KR102058624B1 - Marker TMEM43 for diagnosing sensorineural hearing loss and uses thereof - Google Patents

Abstract

Marker TMEM43 and its use for diagnosing sensorineural hearing loss, specifically, a polynucleotide comprising a contiguous nucleotide sequence selected from the nucleotide sequence of the exon region of the TMEM43 gene or a complementary polynucleotide thereof The present invention relates to a method for detecting a mutation of genomic DNA in order to provide a diagnostic composition for sensorineural hearing loss disease, and to provide information about a diagnosis. It can be analyzed with accuracy, and based on the analysis result, it is possible to efficiently diagnose sensorineural hearing loss.

Description

Marker TMEM43 for diagnosing sensorineural hearing loss and uses technician}

A diagnostic composition for sensorineural hearing loss disease for detecting genetic variation, a method for detecting genotypic mutation for providing information on the diagnosis of sensorineural hearing loss disease, and a predictive prognosis for cochlear implant surgery in patients with sensorineural hearing loss. A composition, a method of detecting mutations in a genome, and a model of sensorineural hearing loss disease to provide information for predicting the prognosis for cochlear implant surgery in patients with sensorineural hearing loss.

Congenital hearing loss occurs in about 3 out of 1,000 newborns, and more than 50% is known to be caused by genetic factors. Hereditary deafness is congenital and occurs after birth. There are many types of deafness, the most common of which is Sensorineural Hearing Loss (SNHL).

Sensorineural hearing loss refers to hearing loss caused by abnormalities in the function of detecting the sound of the cochlea or abnormalities of the auditory nerve or central nervous system that transmits the stimulus induced by the sound to the brain. Sensorineural hearing loss is classified into syndrome and non-syndrome according to symptoms, and syndrome sensory hearing loss refers to cases having clinical symptoms or symptoms of other organs other than those due to inner ear dysfunction. It accounts for 30% of hereditary deafness, and more than 300 types of syndrome hearing loss have been reported. Because it is easily classified into characteristic symptoms or malformations, it is easy to follow the causal gene in patients with the same cause. Non-syndrome sensorineural hearing loss refers to a case in which abnormal symptoms or symptoms of organs other than inner ear dysfunction are not shown, and only hearing impairment. It accounts for 70% of hereditary deafness, and because the genes are diverse, strategic genetic diagnosis is required based on clinical information such as the type of hearing loss and hereditary form. Non-syndrome deafness is known to be caused by 80% of recessive inheritance, 17% of dominant inheritance, 2-3% of X-linked, and 1% of mitochondrial inheritance. Sensorineural hearing loss is a common sensory deafness that has problems with extra cochlear hair cells of the cochlea and auditory neuropathy that has problems with cochlear inner hair cells or the nerve itself. Therefore, auditory neuropathy has asymmetrical emission or cochlear microphonic (CM) action, but no auditory brainstem response or very abnormal findings. Hearing neuropathy occurs sporadic in many patients, but in some cases is hereditary. Autosomal dominant inheritance patterns are associated with progressive hearing loss and are often accompanied by peripheral neuropathy. Autosomal recessive inheritance patterns usually show high hearing loss in infants and do not have peripheral neuropathy. Known causal gene defects include myelin protein zero (MPZ), peripheral myelin protein 22 (PMP22), and otoferlin (OTOF) gene mutations.

Sensory hearing loss is actually expected to have a significant prevalence, but in adults it is expected that many cases have not been diagnosed due to the lack of accurate diagnosis. In addition, some deafness genes have been studied to date, but there have been no reports on the relationship between TMEM43 mutations and sensorineural hearing loss. Against this background, the present inventors have tried to find markers for diagnosing sensorineural hearing loss disease. The present invention was completed by confirming that mutations can be used to diagnose sensorineural hearing loss.

One aspect provides a composition for diagnosing sensorineural hearing loss comprising a polynucleotide comprising a contiguous nucleotide sequence selected from the nucleotide sequence of an exon region of a TMEM43 gene or a complementary polynucleotide thereof to detect TMEM43 mutations.

Another aspect includes identifying a nucleotide sequence of genomic DNA isolated from an individual; And comparing the identified nucleotide sequence of the genomic DNA with a standard nucleotide sequence to identify the mutation of the genomic DNA to provide a method for detecting a mutation of the genomic DNA to provide information regarding the diagnosis of sensorineural hearing loss disease. To provide.

Another aspect is to predict the prognosis for cochlear implant surgery in a patient with sensory nerve deafness comprising a polynucleotide comprising a contiguous nucleotide sequence selected from the nucleotide sequence of the exon region of the TMEM43 gene or a complementary polynucleotide thereof to detect TMEM43 mutations. It provides a composition for.

Another aspect includes identifying a nucleotide sequence of genomic DNA isolated from an individual; And comparing the identified nucleotide sequence of the genomic DNA with a standard nucleotide sequence to identify mutations in the genomic DNA to provide information for predicting the prognosis for cochlear implant surgery in patients with sensorineural hearing loss. Provided are methods for detecting mutations in DNA.

