analysis of Aβ 42 in the hippocampus.
5 is a schematic view of a magnetic particle collection device. Shows the complex of antigens, antibodies, magnetic particles and fluorescent materials.
6 is a result of saliva-derived Aβ quantification using a magnetic particle collection device.
Figure 7 shows that dementia patients can be distinguished by measuring saliva-derived Aβ concentration using a magnetic particle collection device.
8 is a schematic diagram of a nucleic acid level measurement process expressing amyloid beta (Aβ) 42.
Figure 9 is a result of comparing ELAVL2 expression according to AM485-3p transfection in Hippocampal primary cells.
10 is a quantitative comparative analysis result of ELβL2 containing related protein and Aβ 42 in 5 × FAD intranasally treated with AM485-3p.
11 is a graph comparing the recognition function in 5xFAD intranasally treated AM485-3p.
다른 식으로 정의되지 않는 한, 본 명세서에서 사용된 모든 기술적 및 과학적 용어들은 본 발명이 속하는 기술분야에서 숙련된 전문가에 의해서 통상적으로 이해되는 것과 동일한 의미를 갖는다. 일반적으로 본 명세서에서 사용된 명명법은 본 기술분야에서 잘 알려져 있고 통상적으로 사용되는 것이다.Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In general, the nomenclature used herein is well known and commonly used in the art.
본 발명의 구체적 실시예에서 의사로부터 알츠하이머 치매 진단을 받은 환자로부터 얻은 혈액 내에서 miR-485-3p의 발현이 유의적으로 증가하는 것을 확인하였다.In a specific embodiment of the present invention it was confirmed that the expression of miR-485-3p significantly increased in the blood obtained from a patient diagnosed with Alzheimer's dementia from a doctor.
따라서, 본 발명은 일 관점에서 채취된 시료로부터 miR-485-3p의 발현량을 측정하는 단계를 포함하는 알츠하이머병 또는 뇌 질환 진단을 위한 정보제공 방법에 관한 것이다. 또한, 채취된 시료로부터 miR-485-3p의 발현량을 측정하는 단계를 포함하는 알츠하이머병 또는 뇌 질환 진단 방법에 관한 것이다.Therefore, the present invention relates to a method for providing information for diagnosing Alzheimer's disease or brain disease, comprising measuring the expression level of miR-485-3p from a sample collected from one aspect. In addition, the present invention relates to a method for diagnosing Alzheimer's disease or brain disease, including measuring the expression level of miR-485-3p from a sample collected.
본 발명은 시료로부터 마이크로 RNA miR-485-3p를 추출하는 단계를 포함하는 것을 특징으로 할 수 있다. 상기 시료는 혈액 또는 혈장인 것을 특징으로 할 수 있으나 이에 제한되는 것은 아니다.The invention may be characterized in that it comprises the step of extracting the micro RNA miR-485-3p from the sample. The sample may be characterized in that blood or plasma, but is not limited thereto.
본 발명의 일 실시예에서, 의사로부터 알츠하이머 치매 진단을 받은 환자로부터 Sod. citrate (3.2% w/v)가 첨가된 혈액 튜브 (백톤 디킨슨 (Becton Dickinson), 독일)에 약 3ml의 혈액을 채혈하였다. 혈액은 3,500 rpm에 10분간 원심분리하여 혈장을 분리하였으며 RNA 추출 전까지 -80℃에 보관하였다. 제조업자의 권장에 따라 miRNeasy Serum/Plasma Kit(퀴아젠(Qiagen, USA))를 사용하여 miRNA를 추출하였다. miRNA 추출은 다음과 같은 순서로 이루어진다. 혈장 또는 혈청 샘플을 QIAzol Lysis Reagent에 용해시키고, 클로로포름을 첨가한 뒤 원심 분리에 의해 용해물을 수용액상과 유기상으로 분리한다. RNA 부분은 상부의 수용액상으로, DNA 부분은 중간 층으로, 단백질은 중간 층 또는 하부의 유기상으로 나뉘어진다. 상부의 수용액상을 추출하여, 약 18 뉴클레오타이드 이상의 RNA 분자들과 결합할 수 있는 적절한 조건을 제공하기 위해 에탄올을 첨가한다. 샘플을 RNeasy MinElute spin column에 적용하여 모든 RNA는 막에 결합하고, 페놀 및 다른 오염 물질은 효율적으로 씻어낸다. 고품질의 RNA는 RNase가 없는 소량의 물에서 용출시킨다. 혈청과 혈장에는 주로 작은 RNA를 포함하므로, 작은 RNA와 큰 RNA 분획을 별도로 정제할 필요는 없다.In one embodiment of the present invention, Sod. About 3 ml of blood was collected in a blood tube (c. Backton Dickinson, Germany) to which citrate (3.2% w / v) was added. Blood was centrifuged at 3,500 rpm for 10 minutes to separate plasma and stored at -80 ° C until RNA extraction. MiRNA was extracted using miRNeasy Serum / Plasma Kit (Qiagen, USA) as recommended by the manufacturer. miRNA extraction is performed in the following order. Plasma or serum samples are dissolved in QIAzol Lysis Reagent, chloroform is added and the lysates are separated into aqueous and organic phases by centrifugation. The RNA portion is divided into an aqueous solution at the top, the DNA portion is divided into an intermediate layer, and the protein is divided into an intermediate layer or an organic phase at the bottom. The upper aqueous phase is extracted and ethanol is added to provide suitable conditions for binding with more than about 18 nucleotides of RNA molecules. Samples were applied to the RNeasy MinElute spin column to allow all RNA to bind to the membrane and phenol and other contaminants to be washed off efficiently. High quality RNA elutes in small amounts of RNase-free water. Since serum and plasma mainly contain small RNAs, there is no need to purify small RNAs and large RNA fractions separately.
본 발명은 마이크로 RNA miR-485-3p의 발현량을 측정하는 단계를 포함한다.The present invention includes measuring the expression level of micro RNA miR-485-3p.
본 발명에 있어서, 상기 miR-485-3p의 발현량은 rea-time PCR, 정량 PCR 프라이머 신장분석, 핵산 칩분석, 서열분석, 앱타머 기반 검정 및 전기영동에 의한 겔크로마토그래피로 구성된 군에서 선택되는 방법에 의해 측정되는 것을 특징으로 할 수 있으나, 이에 제한되는 것은 아니다.In the present invention, the expression level of miR-485-3p is selected from the group consisting of rea-time PCR, quantitative PCR primer extension analysis, nucleic acid chip analysis, sequencing, aptamer-based assay, and gel chromatography by electrophoresis. It may be characterized by being measured by the method, but is not limited thereto.
본 발명의 일 실시예에서, 추출된 RNA의 농도와 순도를 Bioanalyzer2100 (Agilent, USA)을 이용하여 분석하였다. 상기 추출된 RNA는 Human Neurological Development 및 Neurological Disease의 진행과 연관되어 있다고 알려진 84개의 다른 miRNA를 함유하는 miRNA array를 사용하여 스크리닝하였다.In one embodiment of the present invention, the concentration and purity of the extracted RNA was analyzed using Bioanalyzer2100 (Agilent, USA). The extracted RNA was screened using a miRNA array containing 84 different miRNAs known to be involved in the progression of Human Neurological Development and Neurological Disease.
Quantitative PCR assay 방법은 다음과 같이 요약할 수 있다. Mature한 miRNA는 일반적으로 22nt, noncoding RNA이며 전사 후 조절을 담당한다. Mature한 miRNA는 poly(A) polymerase에 의해 polyadenylation을 유도하고 oligo-dT primers로 cDNA로 합성하였다. oligo-dT primers는 3' degenerate anchor를 갖고 있고 5' 말단에 universal tag sequence를 갖고 있어 Real-time PCR 과정에서 mature miRNA 증폭을 가능하게 한다. miScript SYBR Green PCR Kit (퀴아젠)을 이용해 real-time PCR 과정에서 mature한 miRNA를 정량하였다.Quantitative PCR assay methods can be summarized as follows. Mature miRNAs are generally 22nt, noncoding RNAs and are responsible for post-transcriptional regulation. Mature miRNA induced polyadenylation by poly (A) polymerase and synthesized cDNA with oligo-dT primers. Oligo-dT primers have a 3 'degenerate anchor and a universal tag sequence at the 5' end, enabling mature miRNA amplification during real-time PCR. Mature miRNA was quantified during real-time PCR using miScript SYBR Green PCR Kit (Qiagen).
본 발명에 있어서, 상기 miR-485-3p의 발현량이 정상군 대비 5배, 더욱 구체적으로 9배 이상인 경우 알츠하이머병 또는 뇌 질환을 갖는 것으로 진단하는 것을 특징으로 할 수 있다. 상기 정상군은 59세에서 64세 사이이며, 알츠하이머병 또는 뇌 질환을 겪은 이력이 없는 사람들로 선정하였다. In the present invention, when the expression level of the miR-485-3p is 5 times, more specifically, 9 times or more than the normal group, it may be characterized as having Alzheimer's disease or brain disease. The normal group was selected between 59 and 64 years of age and had no history of Alzheimer's disease or brain disease.
본 발명에 있어서, 상기 뇌 질환은 자폐 스펙트럼 장애, 정신지체, 근위축성 측색 경화증, 경련, 뇌졸중, 파킨슨씨 병, 척수손상으로 구성된 군에서 선택되는 어느 하나일 수 있으나, 이에 한정되는 것은 아니다.In the present invention, the brain disease may be any one selected from the group consisting of autism spectrum disorder, mental retardation, amyotrophic lateral sclerosis, convulsions, stroke, Parkinson's disease, spinal cord injury, but is not limited thereto.
본 발명에 따른 정보제공 방법 및 진단 방법은 마커의 발현량을 검사 대상체의 알츠하이머병 및/또는 여러 가지 뇌 질환의 진단 또는 예후 판별시에 발작 질환 검사 대상체의 비마커 임상정보를 추가로 사용할 수 있다. 이러한 검사 대상체의 비마커 임상정보는 상기 대상체의 나이, 성별, 체중, 식습관, 체질량, 기저질환 및 뇌파검사, 발작 종류, 뇌 MRI, 뇌 CT, 또는 뇌 척수액 검사, 혈액검사, 타액검사를 포함하나, 이에 제한되는 것은 아니다.The information providing method and the diagnostic method according to the present invention may further use non-marker clinical information of the seizure disease test subject when diagnosing or prognosticting Alzheimer's disease and / or various brain diseases of the test subject by measuring the expression level of the marker. . Non-marker clinical information of such test subjects includes age, sex, weight, diet, body mass, underlying disease and EEG, seizure type, brain MRI, brain CT, or cerebrospinal fluid test, blood test, saliva test of the subject. However, the present invention is not limited thereto.
본 발명에 있어서, 상기 알츠하이머병 또는 뇌 질환 진단을 위한 정보제공 방법은 채취된 시료로부터 아밀로이드베타 42(Aβ42)의 농도를 측정하는 단계를 추가로 더 포함하는 것을 특징으로 할 수 있다.In the present invention, the information providing method for diagnosing Alzheimer's disease or brain disease may further comprise the step of measuring the concentration of amyloid beta 42 (Aβ 42) from the collected sample.
상기 시료는 타액 또는 혈액인 것을 특징으로 할 수 있으나 이에 제한되는 것은 아니다. 시료로 타액을 이용하는 것은 환자의 위험성을 최소화하며, 빠르고 정확한 진단이 가능하게 한다.The sample may be saliva or blood, but is not limited thereto. Using saliva as a sample minimizes patient risk and enables fast and accurate diagnosis.
상기 아밀로이드베타 42의 농도 측정은 항원-항체 반응 또는 핵산 앱타머를 이용하여 측정되는 것을 특징으로 할 수 있으나, 이에 제한되는 것은 아니다. 상기 항원-항체 반응은 ELISA(enzyme-linked immunosorbent assay)를 포함하는 당업계에서 널리 알려진 것일 수 있다. 채취된 타액으로부터 아밀로이드베타 42의 농도를 측정하는 경우, 이에 한정되는 것은 아니나, 바람직하게는 한국특허공개 10-2014-0025978 또는 한국특허공개 10-2013-0140528을 참조한다.The concentration measurement of amyloid beta 42 may be measured using an antigen-antibody reaction or nucleic acid aptamer, but is not limited thereto. The antigen-antibody reaction may be well known in the art, including an enzyme-linked immunosorbent assay (ELISA). When measuring the concentration of amyloid beta 42 from the collected saliva, but is not limited to this, preferably refer to Korea Patent Publication 10-2014-0025978 or Korea Patent Publication 10-2013-0140528.
본 발명에 있어서, 용어 '앱타머(aptamer)'는 표적 분자에 대한 특정 결합 친화력을 가지는 핵산을 말하며, 본 발명에서는 특히, 상기 표적분자가 아밀로이드베타 42이다.In the present invention, the term 'aptamer' refers to a nucleic acid having a specific binding affinity for a target molecule. In the present invention, the target molecule is amyloid beta 42.
표적에 대한 앱타머의 특정 결합 친화력(specific binding affinity)은 앱타머는 시료에서의 다른 성분에 결합하는 것보다 일반적으로 더 높은 정도의 친화력으로 그것의 표적에 결합함을 의미한다. 앱타머는 하나 이상의 이와 같은 분자 세트를 말한다. 서로 다른 앱타머는 동일하거나 서로 다른 수의 뉴클레오티드 중 하나를 가질 수 있다. 앱타머는 DNA 또는 RNA 또는 화학적으로 변경된 핵산일 수 있고, 단일 가닥, 이중 가닥 또는 이중 가닥 영역을 포함하는 것일 수 있고, 매우 질서정연한(higher ordered) 구조를 포함할 수 있다. 광반응성(photoreactive) 또는 화학적 반응성 기능기(chemically reactive functional group)가 그것의 대응하는 표적에 공유적으로 결합될 수 있도록 앱타머에 포함되어 있는 한, 앱타머는 또한 광앱타머(photoaptamer)일 수 있다. 본 발명에 기재된 임의의 앱타머 방법은 동일한 표적 분자와 특이적으로 결합하는 두 개 또는 그 이상의 앱타머의 사용을 포함할 수 있다.Specific binding affinity of an aptamer to a target means that the aptamer binds to its target generally with a higher degree of affinity than to other components in the sample. Aptamers refer to one or more such sets of molecules. Different aptamers may have one of the same or different numbers of nucleotides. Aptamers can be DNA or RNA or chemically modified nucleic acids, can comprise single stranded, double stranded or double stranded regions, and can comprise a highly ordered structure. An aptamer may also be a photoaptamer, as long as it is included in the aptamer such that a photoreactive or chemically reactive functional group can be covalently bound to its corresponding target. Any aptamer method described herein may comprise the use of two or more aptamers that specifically bind to the same target molecule.
앱타머는 SELEX를 포함하는 임의의 공지의 방법을 사용하여 확인될 수 있다. 일단 확인되면, 앱타머는 화학 합성 방법 및 효소 합성 방법을 포함하는 임의의 공지의 방법에 따라 제조되거나 합성될 수 있다.Aptamers can be identified using any known method, including SELEX. Once identified, aptamers can be prepared or synthesized according to any known method, including chemical synthesis methods and enzyme synthesis methods.
