KR102070893B1 - Composition for diagnosing of hyperprolactinemia and a method of providing information for predicting the responsiveness of a medication - Google Patents
Composition for diagnosing of hyperprolactinemia and a method of providing information for predicting the responsiveness of a medication Download PDFInfo
- Publication number
- KR102070893B1 KR102070893B1 KR1020180125094A KR20180125094A KR102070893B1 KR 102070893 B1 KR102070893 B1 KR 102070893B1 KR 1020180125094 A KR1020180125094 A KR 1020180125094A KR 20180125094 A KR20180125094 A KR 20180125094A KR 102070893 B1 KR102070893 B1 KR 102070893B1
- Authority
- KR
- South Korea
- Prior art keywords
- hyperprolactinemia
- mir
- hsa
- mirna
- present
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Pathology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Description
본 발명은 고프로락틴혈증의 진단용 조성물에 관한 것으로, 보다 구체적으로 프로락틴선종에 의해 유도된 고프로락틴혈증을 진단하기 위한 조성물에 관한 것이다. 또한, 고프로락틴혈증에서 약물 치료의 반응성을 예측하기 위한 정보를 제공하는 방법에 관한 것이다.The present invention relates to a composition for diagnosing hyperprolactinemia, and more particularly, to a composition for diagnosing hyperprolactinemia induced by prolactin adenoma. It also relates to a method of providing information for predicting the responsiveness of drug treatment in hyperprolactinemia.
고프로락틴혈증(hyperprolactinemia)은 혈액 내의 프로락틴(prolactin)의 수치가 여성의 경우 25 ng/mL 미만, 남성의 경우 15 ng/mL 미만이 정상 수치에 비하여 비정상적으로 높은 것을 의미한다.Hyperprolactinemia means that the levels of prolactin in the blood are abnormally higher than normal levels of less than 25 ng / mL in women and less than 15 ng / mL in men.
상기 프로락틴은 뇌하수체 전엽의 프로락틴분비세포에서 생성되고 프로락틴분비세포에 분포되어 있는 도파민 타입 2(dopamine type 2) 수용체에 의해 조절되면서 박동성에 의해 분비된다. 프로락틴의 분비를 억제하는 인자는 도파민이 대표적이며, 소마토스타틴(somatostatin), 감마-아미노뷰티르산(gamma-aminobutyric acid) 등이 존재한다. 이와 같은 상기 프로락틴의 혈중 내에 존재하는 양은 임신이나 수유, 운동, 식사, 전신마취, 수술적 처치 및 급성 스트레스 이후에 증가될 수 있다.The prolactin is produced by prolactin-secreting cells of the anterior pituitary gland and is regulated by dopamine type 2 receptors distributed in the prolactin-secreting cells and secreted by pulsatile properties. Dopamine is a representative factor that inhibits the secretion of prolactin, and somatostatin, gamma-aminobutyric acid, and the like are present. The amount of such prolactin present in the blood may be increased after pregnancy or lactation, exercise, diet, general anesthesia, surgical treatment and acute stress.
상기 고프로락틴혈증이 유도될 수 있는 원인들은 매우 다양하다. 생리적인 상황으로는 임신, 수유, 스트레스, 운동 그리고 수면과 같은 것들이 존재하며, 신경이완제, 항정신병약제 등과 같은 약물의 복용에 의해도 유도될 수 있다. 일차성 갑상선기능저하증에 의해서도 중등도의 고프로락틴혈증이 유도될 수 있다. 또한, 임신과 관련되지 않는 고프로락틴혈증은 주로 프로락틴선종(prolactinoma)에 의해 유도될 수 있고, 시상하부-뇌하수체-도파민 경로를 방해하는 병적인 경우나 약물의 원인에 의해서도 유도될 수 있다. 뿐만 아니라, 비기능성 뇌하수체 종양이나 다른 터키안 주위에 발생된 종양이 뇌하수체 줄기를 압박하여 도파민 뉴런이 손상되거나 도파민 신호가 차단될 경우 프로락틴 억제가 저하되는 현상에 의해 유도될 수 있다.There are a variety of reasons why the hyperprolactinemia can be induced. Physiological situations include pregnancy, lactation, stress, exercise and sleep, and can also be induced by taking medications such as neuroleptics and antipsychotics. Primary hypothyroidism can also lead to moderate hyperprolactinemia. In addition, hyperprolactinemia not associated with pregnancy can be induced primarily by prolactinoma and also by pathological cases or drug causes that interfere with the hypothalamic-pituitary-dopamine pathway. In addition, non-functional pituitary tumors or tumors that develop around other Turkish subjects may be induced by a phenomenon in which prolactin inhibition is reduced when the dopamine neurons are damaged or the dopamine signal is blocked by compressing the pituitary stem.
한편, 고프로락틴혈증 치료는 원인 질환을 교정하고, 고프로락틴혈증으로 인한 다양한 질환을 예방하거나, 호전시키기 위한 것을 치료의 목적으로 한다. 구체적으로, 고프로락틴혈증의 치료를 위해 도파민 작용제인 bromocriptine, pergolide, cabergoline, metergoline, quinagolide 등을 이용한 약물 치료, 수술 및 방사선 치료가 고려될 수 있다. 이러한 약물 치료에도 불구하고, 시야 장애가 존재하거나 뇌신경을 침범한 거대선종이 있는 경우 또는 약제에 대한 내성이 존재하는 경우에는 개두술 또는 경접형동절제술과 같은 수술적 치료 방법이나, 방사선 치료 방법을 고려해야 한다. 하지만, 약물 치료에 불응하는 환자에게 장기간 약물 치료 지속시 정상 뇌하수체 조직과 종양 조직간의 유착이 발생하여 추후 수술적 완전 절제가 불가능해 지며, 수술적인 치료 방법은 뇌척수액 유출(CSF rhinorrhea), 요붕증, 감염, 시력감소, 뇌하수체 기능부전 등의 부작용이 수반될 수 있으므로, 초기에 고프로락틴혈증의 원인을 정확하게 감별 진단하고 최적의 1차 치료 적용을 위한 약물 치료의 반응성을 예측하는 것이 매우 중요하다.On the other hand, hyperprolactinemia treatment aims at correcting the causative disease and preventing or improving various diseases caused by hyperprolactinemia. Specifically, drug treatment, surgery and radiation therapy using dopamine agonists bromocriptine, pergolide, cabergoline, metergoline, quinagolide, etc. may be considered for the treatment of hyperprolactinemia. Despite these medications, surgical treatments such as craniotomy or transverse sinus resection, or radiation therapy should be considered when there is a visual field disorder, a massive adenomas involving the cranial nerve, or resistance to the drug. However, long-term treatment of patients with refractory medications results in adhesion between normal pituitary and tumor tissues, and surgically complete excision is impossible. Surgical treatments include CSF rhinorrhea, diabetes insipidus, and infection. Because side effects, such as decreased vision and pituitary dysfunction, may be accompanied, it is very important to accurately differentially diagnose the cause of hyperprolactinemia and to predict the responsiveness of drug treatment for optimal primary treatment application.
이와 같이 고프로락틴혈증의 치료 방법은 그 원인에 따라 다르게 접근해야 함에도 불구하고, 현재까지 고프로락틴혈증을 진단하고 약물 치료의 반응성을 정확하게 예측할 수 있는 진단 키트 등에 대해서는 연구된 바 없다.Although the method of treating hyperprolactinemia should be approached differently depending on the cause, there has not been studied a diagnostic kit for diagnosing hyperprolactinemia and accurately predicting the responsiveness of drug treatment.
본 발명의 일 목적은 고프로락틴혈증(Hyperprolactinemia)의 진단용 조성물 및 키트를 제공하는 것이다.One object of the present invention is to provide a composition and kit for diagnosing hyperprolactinemia.
본 발명의 다른 목적은 고프로락틴혈증의 진단을 위한 정보를 제공하는 방법을 제공하는 것이다.Another object of the present invention is to provide a method for providing information for the diagnosis of hyperprolactinemia.
본 발명의 또 다른 목적은 약물 치료의 반응성을 예측하기 위한 정보를 제공하는 방법을 제공하는 것이다.Another object of the present invention is to provide a method for providing information for predicting the responsiveness of drug treatment.
그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당 업계에서 통상의 지식을 가진 자에게 명확하게 이해될 수 있을 것이다.However, the technical problem to be achieved by the present invention is not limited to the above-mentioned problem, another task not mentioned will be clearly understood by those skilled in the art from the following description.
본 발명자들은 약물 치료 방법이 적합한 프로락틴선종에 의해 유도된 고프로락틴혈증(Hyperprolactinemia) 환자의 환자의 혈액 내에, 정상인에 비하여 hsa-miR-424-5p, hsa-miR-514a-5p 및 hsa-miR-20a-5p가 높은 수준으로 존재하는 것을 발견하여 본 발명을 완성하게 되었다.The inventors of the present invention have found that hsa-miR-424-5p, hsa-miR-514a-5p, and hsa-miR- in the blood of patients with hyperprolactinemia induced by suitable prolactin adenomas with suitable drug treatment methods. The discovery of high levels of 20a-5p led to the completion of the present invention.
본 발명의 일 구현 예는 고프로락틴혈증의 진단용 조성물을 제공하는 것이다.One embodiment of the present invention to provide a composition for diagnosing hyperprolactinemia.
상기 진단용 조성물은 hsa-miR-424-5p, hsa-miR-514a-5p 및 hsa-miR-20a-5p로 구성된 군으로부터 선택되는 적어도 어느 하나 이상의 miRNA가 존재하는 수준을 측정하는 제제를 포함한다.The diagnostic composition includes an agent for measuring the level of the presence of at least one miRNA selected from the group consisting of hsa-miR-424-5p, hsa-miR-514a-5p and hsa-miR-20a-5p.