Another aspect provides a model of sensorineural hearing loss comprising a TMEM43 mutation.

One aspect provides a composition for diagnosing sensorineural hearing loss comprising a polynucleotide comprising a contiguous nucleotide sequence selected from a nucleotide sequence of an exon region of a TMEM43 gene or a complementary polynucleotide thereof to detect TMEM43 mutations.

Transmembrane protein 43 (TMEM43) is a protein that functions to maintain nuclear membrane structures by organizing protein complexes in the inner nuclear membrane. The TMEM43 may be a protein encoded by the TMEM43 gene in humans. TMEM43 is a GenBank Accession No. It may be a polypeptide comprising the amino acid sequence of NP_077310.1 or a polypeptide comprising the amino acid sequence of SEQ ID NO: 1. The TMEM43 gene, in humans, is a polynucleotide comprising a nucleotide sequence encoding an amino acid sequence of TMEM43, a polynucleotide comprising a nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 1, GenBank Accession No. It may be a polynucleotide comprising the nucleotide sequence of NM_024334, NM_024334.2, or a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 2.

Those skilled in the art will be able to easily identify the position and sequence of the mutation using the registration number. The specific sequence corresponding to the number registered in the UCSC genome browser or GenBank may change slightly over time. It will be apparent to one skilled in the art that the scope of the present invention also applies to such altered sequences.

The TMEM43 may be expressed in the inner ear. The TMEM43 may be expressed in inner hair cells in the inner ear or supporting cells around the inner hairs. The TMEM43 may promote spontaneous activity in the developing inner ear, inducing survival and maturation of auditory neuronal cells prior to hearing development.

The sensorineural hearing loss refers to the hearing loss caused by an abnormality in the function of detecting the sound of the cochlea or an abnormality of the auditory nerve or the central nervous system that transmits a stimulus caused by the sound to the brain. The sensorineural hearing loss may be non-syndromal sensorineural hearing loss (NS-SNHL). The non-syndrome sensorineural hearing loss refers to the hearing loss that does not show abnormal symptoms or symptoms of other organs other than the inner ear dysfunction. The sensorineural hearing loss may be auditory neuropathy. Hearing neuropathy is a hearing loss caused by the impairment of the synchrony of action potentials in the auditory nerve fibers with respect to sound stimulation. It has acute sound emission or cochlear mic effect but no auditory brainstem response or very abnormal findings. Pathologically, the function of external hair cells is preserved and is due to abnormalities in auditory transmission through inner hair cells and type 1 auditory neurons.

The term "polynucleotide" refers to a nucleotide polymer of any length, which polynucleotide can be used interchangeably with nucleic acid, or oligonucleotide. The polynucleotide may specifically bind to the nucleotide sequence of the target region. The specific binding properties of these polynucleotides can be used to effectively separate target genes or fragments thereof including the target region from the mixture.

The polynucleotide may be singular or plural, and may be in the form of a single strand or a double strand. The polynucleotide is also composed of natural nucleotides, as well as modifications of natural nucleotides, analogs of natural nucleotides, sugars, bases or phosphoric acid sites of natural nucleotides, provided that they have the property of hybridizing with complementary nucleotides by hydrogen bonding. Nucleotides selected from the group consisting of nucleotides and combinations thereof (Scheit, Nucleotide Analogs, John Wiley, New York (1980); Uhlman and Peyman, Chemical Reviews, 90: 543-584 (1990)). . The polynucleotide may be DNA or RNA.

The term "contiguous nucleotide sequence" means two or more contiguous nucleotide sequences.

The term "complementary" means having a degree of complementarity capable of selectively hybridizing to the nucleotide sequence under certain specific hybridization or annealing conditions.

The polynucleotide may be a primer or a probe. The primer or probe may be a nucleotide sequence that is perfectly complementary to the nucleotide sequence, but a nucleotide sequence that is substantially complementary to a range that does not specifically prevent hybridization may be used. . In addition, the primer or probe may have a modified nucleotide sequence within a range that does not interfere specifically with hybridization with respect to the nucleotide sequence of the target region.

The term "primer" refers to a single strand of oligonucleotide that can act as a starting point in the polymerization of nucleotides by a polymerase. For example, the primers can serve as a starting point for template-directed DNA synthesis in suitable conditions and in suitable buffers, i.e. in the presence of four different nucleoside triphosphates and polymerases. May be a single strand of oligonucleotide. Suitable length of the primer can vary depending on various factors, such as temperature and the use of the primer. The primer may be 5 to 100nt, 5 to 70nt, 10 to 50nt, or 15 to 30nt in length. For example, shorter primers can form hybridization complexes that are sufficiently stable with the template at low annealing temperatures. When the length of the primer has a size of less than 5nt, the accuracy for capturing the target region is low, and if the size of more than 100nt has a disadvantage of increasing the synthesis cost. Thus, the primers are economically sized and optimized for gene mutation detection. The design of the primer can be readily carried out by one of ordinary skill in the art with reference to the given nucleotide sequence of the target region to be amplified. For example, it can be designed using a commercially available primer design program. Examples of such commercially available primer design programs include the PRIMER 3 program.