상기 용어 "SELEX" 및 "SELEX 공정(SELEX process)"은 (1) 바람직한 방식, 예를 들어 단백질에 고친화력을 가지는 결합으로 표적 분자와 상호작용하는 앱타머의 선별과 (2) 그 선택된 핵산의 증폭(amplification)의 조합을 일반적으로 칭하기 위하여 본원에서 상호교환적으로 사용된다. 상기 SELEX 공정은 특정 표적 또는 바이오마커에 대하여 고친화력을 가지는 앱타머를 확인하는데 사용될 수 있다. SELEX는 일반적으로 핵산의 후보물질 혼합물을 제조하고, 친화 복합체(affinity complex)를 형성하기 위하여 원하는 표적 분자에 후보물질 혼합물을 결합시키고, 결합되지 않은 후보물질 핵산으로부터 친화 복합체를 분리하고, 친화 복합체로부터 핵산을 분리 및 단리시키고, 핵산을 정제하고, 특정 앱타머 서열을 증폭하는 것을 포함한다. 상기 공정은 선별된 앱타머의 친화력을 더 개선하기 위한 반복 회전(multiple rounds)을 포함할 수 있다. 상기 공정은 공정에서의 하나 또는 그 이상의 지점에서 증폭 단계를 포함할 수 있다(예를 들어, US 5,475,096: Nucleic Acid ligands). 상기 SELEX 공정은 그것의 표적에 공유적으로 결합하는 앱타머 뿐만 아니라 그것의 표적에 비공유적으로 결합하는 앱타머를 생성하기 위하여 사용될 수 있다(예를 들어, US 5,705,337: Systematic Evolution of Nucleic Acid Ligands by Exponential Enrichment: Chemi-SELEX). 상기 SELEX 공정은 예를 들어, 생체 내(in vivo) 안정성을 향상시키거나 운반 특성을 향상시키는 것과 같은, 앱타머 상에 향상된 특성을 부여하는 변경된 뉴클레오티드를 포함하는 고친화성 앱타머를 확인하는데 사용될 수 있다. 이러한 변경의 예는 리보오스(ribose) 및/또는 포스페이트(phosphate) 및/또는 염기 위치(base position)에서의 화학적 치환을 포함한다. SELEX 공정에서 확인된 앱타머는 피리딘의 5'- 및 2'-위치에서 화학적으로 변경된 뉴클레오티드 유도체를 포함하는 올리고뉴클레오티드를 기술하고 있는 미국특허번호 제5,660,985호("High Affinity Nucleic Acid Ligands Containing Modified Nucleotides")에 기재되어 있다. 상기를 참고하여, US 5,580,737는 2'-아미노(2'-NH2), 2'-플루오로(2'-F) 및/또는 2'-O-메틸(2'-OMe)로 변경된 하나 또는 그 이상의 뉴클레오티드를 포함하는 고특이성 앱타머를 기술하고 있다. 또한, SELEX 및 광SELEX에서 확장된 물리 및 화학적 특성을 가지는 핵산 라이브러리 및 그것들의 용도를 기술하고 있는 US 2009/0098549(SELEX 및 PHOTOSELEX)를 참고할 수 있다. SELEX는 또한 바람직한 오프-레이트(off-rate) 특성을 가지는 앱타머를 확인하는데 사용될 수 있다. 표적 분자에 결합할 수 있는 앱타머를 생성하기 위한 향상된 SELEX 방법을 기술하고 있는 US 2009/0004667(Method for Generating Aptamers with Improved Off-Rates)를 참고할 수 있다.The terms "SELEX" and "SELEX process" refer to (1) selection of aptamers that interact with the target molecule in a preferred manner, e.g., a binding with high affinity to the protein, and (2) It is used interchangeably herein to refer to the combination of amplification in general. The SELEX process can be used to identify aptamers having a high affinity for a particular target or biomarker. SELEX generally prepares a candidate mixture of nucleic acids, binds the candidate mixture to the desired target molecule to form an affinity complex, separates the affinity complex from the unbound candidate nucleic acid, and from the affinity complex. Isolating and isolating nucleic acids, purifying nucleic acids, and amplifying specific aptamer sequences. The process may include multiple rounds to further improve the affinity of the selected aptamers. The process may comprise an amplification step at one or more points in the process (eg US 5,475,096: Nucleic Acid ligands). The SELEX process can be used to generate aptamers that covalently bind to its target, as well as aptamers that covalently bind to its target (e.g. US 5,705,337: Systematic Evolution of Nucleic Acid Ligands by Exponential Enrichment: Chemi-SELEX). The SELEX process can be used to identify high affinity aptamers that contain altered nucleotides that confer improved properties on aptamers, such as, for example, to enhance stability in vivo or to enhance transport properties. have. Examples of such modifications include chemical substitutions at ribose and / or phosphate and / or base positions. Aptamers identified in the SELEX process are described in US Pat. No. 5,660,985 ("High Affinity Nucleic Acid Ligands Containing Modified Nucleotides") which describes oligonucleotides comprising chemically modified nucleotide derivatives at the 5'- and 2'-positions of pyridine. It is described in. With reference to the above, US Pat. No. 5,580,737 is one or more of which is modified to 2'-amino (2'-NH2), 2'-fluoro (2'-F) and / or 2'-0-methyl (2'-OMe). High specific aptamers containing the above nucleotides are described. See also US 2009/0098549 (SELEX and PHOTOSELEX) which describes nucleic acid libraries having extended physical and chemical properties in SELEX and optical SELEX and their use. SELEX can also be used to identify aptamers with desirable off-rate properties. See US 2009/0004667 (Method for Generating Aptamers with Improved Off-Rates), which describes an improved SELEX method for generating aptamers that can bind to target molecules.
상기 앱타머는 샘플과 접촉하기 이전에 고체 지지체 상에 고정화된다. 그러나, 어떤 환경하에서, 샘플과 접촉하기 전 앱타머의 고정화는 최적의 검정을 제공하지 않을 수도 있다. 예를 들면, 앱타머의 전-고정화(pre-immobilization)는 아마도 긴 반응시간에 따른 고체 지지체 표면상의 표적 분자와 앱타머의 비효율적인 혼합을 야기할 수 있으므로, 그것의 표적 분자에 대한 앱타머의 효율적인 결합을 위하여 긴 배양기간을 요한다. 게다가, 광앱타머가 검정법에 사용되고 고체 지지체로서 사용된 물질에 의존하는 경우, 상기 고체 지지체는 광앱타머와 그것의 표적 분자 간의 공유 결합의 형성을 이루기 위하여 사용되는 빛을 산란시키거나 흡수하는 경향이 있을 수 있다. 더욱이, 사용된 방법에 따라, 고체 지지체의 표면은 또한 임의의 표지 시약에 노출되고 그것에 의해 영향을 받을 수 있기 때문에, 그것의 앱타머에 결합된 표적 분자의 검출은 부정밀도(imprecision)에 영향을 받기 쉽다. 마지막으로, 고체 지지체 상의 앱타머의 고정화는 일반적으로 샘플에 대한 앱타머의 노출 이전에 앱타머-제조 단계(즉, 고정화)를 포함하며, 이 제조 단계는 상기 앱타머의 활성 또는 기능성에 영향을 미칠 수 있다.The aptamer is immobilized on a solid support prior to contacting the sample. However, under certain circumstances, immobilization of the aptamer prior to contact with the sample may not provide an optimal assay. For example, pre-immobilization of aptamers may lead to inefficient mixing of the target molecule with the aptamer on the surface of the solid support, possibly over a long reaction time, so that the aptamer's Long incubation periods are required for efficient binding. In addition, if the photoaptamer is used in the assay and depends on the material used as the solid support, the solid support will tend to scatter or absorb light used to achieve the formation of covalent bonds between the photoaptamer and its target molecule. Can be. Moreover, depending on the method used, the detection of the target molecule bound to its aptamer affects the imprecision since the surface of the solid support can also be exposed to and affected by any labeling reagent. Easy to receive Finally, immobilization of the aptamer on the solid support generally includes an aptamer-manufacturing step (ie, immobilization) prior to the exposure of the aptamer to the sample, which production step affects the activity or functionality of the aptamer. Can be crazy
앱타머는 앱타머 바이오마커 복합체(또는 광앱타머 바이오마커 공유결합 복합체)로부터 검정 성분의 분리를 용이하게 하고, 검출 및/또는 정량화를 위한 앱타머의 단리가 가능하도록 구성될 수 있다. 일 구현에서, 이 구조체는 앱타머 서열 내에 절단 가능하거나(cleavable) 방출 가능한(releasable) 구성요소를 포함할 수 있다. 다른 구현에서, 부가적인 기능성, 예를 들어 표지 되거나 검출 가능한 성분, 스페이서(spacer) 성분 또는 특정 결합 태그 또는 고정화 구성요소가 앱타머 내로 도입될 수 있다. 예를 들면, 상기 앱타머는 절단 가능한 부분(moiety), 표지(label), 표지를 분리하는 스페이서 성분 및 방출 가능한 부분을 통하여 앱타머에 연결된 태그를 포함할 수 있다.Aptamers may be configured to facilitate separation of assay components from aptamer biomarker complexes (or photoaptamer biomarker covalent complexes) and to isolate aptamers for detection and / or quantification. In one embodiment, the construct may comprise cleavable or releasable components within the aptamer sequence. In other implementations, additional functionality may be introduced into the aptamers, such as labeled or detectable components, spacer components or specific binding tags or immobilization components. For example, the aptamer may comprise a cleavable moiety, a label, a spacer component that separates the label, and a tag connected to the aptamer through the releasable moiety.
상기 핵산 앱타머는 이에 한정되는 것은 아니나, DNA, RNA, 앤타고미어(anti-miR), 안티센스 분자, 소방해 RNA 분자 (siRNA), 소헤어핀 RNA 분자 (shRNA), 2'-O-변형 올리고뉴클레오타이드, 포스포로티오에이트-백본 디옥시리보뉴클레오타이드, 포스포로티오에이트-백본 리보뉴클레오타이드, 디코이 올리고뉴클레오타이드, PNA(peptide nucleic acid) 올리고뉴클레오타이드 또는 LNA(locked nucleic acid) 올리고뉴클레오타이드로 구성된 군에서 선택되는 어느 하나인 것을 특징으로 할 수 있다.The nucleic acid aptamers include, but are not limited to, DNA, RNA, antagonists (anti-miRs), antisense molecules, fire-fighting RNA molecules (siRNAs), small hairpin RNA molecules (shRNAs), 2'-0-modified oligonucleotides , Phosphorothioate-backbone deoxyribonucleotides, phosphorothioate-backbone ribonucleotides, decoy oligonucleotides, peptide nucleic acid (PNA) oligonucleotides, or locked nucleic acid (LNA) oligonucleotides. It can be characterized.
본 발명의 일 실시예에서, 아밀로이드베타 42에 특이적으로 결합하는 sequence 및 핵산 내부 자체 결합하는 sequence를 이용하여 아밀로이드베타 42와 결합 시 소광물질(quencher)이 떨어짐과 동시에 형광이 발현되는 구조적 특징을 가진 멀티핵산을 합성하였다. 상기 멀티핵산의 크기는 항체보다 작으므로 특이성 및 선택성이 우수하며, 1시간 이내 샘플링 및 대량분석이 가능하므로 진단 용이성이 높은 진단 방법 제공이 가능하다.In one embodiment of the present invention, by using a sequence that specifically binds to amyloid beta 42 and the self-binding sequence inside the nucleic acid structural features that the fluorescence is expressed at the same time the quencher (quencher) falls when combined with amyloid beta 42 With multinucleic acid. Since the size of the multinucleic acid is smaller than that of the antibody, the specificity and selectivity are excellent, and sampling and mass analysis are possible within 1 hour, thereby providing a high diagnostic method.
본 발명에 있어서, 상기 아밀로이드베타 42의 농도가 0 이상 500pg/ml 미만인 경우 정상, 500pg/ml 이상 1ng/ml 미만인 경우 경도인지장애(MCI) 또는 1ng/ml 이상인 경우 중증 환자로 진단하는 것을 특징으로 할 수 있다.In the present invention, when the concentration of amyloid beta 42 is 0 or more and less than 500 pg / ml, when it is normal, 500 pg / ml or more and less than 1 ng / ml, mild cognitive impairment (MCI) or 1 ng / ml or more is diagnosed as a serious patient. can do.
본 발명의 일 실시예에서, 선행 연구를 통하여 100명 이상의 치매 환자에서 아밀로이드베타 42를 정량화하여 경도 인지장애와 중등도 치매 구분에 성공(임상의사의 진단과 90%이상 일치)하였다.In one embodiment of the present invention, amyloid beta 42 was quantified in more than 100 patients with dementia through previous studies to successfully distinguish mild cognitive impairment and moderate dementia (more than 90% consistent with a clinician's diagnosis).
본 발명의 일 실시예에서, miR-485-3p의 증가 패턴이 아밀로이드베타 전구체로 알려져 있는 APP발현량에 유의하게 영향을 미치는 것을 확인하였다.In one embodiment of the present invention, it was confirmed that the increase pattern of miR-485-3p significantly affects the amount of APP expression known as amyloid beta precursor.
본 발명은 다른 관점에서, miR-485-3p를 증폭할 수 있는 프라이머 또는 miR-485-3p와 혼성화할 수 있는 프로브를 포함하는 알츠하이머병 또는 뇌 질환 진단용 조성물에 관한 것이다.In another aspect, the present invention relates to a composition for diagnosing Alzheimer's disease or brain disease, comprising a primer capable of amplifying miR-485-3p or a probe capable of hybridizing with miR-485-3p.
본 발명에 있어서, 상기 프라이머는 증폭될 miR-485-3p의 각 가닥과 대체적으로 상보성을 가지도록 제작되고, 적당한 G 또는 C 뉴클레오티드를 포함한다. 이것은 중합반응을 수행하는 조건에서 프라이머가 대응하는 핵산 가닥과 하이브리다이제이션 되기에 충분한 상보성을 가지는 것을 의미한다. 본 발명의 프라이머는 증폭 과정에 사용되며, 상기 증폭 과정은 예를 들면, PCR과 같은, 타겟 로커스가 많은 반응 단계를 거치면서 기하급수적인 숫자로 증가하는 효소 연속 반응이다. 전형적으로, 한 프라이머(안티센스 프라이머)는 로커스의 네가티브(-) 가닥에 대하여 상동성을 가지고, 나머지 하나의 프라이머(센스 프라이머)는 포지티브(+) 가닥에 대하여 상동성을 가진다. 변성된 핵산에 프라이머가 어닐링되면, DNA 폴리머라아제 I(Klenow) 및 뉴클레오티드와 같은 효소 및 반응물들에 의하여 사슬이 신장되고, 그 결과, 타겟 로커스 서열을 함유하는 + 와 - 가닥이 새롭게 합성된다. 상기 새로이 합성된 타겟 로커스가 주형으로도 사용되어 변성, 프라이머 어닐링 및 사슬 신장의 사이클이 반복되면 타겟 로커스 서열의 기하급수적인 합성이 진행된다. 상기 연속 반응의 산물은 반응에 사용된 특이 프라이머의 말단과 대응하는 말단을 가지는 독립적인 이중가닥 핵산이다.In the present invention, the primers are designed to be generally complementary to each strand of miR-485-3p to be amplified, and include appropriate G or C nucleotides. This means that the primers have sufficient complementarity to hybridize with the corresponding nucleic acid strands under the conditions for carrying out the polymerization. The primer of the present invention is used in the amplification process, which is an enzymatic continuous reaction in which the target locus, such as PCR, increases by an exponential number through many reaction steps. Typically, one primer (antisense primer) has homology to the negative (-) strand of the locus, and the other primer (sense primer) has homology to the positive (+) strand. When the primer is annealed to the denatured nucleic acid, the chain is stretched by enzymes and reactants such as DNA polymerase I (Klenow) and nucleotides, resulting in newly synthesized + and-strands containing the target locus sequence. The newly synthesized target locus is also used as a template, and the cycle of denaturation, primer annealing, and chain extension is repeated for exponential synthesis of the target locus sequence. The product of the continuous reaction is an independent double stranded nucleic acid having an end corresponding to the end of the specific primer used in the reaction.
상기 증폭 반응은 당해 분야에서 보편적으로 사용되고 있는 PCR인 것이 바람직하다. 그러나, Real-time PCR 또는 등온 효소를 사용한 선형증폭과 같은 대체적인 방법도 사용할 수 있으며, 멀티플렉스 증폭 반응 역시 사용할 수 있다.The amplification reaction is preferably a PCR that is commonly used in the art. However, alternative methods such as linear amplification with real-time PCR or isothermal enzymes can be used, and multiplex amplification reactions can also be used.
본 발명에 있어서, 상기 프로브는 검출할 수 있도록 표지되며, 예를 들면 방사선 동위원소, 형광 화합물, 바이오 발광화합물, 화학 발광 화합물, 금속 킬레이트 또는 효소로 표지될 수 있다. 상기와 같은 프로브를 적당하게 표지하는 것은 당해 분야에서 널리 알려진 기술이며, 통상적인 방법을 통하여 수행할 수 있다. 상기 프로브는 알려진 질병 진단용 핵산 바이오마커에 특이적으로 결합하는 프로브를 이용할 수 있으며, 이러한 프로브와의 결합 여부를 통하여, 특정 바이오마커 또는 그 단편의 함유 여부를 확인하여 질병을 진단할 수 있다.In the present invention, the probe is labeled so that it can be detected, for example, it can be labeled with radioisotopes, fluorescent compounds, bioluminescent compounds, chemiluminescent compounds, metal chelates or enzymes. Proper labeling of such probes is a technique well known in the art and can be carried out by conventional methods. The probe may use a probe that specifically binds to a known disease diagnostic nucleic acid biomarker. Through the binding of the probe to the known biomarker, the disease may be diagnosed by confirming the presence of a specific biomarker or a fragment thereof.
본 발명에 있어서, miR-485-3p의 서열은 포유류 유래 예를 들면, 인간, 마우스, 또는 래트 유래인 것을 특징으로 할 수 있다.In the present invention, the sequence of miR-485-3p may be derived from a mammal, for example, human, mouse, or rat.
본 발명의 일 실시예에서, miR-485-3p의 서열은 인간 유래이며, 성숙된 서열 (5' GUCAUACACGGCUCUCCUCUCU 3' (서열번호 1))은 물론, 전구 서열 (5'- ACUUGGAGAGAGGCUGGCCGUGAUGAAUUCGAUUCAUCAAAGCGAGUCAUACACGGCUCUCCUCUCUUUUAGU- 3' (서열번호 2))을 포함하는 것이다.In one embodiment of the invention, the sequence of miR-485-3p is derived from human and mature sequence (5 'GUCAUACACGGCUCUCCUCUCU 3' (SEQ ID NO: 1)), as well as the precursor sequence (5'- ACUUGGAGAGAGGCUGGCCGUGAUGAAUUCGAUUCAUCAAAGCGAGUCAUACACGGCUCUCCUCU CU 'UUUA sequence) Number 2)).
따라서, 본 발명에 있어서, 상기 프라이머 또는 프로브는 서열번호 1 또는 서열번호 2의 염기 서열의 전부 또는 일부와 상보적인 서열을 가지는 포함하는 것을 특징으로 할 수 있으나 이에 제한되는 것은 아니다.Thus, in the present invention, the primer or probe may be characterized by having a sequence complementary to all or part of the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2, but is not limited thereto.
본 발명에 있어서, 상기 알츠하이머병 또는 뇌 질환 진단용 조성물은 아밀로이드베타 42에 특이적으로 결합하는 항체 또는 핵산 앱타머를 추가로 더 포함하는 것을 특징으로 할 수 있다. 상기 항체 또는 핵산 앱타머는 아밀로이드베타 42를 검출하기 위한 것으로, 시료로부터 아밀로이드베타 42의 검출을 위해 어떠한 형태로도 사용할 수 있다.In the present invention, the composition for diagnosing Alzheimer's disease or brain disease may further comprise an antibody or nucleic acid aptamer specifically binding to amyloid beta 42. The antibody or nucleic acid aptamer is for detecting amyloid beta 42, and may be used in any form for detection of amyloid beta 42 from a sample.