상기 miRNA가 존재하는 수준을 측정하는 제제는 목적하는 환자 등으로부터 분리된 시료 내에 존재하는 miRNA를 측정하기 위한 제제로서, hsa-miR-424-5p, hsa-miR-514a-5p 또는 hsa-miR-20a-5p에 특이적으로 결합하는 프라이머 또는 프로브일 수 있다. The agent for measuring the level of the miRNA is present as an agent for measuring the miRNA present in a sample isolated from the patient, such as hsa-miR-424-5p, hsa-miR-514a-5p or hsa-miR- It may be a primer or a probe that specifically binds to 20a-5p.
상기 프라이머 또는 프로브의 디자인은 상기 hsa-miR-424-5p, hsa-miR-514a-5p 및 hsa-miR-20a-5p의 염기 서열을 참조하여 당업계에서 공지된 방법에 따라 쉽게 제작할 수 있다.The design of the primer or probe can be easily made according to methods known in the art with reference to the base sequences of hsa-miR-424-5p, hsa-miR-514a-5p and hsa-miR-20a-5p.
상기 hsa-miR-424-5p의 염기 서열은 CAGCAGCAAUUCAUGUUUUGAA인 서열번호 1일 수 있고, 상기 hsa-miR-514a-5p의 염기 서열은 UACUCUGGAGAGUGACAAUCAUG인 서열번호 2일 수 있으며, 상기 hsa-miR-20a-5p의 염기 서열은 UAAAGUGCUUAUAGUGCAGGUAG인 서열번호 3일 수 있으나, 이에 제한되는 것은 아니다.The base sequence of hsa-miR-424-5p may be SEQ ID NO: 1, CAGCAGCAAUUCAUGUUUUGAA, and the base sequence of hsa-miR-514a-5p may be SEQ ID NO: 2, UACUCUGGAGAGUGACAAUCAUG, and the hsa-miR-20a-5p The base sequence of may be SEQ ID NO: 3, which is UAAAGUGCUUAUAGUGCAGGUAG, but is not limited thereto.
상기 프라이머는 짧은 자유 3말단 수산화기(free 3' hydroxyl group)를 가지는 염기서열로 상보 적인 템플레이트(template)와 염기쌍(base pair)을 형성할 수 있고, 템플레이트 가닥 복사를 위한 시작 지점으로 기능하는 짧은 염기서열로서, 증폭의 대상이 되는 miRNA에 정방향 프라이머와 역방향 프라이머가 쌍을 이루어 반응하는 과정을 통해 PCR 산물이 생성되도록 할 수 있다.The primer is a base sequence having a short free 3 'hydroxyl group, which may form a complementary template and base pair, and serves as a starting point for template strand copying. As a sequence, a PCR product may be generated through a process in which a forward primer and a reverse primer are paired with a miRNA to be amplified.
상기 프로브는 상기 miRNA에 특이적으로 결합할 수 있는 수개 내지 수백개의 염기서열의 단편으로서, 시각화 될 수 있도록 형광등이 표지 되어 있기 때문에 상기 프로브를 이용하는 경우 miRNA의 존재 유무 및 시료 내 존재하는 양을 확인할 수 있다.The probe is a fragment of several hundreds to hundreds of nucleotide sequences that can specifically bind to the miRNA, and since the fluorescent lamp is labeled so that it can be visualized, the presence of the miRNA and the amount present in the sample can be confirmed. Can be.
본 발명에서 상기 진단용 조성물을 이용하여 목적하는 환자 및 정상인 으로부터 분리된 시료 내에 존재하는 miRNA가 존재하는 수준을 측정한 뒤, 정상인에 비하여 그 존재 수준이 높은 경우 고프로락틴혈증임을 진단할 수 있다. In the present invention, after measuring the level of the miRNA present in the sample isolated from the target patient and a normal person using the diagnostic composition, the presence of a high level compared to the normal person can be diagnosed as hyperprolactinemia.
상기 고프로락틴혈증은 시상하부-뇌하수체 축에서 발견되는 내분비질환으로, 뇌하수체종양에 의해 유도된 것일 수 있다. 바람직하게는 상기 뇌하수체종양은 프로락틴선종(Prolactinoma)인 것일 수 있으나, 이에 제한되는 것은 아니다. The hyperprolactinemia is an endocrine disease found in the hypothalamic-pituitary axis, which may be induced by pituitary tumors. Preferably, the pituitary tumor may be prolactinoma, but is not limited thereto.
상기 뇌하수체줄기에 발생한 종양으로 인하여 뇌하수체 줄기 압박으로 인해 유도된 고프로락틴혈증에 비하여, 상기 프로락틴선종에 의해 유도된 고프로락틴혈증의 경우 약물 치료에 대한 반응성이 높기 때문에, 상기 조성물은 고프로락틴혈증의 약물 반응성을 예측하기 위한 것일 수 있으나, 이에 제한되는 것은 아니다.The composition is a hyperprolactinemia drug because hyperprolactinemia induced by prolactin adenoma is highly reactive to drug treatment compared to hyperprolactinemia induced by pituitary stem compression due to tumors occurring in the pituitary stem. It may be to predict the reactivity, but is not limited thereto.
본 발명의 상기 조성물을 이용하여 프로락틴선종에 의해 유도된 고프로락틴혈증을 선별하는 경우 조기에 적절한 1차 치료 방법을 제공할 수 있고, 부적절한 치료로 인한 부작용의 발생과 완치율이 저하되는 현상을 현저하게 감소시킬 수 있다.In the case of screening hyperprolactinemia induced by prolactin adenomas using the composition of the present invention, an appropriate primary treatment method can be provided at an early stage, and the occurrence of side effects and the cure rate due to inappropriate treatment are significantly reduced. Can be reduced.
상기 고프로락틴혈증은 골다공증, 성기능 장애, 불임 및 유즙 분비증(galactorrhea), 뇌하수체 종양, 뇌종양으로 구성된 군으로부터 선택되는 적어도 하나 이상의 질환이 동반되는 것일 수 있다.The hyperprolactinemia may be accompanied by at least one disease selected from the group consisting of osteoporosis, sexual dysfunction, infertility and galactorrhea, pituitary tumor, brain tumor.
본 발명의 다른 구현 예는 고프로락틴혈증의 진단용 키트를 제공하는 것이다.Another embodiment of the present invention is to provide a kit for diagnosing hyperprolactinemia.
상기 진단용 키트는 miRNA가 존재하는 수준을 측정하기 위한 프라이머, 프로브 또는 분석 방법에 적합한 한 종류 또는 그 이상의 다른 구성 성분 조성물 용액 또는 장치가 포함될 수 있다. The diagnostic kit may include one or more different component composition solutions or devices suitable for primers, probes or assays to determine the level of miRNA present.
상기 키트가 RT-PCR을 통해 수행되는 것인 경우에는, 테스트 튜브 또는 다른 적절한 컨테이너, 반응 완충액 (pH 및 마그네슘 농도는 다양), 데옥시뉴클레오타이드 (dNTPs), Taq-폴리머라아제 및 역전사효소와 같은 효소, DNase, RNase 억제제, DEPC-수 (DEPC-water), 및 멸균수 등을 포함할 수 있다. 또한, 상기 키트가 DNA 칩 어세이를 통해 수행되는 것인 경우에는, 프로브로 부착되어 있는 기판 등을 포함할 수 있다.If the kit is run via RT-PCR, such as test tubes or other suitable containers, reaction buffers (pH and magnesium concentrations vary), deoxynucleotides (dNTPs), Taq-polymerases and reverse transcriptases Enzymes, DNases, RNase inhibitors, DEPC-water, sterile water, and the like. In addition, when the kit is to be carried out through a DNA chip assay, it may include a substrate attached to the probe.
상기 고프로락틴혈증의 진단용 키트는 hsa-miR-424-5p, hsa-miR-514a-5p 및 hsa-miR-20a-5p로 구성된 군으로부터 선택되는 적어도 어느 하나 이상의 miRNA가 존재하는 수준을 측정하는 제제인 상기 진단용 조성물을 이용하여, 고프로락틴혈증을 진단할 수 있다. 따라서, miRNA가 존재하는 수준을 측정하는 제제, 프로브, 프라이머, 고프로락틴혈증, 동반 질환 등과 관련된 내용은 반복 기재에 따른 명세서의 과도한 복잡성을 피하기 위하여 그 기재를 생략한다.The diagnostic kit for diagnosing hyperprolactinemia is an agent that measures the level of the presence of at least one miRNA selected from the group consisting of hsa-miR-424-5p, hsa-miR-514a-5p, and hsa-miR-20a-5p. By using the above diagnostic composition, hyperprolactinemia can be diagnosed. Therefore, content relating to agents, probes, primers, hyperprolactinemia, concomitant diseases, and the like, which measure the level at which miRNA is present, is omitted in order to avoid undue complexity of the specification according to repeated descriptions.
본 발명의 또 다른 구현 예는 고프로락틴혈증의 진단을 위한 정보를 제공하는 방법을 제공하는 것이다.Another embodiment of the invention is to provide a method for providing information for the diagnosis of hyperprolactinemia.
상기 진단을 위한 정보를 제공하는 방법은 목적하는 환자 또는 정상인으로부터 분리된 시료에서, hsa-miR-424-5p, hsa-miR-514a-5p 및 hsa-miR-20a-5p로 구성된 군으로부터 선택되는 적어도 어느 하나 이상의 miRNA가 존재하는 수준을 측정하는 단계; 및 상기 목적하는 환자와 정상인으로부터 분리된 시료에서 측정된 상기 miRNA들이 존재하는 수준을 비교하는 단계를 포함한다.The method of providing information for the diagnosis is selected from the group consisting of hsa-miR-424-5p, hsa-miR-514a-5p and hsa-miR-20a-5p in samples isolated from the patient or normal subject of interest. Measuring the level at which any one or more miRNAs are present; And comparing the levels of the miRNAs measured in a sample isolated from the patient of interest and the normal subject.