The primer may further include a nucleotide analogue such as phosphorothioate, alkylphosphothioate, peptide nucleic acid or intercalating agent. In addition, the fluorescent substance may further include a label material that emits fluorescence, phosphorescence, or radioactivity. The fluorescent label material may be one of VIC, NED, FAM, PET, or a combination thereof. The labeling substance may be labeled at the 5 'end of the polynucleotide. In addition, the radiolabeled substance may be incorporated into an amplification product through a PCR reaction using a reaction solution of a polymerase chain reaction (PCR) to which radioisotopes such as ³² P or ³⁵ S are added.

The primer may be used for allele specific PCR, PCR extension analysis, PCR single strand conformation polymorphism (PCR-SSCP), TaqMan method and methods using sequencing, etc. have.

The term "probe" refers to a polynucleotide capable of sequence specific binding to the complementary polynucleotide strand. The probe may have a length of 5 to 100nt, 10 to 90nt, 15 to 80nt, 20 to 70nt, or 30 to 50nt. When the length of the probe has a size of less than 10nt, the accuracy for capturing the target region is low, and when the size of the probe is greater than 100nt, the synthesis cost increases. Thus, the probes are economically sized and optimized for detecting genetic variation. The probe is selected from the group consisting of, for example, a perfect match probe consisting of a sequence completely complementary to a nucleotide sequence of a target region and a probe having a sequence that is completely complementary to all nucleotide sequences except for the mutation position. It may be.

The probe may be used in a hybridization method, for example, using a microarray, southern blotting, dynamic allele-specific hybridization, a DNA chip, or the like. Microarray is used in the meaning known in the art, for example, a probe or a group of probes may be immobilized in a plurality of separate areas on the substrate. The substrate is a suitable rigid or semi-rigid support, for example membranes, filters, chips, slides, wafers, fibers, magnetic beads or nonmagnetic beads, gels, tubing, plates, polymers, It may include microparticles and capillaries. The probe or a probe complementary thereto may be used in a method capable of hybridizing with a nucleic acid obtained from an individual and measuring the degree of hybridization obtained therefrom.

The term "gene" refers to a structural unit that determines genetic information and controls the expression of a structural gene, and / or structural gene having information that determines the amino acid sequence of a protein or the nucleotide sequence of a functional RNA (tRNA, rRNA, etc.). Regulatory genes, for example, may include a promoter, a suppressor (repressor), an operator (operator) and the like. The term "gene" is understood herein to mean a single stranded side comprising a nucleotide sequence that is transcribed to produce a product of a gene. For example, a "nucleotide sequence of a gene" may be a nucleotide sequence that controls the expression of a nucleotide sequence and / or structural genes contained in a single strand comprising a nucleotide sequence that is transcribed to produce a product of a gene.

The term "exon" refers to a region of a DNA sequence that contains protein synthesis information, for example, a nucleic acid molecule that encodes some or all of the expressed protein.

The mutation may be one having a change in nucleotide sequence with respect to standard genomic DNA. Variation of the nucleotide sequence may include substitution, insertion, duplication, deletion of one or more nucleotide sequences relative to standard genomic DNA (insertion and deletion, also referred to as 'InDel'). , Translocation, and the like. Substitution of the one or more nucleotide sequences may be, for example, a single nucleotide variant (SNV).

The mutation may be an autosomal dominant mutation. The mutation may be a mutation of an exon region of the TMEM43 gene, for example, the 12th exon region. The mutation may be a c.C1114T mutation in the nucleotide sequence of the TMEM43 gene. The mutation may be a c.C1114T mutation in the nucleotide sequence of SEQ ID NO: 2. The c.C1114T mutation in the nucleotide sequence of SEQ ID NO: 2 is a mutation in which a cytosine (C), which is the 1114th nucleotide from the 5 'end of SEQ ID NO: 2, is substituted with thymine (T) in a polynucleotide comprising a nucleotide sequence of SEQ ID NO: 2 It may be that.

The mutation may be a p.R372X mutation in the amino acid sequence of the TMEM43 protein. The mutation may be a p.R372X mutation in the amino acid sequence of SEQ ID NO: 1. The p.R372X mutation in the amino acid sequence of SEQ ID NO: 1 may be a mutation in which the arginine (R), which is the 372th amino acid from the N terminus of SEQ ID NO: 1, is lost by a stop codon in a polypeptide including the amino acid sequence of SEQ ID NO: 1 have.