본 발명은 또 다른 관점에서, 상기 알츠하이머병 또는 뇌 질환 진단용 조성물을 포함하는 알츠하이머병 또는 뇌 질환 진단용 키트에 관한 것이다.In another aspect, the present invention relates to a kit for diagnosing Alzheimer's disease or brain disease, comprising the composition for diagnosing Alzheimer's disease or brain disease.
본 발명의 진단용 키트는 알츠하이머병 및 또는 여러 가지 뇌 질환 질환의 진단에 사용될 수 있으며, 가장 바람직하게는 알츠하이머병의 진단에 이용될 수 있다.The diagnostic kit of the present invention can be used for diagnosing Alzheimer's disease and / or various brain diseases, and most preferably, for diagnosing Alzheimer's disease.
본 발명의 키트는 상기한 성분 이외에도, 다른 성분들을 추가로 포함할 수 있다. 예를 들어, 본 발명의 키트가 PCR 증폭 과정에 적용되는 경우에는, 선택적으로, PCR 증폭에 필요한 시약, 예컨대, 완충액, DNA 중합효소, DNA 중합 효소 보조인자 및 dNTP를 포함할 수 있으며, 이에 한정된 것은 아니다. 본 발명의 키트는 상기한 시약 성분을 포함하는 다수의 별도 패키징 또는 컴파트먼트로 제작될 수 있다.The kit of the present invention may further include other components in addition to the above components. For example, when the kit of the present invention is applied to a PCR amplification process, it may optionally include reagents required for PCR amplification, such as buffers, DNA polymerases, DNA polymerase cofactors and dNTPs. It is not. Kits of the invention can be produced in a number of separate packaging or compartments containing the reagent components described above.
또한, 본 발명에 따른 키트는 마이크로어레이일 수 있으며, 바람직하게는유전자 증폭 키트가 될 수 있다. 상기 키트가 마이크로어레이인 경우에는, 마이크로어레이의 고상표면에 프로브가 고정화되어 있다. 본 발명의 키트가 유전자 증폭 키트인 경우에는 프라이머를 포함한다. 프로브 또는 프라이머는 본 발명에 따른 miR-485-3p를 특이적으로 인식하는 것으로 상기 서열에 상보적인 서열을 가진다. 사용된 용어 '상보적(complementary)'은 상기에서 정의된 바와 같이, 소정의 혼성화 또는 어닐링 조건하에서 상기 뉴클레오타이드 서열에 선택적으로 혼성화 할 정도의 상보성을 갖는 것을 의미하며, 본 발명의 프로브 또는 프라이머는 완전 상보적인 것 이외에 상기 뉴클레오타이드 서열에 선택적으로 혼성화 할 수 있을 정도이면, 하나 또는 그 이상의 미스매치(mismatch) 염기서열을 가질 수 있다. 프라이머 또는 프로브 제작 시 참조하여야 하는 본 발명의 miRNA의 뉴클레오타이드 서열은 miRBase에서 확인할 수 있으며, 이 서열을 참조하여 프라이머 또는 프로브를 디자인할 수 있다.In addition, the kit according to the invention may be a microarray, preferably a gene amplification kit. When the kit is a microarray, a probe is immobilized on the solid surface of the microarray. When the kit of the present invention is a gene amplification kit, it includes a primer. The probe or primer has a sequence complementary to that sequence as specifically recognizing miR-485-3p according to the present invention. The term 'complementary' as used herein means that it has complementarity enough to selectively hybridize to the nucleotide sequence under predetermined hybridization or annealing conditions, as defined above, and the probe or primer of the present invention is fully In addition to being complementary, the nucleotide sequence may have one or more mismatch sequences as long as it can selectively hybridize to the nucleotide sequence. The nucleotide sequence of the miRNA of the present invention, which should be referred to when preparing a primer or probe, may be identified in miRBase, and the primer or probe may be designed with reference to this sequence.
본 발명에 따른 miR-485-3p의 활성을 억제할 수 있는 물질 및 약학적으로 허용 가능한 담체를 포함하는 조성물은 알츠하이머병 또는 뇌 질환의 예방 또는 치료용 약학 조성물로 제공될 수 있다.The composition comprising a substance capable of inhibiting the activity of miR-485-3p and a pharmaceutically acceptable carrier according to the present invention may be provided as a pharmaceutical composition for preventing or treating Alzheimer's disease or brain disease.
본 발명의 miR-485-3p에 의한 ELAVL2의 발현 감소가 알츠하이머병과 연관되어 있음을 규명한 것에 근거한 것으로, miR-485-3p의 활성을 억제할 수 있는 물질 및 약학적으로 허용 가능한 담체를 포함하는, 알츠하이머병 질환 치료 또는 예방용 약학 조성물을 제공한다.Based on the finding that the decrease in the expression of ELAVL2 by miR-485-3p of the present invention is associated with Alzheimer's disease, it comprises a substance capable of inhibiting the activity of miR-485-3p and a pharmaceutically acceptable carrier. It provides a pharmaceutical composition for treating or preventing Alzheimer's disease.
이때 상기 "miR" 는 주로 표적 RNA의 번역을 억제하여나 분해를 촉진함으로써 유전자 발현 후 전사단계에 관여하는 조절인자로 알려져 있고 21 내지 23개 디옥시리보뉴클레오티드로 이루어진 비코딩 RNA를 의미한다.At this time, the "miR" is known as a regulator that is involved in the transcriptional step after gene expression mainly by inhibiting translation or promoting degradation of the target RNA, and means non-coding RNA consisting of 21 to 23 deoxyribonucleotides.
또한, 상기 miR의 성숙 서열은 miR데이터베이스 (http://www.mirbase.org)에서 얻을 수 있다. 2012년 8월 현재 miR데이터베이스 (19판, miRBase)에 의하면 193개 종에서 유래한 25,141개의 성숙 miR가 등록되어 있다.In addition, the mature sequence of the miR can be obtained from the miR database (http://www.mirbase.org). As of August 2012, the miR database (19th edition, miRBase) lists 25,141 mature miRs from 193 species.
본 발명에 있어서, miR-485-3p는 이에 한정되는 것은 아니지만, 뇌, 특히 해마 및 피질에서 발현되어, ELAVL2 단백질을 코딩하는 ELAVL2 mRNA의 3' 비번역 부위에 결합하여, 이의 발현을 억제하여, 뇌에서의 ELAVL2 단백질 농도를 감소시킨다.In the present invention, miR-485-3p is expressed in the brain, particularly the hippocampus and cortex, but is not limited thereto, binds to the 3 'untranslated site of ELAVL2 mRNA encoding ELAVL2 protein, thereby inhibiting its expression, Decreases ELAVL2 protein concentration in the brain.
본 발명에 있어서, miR-485-3p의 활성 억제는 miR-485-3p의 세포 내 작용 또는 기능을 억제 또는 방해하는 것을 의미하는 것으로 전형적으로 miR-485-3p가 이의 표적, 예를 들면 ELAVL2 단백질을 코딩하는 mRNA 분자와의 결합을 직접적으로 억제하거나, 또는 저분자 억제제, 항체 또는 항체의 단편을 이용하여 miR-485-3p의 기능을 직접적으로 억제하거나, 또는 억제제 또는 small interfering RNA (siRNA)분자를 이용하여 간접적으로 조절되는 것을 포함한다.In the present invention, inhibiting the activity of miR-485-3p means inhibiting or interfering with intracellular actions or functions of miR-485-3p, and typically miR-485-3p is a target thereof, for example ELAVL2 protein. Directly inhibits the binding of the mRNA molecule that encodes the protein to the molecule, or directly inhibits the function of miR-485-3p using a small molecule inhibitor, antibody or fragment of the antibody, or inhibits the inhibitor or small interfering RNA (siRNA) molecule. And indirectly controlled using.
나아가 miR-485-3p의 활성의 방해 또는 억제는 직접 또는 간접적으로 전구서열(서열번호 2) 및 성숙서열 (서열번호 1)의 활성을 억제하는 것을 포함한다. 또한, miR-485-3p의 활성 억제는 miR-485-3p의 전사를 억제하여 이의 세포 내 농도를 낮추는 것을 포함한다.Furthermore, the inhibition or inhibition of the activity of miR-485-3p includes inhibiting the activity of the precursor sequence (SEQ ID NO: 2) and the mature sequence (SEQ ID NO: 1) directly or indirectly. In addition, inhibiting the activity of miR-485-3p includes inhibiting miR-485-3p transcription and lowering its intracellular concentration.
상기 miR-485-3p의 활성을 억제할 수 있는 물질은 이의 발현 및/또는 활성을 억제할 수 있는 임의의 물질을 포함하며, 이러한 물질은 예로서 화합물 (저분자, 고분자), 앤타고미어, 안티센스 분자, 소헤어핀 RNA 분자 (shRNA), 소방해 RNA 분자 (siRNA), 시드 표적 LNA (Locked Nucleic Acid) 올리고뉴클레오타이드, 데코이올리고뉴클레오타이드, 앱타머, 리보자임, 또는 DNA:RNA 하이브리드를 인지하는 항체를 포함할 수 있다.Substances capable of inhibiting the activity of miR-485-3p include any substance capable of inhibiting its expression and / or activity, such substances include, for example, compounds (small molecules, polymers), antagonists, antisenses Molecules, small hairpin RNA molecules (shRNA), fire-fighting RNA molecules (siRNA), seed target Locked Nucleic Acid (LNA) oligonucleotides, decoyoligonucleotides, aptamers, ribozymes, or antibodies that recognize DNA: RNA hybrids can do.
상기 안티센스 올리고뉴클레오타이드는 표적으로 하는 miRNA, 특히 miRNA의 씨드 서열의 전부 또는 일부와 상보적인 서열을 가지고 있어 miRNA와 이합체(duplex)를 형성할 수 있는 핵산-기반 분자를 포괄하는 것이다. 따라서 상기 안티센스 올리고뉴클레오타이드는 상보적 핵산-기반 억제제로 나타낼 수 있다.The antisense oligonucleotide encompasses a nucleic acid-based molecule having a sequence complementary to all or a portion of a miRNA, in particular a miRNA seed sequence, to form a duplex with the miRNA. Thus the antisense oligonucleotides can be represented as complementary nucleic acid-based inhibitors.
또한, 상기 안티센스 올리고뉴클레오타이드에는 다양한 분자가 포함되며, 예를 들면 리보핵산(RNA), 디옥시리보핵산(DNA), 앤타고미어, 2'-O-변형 올리고뉴클레오타이드, 포스포로티오에이트-백본 디옥시리보뉴클레오타이드, 포스포로티오에이트-백본 리보뉴클레오타이드, PNA(peptide nucleic acid) 올리고뉴클레오타이드 또는 LNA(locked nucleic acid) 올리고뉴클레오타이드로서, 바람직하게는 리보핵산이다. In addition, the antisense oligonucleotides include a variety of molecules, for example ribonucleic acid (RNA), deoxyribonucleic acid (DNA), antagonists, 2'-0-modified oligonucleotides, phosphorothioate-backbone deoxyribonucleotides, Phosphorothioate-backbone ribonucleotides, peptide nucleic acid (PNA) oligonucleotides or locked nucleic acid (LNA) oligonucleotides, preferably ribonucleic acid.
상기 리보핵산은 이중가닥 소헤어핀 RNA 분자 (shRNA), 소방해 RNA 분자 (siRNA) 및 라이보자임을 포함한다.The ribonucleic acid includes double stranded small hairpin RNA molecules (shRNA), fire-fighting RNA molecules (siRNA), and ribozymes.
상기 LNA는 기존 올리고뉴클레오타이드에 비해 리보오스 당 부위의 2'내지 4' 탄소 사이에 추가적인 변형을 가햐여 잠금(locked)형태를 가지게 되어 열 안정성을 확보한다.The LNA has an additional modification between 2 'and 4' carbons of the ribose sugar site as compared to conventional oligonucleotides to have a locked form to secure thermal stability.
상기 PNA(peptide nucleic acids)는 당-포스페이트 백본 대신에 펩타이드-기반 백본을 포함한다. 2'-O-변형 올리고뉴클레오타이드는 바람직하게는 2'-O-알킬 올리고뉴클레오타이드이고, 보다 바람직하게는 2'-O-C1-3 알킬 올리고뉴클레오타이드이며, 가장 바람직하게는 2'-O-메틸 올리고뉴클레오타이드이다.The peptide nucleic acids (PNA) include a peptide-based backbone instead of a sugar-phosphate backbone. The 2'-0-modified oligonucleotide is preferably a 2'-0-alkyl oligonucleotide, more preferably a 2'-0-C1-3 alkyl oligonucleotide, most preferably a 2'-0-methyl oligonucleotide. Nucleotides.
상기 안티센스 올리고뉴클레오타이드는, 좁은 의미의 안티센스 올리고뉴클레오타이드, 앤타고미어 및 억제 RNA 분자를 포함한다.The antisense oligonucleotides include narrow sense antisense oligonucleotides, antagonists and inhibitory RNA molecules.
상기 앤타고미어는 단일-가닥의 화학적으로 변형된 올리고뉴클레오타이드로서, 내인성 microRNA의 침묵 (silence)에 사용된다. 앤타고미어는 Arganoute 2 (Ago 2) 절단 부위에서 상보적이지 않는 서열을 포함하거나, 또는 Ago2 절단이 억제되도록 염기가, 예를 들면 2' 메톡시기, 3' 콜레스테롤기, 포스포로씨오에이트로 변형되어 있으며, 표적서열에 상보적 서열을 가진다.The antagonists are single-stranded chemically modified oligonucleotides, used for silencing of endogenous microRNAs. Antagonists include sequences that are not complementary at the Arganoute 2 (Ago 2) cleavage site, or bases such as 2 'methoxy groups, 3' cholesterol groups, phosphorothioates such that Ago2 cleavage is inhibited It is modified and has a complementary sequence to the target sequence.
본 발명에 있어서, 상기 앤타고미어는 miR-485-3p에 적어도 부분적으로 또는 완전하게 상보적인 서열을 갖는다. 본 발명의 실시예에서 앤타고미어는 하나 이상의 변형 (예컨대, 2'-O-메틸-당 변형, 또는 3' 콜레스테롤 변형)을 포함한다. 다른 실시예에서 앤타고미어는 하나 이상의 포스포로씨오에이트 결합을 포함하며, 적어도 부분적으로 포스포로티오에이트 백본을 갖는다.In the present invention, the antagonists have a sequence that is at least partially or completely complementary to miR-485-3p. In an embodiment of the invention antagonists comprise one or more modifications (eg, 2′-O-methyl-sugar modifications, or 3 ′ cholesterol modifications). In another embodiment, the antagonist comprises one or more phosphorothioate linkages and at least partially has a phosphorothioate backbone.
본 발명에 있어서, 상기 miR-485-3p의 발현을 억제하기 위하여 적합한 앤타고미어의 길이는 7-50 뉴클레오타이드, 특히 10-40 뉴클레오타이드, 특히 15-30 뉴클레오타이드, 더더욱 특히 15-25 뉴클레오타이드, 특히 16 내지 19nt이나, 이에 제한되는 것은 아니다.In the present invention, suitable lengths of antagonists for inhibiting the expression of miR-485-3p are 7-50 nucleotides, in particular 10-40 nucleotides, in particular 15-30 nucleotides, even more particularly 15-25 nucleotides, in particular 16 To 19nt, but is not limited thereto.
본 발명에서 사용된 용어 '상보적'은 소정의 혼성화 또는 어닐링 조건, 바람직하게는 생리학적 조건하에서 안티센스 올리고뉴클레오타이드가 miR-485-3p 표적에 선택적으로 혼성화 할 정도로 충분히 상보적인 것을 의미하며, 일부 또는 부분적으로 실질적으로 상보적(substantially complementary) 및 완전히 상보적 (perfectly complementary)인 것을 모두 포괄하는 의미를 가지며, 바람직하게는 완전히 상보적인 것을 의미한다. 실질적으로 상보적이란, 완전히 상보적인 것은 아니지만, 표적 서열에 결합하여 본 발명에 따른 효과 즉, miR-485-3p의 활성을 방해하기에 충분한 효과를 낼 정도의 상보성을 의미하는 것이다.As used herein, the term 'complementary' means that the antisense oligonucleotide is sufficiently complementary to selectively hybridize to a miR-485-3p target, under some hybridization or annealing conditions, preferably physiological conditions, and in part or It has the meaning encompassing both partially and substantially complementary and perfectly complementary, and preferably means completely complementary. Substantially complementary means, but not completely complementary, complementary enough to bind to the target sequence and have a sufficient effect to interfere with the activity of miR-485-3p according to the present invention.
상기 '핵산'은 올리고뉴클레오타이드, DNA, RNA, 및 폴리뉴클레오타이드, 그 유사체 및 그 유도체를 포함하는 것으로 예를 들면 펩타이드 핵산 (PNA) 또는 그 혼합물을 포함한다. 또한, 핵산은 단일 또는 이중 가닥일 수 있으며, mRNA, microRNA, siRNA 또는 폴리펩타이드 등을 포함하는 분자를 코딩할 수 있다.The term 'nucleic acid' includes oligonucleotides, DNA, RNA, and polynucleotides, analogs and derivatives thereof, and includes, for example, peptide nucleic acids (PNAs) or mixtures thereof. In addition, nucleic acids may be single or double stranded, and may encode molecules comprising mRNA, microRNA, siRNA or polypeptides, and the like.
