KR102070893B1 - Composition for diagnosing of hyperprolactinemia and a method of providing information for predicting the responsiveness of a medication - Google Patents

Abstract

The present invention relates to a composition for diagnosing hyperprolactinemia, a method for providing information on diagnosis, and a method for providing information for predicting responsiveness of drug treatment. The present invention can not only diagnose hyperprolactinemia, but also select hyperprolactinemia causing prolactinoma, and thus can provide a highly effective method of treating hyperprolactinemia with few side effects and a high cure rate.

Description

Composition for diagnosing of hyperprolactinemia and a method of providing information for predicting the responsiveness of a medication}

The present invention relates to a composition for diagnosing hyperprolactinemia, and more particularly, to a composition for diagnosing hyperprolactinemia induced by prolactin adenoma. It also relates to a method of providing information for predicting the responsiveness of drug treatment in hyperprolactinemia.

Hyperprolactinemia means that the levels of prolactin in the blood are abnormally higher than normal levels of less than 25 ng / mL in women and less than 15 ng / mL in men.

The prolactin is produced by prolactin-secreting cells of the anterior pituitary gland and is regulated by dopamine type 2 receptors distributed in the prolactin-secreting cells and secreted by pulsatile properties. Dopamine is a representative factor that inhibits the secretion of prolactin, and somatostatin, gamma-aminobutyric acid, and the like are present. The amount of such prolactin present in the blood may be increased after pregnancy or lactation, exercise, diet, general anesthesia, surgical treatment and acute stress.

There are a variety of reasons why the hyperprolactinemia can be induced. Physiological situations include pregnancy, lactation, stress, exercise and sleep, and can also be induced by taking medications such as neuroleptics and antipsychotics. Primary hypothyroidism can also lead to moderate hyperprolactinemia. In addition, hyperprolactinemia not associated with pregnancy can be induced primarily by prolactinoma and also by pathological cases or drug causes that interfere with the hypothalamic-pituitary-dopamine pathway. In addition, non-functional pituitary tumors or tumors that develop around other Turkish subjects may be induced by a phenomenon in which prolactin inhibition is reduced when the dopamine neurons are damaged or the dopamine signal is blocked by compressing the pituitary stem.

On the other hand, hyperprolactinemia treatment aims at correcting the causative disease and preventing or improving various diseases caused by hyperprolactinemia. Specifically, drug treatment, surgery and radiation therapy using dopamine agonists bromocriptine, pergolide, cabergoline, metergoline, quinagolide, etc. may be considered for the treatment of hyperprolactinemia. Despite these medications, surgical treatments such as craniotomy or transverse sinus resection, or radiation therapy should be considered when there is a visual field disorder, a massive adenomas involving the cranial nerve, or resistance to the drug. However, long-term treatment of patients with refractory medications results in adhesion between normal pituitary and tumor tissues, and surgically complete excision is impossible. Surgical treatments include CSF rhinorrhea, diabetes insipidus, and infection. Because side effects, such as decreased vision and pituitary dysfunction, may be accompanied, it is very important to accurately differentially diagnose the cause of hyperprolactinemia and to predict the responsiveness of drug treatment for optimal primary treatment application.

Although the method of treating hyperprolactinemia should be approached differently depending on the cause, there has not been studied a diagnostic kit for diagnosing hyperprolactinemia and accurately predicting the responsiveness of drug treatment.

One object of the present invention is to provide a composition and kit for diagnosing hyperprolactinemia.

Another object of the present invention is to provide a method for providing information for the diagnosis of hyperprolactinemia.

Another object of the present invention is to provide a method for providing information for predicting the responsiveness of drug treatment.

However, the technical problem to be achieved by the present invention is not limited to the above-mentioned problem, another task not mentioned will be clearly understood by those skilled in the art from the following description.

The inventors of the present invention have found that hsa-miR-424-5p, hsa-miR-514a-5p, and hsa-miR- in the blood of patients with hyperprolactinemia induced by suitable prolactin adenomas with suitable drug treatment methods. The discovery of high levels of 20a-5p led to the completion of the present invention.

One embodiment of the present invention to provide a composition for diagnosing hyperprolactinemia.

The diagnostic composition includes an agent for measuring the level of the presence of at least one miRNA selected from the group consisting of hsa-miR-424-5p, hsa-miR-514a-5p and hsa-miR-20a-5p.