In order to detect the TMEM43 mutation, a polynucleotide comprising a continuous nucleotide sequence selected from the nucleotide sequence of the exon region of the TMEM43 gene or its complementary polynucleotide is a single nucleotide mutation position in a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 2. It may be a polynucleotide capable of detecting the 1114th nucleotide from the 5 'end of SEQ ID NO: 2. Alternatively, a polynucleotide comprising the 1114th nucleotide from the 5 'end of SEQ ID NO: 2, which is a single nucleotide variation position in the polynucleotide including the nucleotide sequence of SEQ ID NO: 2, may have the same or complementary sequence. If one single stranded polynucleotide is associated with the risk of developing a sensorineural hearing loss disease, it can be determined that the polynucleotide complementary to the single stranded polynucleotide is also associated with the risk of developing a sensorineural hearing loss disease. Thus, the composition may comprise a single stranded polynucleotide associated with the risk of developing a sensorineural hearing loss disease having one specific nucleotide sequence and / or a polynucleotide having a nucleotide sequence complementary thereto.

Another aspect provides a composition for diagnosing sensorineural hearing loss comprising a polypeptide for specifically detecting a polypeptide missing some amino acids of TMEM43 to detect TMEM43 mutations.

The composition may be one comprising a polypeptide capable of detecting the amino acid deletion position in the TMEM43 protein. The composition may include a polypeptide capable of detecting the 372th amino acid from the N-terminal of the SEQ ID NO: 1, the amino acid deletion position in the polypeptide comprising the amino acid sequence of SEQ ID NO: 1.

Amino acid mutations may be due to nonsense mutations. Nonsense variation refers to an alteration in which one or more nucleotides are changed to a stop codon, thereby no longer producing amino acids.

The polypeptide may specifically bind to the 372th amino acid from the N terminus of SEQ ID NO: 1, which is a position where the amino acid ends and disappears in the polypeptide including the amino acid sequence of SEQ ID NO: 1. The 372th amino acid may be a polynucleotide encoding a 1114 nucleotide from the 5 'end of SEQ ID NO: 2, the polypeptide is a 1114 nucleotide from the 5' end of SEQ ID NO: 2 is replaced by T It may be one that can detect the generated amino acid sequence.

The polypeptide may be an antibody or an antigen binding fragment, and may be singular or plural. Antibodies may be in the form of whole antibodies as well as containing functional fragments of antibody molecules. The whole antibody is a structure having two full length light chains and two full length heavy chains, and each light chain is connected by heavy and disulfide bonds. The functional fragment of an antibody molecule means the fragment which has an antigen binding function.

The polypeptide is immunocytochemical and immunohistochemistry, radioimmunoassay, radioimmunoassay, enzyme linked immunoassay assay (ELISA), immunoblotting, Faar assay, immunoprecipitation, latex It may be used in a method using aggregation, erythrocyte aggregation, non-turbidity, immunodiffusion, counter-current electrophoresis, single radical immunodiffusion, immunochromatography, protein chip and immunofluorescence. That is, it can be used in a method capable of measuring the binding of the antigen to the antibody.

Another aspect provides a kit for diagnosing sensorineural hearing loss comprising a polynucleotide comprising a contiguous nucleotide sequence selected from the nucleotide sequence of an exon region of the TMEM43 gene or a complementary polynucleotide thereof to detect TMEM43 mutations. The kit may comprise a polynucleotide capable of detecting the 1114th nucleotide from the 5 'end of SEQ ID NO: 2, which is a single nucleotide variation position in the polynucleotide comprising the nucleotide sequence of SEQ ID NO: 2. Alternatively, the polynucleotide comprising the 1114th nucleotide from the 5 'end of SEQ ID NO: 2, which is a single nucleotide variation position in the polynucleotide including the nucleotide sequence of SEQ ID NO: 2, may include a polynucleotide having the same or complementary sequence thereof. have.

The kit may be, for example, to include the polynucleotide and the components necessary for the specific use thereof. It may be one containing a reagent necessary for its use with the polynucleotide. The kit may further comprise a known substance required for the polynucleotide to hybridize with the nucleic acid. The kit may specifically be a kit for amplifying a nucleotide sequence of a target region and diagnosing sensorineural hearing loss disease in an individual through the presence or absence of an amplification product. Or a kit for hybridizing the polynucleotide or a probe derived therefrom with a nucleic acid in a sample, and diagnosing the risk of developing a sensory neurological hearing loss disease in the individual from the hybridization result. For example, it may further include a reagent, a buffer, a buffer, a cofactor, and / or a substrate required for hybridization of the nucleic acid. In addition, when the kit is subjected to a PCR amplification process, optionally, it may include a reagent required for PCR amplification, for example, buffer, DNA polymerase, DNA polymerase cofactor and dNTPs. In addition, the kit may further include instructions for use to amplify the target region, and may be manufactured in a number of separate packaging or compartments containing the reagent components described above. For example, the instruction manual may be used for amplifying a target region in an amplification reaction using the specific primer, and when the target region is not amplified in the amplification reaction using the non-specific primer. And an explanation of the outcome determination, including a description of determining that there is an associated target area or variation, and from that result, determining the risk of developing the individual's sensorineural hearing loss disease.