본 발명의 실시예에서, miR-485-3p의 활성을 억제할 수 있는 물질은 miR-485-3p의 전구체 및/또는 성숙 서열의 전부 또는 일부, 특히 씨드 서열에 상보적으로 결합하여, 이의 활성을 억제할 수 있는 안티센스 올리고뉴클레오타이드이다. 상기 활성의 억제는 miR-485-3p의 전사 및/또는 miR-485-3p의 표적 mRNA와의 결합을 억제하는 것이다. 본 발명에 따른 안티센스 올리고뉴클레오타이드는 이를 구성하는 뉴클레오타이드 또는 뉴클레오타이드를 연결하는 백본(골격)이 하기 하나 이상의 변형을 포함할 수 있거나, 또는 포함하지 않을 수 있다. 즉 상기 안티센스 올리고뉴클레오타이드는 이를 구성하는 하나 이상의 뉴클레오타이드가 LNA, 또는 이를 구성하는 하나 이상의 뉴클레오타이드의 당이 2'-O- 메틸화 및 메독실에틸, 또는 이의 백본에 하나이상의 포스포티오에이트를 포함할 수 있다.In an embodiment of the present invention, a substance capable of inhibiting the activity of miR-485-3p binds complementarily to all or part of the precursor and / or mature sequence of miR-485-3p, in particular the seed sequence, and thus its activity. It is an antisense oligonucleotide that can inhibit. Inhibition of this activity is to inhibit transcription of miR-485-3p and / or binding of miR-485-3p with target mRNA. The antisense oligonucleotides according to the present invention may or may not comprise one or more modifications of the nucleotides constituting them or the backbone (skeleton) connecting them. That is, the antisense oligonucleotide may include one or more nucleotides constituting the LNA, or a sugar of one or more nucleotides constituting the same, 2'-0-methylated and medoxylethyl, or one or more phosphothioates in the backbone thereof. have.
본 발명의 실시예에서, 안티센스 올리고뉴클레오타이드 또는 핵산분자는 miR-485-3p의 씨드서열의 전부 또는 일부에 상보적인 서열을 포함한다. 상기 씨드서열은 miRNA의 표적분자의 인지에 매우 중요한 다양한 종에서 보존된 서열이다(Krenz, M. et al., J. Am. Coll. Cardiol. 44:2390-2397(2004); H. Kiriazis, et al., Annu. Rev. Physiol. 62:321(2000)). miRNA는 씨드서열을 통해 표적과 결합하기 때문에, 씨드서열의 표적과의 상호작용을 억제하는 경우, 표적 mRNA의 번역 등을 효과적으로 억제할 수 있다.In an embodiment of the invention, the antisense oligonucleotide or nucleic acid molecule comprises a sequence complementary to all or part of the seed sequence of miR-485-3p. The seed sequence is a sequence conserved in various species that is very important for recognition of target molecules of miRNA (Krenz, M. et al., J. Am. Coll. Cardiol. 44: 2390-2397 (2004); H. Kiriazis, et al., Annu. Rev. Physiol. 62: 321 (2000). Since miRNA binds to the target through the seed sequence, when the seed sequence is inhibited from interacting with the target, translation of the target mRNA can be effectively suppressed.
본 발명의 실시예에서 서열번호 1의 뉴클레오타이드 서열 중 1번째 또는 2번째부터 7번째 또는 8번째까지의 뉴클레오타이드 서열에 전부 또는 부분적으로 상보적인 서열을 포함하며, 예를 들면 본 발명의 안티센스 올리고뉴클레오타이드는 5'-GUGUAUGAC-3'(서열번호 3), 5'-UGUAUGAC-3'(서열번호 4), 5'-GUGUAUGA-3'(서열번호 5), 5'-UGUAUGA-3'(서열번호 6) 또는 5'-AGAGAGGAGAGCCGUGUAUGAC-3'(서열번호 7)일 수 있으며, 상기 올리고뉴클레오타이드를 구성하는 하나 이상의 각 뉴클레오타이드는 2'-O- 메틸화 또는 메독실에틸화되거나, 또는 상기 각 하나 이상의 뉴클레오타이드는 LNA이거나, 또는 상기 백본을 구성하는 화학결합 중 하나 이상은 포스포티오에이트일 수 있으나, 상기 변형을 포함하지 않을 수도 있다.In an embodiment of the present invention comprises a sequence which is partially or completely complementary to the nucleotide sequence of the first or second to seventh or eighth of the nucleotide sequence of SEQ ID NO: 1, for example the antisense oligonucleotide of the present invention 5'-GUGUAUGAC-3 '(SEQ ID NO: 3), 5'-UGUAUGAC-3' (SEQ ID NO: 4), 5'-GUGUAUGA-3 '(SEQ ID NO: 5), 5'-UGUAUGA-3' (SEQ ID NO: 6 ) Or 5'-AGAGAGGAGAGCCGUGUAUGAC-3 '(SEQ ID NO: 7), wherein each of the one or more nucleotides constituting the oligonucleotide is 2'-0- methylated or medoxylethylated, or each of said one or more nucleotides is LNA Or one or more of the chemical bonds constituting the backbone may be phosphothioate, but may not include such modifications.
본 발명은 miR-485-3p이 ELAVL2의 발현을 과도하게 억제하여 알츠하이머병 및 여러 가지 뇌질환 발병에 관여한다는 발견에 근거한 것이다. The present invention is based on the discovery that miR-485-3p excessively inhibits the expression of ELAVL2 and is involved in the development of Alzheimer's disease and various brain diseases.
ELAVL2 발현량 감소는 알츠하이머병, 자폐 스펙트럼 장애, 정신지체, 근위축성 측색 경화증발병과 관련이 있다고 알려져 있다. 특히 흥분독성을 유발하는 kainic acid, NMDA, quisulate, AMPA, glutamate 등의 물질에 ELAVL2의 단백질 레벨이 감소하고, 뇌신경 세포죽음을 초래하여 뇌 기능의 장애를 유발하여 경련, 뇌졸중, 파킨슨씨 병, 척수손상 등과 같은 여러 가지 뇌 질환을 일으킨다는 것이 알려져 있다(Kaminska, B. et al., Acta Biochim Pol. 44:781-789).Reduced ELAVL2 expression levels are known to be associated with Alzheimer's disease, autism spectrum disorders, mental retardation, and atrophic lateral sclerosis. In particular, the levels of ELAVL2 are reduced in substances such as kainic acid, NMDA, quisulate, AMPA, and glutamate, which cause excitatory toxicity, and it causes brain dysfunction by causing neuronal cell death, causing cramps, stroke, Parkinson's disease, and spinal cord. It is known to cause various brain diseases such as damage (Kaminska, B. et al., Acta Biochim Pol. 44: 781-789).
따라서 본 발명의 miR-485-3p 활성 억제를 통한 ELAVL2 단백질의 회복은 알츠하이머병 및/또는 자폐 스펙트럼 장애, 정신지체, 근위축성 측색 경화증, 경련, 뇌졸중, 파킨슨씨 병, 척수손상 등과 같은 여러 가지 뇌 질환의 치료에 사용될 수 있다.Therefore, the recovery of ELAVL2 protein by inhibiting miR-485-3p activity of the present invention can be used in various brains such as Alzheimer's disease and / or autism spectrum disorder, mental retardation, amyotrophic lateral sclerosis, convulsions, stroke, Parkinson's disease, spinal cord injury, etc. It can be used for the treatment of diseases.
본 발명의 실시예에서는 상기 miR-485-3p의 활성을 억제할 수 있는 물질을 포함하는 약학 조성물은 알츠하이머병 (Alzheimer's disease)의 치료에 사용되고, 뇌 질환은 알츠하이머병을 비롯하여, 자폐 스펙트럼 장애, 정신지체, 근위축성 측색 경화증, 경련, 뇌졸중, 파킨슨씨 병, 척수손상을 포함하지만 이에 한정된 것은 아니다. In an embodiment of the present invention, the pharmaceutical composition comprising a substance capable of inhibiting the activity of miR-485-3p is used for the treatment of Alzheimer's disease, and brain diseases, including Alzheimer's disease, autism spectrum disorder, mental It includes, but is not limited to, retardation, amyotrophic lateral sclerosis, cramps, stroke, Parkinson's disease, and spinal cord injury.
본 발명에서 사용된 용어 '치료', '완화' 또는 '개선'이란 본 조성물의 투여로 관련 질환의 증세를 호전시키거나 이롭게 변경하는 모든 행위를 의미한다. 본원이 속하는 기술분야에서 통상의 지식을 가진 자라면, 대한의학협회 등에서 제시된 자료를 참조하여 질환의 정확한 기준을 알고, 개선, 향상 및 치료된 정도를 판단할 수 있을 것이다.As used herein, the term 'treatment', 'mitigation' or 'improvement' means any action that improves or beneficially alters the symptoms of a related disease by administration of the composition. Those skilled in the art to which the present application belongs, will be able to know the exact criteria of the disease, and to determine the degree of improvement, improvement and treatment with reference to the data presented by the Korean Medical Association.
본 발명에서 사용된 용어 '예방'은 관련 질환의 발병을 억제 또는 지연시키는 모든 행위를 의미한다. 본 발명에 있어서 상기 약학 조성물은 초기 증상, 또는 나타나기 전에 투여할 경우 관련 질환을 예방할 수 있다는 것은 당업자에게 자명할 것이다.As used herein, the term "prevention" refers to any action that inhibits or delays the development of related diseases. In the present invention, it will be apparent to those skilled in the art that the pharmaceutical composition can prevent related symptoms when administered before the initial symptoms or symptoms appear.
본 발명에 있어서, 상기 약학 조성물은 본 발명의 miR-485-3p의 활성을 억제할 수 있는 물질 이외에 관련질환의 치료를 위해 동일, 유사 또는 시너지 기능을 나타내는 유효성분을 1종류 이상 또는 miR-485-3p의 활성을 억제할 수 있는 물질 및 유효성분의 용해성 및/또는 흡수성을 유지/증가시키는 화합물을 추가로 함유할 수 있다. 또한, 선택적으로, 면역조절제 및/또는 화학치료제를 추가로 포함할 수 있다.In the present invention, the pharmaceutical composition is one or more active ingredients or miR-485 exhibiting the same, similar or synergistic function for the treatment of related diseases, in addition to the substance that can inhibit the activity of miR-485-3p of the present invention It may further contain a compound capable of inhibiting the activity of -3p and a compound which maintains / increases the solubility and / or absorption of the active ingredient. It may also optionally further comprise immunomodulators and / or chemotherapeutic agents.
상기 약학 조성물은 상기 언급한 유효성분 이외에 추가로 약학적으로 허용가능한 희석제, 담체 및/또는 아주번트를 1종 이상 포함할 수 있다. 약학적으로 허용 가능한 담체는 식염수, 멸균수, 링거액, 완충 식염수, 덱스트로즈 용액, 말토덱스트린 용액, 글리세롤, 에탄올, 리포좀 및 이들 성분 중 하나 이상의 성분을 혼합하여 사용할 수 있으며, 필요에 따라 항산화제, 완충액, 정균제 등 다른 통상의 첨가제를 첨가할 수 있다.The pharmaceutical composition may further contain one or more pharmaceutically acceptable diluents, carriers and / or adjuvants in addition to the above-mentioned active ingredients. Pharmaceutically acceptable carriers may be used in combination with saline, sterile water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol, liposomes, and one or more of these components, as necessary. Other conventional additives, such as a buffer and bacteriostatic agent, can be added.
또한, 희석제, 분산제, 계면활성제, 결합제 및 윤활제를 부가적으로 첨가하여 수용액, 현탁액, 유탁액 등과 같은 주사용 제형, 환약, 캡슐, 과립 또는 정제로 제제화할 수 있으며, 표적 기관에 특이적으로 작용할 수 있도록 표적 기관 특이적 항체 또는 기타 리간드를 상기 담체와 결합시켜 사용할 수 있다.In addition, diluents, dispersants, surfactants, binders, and lubricants may be additionally added to formulate into injectable formulations, pills, capsules, granules, or tablets, such as aqueous solutions, suspensions, emulsions, and the like, which will act specifically on target organs. Target organ specific antibodies or other ligands can be used in combination with the carriers.
나아가 해당 기술분야의 적정한 방법으로 또는 레밍턴의 문헌(Remington's Pharmaceutical Science(최근판), Mack Publishing Company, Easton PA)에 개시되어 있는 방법을 이용하여 각 질환에 따라 또는 성분에 따라 바람직하게 제형화할 수 있다. 예를 들면 현탁액, 리포좀 제형, 에멀젼, 정제, 캡슐, 젤, 시럽 또는 좌제 중 어느 한 가지로 제형화 할 수 있다. Furthermore, it may be preferably formulated according to each disease or component by a suitable method in the art or using a method disclosed in Remington's Pharmaceutical Science (Recent Edition, Mack Publishing Company, Easton PA). . For example, it may be formulated as a suspension, liposome formulation, emulsion, tablet, capsule, gel, syrup or suppository.
본 발명에 따른 약학 조성물의 투여방법은 특별히 제한되는 것은 아니며, 공지된 억제제의 투여방법을 적용할 수 있으며, 목적하는 방법에 따라 비경구 투여(예를 들어 비강내, 정맥 내, 피하, 복강 내 또는 국소에 적용)하거나 경구 투여할 수 있으며, 신속한 치료효과를 얻기 위해서는 비강내 주입에 의한 투여가 바람직하다.The method of administering the pharmaceutical composition according to the present invention is not particularly limited, and known administration methods of inhibitors may be applied, and parenteral administration (for example, intranasal, intravenous, subcutaneous, intraperitoneal) according to a desired method. Or topical administration) or oral administration, and administration by intranasal infusion is preferred for rapid therapeutic effect.
또한, 본 발명에 따른 약학 조성물은 약학적으로 유효한 양으로 투여한다. 상기 '약학적 또는 치료적으로 유효한 양'은 의학적 치료에 적용 가능한 합리적인 수혜/위험 비율로 질환을 치료하기에 충분한 양을 의미하며, 유효용량 수준은 환자의 질환의 종류, 중증도, 약물의 활성, 약물에 대한 민감도, 투여 시간, 투여 경로 및 배출 비율, 치료기간, 동시 사용되는 약물을 포함한 요소 및 기타 의학 분야에 잘 알려진 요소에 따라 결정될 수 있다.In addition, the pharmaceutical composition according to the present invention is administered in a pharmaceutically effective amount. The 'pharmaceutically or therapeutically effective amount' refers to an amount sufficient to treat a disease at a reasonable benefit / risk ratio applicable to medical treatment, and the effective dose level is a type of disease, severity, drug activity, Sensitivity to drug, time of administration, route of administration and rate of release, duration of treatment, factors including concurrent use of drugs, and other factors well known in the medical arts.
상기 약학 조성물은 개별 치료제로 투여하거나 다른 치료제와 병용하여 투여될 수 있고 종래의 치료제와는 순차적 또는 동시에 투여될 수 있으며, 단일 또는 다중 투여될 수 있다. 상기한 요소들을 모두 고려하여 부작용 없이 최소한의 양으로 최대 효과를 얻을 수 있는 양을 투여하는 것이 중요하며, 이는 당업자에 의해 용이하게 결정될 수 있다.The pharmaceutical composition may be administered as a separate therapeutic agent or in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be single or multiple doses. Taking all of the above factors into consideration, it is important to administer an amount that can achieve the maximum effect with a minimum amount without side effects, which can be readily determined by one skilled in the art.
상기 투여량은 환자의 체중, 연령, 성별, 건강상태, 식이, 투여시간, 투여방법, 배설률 및 질환의 중증도 등에 따라 그 범위가 매우 다양하며, 적정한 투여량은 예를 들면 환자의 체내에 축적된 약물의 양 및/또는 사용되는 폴리뉴 클레오타이드의 구체적 효능 정도에 따라 달라질 수 있다. 일반적으로 인 비보 동물모델 및 인 비트로에서 효과적인 것으로 측정된 EC50을 기초로 계산될 수 있으며, 예를 들면 체중 1kg당 0.01μg 내지 1g 일 수 있으며, 일별, 주별, 월별 또는 연별의 단위 기간으로, 단위 기간당 일 회 내지 수회 나누어 투여될 수 있으며, 또는 인퓨전 펌프를 이용하여 장기간 연속적으로 투여될 수 있다. 반복투여 횟수는 약물이 체내 머무는 시간, 체내 약물 농도 등을 고려하여 결정된다. 질환 치료 경과에 따라 치료가 된 후라도, 재발을 위해 약학 조성물이 투여될 수 있다.The dosage varies widely depending on the patient's weight, age, sex, health condition, diet, time of administration, method of administration, excretion rate and severity of the disease, and the appropriate dosage is for example accumulated in the patient's body. The amount of drug and / or the degree of specific efficacy of the polynucleotide used may vary. It can generally be calculated based on an EC50 measured in vivo in an in vivo animal model and in vitro, for example from 0.01 μg to 1 g per kg of body weight, in units of daily, weekly, monthly or yearly units. It may be administered once to several times per period, or may be administered continuously for a long time using an infusion pump. The number of repeated doses is determined in consideration of the time the drug stays in the body, the drug concentration in the body, and the like. Even after treatment according to the course of the disease, the pharmaceutical composition may be administered for recurrence.
본 발명의 실시예에서, miR-485-3p를 시험물질과 접촉시키는 단계 및 상기 시험물질과 접촉된 miR-485-3p의 활성을 결정하는 단계를 포함하며, 상기 접촉된 miR-485-3p 의 활성이, 상기 시험물질과 접촉되지 않은 대조군의 miR-485-3p의 활성과 비교하여 감소한 경우 이를 후보물질로 선별하는 것인, 알츠하이머병 또는 뇌 질환치료 또는 예방용 물질의 스크리닝 방법을 제시한다.In an embodiment of the present invention, the method comprises contacting miR-485-3p with a test substance and determining the activity of miR-485-3p in contact with the test substance, wherein the contact of miR-485-3p is performed. If the activity is reduced compared to the activity of miR-485-3p of the control group that is not in contact with the test substance, it is selected as a candidate substance, it provides a screening method of a substance for treating or preventing Alzheimer's disease or brain disease.