The agent for measuring the level of the miRNA is present as an agent for measuring the miRNA present in a sample isolated from the patient, such as hsa-miR-424-5p, hsa-miR-514a-5p or hsa-miR- It may be a primer or a probe that specifically binds to 20a-5p.

The design of the primer or probe can be easily made according to methods known in the art with reference to the base sequences of hsa-miR-424-5p, hsa-miR-514a-5p and hsa-miR-20a-5p.

The base sequence of hsa-miR-424-5p may be SEQ ID NO: 1, CAGCAGCAAUUCAUGUUUUGAA, and the base sequence of hsa-miR-514a-5p may be SEQ ID NO: 2, UACUCUGGAGAGUGACAAUCAUG, and the hsa-miR-20a-5p The base sequence of may be SEQ ID NO: 3, which is UAAAGUGCUUAUAGUGCAGGUAG, but is not limited thereto.

The primer is a base sequence having a short free 3 'hydroxyl group, which may form a complementary template and base pair, and serves as a starting point for template strand copying. As a sequence, a PCR product may be generated through a process in which a forward primer and a reverse primer are paired with a miRNA to be amplified.

The probe is a fragment of several hundreds to hundreds of nucleotide sequences that can specifically bind to the miRNA, and since the fluorescent lamp is labeled so that it can be visualized, the presence of the miRNA and the amount present in the sample can be confirmed. Can be.

In the present invention, after measuring the level of the miRNA present in the sample isolated from the target patient and a normal person using the diagnostic composition, the presence of a high level compared to the normal person can be diagnosed as hyperprolactinemia.

The hyperprolactinemia is an endocrine disease found in the hypothalamic-pituitary axis, which may be induced by pituitary tumors. Preferably, the pituitary tumor may be prolactinoma, but is not limited thereto.

The composition is a hyperprolactinemia drug because hyperprolactinemia induced by prolactin adenoma is highly reactive to drug treatment compared to hyperprolactinemia induced by pituitary stem compression due to tumors occurring in the pituitary stem. It may be to predict the reactivity, but is not limited thereto.

In the case of screening hyperprolactinemia induced by prolactin adenomas using the composition of the present invention, an appropriate primary treatment method can be provided at an early stage, and the occurrence of side effects and the cure rate due to inappropriate treatment are significantly reduced. Can be reduced.

The hyperprolactinemia may be accompanied by at least one disease selected from the group consisting of osteoporosis, sexual dysfunction, infertility and galactorrhea, pituitary tumor, brain tumor.

Another embodiment of the present invention is to provide a kit for diagnosing hyperprolactinemia.

The diagnostic kit may include one or more different component composition solutions or devices suitable for primers, probes or assays to determine the level of miRNA present.

If the kit is run via RT-PCR, such as test tubes or other suitable containers, reaction buffers (pH and magnesium concentrations vary), deoxynucleotides (dNTPs), Taq-polymerases and reverse transcriptases Enzymes, DNases, RNase inhibitors, DEPC-water, sterile water, and the like. In addition, when the kit is to be carried out through a DNA chip assay, it may include a substrate attached to the probe.

The diagnostic kit for diagnosing hyperprolactinemia is an agent that measures the level of the presence of at least one miRNA selected from the group consisting of hsa-miR-424-5p, hsa-miR-514a-5p, and hsa-miR-20a-5p. By using the above diagnostic composition, hyperprolactinemia can be diagnosed. Therefore, content relating to agents, probes, primers, hyperprolactinemia, concomitant diseases, and the like, which measure the level at which miRNA is present, is omitted in order to avoid undue complexity of the specification according to repeated descriptions.

Another embodiment of the invention is to provide a method for providing information for the diagnosis of hyperprolactinemia.

The method of providing information for the diagnosis is selected from the group consisting of hsa-miR-424-5p, hsa-miR-514a-5p and hsa-miR-20a-5p in samples isolated from the patient or normal subject of interest. Measuring the level at which any one or more miRNAs are present; And comparing the levels of the miRNAs measured in a sample isolated from the patient of interest and the normal subject.

Samples isolated from the target patient or normal person may be, but are not limited to, whole blood, serum, plasma, saliva, urine, sputum, lymph, cells, and the like.