The polynucleotides and variations are as described above.

Another aspect provides a kit for diagnosing sensorineural hearing loss comprising a polypeptide for specifically detecting a polypeptide missing some amino acids of TMEM43 to detect TMEM43 mutations.

The kit is one or more suitable for methods of analyzing a polypeptide for determining the expression level of a polypeptide comprising the amino acid sequence of SEQ ID NO: 1 or a polypeptide that has lost the 372th amino acid in a polypeptide comprising the amino acid sequence of SEQ ID NO: 1 Other components or devices may be included. Measuring the expression level of the polypeptide comprising the amino acid sequence of SEQ ID NO: 1 is a process of confirming the presence and expression of the polypeptide or protein expressed in the gene, specific for the polypeptide comprising the amino acid sequence of SEQ ID NO: 1 The amount of expression of the gene or the amount of protein can be confirmed using the polypeptide that binds to When the kit is subjected to an immunoassay, it may optionally be one comprising a substrate of a secondary antibody and a label.

Such polypeptides and variations are as described above.

Another aspect provides a vector comprising a polynucleotide consisting of a nucleotide sequence encoding a p.R372X variant of TMEM43. The vector may include a polynucleotide consisting of a nucleotide sequence encoding a p.R372X mutation in the amino acid sequence of SEQ ID NO: 1. Vector means a carrier of polynucleotides. The polynucleotide may be present in a vector, eg, an expression vector, which is a suitable expression system. In the vector, the polynucleotide consisting of a nucleotide sequence encoding a p.R372X mutation in the amino acid sequence of SEQ ID NO: 1 may be operably linked to a promoter. The term “operably linked” means a functional bond between an array of nucleic acid expression control sequences, eg, a promoter, signal sequence, or transcriptional regulator binding site, and another nucleic acid sequence, whereby the regulatory sequence To regulate transcription and / or translation of other nucleic acid sequences. Promoters available in the expression vectors are those that can operate in animal cells, for example mammalian cells to regulate the transcription of nucleotide sequences, and promoters derived from mammalian viruses and / or promoters derived from the genome of mammalian cells. It may be to include. For example, cytomegalo virus (CMV) promoter, adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, tk promoter of HSV, RSV promoter, EF1 alpha promoter, metallothionine promoter, or It may be a beta-actin promoter. The vector may be one that includes available polyadenylation sequences. The backbone in the vector may be selected as needed from various vectors suitable for expression of the polynucleotide. For example, pCMV6-Entry, pHY92 vector, pRC CMV vector, pIRES2-EGFP vector, SV40 vector, papilloma virus vector, YIp5 vector, YCpl9 vector, Epstein-Barr virus vector, pMSG vector, pMAMneo-5 vector, Baculus It may be a rovirus pDSVE vector, a pSecTag2B vector or a yT & A vector. For example, a polynucleotide consisting of a nucleotide sequence encoding a p.R372X variant of TMEM43 inserted into a pCMV6-Entry vector may be produced by methods known in the art, such as position-directed mutations and polymerase chain reactions. have.

Another aspect provides a model of sensorineural hearing loss comprising a TMEM43 mutation.

The model may be a transformant having a TMEM43 mutation.

The term “transformer” refers to a transformed cell or transformed animal into which a gene encoding one or more target proteins has been introduced. The transformed animal refers to an animal that continuously expresses TMEM43 with a p.R372X mutation. The transformed animal may be one containing a change in the nucleotide sequence of the exon region of the TMEM43 gene. The transformed animal may be one containing a c.C1114T mutation in the nucleotide sequence of the TMEM43 gene.

The transformed animal may be an animal that integrates the gene of an animal encoding TMEM43 having a p.R372X mutation into the fertilized egg and integrates into the animal's chromosome to continuously express TMEM43 having a p.R372X mutation. The gene encoding TMEM43 having the p.R372X mutation may be inserted into the somatic or germ cells of the transformed animal, or the genomes of somatic and germ cells. The transformed animal was microinjected (Capecchi, MR, Cell, 22: 479 (1980)), calcium phosphate precipitation method (Graham, FL et al.) Into the fertilized egg or embryonic stem cells (ES cells). al., Virology, 52: 456 (1973)), electroporation (Neumann, E. et al., EMBO J., 1: 841 (1982)), liposome-mediated transfection (Wong, TK et al. , Gene, 10:87 (1980)), DEAE-dextran treatment (Gopal, Mol. Cell Biol., 5: 1188-1190 (1985)), retroviral infection and gene balm (Yang et al., Proc. Natl. Acad. Sci., 87: 9568-9572 (1990)).