상기 목적하는 환자 또는 정상인으로부터 분리된 시료는 전혈, 혈청, 혈장, 타액, 뇨, 객담, 림프액, 세포 등일 수 있으나, 이에 제한되는 것은 아니다.Samples isolated from the target patient or normal person may be, but are not limited to, whole blood, serum, plasma, saliva, urine, sputum, lymph, cells, and the like.
본 발명의 상기 정보를 제공하는 방법은 정상인에 비하여 고프로락틴혈증 환자로부터 분리된 시료에서 miRNA들이 존재하는 수준이 더 높은 경우, 뇌하수체종양에 의해 유도된 고프로락틴혈증으로 판단하는 단계를 더 포함할 수 있다. 바람직하게는 상기 뇌하수체종양은 프로락틴선종일 수 있으나, 이에 제한되는 것은 아니다.The method of providing the information of the present invention may further comprise determining hyperprolactinemia induced by pituitary tumors when the levels of miRNAs present in samples isolated from hyperprolactinemia patients are higher than normal individuals. have. Preferably, the pituitary tumor may be prolactin adenoma, but is not limited thereto.
이와 같이, 상기 miRNA들이 정상인에 비하여 높은 수준으로 존재하는 경우 뇌하수체종양에 의해 유도된 고프로락틴혈증의 진단을 위한 정보를 제공함으로써, 발명 초기에 적절한 1차 치료 방법을 제공할 수 있다.As such, when the miRNAs are present at a higher level than normal persons, information for diagnosing hyperprolactinemia induced by pituitary tumor can be provided, thereby providing an appropriate first-line treatment method in the early stage of the invention.
상기 miRNA가 존재하는 수준의 측정은 miRNA를 증폭시키거나 형광 등으로 표지된 프로브와 상보적으로 결합하는 등의 통상의 방법을 통해 확인될 수 있는 것이고, 예를 들면, 중합효소연쇄반응(polymerase chain reaction), 형광상관분석법(fluorescence correlation spectroscopy), 마이크로어레이(microarray) 및 칩어세이(chip-assay)으로 이루어진 군 중에서 선택되는 적어도 하나 이상일 수 있으나, 이에 제한되는 것은 아니다.Determination of the level of the miRNA can be confirmed through conventional methods such as amplifying the miRNA or complementarily binding to a probe labeled with fluorescence or the like, for example, polymerase chain reaction (polymerase chain reaction) At least one selected from the group consisting of reaction, fluorescence correlation spectroscopy, microarray, and chip-assay, but is not limited thereto.
상기 진단을 위한 정보를 제공하는 방법은 상기 진단용 조성물을 이용하여, 시료 내에 상기 miRNA들이 존재하는 수준을 측정함으로써 고프로락틴혈증의 진단을 위한 정보를 제공할 수 있다. 따라서, miRNA가 존재하는 수준을 측정하는 제제, 프로브, 프라이머, 고프로락틴혈증, 동반 질환 등과 관련된 내용은 반복 기재에 따른 명세서의 과도한 복잡성을 피하기 위하여 그 기재를 생략한다.The method for providing information for diagnosis may provide information for diagnosing hyperprolactinemia by measuring the level of the miRNAs present in a sample using the diagnostic composition. Therefore, content relating to agents, probes, primers, hyperprolactinemia, concomitant diseases, and the like, which measure the level at which miRNA is present, is omitted in order to avoid undue complexity of the specification according to repeated descriptions.
본 발명의 또 다른 구현 예는 약물 치료의 반응성을 예측하기 위한 정보를 제공하는 방법을 제공한다.Another embodiment of the present invention provides a method of providing information for predicting responsiveness of drug treatment.
상기 약물 치료의 반응성을 예측하기 위한 정보를 제공하는 방법은 고프로락틴혈증 환자 또는 정상인으로부터 분리된 시료에서, hsa-miR-424-5p, hsa-miR-514a-5p 및 hsa-miR-20a-5p로 구성된 군으로부터 선택되는 적어도 어느 하나 이상의 miRNA가 존재하는 수준을 측정하는 단계; 및 상기 고프로락틴혈증 환자와 정상인으로부터 분리된 시료에서 측정된 상기 miRNA들이 존재하는 수준을 비교하는 단계를 포함한다.Methods for providing information for predicting the responsiveness of the drug treatment include hsa-miR-424-5p, hsa-miR-514a-5p and hsa-miR-20a-5p in samples isolated from hyperprolactinemia patients or normal individuals. Measuring the level of the presence of at least one miRNA selected from the group consisting of; And comparing the levels of the miRNAs measured in a sample isolated from the hyperprolactinemia patient and a normal person.
본 발명의 상기 약물 치료의 반응성을 예측하기 위한 정보를 제공하는 방법은 정상인에 비하여 고프로락틴혈증 환자에서 분리된 시료에서 miRNA들이 존재하는 수준이 더 높은 경우, 약물 치료의 반응성이 좋을 것으로 예측하는 단계를 더 포함한다. 바람직하게는 상기 뇌하수체종양은 프로락틴선종일 수 있으나, 이에 제한되는 것은 아니다.The method for providing information for predicting the responsiveness of the drug treatment of the present invention comprises the steps of predicting that the reactivity of the drug treatment is good when the level of miRNAs present in a sample isolated from hyperprolactinemia patients is higher than that of a normal person. It further includes. Preferably, the pituitary tumor may be prolactin adenoma, but is not limited thereto.
상기 약물 치료는 고프로락틴혈증 환자에서 혈중 프로락틴 수치가 정상화 될 수 있도록 하는 것으로, 예를 들면 도파민 촉진제(dopamine agonist) 등일 수 있으나, 이에 제한되는 것은 아니다.The drug treatment is intended to normalize blood prolactin levels in patients with hyperprolactinemia, for example, but may be a dopamine agonist, but is not limited thereto.
상기 약물 치료의 반응성을 예측하기 위한 정보를 제공하는 방법은 miR-424-5p, miR-514a-5p 및 miR-20a-5p로 구성된 군으로부터 선택되는 적어도 어느 하나 이상의 miRNA가 존재하는 수준을 측정하는 제제인 상기 진단용 조성물을 이용하여, 상기 진단을 위한 정보를 제공하는 방법에서 기재된 바와 같이 상기 miRNA가 존재하는 수준을 측정함으로써 약물 치료의 반응성을 예측하기 위한 정보를 제공할 수 있다. 따라서, miRNA가 존재하는 수준을 측정하는 제제, 프로브, 프라이머, 고프로락틴혈증, 동반 질환, 측정 방법 등과 관련된 내용은 반복 기재에 따른 명세서의 과도한 복잡성을 피하기 위하여 그 기재를 생략한다.The method for providing information for predicting the responsiveness of the drug treatment is to measure the level of the presence of at least one miRNA selected from the group consisting of miR-424-5p, miR-514a-5p and miR-20a-5p. Using the diagnostic composition as an agent, information for predicting the responsiveness of drug treatment may be provided by measuring the level at which the miRNA is present as described in the method for providing information for diagnosis. Thus, descriptions relating to agents, probes, primers, hyperprolactinemia, comorbidities, methods of measurement, and the like, which measure the level of miRNA present, are omitted in order to avoid undue complexity of the specification according to repeated descriptions.
본 발명의 또 다른 구현 예는 약물 치료의 반응성 예측 장치를 제공한다.Another embodiment of the present invention provides an apparatus for predicting reactivity of drug treatment.
구체적으로, 상기 약물의 치료 반응성 예측 장치는 입력부, 비교 판단부 및 출력부를 포함한다.In detail, the apparatus for predicting treatment reactivity of the drug includes an input unit, a comparison determination unit, and an output unit.
입력부Input
본 발명에서 상기 입력부는 약물의 치료 반응성을 예측하기 위하여, 시료 내에서 측정된 miRNA가 존재하는 수준이 입력되는 것으로서, 상기 입력부는 고프로락틴혈증 환자 또는 정상인으로부터 분리된 시료에서, hsa-miR-424-5p, hsa-miR-514a-5p 및 hsa-miR-20a-5p로 구성된 군으로부터 선택되는 적어도 어느 하나 이상의 miRNA가 존재하는 수준이 입력된다.In the present invention, in order to predict the therapeutic responsiveness of the drug, the input level of the miRNA measured in the sample is input, and the input part is a sample isolated from a hyperprolactinemia patient or a normal person, hsa-miR-424 The level at which at least one miRNA is selected from the group consisting of -5p, hsa-miR-514a-5p and hsa-miR-20a-5p is entered.
상기 약물 치료는 고프로락틴혈증 환자에서 혈중 프로락틴 수치가 정상화 될 수 있도록 하는 것으로, 예를 들면 도파민 촉진제(dopamine agonist) 등일 수 있으나, 이에 제한되는 것은 아니다.The drug treatment is intended to normalize blood prolactin levels in patients with hyperprolactinemia, for example, but may be a dopamine agonist, but is not limited thereto.
상기 시료는 전혈, 혈청, 혈장, 타액, 뇨, 객담, 림프액, 세포 등일 수 있으나, 이에 제한되는 것은 아니다.The sample may be whole blood, serum, plasma, saliva, urine, sputum, lymph, cells, and the like, but is not limited thereto.
상기 miRNA가 존재하는 수준의 측정은 프라이머를 이용하여 miRNA를 증폭시키거나 형광 등으로 표지된 프로브와 상보적으로 결합하는 등의 통상의 방법을 통해 확인되어, 상기 입력부에 입력될 수 있는 것이고, 예를 들면, 중합효소연쇄반응(polymerase chain reaction), 형광상관분석법(fluorescence correlation spectroscopy), 마이크로어레이(microarray) 및 칩어세이(chip-assay)로 이루어진 군 중에서 선택되는 적어도 하나 이상일 수 있으나, 이에 제한되는 것은 아니다.The measurement of the level of the miRNA present can be confirmed through conventional methods such as amplifying the miRNA using a primer or complementarily binding to a probe labeled with fluorescence or the like, and inputting to the input unit. For example, at least one selected from the group consisting of a polymerase chain reaction, a fluorescence correlation spectroscopy, a microarray, and a chip-assay, but is not limited thereto. It is not.