The method of providing the information of the present invention may further comprise determining hyperprolactinemia induced by pituitary tumors when the levels of miRNAs present in samples isolated from hyperprolactinemia patients are higher than normal individuals. have. Preferably, the pituitary tumor may be prolactin adenoma, but is not limited thereto.

As such, when the miRNAs are present at a higher level than normal persons, information for diagnosing hyperprolactinemia induced by pituitary tumor can be provided, thereby providing an appropriate first-line treatment method in the early stage of the invention.

Determination of the level of the miRNA can be confirmed through conventional methods such as amplifying the miRNA or complementarily binding to a probe labeled with fluorescence or the like, for example, polymerase chain reaction (polymerase chain reaction) At least one selected from the group consisting of reaction, fluorescence correlation spectroscopy, microarray, and chip-assay, but is not limited thereto.

The method for providing information for diagnosis may provide information for diagnosing hyperprolactinemia by measuring the level of the miRNAs present in a sample using the diagnostic composition. Therefore, content relating to agents, probes, primers, hyperprolactinemia, concomitant diseases, and the like, which measure the level at which miRNA is present, is omitted in order to avoid undue complexity of the specification according to repeated descriptions.

Another embodiment of the present invention provides a method of providing information for predicting responsiveness of drug treatment.

Methods for providing information for predicting the responsiveness of the drug treatment include hsa-miR-424-5p, hsa-miR-514a-5p and hsa-miR-20a-5p in samples isolated from hyperprolactinemia patients or normal individuals. Measuring the level of the presence of at least one miRNA selected from the group consisting of; And comparing the levels of the miRNAs measured in a sample isolated from the hyperprolactinemia patient and a normal person.

The method for providing information for predicting the responsiveness of the drug treatment of the present invention comprises the steps of predicting that the reactivity of the drug treatment is good when the level of miRNAs present in a sample isolated from hyperprolactinemia patients is higher than that of a normal person. It further includes. Preferably, the pituitary tumor may be prolactin adenoma, but is not limited thereto.

The drug treatment is intended to normalize blood prolactin levels in patients with hyperprolactinemia, for example, but may be a dopamine agonist, but is not limited thereto.

The method for providing information for predicting the responsiveness of the drug treatment is to measure the level of the presence of at least one miRNA selected from the group consisting of miR-424-5p, miR-514a-5p and miR-20a-5p. Using the diagnostic composition as an agent, information for predicting the responsiveness of drug treatment may be provided by measuring the level at which the miRNA is present as described in the method for providing information for diagnosis. Thus, descriptions relating to agents, probes, primers, hyperprolactinemia, comorbidities, methods of measurement, and the like, which measure the level of miRNA present, are omitted in order to avoid undue complexity of the specification according to repeated descriptions.

Another embodiment of the present invention provides an apparatus for predicting reactivity of drug treatment.

In detail, the apparatus for predicting treatment reactivity of the drug includes an input unit, a comparison determination unit, and an output unit.

Input

In the present invention, in order to predict the therapeutic responsiveness of the drug, the input level of the miRNA measured in the sample is input, and the input part is a sample isolated from a hyperprolactinemia patient or a normal person, hsa-miR-424 The level at which at least one miRNA is selected from the group consisting of -5p, hsa-miR-514a-5p and hsa-miR-20a-5p is entered.

The drug treatment is intended to normalize blood prolactin levels in patients with hyperprolactinemia, for example, but may be a dopamine agonist, but is not limited thereto.

The sample may be whole blood, serum, plasma, saliva, urine, sputum, lymph, cells, and the like, but is not limited thereto.

The measurement of the level of the miRNA present can be confirmed through conventional methods such as amplifying the miRNA using a primer or complementarily binding to a probe labeled with fluorescence or the like, and inputting to the input unit. For example, at least one selected from the group consisting of a polymerase chain reaction, a fluorescence correlation spectroscopy, a microarray, and a chip-assay, but is not limited thereto. It is not.

The agent for measuring the level of the miRNA in order to determine the level in which the miRNA is present is an agent for measuring the miRNA present in a sample isolated from the patient or the like, hsa-miR-424-5p, hsa- Primers or probes that specifically bind to miR-514a-5p or hsa-miR-20a-5p can be used.