The transformed animal may be a genetic nuclease such as zinc finger nuclease (ZFN), transcriptional activator-like effector nuclease (TALEN), CRISPR / Cas, or CRISPR / Cpf1. It may be to be delivered by the method. The transformed animal is to deliver a polynucleotide consisting of a nucleotide sequence encoding a p.R372X mutation of the TMEM43 to fertilized eggs or embryonic stem cells, to prepare a fertility animal, the fertility of the fertilized egg Implanting into the uterus of the animal, rearing the animal so that the fertilized egg is born, and obtaining progeny to screen for the expression of p.R372X mutation of TMEM43. The transformed animal includes various mammals except humans, but is not limited thereto, and may be mouse, rat, cow, horse, pig, sheep, goat, dog, cat, and the like.

The transformed cell refers to a cell that continuously expresses TMEM43 with a p.R372X mutation. The cells may be somatic or germ cells, or somatic and germ cells. The transformed cell may use a known method for introducing the vector into the cell, and suitable standard techniques such as microinjection, calcium phosphate precipitation, electroporation, liposomes, as known in the art. -Mediated transfection, DEAE-dextran treatment, retroviral infections and gene balmbodies can be used, but are not limited to these. At this time, the circular vector may be cut with an appropriate restriction enzyme and introduced into a linear vector form.

Since the transformant continuously expresses TMEM43 having a p.R372X mutation, the transformant may be used for screening a therapeutic agent or treatment method for sensorineural hearing loss. Screening of the sensory neurodeafness screening agent includes the steps of adding a test substance to be analyzed to a transformant that continuously expresses TMEM43 having a p.R372X mutation, and analyzing the degree of treatment or alleviation of sensorineural hearing loss in the transformant. And evaluating. Adding the test substance to be analyzed to the transformed cells or the transformed animal can be carried out by various methods known to those skilled in the art.

Another aspect includes identifying a nucleotide sequence of genomic DNA isolated from an individual; And comparing the identified nucleotide sequence of the genomic DNA with a standard nucleotide sequence to identify the mutation of the genomic DNA to provide a method for detecting a mutation of the genomic DNA to provide information regarding the diagnosis of sensorineural hearing loss disease. To provide.

The method includes identifying a nucleotide sequence of genomic DNA isolated from an individual.

The subject refers to a subject for predicting the risk of developing a sensorineural hearing loss disease. The subject may be a subject having or suspected of having a sensorineural hearing loss disease. The subject may include a vertebrate, mammal, human ( Homo sapiens ), mouse, rat, cow, horse, pig, sheep, goat, dog, cat and the like. For example, the human may be Asian or Korean. "Subject" and "patient" are used interchangeably herein.

The genomic DNA isolated from an individual in the method may be genomic DNA or fragment thereof isolated from a biological sample. The biological sample may include blood, tissue, urine, mucus, saliva, tears, plasma, serum, sputum, spinal fluid, pleural fluid, nipple aspirate, lymph, airway, serous, urogenital fluid, breast milk, lymphatic system fluid, semen, cerebrospinal fluid, Intratracheal fluid, ascites, cystic tumor fluid, amniotic fluid, or a combination thereof. The biological sample may be purely isolated nucleic acid, crude isolated nucleic acid, cell lysate comprising nucleic acid, or cell free nucleic acid. The method of separating genomic DNA from a biological sample can be performed by conventional nucleic acid separation methods.

Identifying the nucleotide sequence of the genomic DNA in the method means determining the nucleotide at each position or target region in the chromosome. For example, the nucleotide sequencing method of known nucleic acids can directly determine the nucleotides at the target region or at each position in the chromosome. Nucleotide sequencing methods may include Sanger (or dideoxy) sequencing methods or Maksam-Gilbert (chemical cleavage) methods. In addition, the nucleotide sequence of the target region can be determined by hybridizing the probe with the polynucleotide of interest and analyzing the hybridization result. The degree of hybridization can be confirmed, for example, by labeling a target nucleic acid with a detectable label and detecting the hybridized target nucleic acid, or by an electrical method or the like. In addition, a single base primer extension (SBE) method may be used. Nucleotide sequencing methods may also include next generation base sequencing. The term "next generation sequencing (NGS) fragments the full-length genome in a chip-based and PCR-based paired-end format, and fragments the fragment at ultrafast speeds based on chemical hybridization. This technique refers to a technique for performing sequencing A large amount of base sequence data can be generated for a sample to be analyzed within a short time by next-generation sequencing.

The method may comprise fragmenting the isolated genomic DNA to any size. The fragmentation can be performed by methods known to those skilled in the art. For example, genomic DNA can be fragmented by the use of ultrasound. The method may include fragmenting the genomic DNA and then ligation of a sequence for amplification at both ends of the fragmented genomic DNA. The ligation method for the amplification, for example, a paired-end tag, a universal tag, etc. may be appropriately selected by a person skilled in the art.