상기 miRNA가 존재하는 수준을 측정하기 위하여 상기 miRNA가 존재하는 수준을 측정하는 제제는 목적하는 환자 등으로부터 분리된 시료 내에 존재하는 miRNA를 측정하기 위한 제제로서, hsa-miR-424-5p, hsa-miR-514a-5p 또는 hsa-miR-20a-5p에 특이적으로 결합하는 프라이머 또는 프로브를 사용할 수 있다.The agent for measuring the level of the miRNA in order to determine the level in which the miRNA is present is an agent for measuring the miRNA present in a sample isolated from the patient or the like, hsa-miR-424-5p, hsa- Primers or probes that specifically bind to miR-514a-5p or hsa-miR-20a-5p can be used.
상기 프라이머 또는 프로브의 디자인은 상기 hsa-miR-424-5p, hsa-miR-514a-5p 및 hsa-miR-20a-5p의 염기 서열을 참조하여 당업계에서 공지된 방법에 따라 쉽게 제작할 수 있다.The design of the primer or probe can be easily made according to methods known in the art with reference to the base sequences of hsa-miR-424-5p, hsa-miR-514a-5p and hsa-miR-20a-5p.
상기 hsa-miR-424-5p의 염기 서열은 CAGCAGCAAUUCAUGUUUUGAA인 서열번호 1일 수 있고, 상기 hsa-miR-514a-5p의 염기 서열은 UACUCUGGAGAGUGACAAUCAUG인 서열번호 2일 수 있으며, 상기 hsa-miR-20a-5p의 염기 서열은 UAAAGUGCUUAUAGUGCAGGUAG인 서열번호 3일 수 있으나, 이에 제한되는 것은 아니다.The base sequence of hsa-miR-424-5p may be SEQ ID NO: 1, CAGCAGCAAUUCAUGUUUUGAA, and the base sequence of hsa-miR-514a-5p may be SEQ ID NO: 2, UACUCUGGAGAGUGACAAUCAUG, and the hsa-miR-20a-5p The base sequence of may be SEQ ID NO: 3, which is UAAAGUGCUUAUAGUGCAGGUAG, but is not limited thereto.
비교 판단부Comparative Judgment Unit
본 발명에서 상기 비교 판단부는 상기 입력부에서 입력된 고프로락틴환자 및 정상인으로부터 분리된 시료에 존재하는 상기 miRNA가 존재하는 수준을 비교 판단한다.In the present invention, the comparison determining unit compares and determines the level of the miRNA present in the sample separated from the high prolactin patient and the normal person input from the input unit.
상기 비교 판단부에서 정상인에 비하여 고프로락틴혈증 환자로부터 분리된 시료에서 상기 miRNA들이 존재하는 수준이 더 높은 경우, 뇌하수체종양에 의해 유도된 고프로락틴혈증으로 판단하는 단계를 더 포함할 수 있다. 바람직하게는 상기 뇌하수체종양은 프로락틴선종일 수 있으나, 이에 제한되는 것은 아니다.When the level of the miRNAs in the sample separated from the hyperprolactinemia patient is higher than that of the normal person in the comparison determination unit, the method may further include determining hyperprolactinemia induced by pituitary tumor. Preferably, the pituitary tumor may be prolactin adenoma, but is not limited thereto.
이와 같이, 상기 miRNA들이 정상인에 비하여 높은 수준으로 존재하는 경우 뇌하수체종양에 의해 유도된 고프로락틴혈증임을 예측할 수 있고, 이를 통해 약물 치료에 반응성이 매우 좋을 수 있음을 예측할 수 있다.As such, when the miRNAs are present at a higher level than normal persons, it can be predicted that hyperprolactinemia induced by pituitary tumors can be expected to be very responsive to drug treatment.
출력부Output
상기 출력부는 비교 판단부에서 판단된 결과를 출력한다.The output unit outputs the result determined by the comparison determination unit.
본 발명의 일 구체 예에서는 상기 출력부에서 출력된 데이터를 액정 표시창과 같이 가시적으로 표시할 수 있는 액정 표시부를 더 포함할 수 있다.In one embodiment of the present invention may further include a liquid crystal display that can visually display the data output from the output unit, such as a liquid crystal display window.
본 발명의 조성물 및 방법을 사용하는 경우, 고프로락틴혈증을 진단할 수 있을 뿐만 아니라, 프로락틴선종이 원인이되는 고프로락틴혈증을 선별하여, 부작용이 적고 완치율이 높은 고프로락틴혈증의 치료 방법을 매우 효과적으로 제공할 수 있다.In the case of using the composition and method of the present invention, it is possible not only to diagnose hyperprolactinemia, but also to select hyperprolactinemia caused by prolactin adenomas, and to effectively treat hyperprolactinemia with low side effects and high cure rate. Can provide.
도 1은 본 발명의 일 실시예에 따른 miRNA 발굴을 위한 고프로락틴혈증을 동반한 뇌하수체 종양 샘플 수집 방법을 도시한 것이다.
도 2 내지 도 4는 본 발명의 일 실시예에 따른 샘플 내에서 miRNA 발굴을 위한 nCounter 분석 결과를 나타낸 것이다.
도 5 내지 도 11은 본 발명의 일 실시예에 따른 miRNA 검증을 위하여, 각 그룹별로 miRNA가 존재하는 수준을 비교한 결과를 나타낸 것이다.
도 12는 본 발명의 일 실시예에 따른 다양한 뇌하수체 종양 조직 내에서 miRNA가 존재하는 수준을 비교한 결과를 나타낸 것이다.Figure 1 illustrates a pituitary tumor sample collection method with hyperprolactinemia for miRNA discovery according to an embodiment of the present invention.
2 to 4 show the results of nCounter analysis for miRNA discovery in the sample according to an embodiment of the present invention.
5 to 11 show the results of comparing the levels of miRNA present in each group for verifying miRNAs according to an embodiment of the present invention.
Figure 12 shows the result of comparing the level of miRNA present in various pituitary tumor tissue according to an embodiment of the present invention.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로서, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for illustrating the present invention in more detail, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention. .
실시예Example
[준비예] 고프로락틴혈증을 동반한 뇌하수체 종양 샘플 수집Preparation: Pituitary tumor sample collection with hyperprolactinemia
도 1에 도시된 바와 같이, 고프로락틴혈증을 동반한 뇌하수체 종양 환자에서 약물 치료 이전에 혈액을 채혈하고, MRI 촬영 검사를 수행하였다. 약물 치료를 시작하고 3개월 뒤, 상기 환자에서 혈액의 채혈 및 MRI 촬영 검사를 수행하였다.As shown in FIG. 1, blood was collected prior to drug treatment in a pituitary tumor patient with hyperprolactinemia and MRI imaging was performed. Three months after the start of drug treatment, the patient underwent blood collection and MRI scans.
상기 3개월 뒤의 MRI 촬영 검사 시에 종양의 크기가 감소하였던 환자에서 15개월 동안 약물 치료를 지속하였고, 15개월 째에 상기 환자에서 혈액의 채혈 및 MRI 촬영 검사를 수행하였다.The drug treatment was continued for 15 months in the patients whose tumor size decreased on the MRI scans after 3 months, and blood sampling and MRI tests were performed on the patients at 15 months.
또한, 상기 3개월 뒤의 MRI 촬영 검사 시에 종양의 크기에 변화가 없거나, 오히려 증가된 환자의 경우, 약물 치료를 중단하고 수술적 치료를 수행하였다. 상기 수술적 치료가 시작되기 직전 및 수술 치료를 수행하고 6개월이 지난 이후의 환자에서 혈액의 채혈 및 MRI 촬영 검사를 수행하였다.In addition, in the case of patients whose tumor size did not change or increased in the MRI scan after 3 months, the drug treatment was stopped and surgical treatment was performed. Blood collection and MRI scans were performed in patients immediately before the surgical treatment commenced and 6 months after the surgical treatment.
여기서, 상기 약물 치료를 위해 미세선종(microadenoma) 환자의 경우 매주 1 내지 2 mg, 대선종(macroadenoma) 환자의 경우 매주 3 내지 4 mg의 용량의 카베골린(carbegoline)을 투여하였다.Here, for the drug treatment, a dose of cabegoline was administered at a dose of 1 to 2 mg per week for microadenoma patients, and 3 to 4 mg per week for patients with adenomas (macroadenoma).
그런 다음, miRNeasy 키트(cat no. 217184, Qiazen, 미국)를 이용하여, 상기 제조사가 제공하는 프로토콜에 따라 상기 약물 치료 이전에 채혈된 혈액으로부터 유래된 혈청에서 miRNA를 포함하는 전체 RNA(total RNA)를 추출하였다.Then, using miRNeasy kit (cat no. 217184, Qiazen, USA), total RNA including miRNA in serum derived from blood collected prior to drug treatment according to the protocol provided by the manufacturer. Was extracted.
[실시예 1] miRNA 발굴Example 1 Excavation of miRNA
고프로락틴 혈증을 동반한 뇌하수체 종양 환자에 특이적인 miRNA를 선별하기 위하여, 상기 준비예에서 추출된 전체 RNA에 존재하는 miRNA의 nCounter 분석을 하기 표 1에서와 같이 3개의 그룹으로 나누어 수행하였다.In order to select miRNAs specific for patients with pituitary tumors with hyperprolactinemia, nCounter analysis of miRNAs present in total RNA extracted in the above preparation was performed in three groups as shown in Table 1 below.