The design of the primer or probe can be easily made according to methods known in the art with reference to the base sequences of hsa-miR-424-5p, hsa-miR-514a-5p and hsa-miR-20a-5p.

The base sequence of hsa-miR-424-5p may be SEQ ID NO: 1, CAGCAGCAAUUCAUGUUUUGAA, and the base sequence of hsa-miR-514a-5p may be SEQ ID NO: 2, UACUCUGGAGAGUGACAAUCAUG, and the hsa-miR-20a-5p The base sequence of may be SEQ ID NO: 3, which is UAAAGUGCUUAUAGUGCAGGUAG, but is not limited thereto.

Comparative Judgment Unit

In the present invention, the comparison determining unit compares and determines the level of the miRNA present in the sample separated from the high prolactin patient and the normal person input from the input unit.

When the level of the miRNAs in the sample separated from the hyperprolactinemia patient is higher than that of the normal person in the comparison determination unit, the method may further include determining hyperprolactinemia induced by pituitary tumor. Preferably, the pituitary tumor may be prolactin adenoma, but is not limited thereto.

As such, when the miRNAs are present at a higher level than normal persons, it can be predicted that hyperprolactinemia induced by pituitary tumors can be expected to be very responsive to drug treatment.

Output

The output unit outputs the result determined by the comparison determination unit.

In one embodiment of the present invention may further include a liquid crystal display that can visually display the data output from the output unit, such as a liquid crystal display window.

In the case of using the composition and method of the present invention, it is possible not only to diagnose hyperprolactinemia, but also to select hyperprolactinemia caused by prolactin adenomas, and to effectively treat hyperprolactinemia with low side effects and high cure rate. Can provide.

Figure 1 illustrates a pituitary tumor sample collection method with hyperprolactinemia for miRNA discovery according to an embodiment of the present invention.
2 to 4 show the results of nCounter analysis for miRNA discovery in the sample according to an embodiment of the present invention.
5 to 11 show the results of comparing the levels of miRNA present in each group for verifying miRNAs according to an embodiment of the present invention.
Figure 12 shows the result of comparing the level of miRNA present in various pituitary tumor tissue according to an embodiment of the present invention.

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for illustrating the present invention in more detail, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention. .

Example

Preparation: Pituitary tumor sample collection with hyperprolactinemia

As shown in FIG. 1, blood was collected prior to drug treatment in a pituitary tumor patient with hyperprolactinemia and MRI imaging was performed. Three months after the start of drug treatment, the patient underwent blood collection and MRI scans.

The drug treatment was continued for 15 months in the patients whose tumor size decreased on the MRI scans after 3 months, and blood sampling and MRI tests were performed on the patients at 15 months.

In addition, in the case of patients whose tumor size did not change or increased in the MRI scan after 3 months, the drug treatment was stopped and surgical treatment was performed. Blood collection and MRI scans were performed in patients immediately before the surgical treatment commenced and 6 months after the surgical treatment.

Here, for the drug treatment, a dose of cabegoline was administered at a dose of 1 to 2 mg per week for microadenoma patients, and 3 to 4 mg per week for patients with adenomas (macroadenoma).

Then, using miRNeasy kit (cat no. 217184, Qiazen, USA), total RNA including miRNA in serum derived from blood collected prior to drug treatment according to the protocol provided by the manufacturer. Was extracted.

Example 1 Excavation of miRNA

In order to select miRNAs specific for patients with pituitary tumors with hyperprolactinemia, nCounter analysis of miRNAs present in total RNA extracted in the above preparation was performed in three groups as shown in Table 1 below.

Diagnosis / Estimate / Treatment Sample number Histological diagnosis Prolactin adenoma
(prolactinoma; PRLoma) 6 Nonfunctional adenoma or nonprolactin adenoma
(Nonfuctioning adenoma / non-prolactinoma) 6 Clinical presumptive diagnosis Drug non-response group 12 Drug response group 12 Before and after medication Before drug use 12 After drug use 12

The histological diagnosis group of Table 1 selected 6 prolactin adenomas (PRLoma), 6 non-functional adenomas (NFPA) or 6 non-prolactin adenomas. In addition, the clinical presumptive diagnosis group selected 12 non-drug and drug-responder groups, respectively, based on the prolactin level present in the blood and the tumor size change on the MRI of the pituitary gland following drug treatment. In addition, the group before and after the drug treatment was selected 12 patients each normal or abnormal according to the normalization of the prolactin level before and after the start of the drug treatment.