The method may comprise obtaining a hybridized product of the isolated genomic DNA and the polynucleotide in the composition. The method may be to obtain a hybridization product of a polynucleotide included in the composition and a fragment of genomic DNA having a nucleotide sequence of a target region targeted by the polynucleotide. The hybridization can be accomplished by contacting the composition with isolated genomic DNA. The hybridization can be performed by known methods. For example, it can be performed by incubating the genomic DNA isolated from the polynucleotide in a buffer known to be suitable for hybridization of nucleic acids. Hybridization can be carried out at an appropriate temperature. Suitable temperatures for hybridization may be, for example, about 40 ° C. to about 80 ° C., about 50 ° C. to about 75 ° C., about 60 ° C. to about 70 ° C., or about 62 ° C. to about 67 ° C. In addition, the hybridization temperature is not limited thereto, and may be appropriately selected depending on the nucleotide sequence and the length of the polynucleotide included in the composition. Hybridization time can be, for example, for 1 hour to 12 hours (overnight).

The method comprises the steps of: obtaining a hybridization product of the isolated genomic DNA and the polynucleotide in the composition, and before identifying the nucleotide sequence of the isolated genomic DNA, separating the hybridization product of the isolated genomic DNA and the polynucleotide It may be to include a step. The separation may be using a moiety for separation or purification attached to the polynucleotide. The separation or purification may be by a substance or magnetic field that specifically binds to the moiety.

The method uses the isolated hybridization product or the separated genomic DNA as a template, ligates a sequence for amplification at both ends of the template, and uses a universal primer complementary to the sequence for the amplification as a primer. By using PCR, it may be to amplify the isolated hybridization product or isolated genomic DNA. The nucleotide sequence can be identified using the amplified product.

The method includes comparing the identified nucleotide sequence of genomic DNA with a standard nucleotide sequence to identify mutations in the genomic DNA. The term "reference neucleotide sequence" may be a human genomic sequence that does not include a mutation, to which reference is made for identification of the mutation. The standard nucleotide sequence may be a nucleotide sequence of a reference genome, for example, a nucleotide sequence of a human gene, specifically NCBI37.1 or UCSC hg19 (GRCh37), published in a database of the National Institute of Biotechnology Information Institute of the National Institutes of Health. . The comparison between the nucleotide sequence of the genomic DNA and the standard nucleotide sequence can be performed using various known sequence comparison analysis programs, for example, Maq, Bowtie, SOAP, GSNAP and the like.

When the mutation of the genomic DNA is confirmed, the method may include determining that the individual belongs to a high risk group of the risk of developing a sensorineural hearing loss disease. That is, it can be diagnosed that the individual has sensorineural hearing loss disease. The risk group refers to a group having a standard nucleotide sequence or a group predicted or diagnosed with an increased probability of developing a sensorineural hearing loss disease compared to a normal group.

The variation is as described above.

Another aspect is to predict the prognosis for cochlear implant surgery in a patient with sensory nerve deafness comprising a polynucleotide comprising a contiguous nucleotide sequence selected from the nucleotide sequence of the exon region of the TMEM43 gene or a complementary polynucleotide thereof to detect TMEM43 mutations. It provides a composition for.

Predicting the prognosis for the cochlear implant surgery of the sensorineural hearing loss patient means predicting whether speech can be understood during the cochlear implant surgery or better understood after the cochlear implant surgery. For example, it may be to predict whether the auditory brainstem response will be normal. Patients with sensorineural hearing loss having the above mutations have abnormalities in the inner hair cells or the supporting cells around the inner hair cells, and there will be no problem in the conduction of the auditory nerves.

The mutation, polynucleotide and sensorineural hearing loss are as described above.

Another aspect includes identifying a nucleotide sequence of genomic DNA isolated from an individual; And comparing the identified nucleotide sequence of the genomic DNA with a standard nucleotide sequence to identify mutations in the genomic DNA to provide information for predicting prognosis for cochlear implant surgery in patients with sensorineural hearing loss. Provided are methods for detecting mutations in DNA.

Identifying the nucleotide sequence of genomic DNA isolated from the individual; And comparing the identified nucleotide sequence of the genomic DNA with a standard nucleotide sequence to identify the variation of the genomic DNA as described above.

Providing information for predicting the prognosis for cochlear implant surgery in patients with sensorineural hearing loss means predicting whether speech can be understood during cochlear implant surgery or better understood after cochlear implant surgery. . For example, it may be to predict whether the auditory brainstem response will be normal.

All technical terms used in the present invention, unless defined otherwise, are used in the meaning as commonly understood by those skilled in the art in the related field of the present invention.

Using the composition or kit according to one aspect, the mutation of the TMEM43 gene can be analyzed with high sensitivity and accuracy, and the sensory neuron hearing loss can be efficiently diagnosed based on the analysis result.