(prolactinoma; PRLoma)Prolactin adenoma
(prolactinoma; PRLoma)
(Nonfuctioning adenoma/non-prolactinoma)Nonfunctional adenoma or nonprolactin adenoma
(Nonfuctioning adenoma / non-prolactinoma)
상기 표 1의 조직학적 진단 그룹은 프로락틴선종(PRLoma) 6명, 비기능성 선종(NFPA) 또는 비-프로락틴선종 6명을 선별하였다. 또한, 상기 임상적 추정 진단 그룹은 혈액 내에 존재하는 프로락틴 수치와, 약물 치료에 따른 뇌하수체의 MRI 상에서 종양의 크기 변화를 바탕으로 약물 비반응군 및 약물 반응군으로 각각 12명을 선별하였다. 또한, 상기 약물 치료 전후 그룹은 약물 치료를 시작하기 이전과 이후의 프로락틴 수치의 정상화에 따라 정상 또는 비정상군으로 각각 12명을 선별하였다.The histological diagnosis group of Table 1 selected 6 prolactin adenomas (PRLoma), 6 non-functional adenomas (NFPA) or 6 non-prolactin adenomas. In addition, the clinical presumptive diagnosis group selected 12 non-drug and drug-responder groups, respectively, based on the prolactin level present in the blood and the tumor size change on the MRI of the pituitary gland following drug treatment. In addition, the group before and after the drug treatment was selected 12 patients each normal or abnormal according to the normalization of the prolactin level before and after the start of the drug treatment.
이와 같이 선별된 상기 3개의 그룹 내 환자로부터 추출된 RNA를 이용하여 nCounter 분석을 수행하였다. nCounter 분석 시에, 정규화 값(normalization value) 15 이상, P-값(P-value) 0.05 이하, 군간 값이 2배 이상으로 확인되는 miRNA를 선별하여, 그 결과를 도 2 내지 도 4와, 하기 표 2 내지 4에 나타내었다.NCounter analysis was performed using RNA extracted from the patients in the three groups thus selected. In the nCounter analysis, miRNAs with a normalization value of 15 or more, a P-value of 0.05 or less, and an intergroup value of 2 or more are identified, and the results are shown in FIGS. Tables 2-4 are shown.
상기 표 2 내지 4에서 보는 바와 같이, 조직학적 진단 그룹 내에서 hsa-miR-612, hsa-miR-301a-3p, hsa-miR-4755-5p 및 hsa-miR-509-5p가 비기능성 선종에 비하여 프로락틴선종에서 적어도 2배 이상 감소되었고, hsa-miR-424-5p, hsa-miR-514a-5p 및 hsa-miR-20a-5p는 적어도 1.24배 이상 증가된 것을 확인하였다. 또한, 임상적 추정 진단 그룹 내에서 hsa-miR-3196, hsa-miR-211-3p, hsa-miR-501-3p, hsa-miR-548h-5p 및 hsa-miR-190a-5p가 약물 비반응군에 비하여 약물 반응군에서 1.5배 이상 감소되었고, hsa-miR-424-5p, hsa-miR-514a-5p 및 hsa-miR-20a-5p는 적어도 1.74배 이상 증가된 것을 확인하였다. 이에 더하여, 약물 치료 전후 그룹 내에서 hsa-miR-587, hsa-miR-1185-2-3p, hsa-miR-1285-3p 및 hsa-miR-939-5p가 약물 치료 전에 비하여 약물 치료 후에서 2배 이상 증가된 것을 확인하였다.As shown in Tables 2 to 4, hsa-miR-612, hsa-miR-301a-3p, hsa-miR-4755-5p, and hsa-miR-509-5p in non-functional adenoma in the histological diagnosis group Compared to the prolactin adenoma was reduced by at least two times, hsa-miR-424-5p, hsa-miR-514a-5p and hsa-miR-20a-5p was confirmed to be increased by at least 1.24 times. In addition, hsa-miR-3196, hsa-miR-211-3p, hsa-miR-501-3p, hsa-miR-548h-5p and hsa-miR-190a-5p were non-responsive within the clinical putative diagnostic group. It was confirmed that the drug response group was reduced by 1.5 times or more, and the hsa-miR-424-5p, hsa-miR-514a-5p, and hsa-miR-20a-5p increased at least 1.74 times compared to the group. In addition, hsa-miR-587, hsa-miR-1185-2-3p, hsa-miR-1285-3p, and hsa-miR-939-5p in the group before and after drug treatment were compared to after the drug treatment. It was confirmed that more than doubled.
[실시예 2] 뇌하수체 종양 및 프로락틴 분비와 관련된 miRNA 선별Example 2 miRNA Screening Associated with Pituitary Tumors and Prolactin Secretion
상기 실시예 1에서 선별된 miRNA 중에서, 뇌하수체 종양 및 호르몬 생성과 관련된 기능이 존재할 것으로 예상되는 miRNA를 miRNA로서 선별하는 과정을 수행하였다.Of the miRNAs selected in Example 1, a process was performed to select miRNAs that are expected to have functions related to pituitary tumor and hormone production as miRNAs.
구체적으로, 뇌하수체 종양 및 호르몬 생성과 연관성이 있는 RNA의 리스트를 미리 데이터 베이스화하여 준비한 표적 스캔휴먼 웹사이트(Target ScanHuman website; http://www.targetscan.org/vert_72/)를 기반으로, 상기 실시예 1에서 발굴된 miRNA에서 특정 miRNA를 표적하는 RNA의 종류를 확인하고, 이 중에서 뇌하수체와 관련된 RNA를 표적하는 miRNA만을 선별하였다.Specifically, based on the target ScanHuman website (http://www.targetscan.org/vert_72/) prepared by database-preparing a list of RNAs associated with pituitary tumor and hormone production, In the miRNA discovered in Example 1, the type of RNA targeting a specific miRNA was confirmed, and among these, only miRNAs targeting RNA related to the pituitary gland were selected.
그 결과, 상기 실시예 1에서 발굴된 miRNA 중 뇌하수체 종양과 호르몬 생성에 연관이 있는 것으로 확인된 hsa-miR-424-5p, hsa-miR-514a-5p 및 hsa-miR-20a-5p를 선별하였다.As a result, hsa-miR-424-5p, hsa-miR-514a-5p, and hsa-miR-20a-5p, which were found to be related to pituitary tumor and hormone production, were selected from the miRNAs discovered in Example 1 above. .
[실시예 3] miRNA 검증을 위한 부분군 분석(subgroup analysis)Example 3 Subgroup Analysis for miRNA Validation
본 발명에서 선별된 miRNA의 검증에 사용될 수 있는 부분군 분석을 위하여 4개의 그룹을 하기 표 5와 같이 구성하였다. 여기서, 상기 4개의 그룹 내 포함되는 환자는 상기 준비예와 동일한 방법으로 혈액 채취 및 MRI 영상 촬영을 수행하였다.Four groups were configured as shown in Table 5 below for subgroup analysis that can be used for verification of selected miRNAs in the present invention. Here, the patients included in the four groups were subjected to blood sampling and MRI imaging in the same manner as the preparation example.
상기 표 5의 1 그룹을 약물 치료 이전에 혈액 검사 상으로 프로락틴 수치와 MRI 촬영 검사 결과를 이용하여 정상, 프로락틴선종, 프로락틴선종이 아닌 뇌하수체 종양에 의한 줄기 효과로 인해 발생된 프로락틴혈증, 임상적으로 추정이 불가능한 경우 및 특발성 고프로락틴혈증으로 분류하였다. 또한, 3개월 또는 15개월 동안 약물 치료를 수행하고, 그에 의해 20 % 이상 또는 30 % 이상 종양의 크기가 감소된 경우, 종양 크기의 변화가 없는 경우를 2 그룹 또는 3 그룹으로 분류하였다. 수술이 시행된 경우, 면역화학염색상에서 뇌하수체 종양의 종류가 프로락틴 선종인 경우와 아닌 경우를 4 그룹 분류하였다. 여기서, miRNA를 포함하는 전체 RNA의 추출하기 위해 상기 준비예에서와 동일한 방식을 수행하였다.Prolactinemia caused by the stem effect of the pituitary gland rather than normal, prolactin, and prolactin adenomas using prolactin levels and MRI imaging results on blood tests prior to drug treatment Cases were not estimated and classified as idiopathic hyperprolactinemia. In addition, when drug treatment was performed for 3 months or 15 months, whereby the tumor size was reduced by 20% or more or 30% or more, the cases where there was no change in tumor size were classified into 2 or 3 groups. When surgery was performed, four groups were classified into those with and without prolactin adenoma in immunochemical staining. Here, the same manner as in the above preparation was performed to extract the total RNA including the miRNA.
상기 1 그룹 내지 4 그룹의 약물 치료 전 또는 약물 치료 후에 채혈된 혈액으로부터 추출된 혈액 내에서, 상기 실시예 2에서 선별된 miRNA가 존재하는 수준을 비교하기 위해 중합효소연쇄반응을 수행하였다. 중합효소연쇄반응을 위해, miRNA cDNA 합성 키트(ABI, Cat no. a28007, 미국)를 사용하여, 상기 추출된 각각의 RNA를 주형가닥으로 cDNA를 합성하였다. 그런 다음, 상기 각각의 cDNA를 주형가닥으로, TaqMan™ Advanced miRNA 분석 프로브(ABI, Cat no. a25576, 미국)를 사용하여, hsa-miR-424-5p(478586_mir), hsa-miR-514a-5p(478092_mir) 및 hsa-miR-20a-5p(478974_mir)에 대한 중합효소연쇄반응을 수행하였다. The polymerase chain reaction was performed to compare the levels of the miRNAs selected in Example 2 in the blood extracted from the blood collected before or after the drug treatment of groups 1-4. For polymerase chain reaction, cDNA was synthesized from each of the extracted RNAs as template strands using a miRNA cDNA synthesis kit (ABI, Cat no. A28007, USA). Then, using each of the cDNAs as template strands, using a TaqMan ™ Advanced miRNA analysis probe (ABI, Cat no. A25576, USA), hsa-miR-424-5p (478586_mir), hsa-miR-514a-5p Polymerase chain reaction was carried out on (478092_mir) and hsa-miR-20a-5p (478974_mir).