NCounter analysis was performed using RNA extracted from the patients in the three groups thus selected. In the nCounter analysis, miRNAs with a normalization value of 15 or more, a P-value of 0.05 or less, and an intergroup value of 2 or more are identified, and the results are shown in FIGS. Tables 2-4 are shown.

miRNA types PRLoma VS NFPA Levels P-value hsa-miR-612 -2.59 0.00034159 hsa-miR-301a-3p -4.01 0.00111505 hsa-miR-4755-5p -3.18 0.00205509 hsa-miR-509-5p -2.88 0.00369512 hsa-miR-424-5p 2.14 0.0008 hsa-miR-514a-5p 1.24 0.0009 hsa-miR-20a-5p 3.17 0.0006

miRNA types Responder vs. non-responder P-value hsa-miR-3196 -1.88 0.00011574 hsa-miR-211-3p -1.52 0.00014 hsa-miR-501-3p -1.56 0.00016842 hsa-miR-548h-5p -1.88 0.00032323 hsa-miR-190a-5p -1.56 0.00037475 hsa-miR-424-5p 1.74 0.0011 hsa-miR-514a-5p 4.21 0.0002 hsa-miR-20a-5p 1.85 0.0007

miRNA types After treatment vs before treatment P-value hsa-miR-587 2.89 0.00295115 hsa-miR-1185-2-3p 2.87 0.0034669 hsa-miR-1285-3p 2.43 0.00584475 hsa-miR-939-5p 2.69 0.01005696

As shown in Tables 2 to 4, hsa-miR-612, hsa-miR-301a-3p, hsa-miR-4755-5p, and hsa-miR-509-5p in non-functional adenoma in the histological diagnosis group Compared to the prolactin adenoma was reduced by at least two times, hsa-miR-424-5p, hsa-miR-514a-5p and hsa-miR-20a-5p was confirmed to be increased by at least 1.24 times. In addition, hsa-miR-3196, hsa-miR-211-3p, hsa-miR-501-3p, hsa-miR-548h-5p and hsa-miR-190a-5p were non-responsive within the clinical putative diagnostic group. It was confirmed that the drug response group was reduced by 1.5 times or more, and the hsa-miR-424-5p, hsa-miR-514a-5p, and hsa-miR-20a-5p increased at least 1.74 times compared to the group. In addition, hsa-miR-587, hsa-miR-1185-2-3p, hsa-miR-1285-3p, and hsa-miR-939-5p in the group before and after drug treatment were compared to after the drug treatment. It was confirmed that more than doubled.

Example 2 miRNA Screening Associated with Pituitary Tumors and Prolactin Secretion

Of the miRNAs selected in Example 1, a process was performed to select miRNAs that are expected to have functions related to pituitary tumor and hormone production as miRNAs.

Specifically, based on the target ScanHuman website (http://www.targetscan.org/vert_72/) prepared by database-preparing a list of RNAs associated with pituitary tumor and hormone production, In the miRNA discovered in Example 1, the type of RNA targeting a specific miRNA was confirmed, and among these, only miRNAs targeting RNA related to the pituitary gland were selected.

As a result, hsa-miR-424-5p, hsa-miR-514a-5p, and hsa-miR-20a-5p, which were found to be related to pituitary tumor and hormone production, were selected from the miRNAs discovered in Example 1 above. .

Example 3 Subgroup Analysis for miRNA Validation

Four groups were configured as shown in Table 5 below for subgroup analysis that can be used for verification of selected miRNAs in the present invention. Here, the patients included in the four groups were subjected to blood sampling and MRI imaging in the same manner as the preparation example.

group Classification Gender and number of samples male female 1 group normal 5 33 Prolactin adenoma (PRLoma) 36 29 Prolactinemia (caused by stem effects from pituitary tumors, not prolactin adenoma) 2 36 No clinical estimate 3 92 Idiopathic hyperprolactinemia (idiopathic hyperPRL) One 3 2 groups 20% or more size reduction 28 60 No change in size 12 83 Idiopathic hyperprolactinemia One 3 3 groups 30% more size reduction 23 33 No change in size 7 23 Idiopathic hyperprolactinemia One 3 4 groups Prolactin adenoma One 25 Non-prolactin adenoma 0 18