상기 miR-485-3p는 이를 발현하는 세포의 형태로 제공되며, 상기 활성은 miR-485-3p의 발현으로 분석되는 것이다. 예를들어 본 발명에 따른 miR-485-3p을 발현하는 세포를 시험물질과 접촉시킨 후, miR-485-3p의 발현량의 변화를 접촉 전 또는 접촉되지 않은 대조군 세포와 비교하여, 발현량에 변동, 특히 감소가 있는 것을 후보물질로 선별한다. 상기 miR-485-3p의 발현량 측정은 노던블랏, RT-PCR, 마이크로 어레이를 이용한 혼성화 방법 등과 같은 공지된 방법을 이용하여 수행될 수 있다.The miR-485-3p is provided in the form of cells expressing it, and the activity is analyzed by expression of miR-485-3p. For example, after contacting a cell expressing miR-485-3p according to the present invention with a test substance, the change in the expression level of miR-485-3p is compared to the control cells before or without contact. Candidates are screened for variations, especially decreases. Expression measurement of the miR-485-3p can be performed using a known method such as Northern blot, RT-PCR, hybridization method using a micro array.
상기 miR-485-3p는 이를 발현하는 세포의 형태로 제공되며, 상기 활성은 상기 miR-485-3p와 이의 표적인 ELAVL2 단백질(ELAV like neuron-specific RNA binding protein 2)의 3'-UTR 과의 상호작용 분석으로 결정된다. 예를 들어 본 발명에 따른 miR-485-3p 을 발현하는 세포를 시험물질과 접촉시킨 후, ELAVL2 단백질의 3'-UTR과 miR-485-3p의 상호작용 정도를 접촉 전 또는 접촉되지 않은 대조군 세포와 비교하여, 상호작용에 변동, 특히 감소가 있는 것을 후보물질로 선별한다. 본 발명에 따른 방법에 사용되는 RNA-RNA 상호작용을 검출하는 방법은 당업계의 공지된 것으로 예를 들면 RNA Walk (Lusting et al., Nucleic Acids Res. 2010; 38(1):e5 에 기재된 것 참조) 또는 Yeat two hybrid system (Piganeau et al., RNA 2006; 12: 177-184) 등을 이용하여 검출할 수 있으며, RNA: A Laboratory Manual (Cold Spring Harbor Laboratory Press 2011)를 참조할 수 있다.The miR-485-3p is provided in the form of cells expressing the same, and the activity of the miR-485-3p and its target ELAVL2 protein (ELAV like neuron-specific RNA binding protein 2) with the 3'-UTR Determined by interaction analysis. For example, after contacting a cell expressing miR-485-3p according to the present invention with a test substance, the control cell before or without contacting the degree of interaction between the 3'-UTR and miR-485-3p of the ELAVL2 protein was contacted. Compared with, candidates are selected for variations, especially decreases, in interactions. Methods for detecting RNA-RNA interactions used in the method according to the invention are known in the art and described, for example, in RNA Walk (Lusting et al., Nucleic Acids Res. 2010; 38 (1): e5 Or Yeat two hybrid system (Piganeau et al., RNA 2006; 12: 177-184) and the like, and RNA: A Laboratory Manual (Cold Spring Harbor Laboratory Press 2011).
상기 스크리닝 방법에서 사용되는 세포의 종류 및 시험물질의 양 및 종류 등은 사용하는 구체적인 실험방법 및 시험물질의 종류에 따라 달라지며, 당업자라면 적절한 세포의 종류, 양 및/또는 조건을 선택할 수 있을 것이다. 실험결과 시험물질과 접촉되지 않은 대조군과 비교하여 시험물질의 존재 하에서 miR-485-3p의 활성의 감소를 가져오는 물질을 후보물질로 선별한다. 대조군과 비교 약 99% 이하 감소, 약 95% 이하 감소, 약 90% 감소, 약 85% 감소, 약 80% 감소, 약 75% 감소, 약 70% 감소, 약 65% 이하 감소, 약 60% 이하 감소, 약 55% 감소, 약 50% 이하 감소, 약 45% 이하 감소, 약 40% 이하 감소, 약 30% 이하 감소, 약 20% 이하 감소를 의미하나, 이를 벗어나는 범위를 제외하는 것은 아니다.The type of cells used in the screening method and the amount and type of the test substance vary depending on the specific test method and the type of test substance used, and those skilled in the art will be able to select appropriate types, amounts and / or conditions of cells. . As a result of the experiment, as a candidate, a substance which results in a decrease in miR-485-3p activity in the presence of the test substance is selected as compared with the control group which is not in contact with the test substance. Less than about 99% less, Less than about 95% less, About 90% less, About 85% less, About 80% less, About 75% less, About 70% less, Less than about 65% less than about 60% A reduction, about 55% reduction, about 50% or less reduction, about 45% or less reduction, about 40% or less reduction, about 30% or less reduction, or about 20% or less reduction, but the range is not excluded.
상기 '시험물질'은 상술한 바와 같은 miR-485-3p의 활성 억제할 것으로 기대되는 물질을 의미하여, 저분자량 화합물, 고분자량 화합물, 화합물들의 혼합물(예컨대, 천연 추출물 또는 세포 또는 조직 배양물), 또는 바이오의약품(예컨대, 단백질, 항체, 펩타이드, DNA, RNA, 안티센스 올리고뉴클레오타이드, RNAi, 앱타머, RNAzyme 및 DNAzyme), 또는 당 및 지질 등을 포함하나 이로 한정하는 것은 아니다. 상기 시험물질은 2개 이상의 아미노산 잔기, 예컨대 6개, 10개, 12개, 20개 이하 또는 20개 초과 예컨대 50개 아미노산 잔기를 갖는 폴리펩타이드일 수 있다. 상기 시험 물질은 합성 또는 천연 화합물의 라이브러리로부터 얻을 수 있으며 이러한 화합물의 라이브러리를 얻는 방법은 당업계에 공지되어 있다. 합성 화합물 라이브러리는 Maybridge Chemical Co.(UK), Comgenex(USA), Brandon Associates(USA), Microsource(USA) 및 Sigma-Aldrich(USA)에서 구입 가능하며, 천연 화합물의 라이브러리는 Pan Laboratories(USA) 및 MycoSearch(USA)에서 구입 가능하다. 시험 물질은 당업계에 공지된 다양한 조합 라이브러리 방법에 의해 얻을 수 있으며, 예를 들어, 생물학적 라이브러리, 공간 어드레서블 패러럴 고상 또는 액상 라이브러리(spatially addressable parallel solid phase or solution phase libraries), 디컨볼루션이 요구되는 합성 라이브러리 방법, "1-비드 1-화합물" 라이브러리 방법, 그리고 친화성 크로마토그래피 선별을 이용하는 합성 라이브러리 방법에 의해 얻을 수 있다. 분자 라이브러리의 합성 방법은, DeWitt et al., Proc. Natl. Acad. Sci. U.S.A. 90, 6909, 1993; Erb et al. Proc. Natl. Acad. Sci. U.S.A. 91, 11422, 1994; Zuckermann et al., J. Med. Chem. 37, 2678, 1994; Cho et al., Science 261, 1303, 1993; Carell et al., Angew. Chem. Int. Ed. Engl. 33, 2059, 1994; Carell et al., Angew. Chem. Int. Ed. Engl. 33, 2061; Gallop et al., J. Med. Chem. 37, 1233, 1994 등에 개시되어 있다.The 'test substance' refers to a substance expected to inhibit the activity of miR-485-3p as described above, and low molecular weight compounds, high molecular weight compounds, mixtures of compounds (eg, natural extracts or cell or tissue culture) Or biopharmaceuticals (eg, proteins, antibodies, peptides, DNA, RNA, antisense oligonucleotides, RNAi, aptamers, RNAzyme and DNAzyme), or sugars and lipids, and the like. The test substance may be a polypeptide having two or more amino acid residues, such as 6, 10, 12, 20 or less or more than 20 such as 50 amino acid residues. The test substance can be obtained from a library of synthetic or natural compounds and methods of obtaining libraries of such compounds are known in the art. Synthetic compound libraries are available from Maybridge Chemical Co. (UK), Comgenex (USA), Brandon Associates (USA), Microsource (USA), and Sigma-Aldrich (USA), and libraries of natural compounds are available from Pan Laboratories (USA) and Available from MycoSearch (USA). Test materials can be obtained by a variety of combinatorial library methods known in the art, for example, biological libraries, spatially addressable parallel solid phase or solution phase libraries, deconvolution Required by the synthetic library method, the "1-bead 1-compound" library method, and the synthetic library method using affinity chromatography screening. Methods of synthesizing molecular libraries are described in DeWitt et al., Proc. Natl. Acad. Sci. U.S.A. 90, 6909, 1993; Erb et al. Proc. Natl. Acad. Sci. U.S.A. 91, 11422, 1994; Zuckermann et al., J. Med. Chem. 37, 2678, 1994; Cho et al., Science 261, 1303, 1993; Carell et al., Angew. Chem. Int. Ed. Engl. 33, 2059, 1994; Carell et al., Angew. Chem. Int. Ed. Engl. 33, 2061; Gallop et al., J. Med. Chem. 37, 1233, 1994 and the like.
본 발명에 따른 알츠하이머병 및/또는 여러가지 뇌 질환을 치료하는 약물의 스크리닝 목적을 위해서는 화합물은 저분자량의 치료효과를 갖는 것이 사용될 수 있다. 예를 들면 중량이 400 Da, 600 Da 또는 800 Da과 같은 약 1000 Da 내외의 화합물이 사용될 수 있다. 목적에 따라 이러한 화합물은 화합물 라이브러리의 일부를 구성할 수 있으며, 라이브러리를 구성하는 화합물의 숫자도 수십개부터 수백만개까지 다양하다. 이러한 화합물 라이브러리는 펩타이드, 펩토이드 및 기타 환형 또는 선형의 올리고머성 화합물, 및 주형을 기본으로 하는 저분자 화합물, 예컨대 벤조디아제핀, 하이단토인, 바이아릴, 카보사이클 및 폴리사이클 화합물 (예컨대 나프탈렌, 페노티아진, 아크리딘, 스테로이드 등), 카보하이드레이트 및 아미노산 유도체, 디하이드로피리딘, 벤즈하이드릴 및 헤테로사이클 (예컨대 트리아진, 인돌, 티아졸리딘 등)을 포함하는 것일 수 있으나, 이는 단지 예시적인 것으로 이로 한정되는 것은 아니다.For the purpose of screening drugs for treating Alzheimer's disease and / or various brain diseases according to the present invention, compounds having a low molecular weight therapeutic effect may be used. For example, compounds of about 1000 Da in weight such as 400 Da, 600 Da or 800 Da can be used. Depending on the purpose, such compounds may form part of a compound library, and the number of compounds constituting the library may vary from tens to millions. Such compound libraries include peptides, peptoids and other cyclic or linear oligomeric compounds, and low molecular compounds based on templates such as benzodiazepines, hydantoin, biaryls, carbocycles and polycycle compounds (such as naphthalene, phenoty) Azines, acridines, steroids, etc.), carbohydrates and amino acid derivatives, dihydropyridine, benzhydryl and heterocycles (such as triazines, indole, thiazolidines, etc.), but this is merely illustrative. It is not limited to this.
또한, 세포 또는 바이오분자가 스크리닝에 사용될 수 있다. 상기 바이오분자란, 단백질, 핵산, 탄수화물, 지질 또는 생체내 및 생체외에서 세포 시스템 등을 이용하여 생산된 물질을 일컫는 것이다. 바이오분자를 단독으로 또는 다른 바이오분자 또는 세포와 조합으로 제공될 수 있다. 바이오분자는 예를 들면, 폴리뉴클레오타이드, 펩타이드, 항체, 또는 기타 혈장에서 발견되는 단백질 또는 생물학적 유기물질을 포함하는 것이다.In addition, cells or biomolecules can be used for screening. The biomolecules refer to proteins, nucleic acids, carbohydrates, lipids or substances produced using cellular systems in vivo and ex vivo. Biomolecules may be provided alone or in combination with other biomolecules or cells. Biomolecules include, for example, polynucleotides, peptides, antibodies, or other proteins or biological organics found in plasma.
본 발명의 실시예에서, 검체로부터 miR-485-3p마커의 발현을 검출하는 단계; 및 상기 검출된 마커의 발현량을 검사 대상체의 알츠하이머병 및/또는 여러 가지 뇌 질환의 진단 또는 예후와 연관시키는 단계를 포함하여 알츠하이머병 및/또는 여러 가지 뇌 질환의 진단 또는 예후에 필요한 정보를 제공하기 위하여 상기 마커를 검출하는 방법을 제시한다.In an embodiment of the invention, detecting the expression of miR-485-3p marker from the sample; And correlating the expression level of the detected markers with the diagnosis or prognosis of Alzheimer's disease and / or various brain diseases in the test subject. The present invention provides a method for detecting the marker.
본 발명에 있어서, 상기 연관시키는 단계는 상기 결정된 마커의 발현량을 대조군에서 결정된 상기 각 마커에 대한 검출결과와 비교하는 것으로, 상기 마커 중 miR-485-3p는 대조군과 비교하여 그 발현량이 증가한 것이다.In the present invention, the associating step is to compare the expression level of the determined markers with the detection results for the respective markers determined in the control group, wherein miR-485-3p of the markers is increased in expression level compared to the control group. .
상기 마커의 발현량을 검사 대상체의 알츠하이머병 및/또는 여러 가지 뇌 질환의 진단 또는 예후 판별시에 발작 질환 검사 대상체의 비마커 임상정보를 추가로 사용할 수 있다. 이러한 검사 대상체의 비마커 임상정보는 상기 대상체의 나이, 성별, 체중, 식습관, 체질량, 기저질환 및 뇌파검사, 발작 종류, 뇌 MRI, 뇌 CT, 또는 뇌 척수액 검사, 혈액검사, 타액검사를 포함하나 이로 제한하는 것은 아니다.Non-marker clinical information of the seizure disease test subject may be additionally used for diagnosis or prognosis of Alzheimer's disease and / or various brain diseases of the test subject. Non-marker clinical information of such test subjects includes age, sex, weight, diet, body mass, underlying disease and EEG, seizure type, brain MRI, brain CT, or cerebrospinal fluid test, blood test, saliva test of the subject. It is not limited to this.
본 발명의 실시예에서 miR-485-3p 이 ELAVL2단백질의 발현을 과도하게 억제하여 알츠하이머병 및/또는 여러 가지 뇌 질환발병에 관여한다는 발견에 근거한 것으로, 또 다른 실시예에서 대상체의 세포 또는 조직에서, 특히 뇌세포 또는 뇌조직 또는 뇌에서의 miR-485-3p활성 억제를 통한 알츠하이머병 및 또는 뇌 질환 치료 또는 예방 방법을 제공한다.In an embodiment of the present invention based on the discovery that miR-485-3p is involved in Alzheimer's disease and / or various brain diseases by excessively inhibiting the expression of ELAVL2 protein, in another embodiment in a cell or tissue of a subject In particular, the present invention provides a method for treating or preventing Alzheimer's disease and / or brain disease through inhibiting miR-485-3p activity in brain cells or brain tissue or brain.
본 발명의 실시예에서 알츠하이머병 및 또는 뇌 질환의 치료 또는 예방이 필요한 대상체에게 치료적 또는 예방적으로 유효한 양의 miR-485-3p활성 억제제를 투여하는 단계를 포함하는, 대상체의 알츠하이머병 및 또는 뇌 질환 치료 또는 예방 방법을 제공한다.Alzheimer's disease in a subject, comprising administering a therapeutically or prophylactically effective amount of a miR-485-3p activity inhibitor to a subject in need of treatment or prevention of Alzheimer's disease and / or brain disease in an embodiment of the invention Provided are methods for treating or preventing brain diseases.
나아가 본 발명의 실시예에서는 뇌 질환 질환의 치료 또는 예방용 용도의 miR-485-3p의 활성을 억제할 수 있는 물질을 제공하며, 이때 miR-485-3p의 활성을 억제할 수 있는 물질은 특히 뇌로 전달된다.Furthermore, embodiments of the present invention provides a substance capable of inhibiting the activity of miR-485-3p for the treatment or prevention of brain diseases, wherein the substance capable of inhibiting the activity of miR-485-3p is particularly Delivered to the brain.
또한, 사용되는 miR-485-3p활성 억제제, miR-485-3p활성 조절 또는 억제, 투여방법, 치료 가능한 질환의 종류 등에 대하여는 앞서 설명한 것을 참조할 수 있다.In addition, the above-described miR-485-3p activity inhibitor, miR-485-3p activity control or inhibition, the method of administration, the kind of the treatable disease, etc. can be referred to.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 예시하기 위한 것으로, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지 않는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다. Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for illustrating the present invention, it will be apparent to those skilled in the art that the scope of the present invention is not to be construed as limited by these examples.
실시예Example 1: 알츠하이머 환자의 1: Alzheimer's patient plasmaplasma 에서 in miRNAmiRNA qPCRqPCR array를array 이용한 Used miRNAmiRNA 발현 Expression 페턴Peton 분석 analysis
(1) 환자 및 샘플 제조(1) patient and sample preparation
표 1은 연구에 이용된 환자의 특징으로, 의사로부터 알츠하이머 치매 진단을 받은 4인의 환자로부터 Sod. citrate (3.2% w/v)가 첨가된 혈액 튜브 (백톤 디킨슨 (Becton Dickinson, 독일)에 약 3ml의 혈액을 채혈하였다. 4인의 연령 (±4년)을 매칭한 건강한 성인을 정상군으로 포함시켰다.Table 1 shows the characteristics of the patients used in the study. Sod. Approximately 3 ml of blood was collected in a blood tube (c. Backton Dickinson, Germany) to which citrate (3.2% w / v) was added. Healthy adults with age of 4 (± 4 years) were included as normal. .