상기 약물 치료 전에 채혈된 혈액으로부터 추출된 혈액 내에 miRNA가 존재하는 수준의 결과를 도 5 내지 도 7에 나타내었다. 또한, 약물 치료 전 후에 채혈된 혈액으로부터 추출된 혈액 내에 miRNA가 존재하는 수준의 비교 결과를 도 8 내지 도 11에 나타내었다.Results of the level of miRNA present in blood extracted from blood collected prior to drug treatment are shown in FIGS. 5 to 7. In addition, the comparison results of the levels of miRNA present in blood extracted from blood collected before and after drug treatment are shown in FIGS. 8 to 11.
도 5에서 보는 바와 같이, hsa-miR-20a-5p가 존재하는 수준을 측정한 결과, 1 그룹에서 정상인 경우 0.2250으로 확인된 반면, 프로락틴선종인 경우 2.2450으로 확인되었다. 2 그룹에서 정상 및 종양의 크기가 변하지 않은 경우에는 각각 0.2250 및 1.88인 반면, 20 % 이상 종양의 크기가 감소한 경우에는 2.8300으로 확인되었다. 3 그룹에서 정상 및 종양의 크기가 변하지 않은 경우에는 각각 0.2250 및 3.28인 반면, 30 %이상 크기가 감소한 경우 3.7800으로 확인되었다. 또한, 4 그룹에서 정상 및 비 프로락틴선종인 경우 각각 0.2250 및 0.740인 반면, 프로락틴선종인 경우 6.4450의 수준으로 상기 miRNA가 존재하는 것을 확인하였다.As shown in FIG. 5, as a result of measuring the level of hsa-miR-20a-5p present, it was confirmed as 0.2250 in the normal group, and 2.2450 in the prolactin adenomas. In the two groups, normal and tumor size did not change, respectively, 0.2250 and 1.88, while the tumor size was reduced by more than 20% was 2.8300. In the 3 groups, normal and tumor size did not change, respectively 0.2250 and 3.28, while the size of more than 30% was reduced to 3.7800. In addition, it was confirmed that the miRNA was present at the level of 6.4450 for prolactin adenomas, whereas 0.2 and 0.740 for normal and non-prolactin adenomas, respectively, in the fourth group.
도 6에서 보는 바와 같이, hsa-miR-424-5p가 존재하는 수준을 측정한 결과, 1 그룹에서 정상인 경우 0.5450으로 확인된 반면, 프로락틴선종인 경우 3.1100으로 확인되었다. 2 그룹에서 정상 및 종양의 크기가 변하지 않은 경우에는 각각 0.5450 및 2.380인 반면, 20 % 이상 종양의 크기가 감소한 경우에는 4.2850으로 확인되었다. 3 그룹에서 정상 및 종양의 크기가 변하지 않은 경우에는 각각 0.5450 및 5.600인 반면, 30 %이상 크기가 감소한 경우 10.260으로 확인되었다. 또한, 4 그룹에서 정상 및 비 프로락틴선종인 경우 각각 0.5450 및 0.890인 반면, 프로락틴선종인 경우 10.505의 수준으로 상기 miRNA가 존재하는 것을 확인하였다.As shown in FIG. 6, as a result of measuring the level of hsa-miR-424-5p present, it was found to be 0.5450 in the normal group, and 3.1100 in the case of prolactin adenomas. In the two groups, normal and tumor size did not change, respectively, 0.5450 and 2.380, while the tumor size of more than 20% was reduced to 4.2850. In the 3 groups, normal and tumor size did not change, 0.5450 and 5.600, respectively, the size was reduced by more than 30% 10.260 was confirmed. In addition, it was confirmed that the miRNA was present at the level of 10.505 for prolactin adenomas, while 0.5 and 0.890 for normal and non-prolactin adenomas, respectively, in the 4 groups.
도 7에서 보는 바와 같이, hsa-miR-514a-5p가 존재하는 수준을 측정한 결과, 1 그룹에서 정상인 경우 1.300으로 확인된 반면, 프로락틴선종인 경우 2.600으로 확인되었다. 2 그룹에서 정상 및 종양의 크기가 변하지 않은 경우에는 각각 1.300 및 1.93인 반면, 20 % 이상 종양의 크기가 감소한 경우에는 4.48으로 확인되었다. 3 그룹에서 정상 및 종양의 크기가 변하지 않은 경우에는 각각 1.300 및 3.43인 반면, 30 %이상 크기가 감소한 경우 4.610으로 확인되었다. 또한, 4 그룹에서 정상 및 비 프로락틴선종인 경우 각각 1.300 및 2.06인 반면, 프로락틴선종인 경우 2.15의 수준으로 상기 miRNA가 존재하는 것을 확인하였다.As shown in FIG. 7, as a result of measuring the level of hsa-miR-514a-5p present, it was confirmed as 1.300 in the normal group, and 2.600 in the prolactin adenomas. In the two groups, normal and tumor size did not change, while 1.300 and 1.93, respectively, the tumor size of more than 20% was found to be 4.48. In the 3 groups, normal and tumor size did not change, respectively, 1.300 and 3.43, while the size was reduced by more than 30% was 4.610. In addition, it was confirmed that the miRNA was present at the level of 2.15 in the case of normal and non-prolactin adenoma in the four groups, while 1.300 and 2.06, respectively.
상기 결과를 통해, 1 그룹에서 상기 miRNA가 존재하는 수준이 정상에 비하여 프로락틴선종 환자에서 높게 존재하는 것으로 보아, 상기 miRNA를 통해 고프로락틴혈증 환자와, 프로락틴선종에 의해 유도된 고프로락틴혈증 환자를 진단할 수 있음을 알 수 있다.Based on the above results, the level of the miRNA in one group was higher in prolactin adenomas than in normal patients, and thus the diagnosis of hyperprolactinemia and hyperprolactinemia induced by prolactin adenomas was performed by the miRNA. It can be seen that.
또한, 상기 2 그룹 내지 4 그룹에서 약물 치료에 의해 종양의 크기가 줄어든 프로락틴선종 환자에서 상기 miRNA가 높게 존재하는 것으로 보아, 상기 miRNA가 혈청 내에 높은 수준으로 존재하는 경우 약물 치료가 최적의 1차 치료로서 적용될 수 있음을 알 수 있다. 또한, 상기 miRNA 가 혈청 내에 낮은 수준으로 존재하는 경우 비약물적 치료를 1차 치료로 적용할 수 있음을 알 수 있다. In addition, since the miRNA is present in patients with prolactin adenomas whose tumor size is reduced by drug treatment in groups 2 to 4, drug therapy is optimally treated when the miRNA is present at high levels in serum. It can be seen that it can be applied as. In addition, it can be seen that non-pharmaceutical treatment can be applied as a primary treatment when the miRNA is present at low levels in serum.
도 8 내지 11의 경우, 약물 치료 이후에 혈중 프로락틴의 수치가 정상화 되면서, 그룹 1 내지 그룹 4의 환자들의 치료전 혈액에서 증가되어 있던 상기 miRNA들이 정상 수준으로 혈액에 miRNA가 존재하는 수준이 감소함을 확인할 수 있다. 8 to 11, the level of prolactin in the blood after drug treatment was normalized, and the levels of miRNAs present in the blood decreased to the normal levels of the miRNAs that were increased in the pre-treatment blood of patients in
상기 결과를 통해, 고프로락틴혈증 환자의 혈액 내에서 miRNA 가 높은 수준으로 존재하는 것은 고프로락틴혈증과 관련성이 매우 높다는 것을 알 수 있다. The results indicate that the presence of high levels of miRNA in the blood of hyperprolactinemia patients is highly related to hyperprolactinemia.
[실시예 4] 뇌하수체 조직 내 miRNA가 존재하는 수준 확인Example 4 Confirmation of the level of miRNA present in pituitary tissue
정상인과 종양 환자들의 뇌하수체 조직 내 본 발명에 따른 상기 miRNA 들이 존재하는 수준을 확인하였다.The level of the miRNAs according to the present invention in the pituitary tissue of normal and tumor patients was confirmed.
정상 뇌하수체(normal pituitary gland) 6명, 프로락틴선종 8명, 비 기능성 뇌하수체 선종(nonfunctioning pituitary adenoma) 8명, GH 분비 뇌하수체 선종(GH secreting pituitary adenoma) 21명 및 ACTH 분비 뇌하수체 선종(ACTH secreting pituitary adenoma) 3명으로부터 수술 시에 얻은 조직을 사용하였다.6 normal pituitary gland, 8 prolactin adenoma, 8 nonfunctional pituitary adenoma, 21 GH secreting pituitary adenoma and ACTH secreting pituitary adenoma Tissues obtained at the time of surgery from 3 patients were used.
RNeasy Mini Kit (Qiagen, Cat No. 74104, 미국)를 이용하여 상기 조직으로부터 전체 RNA를 분리해낸 뒤, 상기 실시예 3과 동일한 방법으로 hsa-miR-424-5p(478586_mir), hsa-miR-514a-5p(478092_mir) 및 hsa-miR-20a-5p(478974_mir)에 대한 중합효소연쇄반응을 수행하여, 그 결과를 도 12 및 도 13에 나타내었다.Total RNA was isolated from the tissue using RNeasy Mini Kit (Qiagen, Cat No. 74104, USA), and then hsa-miR-424-5p (478586_mir) and hsa-miR-514a in the same manner as in Example 3. Polymerase chain reaction was performed on −5p (478092_mir) and hsa-miR-20a-5p (478974_mir), and the results are shown in FIGS. 12 and 13.