Prolactinemia caused by the stem effect of the pituitary gland rather than normal, prolactin, and prolactin adenomas using prolactin levels and MRI imaging results on blood tests prior to drug treatment Cases were not estimated and classified as idiopathic hyperprolactinemia. In addition, when drug treatment was performed for 3 months or 15 months, whereby the tumor size was reduced by 20% or more or 30% or more, the cases where there was no change in tumor size were classified into 2 or 3 groups. When surgery was performed, four groups were classified into those with and without prolactin adenoma in immunochemical staining. Here, the same manner as in the above preparation was performed to extract the total RNA including the miRNA.

The polymerase chain reaction was performed to compare the levels of the miRNAs selected in Example 2 in the blood extracted from the blood collected before or after the drug treatment of groups 1-4. For polymerase chain reaction, cDNA was synthesized from each of the extracted RNAs as template strands using a miRNA cDNA synthesis kit (ABI, Cat no. A28007, USA). Then, using each of the cDNAs as template strands, using a TaqMan ™ Advanced miRNA analysis probe (ABI, Cat no. A25576, USA), hsa-miR-424-5p (478586_mir), hsa-miR-514a-5p Polymerase chain reaction was carried out on (478092_mir) and hsa-miR-20a-5p (478974_mir).

Results of the level of miRNA present in blood extracted from blood collected prior to drug treatment are shown in FIGS. 5 to 7. In addition, the comparison results of the levels of miRNA present in blood extracted from blood collected before and after drug treatment are shown in FIGS. 8 to 11.

As shown in FIG. 5, as a result of measuring the level of hsa-miR-20a-5p present, it was confirmed as 0.2250 in the normal group, and 2.2450 in the prolactin adenomas. In the two groups, normal and tumor size did not change, respectively, 0.2250 and 1.88, while the tumor size was reduced by more than 20% was 2.8300. In the 3 groups, normal and tumor size did not change, respectively 0.2250 and 3.28, while the size of more than 30% was reduced to 3.7800. In addition, it was confirmed that the miRNA was present at the level of 6.4450 for prolactin adenomas, whereas 0.2 and 0.740 for normal and non-prolactin adenomas, respectively, in the fourth group.

As shown in FIG. 6, as a result of measuring the level of hsa-miR-424-5p present, it was found to be 0.5450 in the normal group, and 3.1100 in the case of prolactin adenomas. In the two groups, normal and tumor size did not change, respectively, 0.5450 and 2.380, while the tumor size of more than 20% was reduced to 4.2850. In the 3 groups, normal and tumor size did not change, 0.5450 and 5.600, respectively, the size was reduced by more than 30% 10.260 was confirmed. In addition, it was confirmed that the miRNA was present at the level of 10.505 for prolactin adenomas, while 0.5 and 0.890 for normal and non-prolactin adenomas, respectively, in the 4 groups.

As shown in FIG. 7, as a result of measuring the level of hsa-miR-514a-5p present, it was confirmed as 1.300 in the normal group, and 2.600 in the prolactin adenomas. In the two groups, normal and tumor size did not change, while 1.300 and 1.93, respectively, the tumor size of more than 20% was found to be 4.48. In the 3 groups, normal and tumor size did not change, respectively, 1.300 and 3.43, while the size was reduced by more than 30% was 4.610. In addition, it was confirmed that the miRNA was present at the level of 2.15 in the case of normal and non-prolactin adenoma in the four groups, while 1.300 and 2.06, respectively.

Based on the above results, the level of the miRNA in one group was higher in prolactin adenomas than in normal patients, and thus the diagnosis of hyperprolactinemia and hyperprolactinemia induced by prolactin adenomas was performed by the miRNA. It can be seen that.

In addition, since the miRNA is present in patients with prolactin adenomas whose tumor size is reduced by drug treatment in groups 2 to 4, drug therapy is optimally treated when the miRNA is present at high levels in serum. It can be seen that it can be applied as. In addition, it can be seen that non-pharmaceutical treatment can be applied as a primary treatment when the miRNA is present at low levels in serum.

8 to 11, the level of prolactin in the blood after drug treatment was normalized, and the levels of miRNAs present in the blood decreased to the normal levels of the miRNAs that were increased in the pre-treatment blood of patients in groups 1 to 4. can confirm.