혈액은 3,500 rpm에 10분간 원심분리하여 혈장을 분리하였으며 RNA 추출 전까지 -80℃에 보관하였다. 제조업자의 권장에 따라 miRNAeasy Serum/Plasma 키트 (퀴아젠 (Qiagen, USA)를 사용하여 miRNA를 추출하였다. 추출된 RNA는 농도와 순도를 Bioanalyzer2100 (Agilent, USA)을 이용하여 분석하였다. 정상군을 포함한 8개 군이 품질 기준에 적합하여 연구에 사용하였다.Blood was centrifuged at 3,500 rpm for 10 minutes to separate plasma and stored at -80 ° C until RNA extraction. MiRNA was extracted using miRNAeasy Serum / Plasma kit (Qiagen, USA) according to the manufacturer's recommendation. The extracted RNA was analyzed for concentration and purity using Bioanalyzer2100 (Agilent, USA). Eight groups met the quality criteria and used in the study.
(2) miRNA qPCR array(2) miRNA qPCR array
표 2는 miRNA qPCR array 분석에 이용된 gene list로서 추출된 RNA는 Human Neurological Development 및 Neurological Disease의 진행과 연관되어 있다고 알려진 84개의 다른 miRNA를 함유하는 miRNA array를 사용하여 스크리닝하였다.Table 2 shows miRNA qPCR arrays The extracted RNA as a gene list used for analysis was screened using a miRNA array containing 84 different miRNAs known to be involved in the progression of Human Neurological Development and Neurological Disease.
Quantitative PCR assay 방법은 다음과 같이 요약할 수 있다. Mature한 miRNA는 일반적으로 22nt, noncoding RNA이며 전사 후 조절을 담당한다. Mature한 miRNA는 poly(A) polymerase에 의해 polyadenylation을 유도하고 oligo-dT primers로 cDNA로 합성하였다. oligo-dT primers는 3' degenerate anchor를 갖고 있고 5' 말단에 universal tag sequence를 갖고 있어 Real-time PCR 과정에서 mature miRNA 증폭을 가능하게 한다. miScript SYBR Green PCR Kit (퀴아젠)을 이용해 real-time PCR 과정에서 mature한 miRNA를 정량하였다.Quantitative PCR assay methods can be summarized as follows. Mature miRNAs are generally 22nt, noncoding RNAs and are responsible for post-transcriptional regulation. Mature miRNA induced polyadenylation by poly (A) polymerase and synthesized cDNA with oligo-dT primers. Oligo-dT primers have a 3 'degenerate anchor and a universal tag sequence at the 5' end, enabling mature miRNA amplification during real-time PCR. Mature miRNA was quantified during real-time PCR using miScript SYBR Green PCR Kit (Qiagen).
(3) Volcano plot을 통한 miRNA 발현 패턴 분석(3) Analysis of miRNA expression pattern through Volcano plot
도 1(A)는 정상군 대비 환자군에서 miRNA 발현 패턴 분석(volcano blot)으로, 정상군 대비 환자군의 84종 miRNA 발현 패턴을 분석하였다.FIG. 1 (A) shows the miRNA expression pattern analysis (volcano blot) in the patient group compared to the normal group, and analyzed 84 miRNA expression patterns in the patient group compared to the normal group.
x축은 Fold change를 나타내고 y축은 -log10의 p-value 값을 나타낸다. 가로 검은색 줄은 p value가 0.05 이하를 나타낸다. Volcano blot 분석 결과 hsa-miR-105-5p, hsa-miR-98-5p, hsa-miR-15a-5p, hsa-miR-134-5p, hsa-miR-409-3p, hsa-miR-19b-3p, hsa-miR-92a-3p, hsa-miR-28-5p, hsa-miR-30d-5p, hsa-miR-212-3p, hsa-miR-93-5p, hsa-miR-342-3p, hsa-miR-381-3p, hsa-miR-431-5p, hsa-miR-130a-3p, hsa-miR-146b-5p, hsa-miR-29a-3p, hsa-miR-132-3p, hsa-miR-376b-3p, hsa-miR-22-3p, hsa-miR-509-3p, hsa-miR-139-5p, hsa-miR-499a-5p, hsa-miR-203a-3p, hsa-miR-95-3p, hsa-miR-128-3p, hsa-miR-487a-3p, hsa-miR-485-3p, hsa-miR-195-5p, hsa-miR-433-3p, hsa-miR-133b, hsa-miR-191-5p, hsa-miR-489-3p, hsa-miR-432-5p, hsa-miR-29c-3p, hsa-miR-485-5p, hsa-miR-652-3p, hsa-miR-126-5p, hsa-miR-328-3p, hsa-let-7b-5p, hsa-miR-539-5p, hsa-miR-106b-5p, hsa-miR-101-3p, hsa-miR-302a-5p, hsa-miR-484, hsa-miR-518b, hsa-miR-148b-3p, hsa-miR-181d-5p, hsa-miR-7-5p, hsa-miR-512-3p, hsa-miR-151a-3p, hsa-miR-15b-5p, hsa-let-7e-5p, hsa-miR-135b-5p, hsa-miR-181a-5p, hsa-miR-138-5p, hsa-miR-34a-5p, hsa-miR-346, hsa-miR-511-5p, hsa-miR-485-3p, hsa-miR-485-5p, hsa-miR-487a-3p, hsa-miR-489-3p, hsa-miR-499a-5p, hsa-miR-509-3p, hsa-miR-511-5p, hsa-miR-512-3p, hsa-miR-518b, hsa-miR-539-5p, hsa-miR-652-3p, hsa-miR-7-5p, hsa-miR-92a-3p, hsa-miR-93-5p hsa-miR-95-3p, hsa-miR-98-5p이 환자군에서 발현이 상승하는 것을 확인하였다. 그러나 hsa-miR-485-3p을 제외한 miRNA의 조절은 통계적으로 유의하지 않았다. hsa-485-3p의 경우 p-value가 0.00439을 나타내어 알츠하이머 환자에서 정상군 대비 유의적으로 증가한다고 보여진다. 정상군을 1로 보았을 때, 중증치매는 9배 정도의 차이를 보였으며, 그 사이 즉, 1배 내지 9배 사이인 경우를 경도인지장애로 구분할 수 있다(도 1(B)). 따라서 hsa-miR-485-3p는 알츠하이머병을 진단하기 위한 기대 지표가 될 수 있다.The x-axis represents the fold change and the y-axis represents the p-value of -log10. Horizontal black lines show p values less than 0.05. Volcano blot analysis shows hsa-miR-105-5p, hsa-miR-98-5p, hsa-miR-15a-5p, hsa-miR-134-5p, hsa-miR-409-3p, hsa-miR-19b- 3p, hsa-miR-92a-3p, hsa-miR-28-5p, hsa-miR-30d-5p, hsa-miR-212-3p, hsa-miR-93-5p, hsa-miR-342-3p, hsa-miR-381-3p, hsa-miR-431-5p, hsa-miR-130a-3p, hsa-miR-146b-5p, hsa-miR-29a-3p, hsa-miR-132-3p, hsa- miR-376b-3p, hsa-miR-22-3p, hsa-miR-509-3p, hsa-miR-139-5p, hsa-miR-499a-5p, hsa-miR-203a-3p, hsa-miR- 95-3p, hsa-miR-128-3p, hsa-miR-487a-3p, hsa-miR-485-3p, hsa-miR-195-5p, hsa-miR-433-3p, hsa-miR-133b, hsa-miR-191-5p, hsa-miR-489-3p, hsa-miR-432-5p, hsa-miR-29c-3p, hsa-miR-485-5p, hsa-miR-652-3p, hsa- miR-126-5p, hsa-miR-328-3p, hsa-let-7b-5p, hsa-miR-539-5p, hsa-miR-106b-5p, hsa-miR-101-3p, hsa-miR- 302a-5p, hsa-miR-484, hsa-miR-518b, hsa-miR-148b-3p, hsa-miR-181d-5p, hsa-miR-7-5p, hsa-miR-512-3p, hsa- miR-151a-3p, hsa-miR-15b-5p, hsa-let-7e-5p, hsa-miR-135b-5p, hsa-miR-181a-5p, hsa-miR-138-5p, hsa-miR- 34a-5p, hsa-miR-346, hsa-miR-511-5p, hsa-miR-485-3p, hsa-miR-485-5p, hsa -miR-487a-3p, hsa-miR-489-3p, hsa-miR-499a-5p, hsa-miR-509-3p, hsa-miR-511-5p, hsa-miR-512-3p, hsa-miR -518b, hsa-miR-539-5p, hsa-miR-652-3p, hsa-miR-7-5p, hsa-miR-92a-3p, hsa-miR-93-5p hsa-miR-95-3p, It was confirmed that the expression of hsa-miR-98-5p is increased in the patient group. However, the regulation of miRNA except for hsa-miR-485-3p was not statistically significant. In the case of hsa-485-3p, the p-value is 0.00439, which is significantly increased in the Alzheimer's patients compared to the normal group. When the normal group was viewed as 1, severe dementia showed a 9-fold difference, that is, between 1 and 9 times can be classified as mild cognitive impairment (Fig. 1 (B)). Thus, hsa-miR-485-3p may be a predictive indicator for diagnosing Alzheimer's disease.
실시예Example 2: 2: HumanHuman miRNAmiRNA 표적 유전자 예측 및 마우스에서 동일 Target Gene Prediction and Same in Mice miRNAmiRNA 표적 유전자 보존과 anti-mmu-miR-485-3p 합성 Target Gene Conservation and Anti-mmu-miR-485-3p Synthesis
hsa-miR-485-3p의 염기 서열 및 표적 위치 분석을 하기 위해 표적 예측 소프트웨어(miRDB)를 이용하여 사람유래 ELAVL2의 3 말단 비번역 부위(UTR)가 hsa-miR-485-3p의 표적인 것을 확인하였다. 여기서 확인된 시드 서열은 mmu-miR-485-3p 와 마우스 유래 ELAVL2 3 말단 비번역 부위에도 보존되어 있는 것을 확인하였다.Using the target prediction software (miRDB) for the nucleotide sequence and target position analysis of hsa-miR-485-3p, the three-term untranslated region (UTR) of human-derived ELAVL2 was targeted to hsa-miR-485-3p. Confirmed. It was confirmed that the seed sequence confirmed here was also conserved in mmu-miR-485-3p and mouse-derived ELAVL2 3-terminal untranslated site.
도 2는 hsa-miR485-3p의 타겟으로 알려진 ELAVL2 3'-비번역 부위(UTR) mRNA를 나타낸 목록으로, miR-485-3p의 표적 ELAVL2 3'-비번역 부위(UTR) mRNA를 보여준다. miR-485-3p의 5' 씨드 서열 (ELAVL2)은 빨간색으로 표시되어 있다. 표 3은 has-miR-485-3p의 염기 서열로서, 알츠하이머 질병모델을 이용하여 miR-485-3p의 생리학적 기능을 규명하기 위해 sequence를 합성하여 Functional study를 진행하였다.FIG. 2 is a list of
표 4는 mmu-miR485-3p의 염기 서열 및 표적 위치 분석으로, 표적 예측 소프트웨어(TargetScan, PicTar, 및 microT)을 이용하여 마우스 ELAVL2의 3'-비번역 부위(UTR)와 mmu-miR-485-3p의 표적서열이 보존되어 있는 것을 확인하였다. 마우스 ELAVL2의 3'-비번역 부위(UTR)가 mmu-miR-485-3p의 표적인 것을 확인하였다.Table 4 shows the base sequence and target position analysis of mmu-miR485-3p, using 3'-untranslated site (UTR) and mmu-miR-485- of mouse ELAVL2 using target prediction software (TargetScan, PicTar, and microT). It was confirmed that the target sequence of 3p was preserved. The 3'-untranslated site (UTR) of mouse ELAVL2 was confirmed to be the target of mmu-miR-485-3p.
알츠하이머 마우스 모델에서 과발현되는 mmu-miR-485-3p에 대하여 알츠하이머 및 뇌질환과 관련된 타겟 유전자, 특이 서열 antagomir, 2`-O- 메틸화 및 포스포로티오에이트 modification된 안티센스 올리고 뉴클레오타이드를 합성하였다.Target genes, specific sequences antagomir, 2′-O-methylated and phosphorothioate modified antisense oligonucleotides associated with Alzheimer's and brain diseases were synthesized for mmu-miR-485-3p overexpressed in the Alzheimer's mouse model.
실시예Example 3: 5xFAD3: 5xFAD 마우스의 해마 및 대뇌 피질에서 In the Hippocampus and Cerebral Cortex of the Mouse miRmiR -485-3p 발현 분석 (RT-qPCR)-485-3p Expression Analysis (RT-qPCR)
(1) 연구 방법(1) Research method
5xFAD transgenic mouse는 돌연변이 형태의 APP와 PSEN1를 over expression시켜 6주 정도부터 intraneuronal Aβ42의 축적이 심하게 나타나는 Alzheimer disease의 동물모델이다.The 5xFAD transgenic mouse is an animal model of Alzheimer disease that overexpresses the mutant APP and PSEN1 and shows severe accumulation of intraneuronal Aβ42 from about 6 weeks.
실시예 1의 결과에 따라 치매 동물 모델에서 miR-485-3p의 발현 여부를 확인하고자 RT-qPCR를 진행하였다. 10개월 된 5xFAD transgenic mouse와 Wild type (WT) mouse를 깊이 마취시킨 후 단두로 희생시켰다. 뇌를 즉시 적출하였고 해마 및 대뇌피질을 잔류 뇌구조에서 절개하였다. PAXgene Tissue miRNA Kit(Qiagen, USA)을 제조자의 방법대로 사용하여 해마에서 total miRNA를 분리하였다. miScript II RT Kit (Qiagen, USA)를 사용하여 cDNA를 합성하였고 mmu_miR-485-3p miScript Primer Assay 및 miScript SYBR Green PCR Kit 사용하여 qPCR을 진행하였다. miRNA level은 snoRNA202(mouse control)에 따라 normalize하여 정량하였다.RT-qPCR was performed to confirm the expression of miR-485-3p in the animal model of dementia according to the results of Example 1. Ten months old 5xFAD transgenic mice and Wild type (WT) mice were deeply anesthetized and sacrificed with the head. The brain was immediately removed and the hippocampus and cerebral cortex were excised from the remaining brain structures. Total miRNA was isolated from hippocampus using PAXgene Tissue miRNA Kit (Qiagen, USA) according to the manufacturer's method. cDNA was synthesized using miScript II RT Kit (Qiagen, USA) and qPCR was performed using mmu_miR-485-3p miScript Primer Assay and miScript SYBR Green PCR Kit. miRNA levels were quantified by normalizing according to snoRNA202 (mouse control).
(2) 연구 결과(2) study results
도 3(A)는 hippocampus 및 cortex에서 miR-485-3p의 발현 비교 결과로서, 5xFAD의 해마 및 대뇌피질에서 miR-485-3p의 발현 패턴을 확인하고자 RT-PCR를 진행하였다. 그 결과 WT대비 5xFAD의 해마에서 miR-485-3p의 발현이 증가된 것으로 나타났다. 따라서, 실시예 1의 연구 결과와 함께, 알츠하이머성 치매에서 miR-485-3p의 발현이 상승하는 것으로 보여진다. 이에 따라 miR-485-3p가 영향을 미칠 수 있는 neuronal target mRNA 또는 protein을 확인해보고자 하였다.Figure 3 (A) is a comparison of the expression of miR-485-3p in hippocampus and cortex, RT-PCR was performed to confirm the expression pattern of miR-485-3p in the hippocampus and cerebral cortex of 5xFAD. As a result, miR-485-3p expression was increased in 5xFAD hippocampus compared to WT. Thus, with the results of the study of Example 1, it is shown that the expression of miR-485-3p is elevated in Alzheimer's dementia. Accordingly, we attempted to identify neuronal target mRNA or protein that miR-485-3p may affect.
실시예Example 4: 5xFAD4: 5xFAD 마우스의 해마 및 대뇌 피질에서 In the Hippocampus and Cerebral Cortex of the Mouse ELAVL2ELAVL2 포함 include 관련단백질Related Protein 및 아밀로이드베타42 단백질 발현 확인 And amyloid beta42 protein expression
(1) 연구 방법(1) Research method
실시예 3의 결과에 따라, 5xFAD의 해마 및 대뇌피질에서 ELAVL2 포함 관련단백질 및 아밀로이드베타 42 단백질 발현 여부를 확인하고자 하였다. 마취한 마우스 (9개월)를 단두로 희생시키고 즉시 뇌를 적출하였다. 뇌 부위 (해마, 대뇌피질)의 균질화물을 제조하여 ELAVL2에 대한 항체 (abcam, USA), cFOS 항체 (cell signaling, USA), APP 항체 (cell signaling, USA), 아밀로이드베타 항체 (cell signaling, USA)를 사용하여 western blot을 진행하였다. 면역반응 단백질을 화학발광 시약 (GE health care, UK)로 가시화시키고 화학이미지분석기 (Fusion SL)을 이용하여 측정 및 정량하였다. 해마 및 대뇌피질의 아밀로이드베타 42 단백질을 정량하기 위해 mouse/rat amyloid beta (1-42) ELISA kit (IBL)를 이용하여 정량하였으며 세부 사항은 제조사의 설명서를 참조하였다.According to the results of Example 3, the expression of ELAVL2-containing proteins and amyloid beta 42 protein in the hippocampus and cerebral cortex of 5xFAD was determined. Anesthetized mice (9 months) were sacrificed with the head and immediately brain extracted. Homogenates of brain regions (hippocampus, cerebral cortex) were prepared to produce antibodies against ELAVL2 (abcam, USA), cFOS antibodies (cell signaling, USA), APP antibodies (cell signaling, USA), amyloid beta antibodies (cell signaling, USA) ) Western blot was used. Immune response proteins were visualized with chemiluminescent reagents (GE health care, UK) and measured and quantified using a chemical imager (Fusion SL). To quantify amyloid beta 42 protein in hippocampus and cerebral cortex, mouse / rat amyloid beta (1-42) ELISA kit (IBL) was used for quantification.