그 결과, 도 12에서 보는 바와 같이, hsa-miR-20a-5p가 존재하는 수준은 정상 조직에서 1.1인 반면, 프로락틴선종의 종양 조직 내에서 5.9인 것을 확인하였다. 이는, 비 기능성 뇌하수체 선종 GH 및 ACTH 분비 뇌하수체 선종과 비교하여도 현저하게 높은 수준에 해당하였다.As a result, as shown in Figure 12, the level of the presence of hsa-miR-20a-5p was 1.1 in the normal tissue, it was confirmed that the 5.9 in the tumor tissue of prolactin adenoma. This corresponded to a significantly higher level compared to nonfunctional pituitary adenoma GH and ACTH secreting pituitary adenoma.
상기 결과를 통해, 고프로락틴혈증 환자의 혈액 내에 증가되어 있던 hsa-miR-20a-5p의 기원은 뇌하수체임을 명확하게 알 수 있다.The results clearly show that the origin of hsa-miR-20a-5p, which was increased in the blood of hyperprolactinemia patients, is the pituitary gland.
[실시예 5] miRNA들과 약물 치료 반응성의 상관관계 분석Example 5 Correlation Analysis of miRNAs and Drug Treatment Reactivity
상기 실시예 3에서 측정된 약물 치료 전에 채혈된 혈액 내에서 측정된 상기 miRNA들이 존재하는 수준과 약물 치료 반응성의 상관관계를 분석하였다. 상기 분석은 정상에서 miRNA가 존재하는 수준을 기준으로, 상기 실시예 3의 2 그룹 및 3 그룹의 약물 치료 전에 채혈된 혈액으로부터 얻어진 혈청 내에 miRNA 들이 존재하는 수준의 값을 비교하여, 그 결과를 하기 표 6에 나타내었다.Correlation between the level of the miRNAs measured in the blood taken prior to the drug treatment measured in Example 3 and the drug treatment responsiveness was analyzed. The assay compares the values of the levels of miRNAs present in serum obtained from blood collected prior to drug treatment of
상기 표 6에서 보는 바와 같이, 크기 변화가 없는 경우와 비교하여, 약물 치료에 의해 종양의 크기가 20 % 이상 감소한 경우에는 hsa-miR-20a-5p, hsa-miR-424-5p 및 hsa-miR-514a-5p가 존재하는 수준이 높은 것을 확인하였다. 나아가, 2 그룹 뿐만 아니라 3 그룹에서도 hsa-miR-514a-5p의 경우에는 종양의 크기가 감소한 경우에만 그 존재하는 수준이 높은 것을 확인하였다.상기 결과를 통해, 상기 miRNA들이 혈청 내에 높은 수준으로 존재하는 경우 약물 치료가 최적의 1차 치료로서 적용될 수 있음을 알 수 있다.As shown in Table 6, when the size of the tumor is reduced by 20% or more due to the drug treatment, hsa-miR-20a-5p, hsa-miR-424-5p, and hsa-miR as compared with the case where there is no change in size. It was confirmed that the level of -514a-5p present was high. Furthermore, it was confirmed that the levels of hsa-miR-514a-5p were high only when the tumor size was reduced in the group 2 as well as the
[실시예 6] miRNA들과 프로락틴선종에 의해 유도된 프로락틴혈증의 상관관계 분석Example 6 Correlation Analysis of Prolactinemia Induced by miRNAs and Prolactin Adenoma
상기 실시예 3에서 측정된 약물 치료 전에 채혈된 혈액 내에서 측정된 상기 miRNA들이 존재하는 수준과 프로락틴선종에 의해 유도된 프로락틴혈증의 상관관계를 분석하였다. 상기 분석은 정상에서 miRNA가 존재하는 수준을 기준으로, 상기 실시예 3의 4 그룹의 혈액으로부터 얻어진 혈청 내에 miRNA 들이 존재하는 수준의 값을 비교하여, 그 결과를 하기 표 7에 나타내었다The correlation between the levels of the miRNAs measured in the blood taken prior to the drug treatment measured in Example 3 and the prolactinemia induced by prolactin adenomas was analyzed. The assay compares the values of the levels of miRNAs present in serum obtained from the blood of the four groups of Example 3, based on the levels of miRNAs present in normal, and the results are shown in Table 7 below.
상기 표 7에서 보는 바와 같이, 비 프로락틴선종으로 확인된 고프로락틴혈증 환자의 혈액에 비하여, 프로락틴선종으로 확인된 고프로락틴혈증 환자의 혈청 내에 hsa-miR-20a-5p, hsa-miR-424-5p 및 hsa-miR-514a-5p가 존재하는 수준이 높은 것을 확인하였다.상기 결과를 통해, 상기 miRNA들이 혈청 내에 높은 수준으로 존재하는 경우 고프로락틴혈증은 프로락틴선종에 의해 유도된 것일 가능성이 현저하게 높은 것을 알 수 있다.As shown in Table 7, hsa-miR-20a-5p and hsa-miR-424-5p in the serum of hyperprolactinemia patients identified as prolactin adenomas compared to the blood of hyperprolactinemia patients identified as non-prolactin adenomas. And high levels of hsa-miR-514a-5p present. The results indicate that hyperprolactinemia is likely to be induced by prolactin adenomas when the miRNAs are present at high levels in serum. It can be seen that.
이상으로 본 발명의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현 예일 뿐이며, 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다.Having described the specific part of the present invention in detail, it is apparent to those skilled in the art that the specific technology is merely a preferred embodiment, and the scope of the present invention is not limited thereto. Therefore, the substantial scope of the present invention will be defined by the appended claims and equivalents thereof.
<110> Yeonsei university <120> Composition for diagnosing of hyperprolactinemia and a method of providing information for predicting the responsiveness of a medication <130> PDPB187299 <160> 3 <170> KoPatentIn 3.0 <210> 1 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> hsa-miR-424-5p <400> 1 cagcagcaau ucauguuuug aa 22 <210> 2 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> hsa-miR-514a-5p <400> 2 uacucuggag agugacaauc aug 23 <210> 3 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> hsa-miR-20a-5p <400> 3 uaaagugcuu auagugcagg uag 23 <110> Yeonsei university <120> Composition for diagnosing of hyperprolactinemia and a method of providing information for predicting the responsiveness of a medication <130> PDPB187299 <160> 3 <170> KoPatentIn 3.0 <210> 1 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> hsa-miR-424-5p <400> 1 cagcagcaau ucauguuuug aa 22 <210> 2 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> hsa-miR-514a-5p <400> 2 uacucuggag agugacaauc aug 23 <210> 3 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> hsa-miR-20a-5p <400> 3 uaaagugcuu auagugcagg uag 23
Claims (17)
상기 miRNA가 존재하는 수준을 측정하는 제제는, 상기 hsa-miR-424-5p, hsa-miR-514a-5p 및 hsa-miR-20a-5p로 구성된 군으로부터 선택되는 적어도 어느 하나 이상의 miRNA에 특이적으로 결합하는 프라이머 또는 프로브를 포함하는 것인, 고프로락틴혈증의 진단용 조성물.The method of claim 1,
The agent for measuring the level at which the miRNA is present is specific for at least one miRNA selected from the group consisting of hsa-miR-424-5p, hsa-miR-514a-5p and hsa-miR-20a-5p. It comprises a primer or probe that binds to, the composition for diagnosing hyperprolactinemia.
상기 고프로락틴혈증은 뇌하수체종양에 의해 유도된 것인, 고프로락틴혈증의 진단용 조성물.The method of claim 1,
The hyperprolactinemia is induced by the pituitary tumor, composition for diagnosing hyperprolactinemia.
상기 뇌하수체종양은 프로락틴선종(Prolactinoma)인 것인, 고프로락틴혈증의 진단용 조성물.The method of claim 3, wherein
The pituitary tumor is prolactinoma (Prolactinoma), the composition for diagnosing hyperprolactinemia.
상기 고프로락틴혈증은 골다공증, 성기능 장애, 불임, 뇌하수체 종양, 뇌종양 및 유즙 분비증(galactorrhea)으로 구성된 군으로부터 선택되는 적어도 하나 이상의 질환이 동반되는 것인, 고프로락틴혈증의 진단용 조성물.The method of claim 1,
The hyperprolactinemia is accompanied by at least one disease selected from the group consisting of osteoporosis, sexual dysfunction, infertility, pituitary tumors, brain tumors and galactorrhea, the composition for diagnosing hyperprolactinemia.
상기 조성물은 고프로락틴혈증의 약물 반응성을 예측하기 위한 것인, 고프로락틴혈증의 진단용 조성물.The method of claim 1,
The composition is for predicting the drug reactivity of hyperprolactinemia, the composition for diagnosing hyperprolactinemia.
상기 목적하는 환자와 정상인으로부터 분리된 시료에서 측정된 상기 miRNA들이 존재하는 수준을 비교하는 단계를 포함하는, 고프로락틴혈증의 진단을 위한 정보를 제공하는 방법.In samples isolated from a patient of interest or normal, the level at which at least one miRNA is selected from the group consisting of hsa-miR-424-5p, hsa-miR-514a-5p and hsa-miR-20a-5p is present. Measuring; And
Comparing the levels of the miRNAs measured in a sample isolated from the patient of interest and the subject of interest, providing information for diagnosing hyperprolactinemia.