The results indicate that the presence of high levels of miRNA in the blood of hyperprolactinemia patients is highly related to hyperprolactinemia.

Example 4 Confirmation of the level of miRNA present in pituitary tissue

The level of the miRNAs according to the present invention in the pituitary tissue of normal and tumor patients was confirmed.

6 normal pituitary gland, 8 prolactin adenoma, 8 nonfunctional pituitary adenoma, 21 GH secreting pituitary adenoma and ACTH secreting pituitary adenoma Tissues obtained at the time of surgery from 3 patients were used.

Total RNA was isolated from the tissue using RNeasy Mini Kit (Qiagen, Cat No. 74104, USA), and then hsa-miR-424-5p (478586_mir) and hsa-miR-514a in the same manner as in Example 3. Polymerase chain reaction was performed on −5p (478092_mir) and hsa-miR-20a-5p (478974_mir), and the results are shown in FIGS. 12 and 13.

As a result, as shown in Figure 12, the level of the presence of hsa-miR-20a-5p was 1.1 in the normal tissue, it was confirmed that the 5.9 in the tumor tissue of prolactin adenoma. This corresponded to a significantly higher level compared to nonfunctional pituitary adenoma GH and ACTH secreting pituitary adenoma.

The results clearly show that the origin of hsa-miR-20a-5p, which was increased in the blood of hyperprolactinemia patients, is the pituitary gland.

Example 5 Correlation Analysis of miRNAs and Drug Treatment Reactivity

Correlation between the level of the miRNAs measured in the blood taken prior to the drug treatment measured in Example 3 and the drug treatment responsiveness was analyzed. The assay compares the values of the levels of miRNAs present in serum obtained from blood collected prior to drug treatment of groups 2 and 3 of Example 3, based on the levels of miRNAs present in normal, and the results are as follows. Table 6 shows.

Classification hsa-miR-20a-5p hsa-miR-424-5p hsa-miR-514a-5p 2 groups 20% or more size reduction 12.58 7.86 3.45 No change in size 8.36 4.37 1.48 3 groups 30% more size reduction 16.80 18.83 3.55 No change in size 14.58 10.28 2.64

As shown in Table 6, when the size of the tumor is reduced by 20% or more due to the drug treatment, hsa-miR-20a-5p, hsa-miR-424-5p, and hsa-miR as compared with the case where there is no change in size. It was confirmed that the level of -514a-5p present was high. Furthermore, it was confirmed that the levels of hsa-miR-514a-5p were high only when the tumor size was reduced in the group 2 as well as the group 3. Through the above results, the miRNAs were present at high levels in the serum. It can be seen that drug treatment can be applied as an optimal primary treatment.

Example 6 Correlation Analysis of Prolactinemia Induced by miRNAs and Prolactin Adenoma

The correlation between the levels of the miRNAs measured in the blood taken prior to the drug treatment measured in Example 3 and the prolactinemia induced by prolactin adenomas was analyzed. The assay compares the values of the levels of miRNAs present in serum obtained from the blood of the four groups of Example 3, based on the levels of miRNAs present in normal, and the results are shown in Table 7 below.

Classification hsa-miR-20a-5p hsa-miR-424-5p hsa-miR-514a-5p 4 groups Prolactin adenoma 28.644 19.275 1.654 Non-prolactin adenoma 8.709 1.633 1.584

As shown in Table 7, hsa-miR-20a-5p and hsa-miR-424-5p in the serum of hyperprolactinemia patients identified as prolactin adenomas compared to the blood of hyperprolactinemia patients identified as non-prolactin adenomas. And high levels of hsa-miR-514a-5p present. The results indicate that hyperprolactinemia is likely to be induced by prolactin adenomas when the miRNAs are present at high levels in serum. It can be seen that.

Having described the specific part of the present invention in detail, it is apparent to those skilled in the art that the specific technology is merely a preferred embodiment, and the scope of the present invention is not limited thereto. Therefore, the substantial scope of the present invention will be defined by the appended claims and equivalents thereof.