(2) 연구 결과(2) study results
1) 해마 및 대뇌피질에서 ELAVL2 발현 확인1) Confirmation of ELAVL2 Expression in Hippocampus and Cerebral Cortex
도 3(B) 및 도 3(C)는 5xFAD의 해마 및 대뇌피질에서 ELAVL2의 발현 및 관련 단백질 발현 비교 결과이다. ELAVL2는 ELAV-like RNA-binding proteins으로, 인지 및 행동 기능과 직접적으로 연관되어 있는 뉴런 흥분 또는 시냅스 전달과 같은 신경 기능을 조절하는 단백으로 알려져 있다. 또한 ELAVL2는 neural-specific RNA-binding protein으로서, RNA의 GAAA motif를 인식하여 post-transcriptional gene regulation을 담당한다. 그 타겟으로는 단백질의 발현량에 영향을 미치는 전사인자 cFOS가 알려져 있다. 또한 cFOS는 뇌세포안에서 아밀로이드베타 전구체로 알려져 있는 APP단백질 발현에 영향을 미친다고 알려져 있다. 일련의 과정에서 miR-485-3p의 증가 패턴이 APP 발현량에 유의하게 영향을 미치는 것을 확인할 수 있었다.Figure 3 (B) and Figure 3 (C) is a comparison of the expression of ELAVL2 and related protein expression in the hippocampus and cerebral cortex of 5xFAD. ELAVL2 is an ELAV-like RNA-binding protein known as a protein that regulates neuronal function, such as neuronal excitability or synaptic transmission, which is directly linked to cognitive and behavioral functions. ELAVL2 is also a neural-specific RNA-binding protein that recognizes the GAAA motif of RNA and is responsible for post-transcriptional gene regulation. As the target, a transcription factor cFOS that affects the expression level of a protein is known. In addition, cFOS is known to affect the expression of APP protein known as amyloid beta precursor in brain cells. It was confirmed that the increase pattern of miR-485-3p significantly affects the APP expression level in a series of processes.
2) 대뇌피질 및 해마에서 Aβ42 발현 비교2) Comparison of Aβ42 Expression in the Cerebral Cortex and Hippocampus
도 4는 5xFAD에서 Aβ42 정량 비교 분석 결과로서, 5xFAD의 대뇌 피질 및 해마의 Aβ42 발현을 비교 분석 하였다. 5xFAD에서 대뇌피질(도 4(A)) 및 해마(도 4(B)) 모두 Aβ42가 WT대비 유의적으로 증가함을 확인하였다. 이 결과들로 보아 miR-485-3p를 조절하는 것이 알츠하이머병의 원인 물질로 알려져 있는 아밀로이드베타를 줄일 수 있는 방법이 될 수 있다고 보여진다.4 is a quantitative comparative analysis result of Aβ42 in 5xFAD, and compared the Aβ42 expression of the cerebral cortex and hippocampus of 5xFAD. In 5xFAD, both cerebral cortex (Fig. 4 (A)) and hippocampus (Fig. 4 (B)) were found to significantly increase Aβ42 relative to WT. These results suggest that controlling miR-485-3p may be a way to reduce amyloid beta, a known cause of Alzheimer's disease.
실시예 5: 타액으로부터 분리한 아밀로이드베타(Aβ) 42의 농도 측정 Example 5: Determination of the concentration of amyloid beta (Aβ) 42 isolated from saliva
(1) 연구 방법(1) Research method
뇌와 실질적으로 가까운 타액에서 아밀로이드베타를 측정하기 때문에 정확도가 혈액 대비 우수하며, 적은 양의 아밀로이드베타까지 정량함으로써 조기진단이 가능하다는 장점이 있다. 또한 보조수단(혈액, miRNA)으로 더블체크함으로써 더 높은 정확도(99% 이상)를 확보할 수 있다.Since amyloid beta is measured in saliva substantially close to the brain, the accuracy is excellent compared to blood, and early diagnosis is possible by quantifying a small amount of amyloid beta. In addition, by double-checking with secondary means (blood, miRNA), higher accuracy (more than 99%) can be ensured.
아밀로이드베타 42에 특이적으로 결합하는 sequence 및 핵산 내부 자체 결합하는 sequence를 이용하여 아밀로이드베타 42와 결합 시 소광물질(quencher)이 떨어짐과 동시에 형광이 발현되는 구조적 특징을 가진 멀티핵산을 합성하였다. 상기 멀티핵산의 크기는 항체보다 작으므로 특이성 및 선택성이 우수하며, 1시간 이내 샘플링 및 대량분석이 가능하므로 진단 용이성이 높은 진단 방법 제공이 가능하다. 극미량의 바이오 마커를 모노 레이어로 집합시킬 수 있는 플랫폼 기술(magnetoimmunoassay 시스템)을 이용하여 타액 속 아밀로이드베타 42를 정량화하였다(도 5). 일정한 면적에 일정한 나노입자들이 모이는 것을 재현할 수 있다. 타액유래 아밀로이드베타와 자성입자 복합체의 집합체는 직경 300 μm 이내이고, 집합체 속의 자성입자의 수는 ~1.0 X 104이다(도 6(a)). Photomultiplier tube (PMT)분석의 Region-of-interest (ROI)는 100 × 100 μm2이고, PMT에 의해 3번의 형광물질을 측정한 다음 각 샘플의 평균값을 계산하였다(도 6(b)).Using a sequence that specifically binds to amyloid beta 42 and a sequence that binds to itself inside the nucleic acid, a multinucleic acid having structural characteristics in which quenchers are dropped and fluorescence is expressed at the time of binding to amyloid beta 42 is synthesized. Since the size of the multinucleic acid is smaller than that of the antibody, the specificity and selectivity are excellent, and sampling and mass analysis are possible within 1 hour, thereby providing a high diagnostic method. Amyloidbeta 42 in saliva was quantified using a platform technology (magnetoimmunoassay system) that allows the collection of trace biomarkers into monolayers (FIG. 5). It is possible to reproduce the collection of certain nanoparticles in a certain area. The aggregate of saliva-derived amyloid beta and magnetic particle complex is within 300 μm in diameter, and the number of magnetic particles in the aggregate is ˜1.0 × 10 4 (FIG. 6 (a)). The region-of-interest (ROI) of the photomultiplier tube (PMT) assay was 100 × 100 μm 2 , and three fluorescent materials were measured by PMT, and then the average value of each sample was calculated (FIG. 6 (b)).
정상군 100명, 경도인지장애부터 중증치매까지 100명의 환자군을 모집하였으며, 연령대는 30대 초반부터 80대 후반까지이다. 치매에 영향을 줄 수 있는 다른 질환을 가질 수 있는 환자는 제외하였다.A total of 100 patients were recruited from 100 normal patients and mild cognitive impairment to severe dementia. Age ranged from early 30s to late 80s. Patients who could have other diseases that could affect dementia were excluded.
(2) 연구 결과(2) study results
타액에서 극소량의 아밀로이드베타를 측정하며, ELISA로 나오지 않는 아밀로이드베타를 재현하였다. 연구용으로 시장에 나와 있는 ELISA와 비교 실험한 결과, 30대 정상인에서 검출되지 않았다.A small amount of amyloid beta was measured in saliva, and amyloid beta that was not produced by ELISA was reproduced. When compared with ELISA on the market for research, it was not detected in the normal 30s.
본 실시예에 따른 magnetoimmunoassay 시스템은 상업용 ELISA 시스템보다 다소 높은 ~ 20 pg/ml의 농도에서 타액 아밀로이드베타 펩타이드를 간단히 검출할 수 있다. 참고로 사용된 ELISA 시스템의 프로토콜에 따르면, 표준 아밀로이드베타 펩타이드의 가장 낮은 측정 가능한 농도는 7.4 pg/ml이며, 이는 측정을 위한 커브-피트가 매우 낮은 농도 범위에 대한 정확한 선형성을 만족시키지 못하기 때문에 약간 모호할 수 있다.The magnetoimmunoassay system according to this embodiment can easily detect saliva amyloid beta peptides at concentrations of ˜20 pg / ml, somewhat higher than commercial ELISA systems. According to the protocol of the ELISA system used for reference, the lowest measurable concentration of standard amyloid beta peptide is 7.4 pg / ml, since the curve-feet for the measurement do not satisfy the exact linearity for very low concentration ranges. It can be a bit vague.
각 치매 환자별 타액유래 아밀로이드베타 42 측정 결과 정상, 경도인지장애(MCI), 중증환자를 구별할 수 있었다. 즉, 정상 (0~500 pg/ml), 경도인지장애 (500 pg~1ng/ml), 중증 (1 ng/ml~)의 아밀로이드베타 농도를 확인하였다(도 7). 또한, 100명 이상의 치매 환자에서 아밀로이드베타를 정량화하여 경도 인지장애와 중등도 치매 구분에 성공(임상의사의 진단과 90%이상 일치) 하였다.Saliva-derived amyloid beta 42 was used to identify normal, mild cognitive impairment (MCI), and severe patients. That is, normal (0 ~ 500 pg / ml), mild cognitive impairment (500 pg ~ 1ng / ml), severe (1 ng / ml ~) was confirmed the amyloid beta concentration (Fig. 7). In addition, amyloid beta was quantified in more than 100 patients with dementia to distinguish between mild cognitive impairment and moderate dementia (more than 90% consistent with clinical diagnosis).
실시예 6: Hippocampal primary cell line 제작 및 In vitro transfectionExample 6: Hippocampal primary cell line preparation and in vitro transfection
(1) 연구 방법(1) Research method
5xFAD embryo에서 적출한 해마와 대뇌피질의 조직에서 추출한 primary cell을 배양하였다. 제작 및 배양 방법인 종전의 연구를 참조하였다 (Seibenhener, M.L & Woonten M.W, Isolation and culture of Hippocampal Neurons from Prenatal Mice, Jove, 2012). In Vitro Transfection Lipofectamine 2000을 사용하여 Primary cells에 50 nM of miR-485-3p duplex (or scrambled miRNA duplex; Bioneer, Daejon, South Korea) 와 50 nM of Antagomir (AM)485-3p을 transfection 시켰다. transfection 후 48시간 이후부터 얻어진 cell homogenates을 제조하였고 이를 ELAVL2 antibody (abcam,UK)을 사용하여 western blot을 진행하였다. 면역반응 단백질은 면역반응 단백질을 화학발광 시약 (GE health care, UK)로 가시화시키고 화학 이미지분석기 (Fusion SL)을 이용하여 측정 및 정량하였다. 아밀로이드베타 42 단백질은 mouse/rat amyloid beta(1-42) assay kit (IBL)을 이용하여 제조사의 설명서를 참조하여 측정하였다.Primary cells extracted from hippocampus and cerebral cortex tissues from 5xFAD embryos were cultured. Reference was made to previous studies, a method of fabrication and culture (Seibenhener, M.L & Woonten M.W, Isolation and culture of Hippocampal Neurons from Prenatal Mice, Jove, 2012). In
(2) 연구 결과(2) study results
Hippocampal primary cell에서 AM485-3p transfection에 따른 ELAVL2 발현을 비교하였다(도 9). 5xFAD의 hippocampus primary cell 내에 ELAVL2가 발현되며 AM485-3p를 transfection시킨 cell에서 control대비 ELAVL2의 발현이 증가됨을 확인하였다. 이는 miR-485-3p가 ElAVL2의 발현을 억제시킨다는 것을 의미하며 AM를 처리한 cell에서 이를 증명하였다. ELAVL2는 뉴런 흥분에 관여하여 인지 기능에 영향을 미치는 중요 인자이므로 ELAVL2를 상승시키는 miR-485-3p 억제제와 같은 약물 또는 조성물의 개발이 알츠하이머 질환을 예방/치료하는데 핵심 전략이 될 수 있다.The expression of ELAVL2 according to AM485-3p transfection in hippocampal primary cells was compared (FIG. 9). ELAVL2 was expressed in 5xFAD hippocampus primary cells and ELAVL2 expression was increased compared to control in cells transfected with AM485-3p. This means that miR-485-3p inhibits the expression of ElAVL2 and demonstrated this in cells treated with AM. Since ELAVL2 is an important factor involved in neuronal excitability and affects cognitive function, the development of drugs or compositions such as miR-485-3p inhibitors that elevate ELAVL2 may be a key strategy in preventing / treating Alzheimer's disease.
실시예Example 7: AM485-3p를 7: AM485-3p 비강내Intranasal 처리한 Processed 5xFAD에서In 5xFAD ELAVL2포함ELAVL2 included 관련 단백질 및 아밀로이드베타42 단백질 정량 비교 분석 Quantitative Comparative Analysis of Related Proteins and Amyloidbeta42 Proteins
(1) 연구 방법(1) Research method
miR-485-3p의 억제는 서열-특이적 엔타고미어 또는 스크램블-서열 엔타고미어의 비강투여로 유도하였다. 엔타고미어의 비강내 투여는 마우스를 마취시키지 않고 뇌를 표적으로 하는 방법에 따라 실시하였다. (Leah R.T., et al. (2013) Intranasal Administration of CNS Therapeutics to Awake Mice. J Vis Exp. 2013; (74): 4440). 논문에 나와있는 적응단계를 끝낸 마우스에 비강내 흡입을 위한 고정 (Intranasal grip)을 하고 복부를 위로 향하게 위치 시킨 다음 한쪽 비강 앞에 파이펫을 위치시킨다. 6㎕를 파이펫으로 2번을 흡입시키는데 drop형태로 흡입시킨다 (1drop = 3㎕). 15초 자세유지 후에 오른쪽 비강 내에 똑같이 흡입시킨다. 2분후 똑 같은 과정을 반복하고 총 24㎕를 흡입시킨다 (AM485 (2'-O-Methylated)-5'-gagaggagagccguguaugacu-3'; 24㎕의 0.1% v/v 디에틸피로카르보네이트-처리된 증류수 중 5nmol; 바이오니어, 한국). 대조군 마우스에게는 Vehicle을 동등한 부피만큼 투여하였다. 비강 투여 한 시점(7개월)에서 12주(주 1회 투여) 뒤, 마취한 마우스를 단두로 희생시키고, 즉시 뇌를 적출하였다. 뇌 부위(해마, 및 피질)의 균질화물을 제조하여 이를 ELAVL2에 대한 항체 (abcam, USA), cFOS 항체 (cell signaling, USA), APP 항체 (cell signaling, USA), 아밀로이드베타 항체 (cell signaling, USA)를 사용하여 western blot을 진행하였다. 면역반응 단백질은 면역반응 단백질을 화학발광 시약 (GE health care, UK)로 가시화시키고 화학 이미지분석기 (Fusion SL)을 이용하여 측정 및 정량하였다. 아밀로이드베타 42 단백질은 mouse/rat amyloid beta(1-42) assay kit (IBL)을 이용하여 제조사의 설명서를 참조하여 측정하였다.Inhibition of miR-485-3p was induced by nasal administration of sequence-specific entagomeres or scramble-sequence entagomeres. Intranasal administration of entagomeres was performed according to the method of targeting the brain without anesthetizing the mouse. (Leah R.T., et al. (2013) Intranasal Administration of CNS Therapeutics to Awake Mice. J Vis Exp. 2013; (74): 4440). Intranasal grip is placed on the intranasal inhalation and the pipette is placed in front of one nasal cavity. Aspirate 6 μl twice with a pipette and drop in drop form (1 drop = 3 μl). After 15 seconds posture, inhale equally into the right nasal cavity. After 2 minutes, repeat the same procedure and aspirate a total of 24 μl (AM485 (2'-O-Methylated) -5'-gagaggagagccguguaugacucu-3 '; 24 μl of 0.1% v / v diethylpyrocarbonate-treated 5 nmol in distilled water; Bioneer, Korea). Control mice received an equivalent volume of Vehicle. After 12 weeks (once weekly) at the time of nasal administration (7 months), the anesthetized mice were sacrificed with the head and immediately brain extracted. Homogenates of the brain areas (hippocampus, and cortex) are prepared and produced as antibodies against ELAVL2 (abcam, USA), cFOS antibodies (cell signaling, USA), APP antibodies (cell signaling, USA), amyloid beta antibodies (cell signaling, USA) was used to perform western blot. Immune response proteins were visualized with chemiluminescent reagents (GE health care, UK) and measured and quantified using a chemical imager (Fusion SL). Amyloid beta 42 protein was measured using a mouse / rat amyloid beta (1-42) assay kit (IBL) with reference to the manufacturer's instructions.