정상인에 비하여 고프로락틴혈증 환자에서 분리된 시료에서 miRNA들이 존재하는 수준이 더 높은 경우, 뇌하수체종양에 의해 유도된 고프로락틴혈증으로 판단하는 단계를 더 포함하는, 고프로락틴혈증의 진단을 위한 정보를 제공하는 방법.The method of claim 8,
If the level of miRNAs present in a sample isolated from hyperprolactinemia patients compared to normal persons, further comprising the step of judging that hyperprolactinemia induced by pituitary tumor, provides information for the diagnosis of hyperprolactinemia How to.
상기 뇌하수체종양은 프로락틴선종(Prolactinoma)인 것인, 고프로락틴혈증의 진단을 위한 정보를 제공하는 방법.The method of claim 9,
The pituitary tumor is prolactinoma (Prolactinoma), which provides information for the diagnosis of hyperprolactinemia.
상기 고프로락틴혈증은 골다공증, 성기능 장애, 불임, 뇌하수체 종양, 뇌종양 및 유즙 분비증(galactorrhea)으로 구성된 군으로부터 선택되는 적어도 하나 이상의 질환이 동반되는 것인, 고프로락틴혈증의 진단을 위한 정보를 제공하는 방법.The method of claim 8,
The hyperprolactinemia is accompanied by at least one disease selected from the group consisting of osteoporosis, sexual dysfunction, infertility, pituitary tumor, brain tumor and galactorrhea, providing information for the diagnosis of hyperprolactinemia Way.
상기 miRNA가 존재하는 수준의 측정은 중합효소연쇄반응(polymerase chain reaction), 형광상관분석법(fluorescence correlation spectroscopy), 마이크로어레이(microarray) 및 칩어세이(chip-assay)으로 이루어진 군 중에서 선택되는 적어도 하나 이상인 것인, 고프로락틴혈증의 진단을 위한 정보를 제공하는 방법.The method of claim 8,
The measurement of the level of the miRNA is at least one selected from the group consisting of polymerase chain reaction, fluorescence correlation spectroscopy, microarray and chip-assay. And providing information for diagnosis of hyperprolactinemia.
상기 고프로락틴혈증 환자와 정상인으로부터 분리된 시료에서 측정된 상기 miRNA들이 존재하는 수준을 비교하는 단계를 포함하는, 약물 치료의 반응성을 예측하기 위한 정보를 제공하는 방법.In samples isolated from hyperprolactinemia patients or normal subjects, at least one miRNA selected from the group consisting of hsa-miR-424-5p, hsa-miR-514a-5p, and hsa-miR-20a-5p is present. Measuring; And
Comparing the levels of the miRNAs measured in a sample isolated from the hyperprolactinemia patient with a normal person.
정상인에 비하여 고프로락틴혈증 환자에서 분리된 시료에서 miRNA들이 존재하는 수준이 더 높은 경우, 약물 치료의 반응성이 좋을 것으로 예측하는 단계를 더 포함하는, 약물 치료의 반응성을 예측하기 위한 정보를 제공하는 방법.The method of claim 13,
A method of providing information for predicting the responsiveness of a drug treatment further comprising the step of predicting that the drug responsiveness will be higher if the levels of miRNAs are present in a sample isolated from a hyperprolactinemia patient as compared to a normal person. .
상기 miRNA가 존재하는 수준의 측정은 중합효소연쇄반응(polymerase chain reaction), 형광상관분석법(fluorescence correlation spectroscopy), 마이크로어레이(microarray) 및 칩어세이(chip-assay)으로 이루어진 군 중에서 선택되는 적어도 하나 이상인 것인, 약물 치료의 반응성을 예측하기 위한 정보를 제공하는 방법.The method of claim 13,
The measurement of the level of miRNA is at least one selected from the group consisting of polymerase chain reaction, fluorescence correlation spectroscopy, microarray and chip-assay. And provide information for predicting the responsiveness of the drug treatment.
상기 고프로락틴혈증 환자와 정상인으로부터 분리된 시료에서 측정된 상기 miRNA들이 존재하는 수준이 비교되는 비교 판단부; 및
상기 비교 판단부의 판단 결과를 출력하기 위한 출력부를 포함하는 약물 치료의 반응성 예측 장치.In samples isolated from hyperprolactinemia patients or normal subjects, at least one miRNA selected from the group consisting of hsa-miR-424-5p, hsa-miR-514a-5p, and hsa-miR-20a-5p is present. The first input unit is input;
A comparison judgment unit for comparing the levels of the miRNAs measured in a sample separated from the hyperprolactinemia patient and a normal person; And
And an output unit for outputting a determination result of the comparison determination unit.
상기 비교 판단부는 정상인에 비하여 고프로락틴혈증 환자에서 분리된 시료에서 miRNA들이 존재하는 수준이 더 높은 경우, 약물 치료의 반응성이 좋을 것으로 비교 판단하는 것인, 약물 치료의 반응성 예측 장치.The method of claim 16,
Wherein the comparison unit is compared with the normal person, if the level of miRNAs in the sample separated from the hyperprolactinemia patients is higher, the response to the drug treatment responsiveness predicting device, drug reactivity prediction device.
Priority Applications (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020180125094A KR102070893B1 (en) | 2018-10-19 | 2018-10-19 | Composition for diagnosing of hyperprolactinemia and a method of providing information for predicting the responsiveness of a medication |
PCT/KR2019/013295 WO2020080739A1 (en) | 2018-10-19 | 2019-10-10 | Composition for diagnosing hyperprolactinemia, and method for providing information for predicting response to drug treatment |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020180125094A KR102070893B1 (en) | 2018-10-19 | 2018-10-19 | Composition for diagnosing of hyperprolactinemia and a method of providing information for predicting the responsiveness of a medication |
Related Child Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020200007892A Division KR102162110B1 (en) | 2020-01-21 | 2020-01-21 | Composition for diagnosing of hyperprolactinemia and a method of providing information for predicting the responsiveness of a medication |
Publications (1)
Publication Number | Publication Date |
---|---|
KR102070893B1 true KR102070893B1 (en) | 2020-01-29 |
Family
ID=69322180
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020180125094A KR102070893B1 (en) | 2018-10-19 | 2018-10-19 | Composition for diagnosing of hyperprolactinemia and a method of providing information for predicting the responsiveness of a medication |
Country Status (2)
Country | Link |
---|---|
KR (1) | KR102070893B1 (en) |
WO (1) | WO2020080739A1 (en) |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN112501304A (en) * | 2020-12-17 | 2021-03-16 | 浙江清华长三角研究院 | Application of miRNA-424 as pituitary tumor diagnosis marker |
Family Cites Families (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP2678448A4 (en) * | 2011-02-22 | 2014-10-01 | Caris Life Sciences Luxembourg Holdings S A R L | Circulating biomarkers |
-
2018
- 2018-10-19 KR KR1020180125094A patent/KR102070893B1/en active IP Right Grant
-
2019
- 2019-10-10 WO PCT/KR2019/013295 patent/WO2020080739A1/en active Application Filing
Non-Patent Citations (3)
Title |
---|
DeVore SB et al., Mol Cell Biol. Vol.38(19): e00084-18. (온라인공개 2018.07.09.) * |
Feng Y et al., Horm Metab Res Vol.50: 179-192. (온라인공개 2018.01.19.) * |
Triebel J et al., Front Endocrinol (Lausanne). Vol.8: 342. (온라인공개 2017.12.11.) * |
Also Published As
Publication number | Publication date |
---|---|
WO2020080739A1 (en) | 2020-04-23 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
KR102622309B1 (en) | Detection of chromosomal interactions | |
JP2019059733A (en) | Phosphodiesterase 4d7 as prostate cancer marker | |
WO2007128884A1 (en) | Novel genes and markers in type 2 diabetes and obesity | |
EP3294903B1 (en) | Method for in vitro diagnosis of dementia with lewy bodies using alphasynuclein gene transcripts | |
CN106662543B (en) | Non-invasive gene mutation detection in lung cancer patients | |
MXPA03004928A (en) | Method of determining a chemotherapeutic regimen based on ercc1 and ts expression. | |
KR20190024923A (en) | System for predicting prognosis and benefit from adjuvant chemotherapy for patients with stage II and III gastric cancer | |
JP2008532495A (en) | Detection of biomarkers for neuropsychiatric disorders | |
CN106967719B (en) | Application of long-chain non-coding RNA as prostate cancer molecular marker | |
WO2018220185A1 (en) | Novel circular rna biomarkers for heart failure | |
KR102070893B1 (en) | Composition for diagnosing of hyperprolactinemia and a method of providing information for predicting the responsiveness of a medication | |
CN108715893B (en) | SNP markers related to radioactive brain injury caused by radiotherapy and application thereof | |
US11047012B2 (en) | Method for detecting the risk and prognosis of adult-onset Still's disease | |
CN108753980A (en) | A kind of kit for screening of the metastatic screening of the small papillary carcinoma of thyroid gland | |
KR102162110B1 (en) | Composition for diagnosing of hyperprolactinemia and a method of providing information for predicting the responsiveness of a medication | |
CN109988830A (en) | A kind of lncRNA and its application for sepsis markers | |
CN108753959B (en) | SNP marker located in DISC1FP1 gene and related to radioactive brain injury caused by radiotherapy and application thereof | |
KR20100037639A (en) | Predictive markers for egfr inhibitors treatment | |
CN110577994A (en) | Product for non-invasive diagnosis of male osteoporosis | |
KR102414152B1 (en) | Biomarker for diagnosing age-related macular degeneration and uses thereof | |
JP2014506117A (en) | Method for detecting mild inflammation | |
CN108715895B (en) | SNP marker located in KCTD1 gene and related to radioactive brain injury caused by radiotherapy and application thereof | |
US20220090198A1 (en) | Analysis method and kit for diagnosis of urolithiasis | |
Bujko et al. | Microsatellite instability analysis in pituitary adenomas | |
KR20180033719A (en) | Use of homeoboxA9 as a melasma or seborrheic keratosis distinguishing marker |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
A107 | Divisional application of patent | ||
GRNT | Written decision to grant |