<110> Yeonsei university <120> Composition for diagnosing of hyperprolactinemia and a method of          providing information for predicting the responsiveness of a          medication <130> PDPB187299 <160> 3 <170> KoPatentIn 3.0 <210> 1 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> hsa-miR-424-5p <400> 1 cagcagcaau ucauguuuug aa 22 <210> 2 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> hsa-miR-514a-5p <400> 2 uacucuggag agugacaauc aug 23 <210> 3 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> hsa-miR-20a-5p <400> 3 uaaagugcuu auagugcagg uag 23

Claims (17)

hyperprolactinemia, comprising an agent that measures the level at which one or more miRNAs are selected from the group consisting of hsa-miR-424-5p, hsa-miR-514a-5p, and hsa-miR-20a-5p Diagnostic composition of hyperprolactinemia). The method of claim 1,
The agent for measuring the level at which the miRNA is present is specific for at least one miRNA selected from the group consisting of hsa-miR-424-5p, hsa-miR-514a-5p and hsa-miR-20a-5p. It comprises a primer or probe that binds to, the composition for diagnosing hyperprolactinemia. The method of claim 1,
The hyperprolactinemia is induced by the pituitary tumor, composition for diagnosing hyperprolactinemia. The method of claim 3, wherein
The pituitary tumor is prolactinoma (Prolactinoma), the composition for diagnosing hyperprolactinemia. The method of claim 1,
The hyperprolactinemia is accompanied by at least one disease selected from the group consisting of osteoporosis, sexual dysfunction, infertility, pituitary tumors, brain tumors and galactorrhea, the composition for diagnosing hyperprolactinemia. The method of claim 1,
The composition is for predicting the drug reactivity of hyperprolactinemia, the composition for diagnosing hyperprolactinemia. A diagnostic kit for hyperprolactinemia comprising the composition of any one of claims 1 to 6. In samples isolated from a patient of interest or normal, the level at which at least one miRNA is selected from the group consisting of hsa-miR-424-5p, hsa-miR-514a-5p and hsa-miR-20a-5p is present. Measuring; And
Comparing the levels of the miRNAs measured in a sample isolated from the patient of interest and the subject of interest, providing information for diagnosing hyperprolactinemia. The method of claim 8,
If the level of miRNAs present in a sample isolated from hyperprolactinemia patients compared to normal persons, further comprising the step of judging that hyperprolactinemia induced by pituitary tumor, provides information for the diagnosis of hyperprolactinemia How to. The method of claim 9,
The pituitary tumor is prolactinoma (Prolactinoma), which provides information for the diagnosis of hyperprolactinemia. The method of claim 8,
The hyperprolactinemia is accompanied by at least one disease selected from the group consisting of osteoporosis, sexual dysfunction, infertility, pituitary tumor, brain tumor and galactorrhea, providing information for the diagnosis of hyperprolactinemia Way. The method of claim 8,
The measurement of the level of the miRNA is at least one selected from the group consisting of polymerase chain reaction, fluorescence correlation spectroscopy, microarray and chip-assay. And providing information for diagnosis of hyperprolactinemia. In samples isolated from hyperprolactinemia patients or normal subjects, at least one miRNA selected from the group consisting of hsa-miR-424-5p, hsa-miR-514a-5p, and hsa-miR-20a-5p is present. Measuring; And
Comparing the levels of the miRNAs measured in a sample isolated from the hyperprolactinemia patient with a normal person. The method of claim 13,
A method of providing information for predicting the responsiveness of a drug treatment further comprising the step of predicting that the drug responsiveness will be higher if the levels of miRNAs are present in a sample isolated from a hyperprolactinemia patient as compared to a normal person. . The method of claim 13,
The measurement of the level of miRNA is at least one selected from the group consisting of polymerase chain reaction, fluorescence correlation spectroscopy, microarray and chip-assay. And provide information for predicting the responsiveness of the drug treatment. In samples isolated from hyperprolactinemia patients or normal subjects, at least one miRNA selected from the group consisting of hsa-miR-424-5p, hsa-miR-514a-5p, and hsa-miR-20a-5p is present. The first input unit is input;
A comparison judgment unit for comparing the levels of the miRNAs measured in a sample separated from the hyperprolactinemia patient and a normal person; And
And an output unit for outputting a determination result of the comparison determination unit. The method of claim 16,
Wherein the comparison unit is compared with the normal person, if the level of miRNAs in the sample separated from the hyperprolactinemia patients is higher, the response to the drug treatment responsiveness predicting device, drug reactivity prediction device.

Images