(2) 연구 결과(2) study results
AM485-3p를 비강내 처리한 5xFAD에서 ELAVL2포함 관련 단백질 및 아밀로이드베타 42단백질 정량 비교 분석하였다(도 10). 실시예 6에서 mouse primary cell line에서 AM485-3p의 처리가 ELAVL2 변화를 유도하였기 때문에, 5xFAD에 AM485-3p를 비강처리하여 in vivo에서 AM485-3p의 역할을 확인해보고자 하였다. AM485-3p군에서 ELAVL2의 발현이 control군 대비 증가하였다. ELAVL2의 회복에 따라 APP에 발현에 관여하고 있는 전사인자인 cFOS의 발현이 정상화되고 이것이 APP의발현을 줄이고 이것은 아밀로이드베타 42 단백질의 감소를 이끌어 내었다(도 10(A) 및 (B)). 이는 miR-485-3p 억제제와 같은 약물 또는 조성물의 개발이 알츠하이머 질환을 예방/치료하는데 핵심 전략임을 제시하는 바이다. 또한, 동물 모델에서 AM485-3p의 처리가 Aβ42의 생성 억제에 영향을 미친다는 것을 확인하였으므로 (도 10(C)), 관련 억제제 또는 약물 처리가 알츠하이머 치매의 병리 증상을 해소할 수 있을 것으로 보인다.Quantitative analysis of ELAVL2-containing related proteins and amyloid beta 42 protein in 5 × FAD intranasally treated with AM485-3p (FIG. 10). Since the treatment of AM485-3p in the mouse primary cell line in Example 6 induced ELAVL2 change, we tried to confirm the role of AM485-3p in vivo by treating AM485-3p in 5xFAD. The expression of ELAVL2 in the AM485-3p group was increased compared to the control group. The recovery of ELAVL2 normalized the expression of cFOS, a transcription factor involved in APP expression, which reduced the expression of APP, which led to a decrease in amyloid beta 42 protein (FIGS. 10 (A) and (B)). This suggests that the development of drugs or compositions, such as miR-485-3p inhibitors, is a key strategy for preventing / treating Alzheimer's disease. In addition, since it was confirmed that the treatment of AM485-3p in the animal model affects the inhibition of production of Aβ 42 (FIG. 10C), related inhibitors or drug treatment may be able to resolve the pathological symptoms of Alzheimer's dementia.
실시예Example 8: 5xFAD8: 5xFAD 마우스에 AM485- AM485- on mouse 3p 를3p 비강 내 처리한 Intranasally treated 5xFAD에서In 5xFAD 인지 기능 여부 비교 Cognitive function comparison
(1) 연구 방법(1) Research method
AM485-3p를 비강 처리한 5xFAD의 인지 기능 개선 여부를 확인하고자 Y-maze 및 passive avoidance test를 진행하였다.The Y-maze and passive avoidance tests were conducted to determine whether 5xFAD treated with AM485-3p was improved.
1) Y-maze 시험1) Y-maze test
Y-미로 실험 장치는 검은 아크릴 판 (가로 10 cm, 세로 41 cm, 높이 25 cm)으로 제작한 Y자 모양의 사방이 막힌 미로로 구성되어 있으며, 각 미로는 서로 120°의 일정한 각도로 배치되어 있다. 각각의 미로를 A, B, C 영역으로 정한 후 하나의 영역에 실험동물을 조심스럽게 놓고 8분간 자유롭게 움직이도록 한 다음, 각 미로에 들어간 횟수 및 순서를 측정하여 변경 행동력 (spontaneous alteration, %)을 평가하였다. 세 곳의 다른 영역에 순차적으로 들어간 경우 1점(실제변경: actual alteration, 즉 ABC, BCA, CAB 등의 순서)으로 인정하였다. 연속되게 들어가 지 않은 경우는 점수로 인정하지 않았다. 따라서 % 변경행동력 (% spontaneous alteration)은 다음과 같은 수식으로 계산하였다.The Y-maze lab apparatus consists of a blocky maze of Y-shaped blocks made of black acrylic plates (10 cm wide, 41 cm wide and 25 cm high). Each maze is placed at a constant angle of 120 ° to each other. have. Each labyrinth is defined as A, B, and C zones, and the experimental animals are carefully placed in one zone and allowed to move freely for 8 minutes, and then the number and order of entry into each labyrinth is measured to determine the spontaneous alteration (%). Evaluated. One point (sequential change: actual alteration: ABC, BCA, CAB, etc.) was accepted if entered into three different areas sequentially. In the case of not entering consecutively, the score was not recognized. Therefore,% spontaneous alteration was calculated by the following equation.
% spontaneous alteration = 총 alteration 수/(총 입장 회수 - 2) x 100% spontaneous alteration = total alteration / (total entries-2) x 100
2) Passive avoidance 시험2) Passive avoidance test
학습 및 기억력 측정을 위하여 널리 이용하고 있는 Passive avoidance test(수동회피실험)는 설치류의 working memory ability를 측정하는 방법이다. 수동회피실험 장치는 두 칸의 방으로 나뉘어 있는 shuttle box로 한쪽 방에는 밝은 전구가 설치되어 있어 실험동물이 싫어하는 밝은 환경을 조성할 수 있게 하였으며, 다른 한쪽 방에는 빛이 들어오지 않게 하여 실험동물이 편안함을 느끼게 하였다. 2시간의 스트레스 부과가 끝나고 난 뒤, 수동회피반응을 시험했다(training test). 어두운 방의 바닥에는 알루미늄 막대가 일정한 간격으로 깔려 있어서 이를 통해 동물의 발바닥에 전기충격을 가할 수 있다. 실험동물은 어두운 방에 들어가려는 경향이 있어, 밝은 방에 두었다가 어두운 방에 들어가게 되면 전기 쇼크(5V, 0.5 mA, 10 sec)를 주어 동물이 이를 기억 하게 하였다. 이후 곧바로, 24시간 후에 전기쇼크 없이, 어두운 방으로 들어가는 시간(latency time)을 90초까지 측정하였다 (retention test 1, 2, 3).The passive avoidance test, which is widely used to measure learning and memory, is a measure of the working memory ability of rodents. The passive avoidance test device is a shuttle box that is divided into two compartments. A bright light bulb is installed in one room to create a bright environment that the experimental animal dislikes. Made me feel. After 2 hours of stress, the passive avoidance reaction was tested (training test). In the dark room, aluminum bars are spread at regular intervals, which can be used to shock the animal's paws. The animals tended to enter the dark room, and when placed in the dark room, they were given an electric shock (5V, 0.5 mA, 10 sec) to remind the animal. Immediately thereafter, after 24 hours, the latency time into the dark room without electric shock was measured up to 90 seconds (
(2) 연구 결과(2) study results
AM485-3p를 비강내 처리한 5xFAD에서 인지 기능 여부를 비교하였다(도 11). 행동실험 결과 WT 대비 5xFAD에서 변경 행동력(Spontaneous alteration, 도 11(A)) 및 머무름 시간(Latency time, 도 11(B))이 모두 감소하였다. 알츠하이머성 치매의 주 증상이 행동 장애 및 기억력 저하로 대표되므로 5xFAD의 행동 장애는 아밀로이드베타의 과도한 축적 및 병리현상에 의한 것으로 보여진다. 그러나 AM485-3p를 비강 처치한 군에서는 변경 행동력 및 머무름 시간이 모두 5xFAD 대비 유의하게 증가하였다. 이는 AM485-3p의 처리가 miR-485-3p이 아밀로이드베타42단백질 생성을 촉진시켜 나타나는 행동 장애, 기억력 저하와 같은 병리 증상을 해소시켜 알츠하이머의 주요 증상을 개선시킬 수 있다는 것을 의미한다. 따라서 miR-485-3p를 조절하는 약물 또는 조성물 제조는 알츠하이머 치매의 주요 증상인 행동 장애 및 인지 기능을 개선할 수 있는 새로운 전략이 될 수 있음을 제안한다.The cognitive function was compared in 5xFAD intranasally treated with AM485-3p (FIG. 11). As a result of the behavioral experiment, the change behavior (Spontaneous alteration, FIG. 11 (A)) and retention time (Latency time, FIG. 11 (B)) were all reduced at 5xFAD. Since the main symptoms of Alzheimer's dementia are represented by behavioral impairment and memory loss, the behavioral impairment of 5xFAD appears to be due to excessive accumulation and pathology of amyloid beta. However, in the group treated with AM485-3p, both altered behavior and retention time increased significantly compared to 5xFAD. This means that the treatment of AM485-3p may improve the major symptoms of Alzheimer's by mimicking pathological symptoms such as behavioral disorders and memory loss that miR-485-3p promotes amyloidbeta42 protein production. Therefore, we suggest that the preparation of drugs or compositions that modulate miR-485-3p may be a new strategy to improve behavioral disorders and cognitive function, which are the main symptoms of Alzheimer's dementia.
실시예 9: 통계 분석Example 9: Statistical Analysis
Student's-t 테스트를 사용하여 두 그룹을 비교하였고, 분산에 대한 Krushall-Wallis 분석을 사용하여 3개 이상의 그룹을 비교하였다. Krushall-Wallis 테스트에서 얻은 P-수치가 <0.05 일때, Mann-Whitney U 테스트를 사용하여 그룹 사이 비교의 사후 검정 (post-hoc)을 하였다. 0.05 이하의 양측 검증된(two-tailed) P-수치가 통계적으로 유의한 것으로 하였다.Two groups were compared using the Student's-t test and three or more groups were compared using the Krushall-Wallis analysis of variance. When the P-value obtained from the Krushall-Wallis test was <0.05, the Mann-Whitney U test was used to post-hoc the comparison between the groups. Two-tailed P-values of 0.05 or less were considered statistically significant.
이상으로 본 발명 내용의 특정한 부분을 상세히 기술하였는바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적 기술은 단지 바람직한 실시 양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다고 할 것이다.As described above in detail specific parts of the present invention, it will be apparent to those skilled in the art that these specific descriptions are merely preferred embodiments, and thus the scope of the present invention is not limited thereto. will be. Thus, the substantial scope of the present invention will be defined by the appended claims and their equivalents.
<110> BIORCHESTRA Ltd. <120> Method for Diagnosing Alzheimer's disease Using microRNA-485-3p <130> P17-B152 <160> 8 <170> KoPatentIn 3.0 <210> 1 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miR-485-3p <400> 1 gucauacacg gcucuccucu cu 22 <210> 2 <211> 73 <212> RNA <213> Artificial Sequence <220> <223> miR-485-3p <400> 2 acuuggagag aggcuggccg ugaugaauuc gauucaucaa agcgagucau acacggcucu 60 ccucucuuuu agu 73 <210> 3 <211> 9 <212> RNA <213> Artificial Sequence <220> <223> miR-485-3p <400> 3 guguaugac 9 <210> 4 <211> 8 <212> RNA <213> Artificial Sequence <220> <223> miR-485-3p <400> 4 uguaugac 8 <210> 5 <211> 8 <212> RNA <213> Artificial Sequence <220> <223> miR-485-3p <400> 5 guguauga 8 <210> 6 <211> 7 <212> RNA <213> Artificial Sequence <220> <223> miR-485-3p <400> 6 uguauga 7 <210> 7 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miR-485-3p <400> 7 agagaggaga gccguguaug ac 22 <210> 8 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> mmu-miR-485-3p <400> 8 agucauacac ggcucuccuc uc 22 <110> BIORCHESTRA Ltd. <120> Method for Diagnosing Alzheimer's disease Using microRNA-485-3p <130> P17-B152 <160> 8 <170> KoPatentIn 3.0 <210> 1 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miR-485-3p <400> 1 gucauacacg gcucuccucu cu 22 <210> 2 <211> 73 <212> RNA <213> Artificial Sequence <220> <223> miR-485-3p <400> 2 acuuggagag aggcuggccg ugaugaauuc gauucaucaa agcgagucau acacggcucu 60 ccucucuuuu agu 73 <210> 3 <211> 9 <212> RNA <213> Artificial Sequence <220> <223> miR-485-3p <400> 3 guguaugac 9 <210> 4 <211> 8 <212> RNA <213> Artificial Sequence <220> <223> miR-485-3p <400> 4 uguaugac 8 <210> 5 <211> 8 <212> RNA <213> Artificial Sequence <220> <223> miR-485-3p <400> 5 guguauga 8 <210> 6 <211> 7 <212> RNA <213> Artificial Sequence <220> <223> miR-485-3p <400> 6 uguauga 7 <210> 7 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miR-485-3p <400> 7 agagaggaga gccguguaug ac 22 <210> 8 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> mmu-miR-485-3p <400> 8 agucauacac ggcucuccuc uc 22
Claims (12)
A composition for diagnosing Alzheimer's disease comprising a primer capable of amplifying miR-485-3p of blood or plasma, or a probe capable of hybridizing with miR-485-3p, wherein the expression of the miR-485-3p is performed using the diagnostic composition. The diagnostic composition, characterized in that the amount is increased by more than five times compared to the normal group in patients with Alzheimer's disease.
Alzheimer's disease diagnostic kit comprising the composition of claim 10.
Priority Applications (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020170147272A KR102074407B1 (en) | 2017-11-07 | 2017-11-07 | Method for Diagnosing Alzheimer's disease Using microRNA-485-3p |
PCT/KR2017/014749 WO2018139759A1 (en) | 2017-01-26 | 2017-12-14 | Method for diagnosis of alzheimer's disease using microrna |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020170147272A KR102074407B1 (en) | 2017-11-07 | 2017-11-07 | Method for Diagnosing Alzheimer's disease Using microRNA-485-3p |
Related Child Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020190165478A Division KR102105016B1 (en) | 2019-12-12 | 2019-12-12 | Method for Diagnosing Alzheimer's disease Using microRNA-485-3p |
Publications (2)
Publication Number | Publication Date |
---|---|
KR20190051510A KR20190051510A (en) | 2019-05-15 |
KR102074407B1 true KR102074407B1 (en) | 2020-02-06 |
Family
ID=66579468
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020170147272A KR102074407B1 (en) | 2017-01-26 | 2017-11-07 | Method for Diagnosing Alzheimer's disease Using microRNA-485-3p |
Country Status (1)
Country | Link |
---|---|
KR (1) | KR102074407B1 (en) |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR102321753B1 (en) * | 2021-08-13 | 2021-11-04 | 주식회사 알츠코리아 | Novel biomarker microRNA for diagnosing early Alzheimer's disease |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2015073972A1 (en) | 2013-11-18 | 2015-05-21 | Diamir, Llc | METHODS OF USING mIRNAs FROM BODILY FLUIDS FOR DETECTION AND MONITORING OF PARKINSON'S DISEASE (PD) |
-
2017
- 2017-11-07 KR KR1020170147272A patent/KR102074407B1/en active IP Right Grant
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2015073972A1 (en) | 2013-11-18 | 2015-05-21 | Diamir, Llc | METHODS OF USING mIRNAs FROM BODILY FLUIDS FOR DETECTION AND MONITORING OF PARKINSON'S DISEASE (PD) |
Non-Patent Citations (7)
Title |
---|
Acta Neuropathologica (2011) 121:193-205 |
Aging (2012) 4(9):590-605 |
Alzheimer's & Dementia (2017.07.) 13(7)Supplement:P710-P711 |
BMC Neurology (2010) 10:108 |
Frontiers in Aging Neuroscience (2017.10.04.) 9:323* |
Frontiers in Neuroscience (2015) 9:430* |
Journal of Alzheimer's Disease (2016.12.06.) 55(3):1175-1182* |
Also Published As
Publication number | Publication date |
---|---|
KR20190051510A (en) | 2019-05-15 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US10011835B2 (en) | miRNAs as novel therapeutic targets and diagnostic biomarkers for parkinson's disease | |
US11198908B2 (en) | Method for diagnosis of Alzheimer's disease using microRNA | |
Wang et al. | miR-107 regulates granulin/progranulin with implications for traumatic brain injury and neurodegenerative disease | |
Korotkov et al. | microRNA‐132 is overexpressed in glia in temporal lobe epilepsy and reduces the expression of pro‐epileptogenic factors in human cultured astrocytes | |
KR101758667B1 (en) | Means and methods for counteracting, preventing and/or determining heart failure, or a risk of heart failure | |
US11542503B2 (en) | Uses for prevention or treatment of brain diseases using microRNA | |
KR102105016B1 (en) | Method for Diagnosing Alzheimer's disease Using microRNA-485-3p | |
WO2018139759A1 (en) | Method for diagnosis of alzheimer's disease using microrna | |
WO2012105826A1 (en) | Use of micrornas in diagnosis and therapy of aging | |
KR102547432B1 (en) | Pharmaceutical Composition Comprising Modulator of TUT4/7 Expression | |
CN108611413B (en) | Parkinson related biomarker and application thereof | |
Grinman et al. | Emerging roles for long noncoding RNAs in learning, memory and associated disorders | |
KR102304878B1 (en) | Method for Treating Alzheimer's Disease Using microRNA-485-3p Inhibitor | |
KR102074407B1 (en) | Method for Diagnosing Alzheimer's disease Using microRNA-485-3p | |
Teresa de Barros Viegas et al. | miRNAs: new biomarkers and therapeutic targets in dementia | |
CA3046766A1 (en) | Method for diagnosis of alzheimer's disease using microrna | |
AU2019204231A1 (en) | Method for diagnosis of Alzheimer's disease using microRNA | |
EP4023768A1 (en) | Methods and kits for detecting a risk for developing neurological or neurophysiological disorders | |
US20220348916A1 (en) | Composition for diagnosis or treatment of a condition associated with increased activity of eif4e comprising an eif4e inhibitor | |
McCallister et al. | A high-fidelity CRISPR-Cas13 system improves abnormalities associated with C9ORF72-linked ALS/FTD | |
EP3947676A1 (en) | Inhibitor of mir-129 and uses thereof | |
AU2019204230A1 (en) | Uses for prevention or treatment of brain diseases using microRNA | |
Parsi | miRNAs as therapeutic agents in neurodegeneration: a pilot study | |
Grasso et al. | Circulating cell-free microRNAs as biomarkers for neurodegenerative diseases | |
CA3046767A1 (en) | Uses for prevention or treatment of brain diseases using microrna |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
A201 | Request for examination | ||
E902 | Notification of reason for refusal | ||
E90F | Notification of reason for final refusal | ||
E701 | Decision to grant or registration of patent right |