Figures 1a and 1b shows the process of identifying the family tree and TMEM43 mutation belonging to the members of the cohort (SB162).
Figure 2 shows the results of confirming the organ expressing TMEM43 in the mouse.
3 is a result confirming that TMEM43 is expressed in the inner ear of 4 to 5 days old and 20 days old mice.
Figure 4 shows the results of confirming the expression of TMEM43 in the inner ear of 4, 15 and 20 days old mice.
5 shows the process of making a transformed animal with a p.R372X variant of TMEM43. Auditorin stands for TMEM43.
6 shows TMEM43 ^{+ / +} and TMEM43 ^{+ / tm1Cby} at 2, 7, and 13 months of age. Scanning transcription microscopy images showing inner border cells and border cells in the retinal lamina of mouse hair cells. Here, green and light green represent inner border cells, and orange and yellow represent border cells, respectively.
7 shows TMEM43 ^{+ / +} and TMEM43 ^{+ / tm1Cby} at 6 and 9 months of age. Mean ABR thresholds for 4, 8, 16, and 32 kHz in mice are shown. Auditorin stands for TMEM43.

Hereinafter, the present invention will be described in more detail with reference to Examples. However, these examples are for illustrative purposes only and the scope of the present invention is not limited to these examples.

Example  1. From patients with sensorineural hearing loss Of TMEM43  p. R372X  Mutation Detection and Identification of Sensorineural Hearing Loss in Animal Models with p.R372X Mutation of TMEM43

1. Select Experiment Object

This study was approved by the Deliberation Committee of Seoul National University Bundang Hospital (IRB-B-1007-105-402 and IRBYH-0905-041-281).

To investigate the genetic cause of auditory neuropathy, a family tree (SB162) was used to isolate adult-onset progressive auditory neuropathy by autosomal dominant genetic method based on standardized hearing test or family history data. Compared to the normal subject 290, the subjects 291, 284, and 304 affected by auditory neuropathy had a decrease in sensitivity to sound in the Pure Tone Average (PTA), and a language discrimination score ( Impairment recognition in Speech discrimination Score (SDS), with complete absence of Auditory Brainstem Respons (ABR), and modulation product otoacoustic emissions (DPOAE) or cochlear microphone (Cochlea microphonic potential (CM)) It was normal.

Specifically, 1,100 hearing impaired households were screened first in 780 households with hearing loss. In adult auditory neuropathy, households whose age of onset was after language acquisition were selected secondarily. Subsequently, adult auditory neuropathy was categorized into three types based on clinical manifestations, electrophysiological findings, and genetic diagnosis in candidate gene pools.

Type 1: Caused by previously known deafness genes (eg DIAPH3)

Type 2: If a causative gene cannot be found in previously known hearing loss genes and an electrically evoked auditory brainstem response (E-ABR) is present.

Type 3: If no causative gene is found in previously known hearing loss genes and no electrical stimulating auditory brainstem response exists

2. Molecular Genetic Screening

To screen for candidate variations associated with sensorineural hearing loss, the following was performed.

Target exome sequencing was performed on the 3p25-26 region from linkage analysis for 4 subjects (SB162-284, 289, 290, 291) and listed candidate variants. Mutations with minor allele frequencies of less than 1% were identified in ESP6500 and 1000G. The genetic patterns were filtered and dbSNPs were filtered rather than the flagged dbSNPs. 622 normal controls were then used to remove Korean specific common mutations. The genome level log2 ratio for chromosome 3 was investigated.

At the same time, whole exome sequencing was performed on four subjects (SB162-284, 289, 290, 291) to analyze a case where no mutations were found in the target exome sequencing, or because the number of patients in the household is expected to be Mendelian. : WES) was performed. Whole blood was extracted from subjects with sensorineural hearing loss and whole exome sequencing was performed using SureSelect Human All Exon Kit V3 (Agilent, Santa Clara, Calif., USA). It was also sequenced using HiSeq 2000 (Illumina, San Diego, Calif., USA) with 101 base pair terminal reads. Bioinformatics analysis reveals Whole-exome sequencing reveals diverse modes of inheritance in sporadic mild to moderate sensorineural hearing loss in a pediatric population. Genet Med 17: performed as described in 901-911. Sequencing reads were aligned to the human reference genome (hg19) using BWA v 0.7.5 and SAMTOOLS v 0.1.18 and sorted, indexed, rearranged, and duplicated using CATK v 2.4-7 and Picard v 1.93. . Mutations were named using the GATK Unified Genotyper, and the mutations were reconfirmed. Variations were annotated using ANNOVAR. Thereafter, the final candidate variation of the household was confirmed by Sanger sequencing.

Candidate variations were filtered by synonymous variants of coding regions and variations of non-coding regions. Variants with a minority allele frequency of less than 1% were found in the Exome Sequencing Project 6500, ESP6500, 1000 Genome Project (1000G), The Exome Aggregation Consortium (ExAC), and 81 Koreans. Screening was based on a database of individual exomes. Homozygous variants and compound heterozygote variants were then screened with a lead depth of at least 10 × and genotyping quality scores of at least 20. Finally, 20 candidate mutations co-segregated with the ANSD phenotype were identified except for clinically insignificant dbSNP ID variations. After WES for four families, a segregation study was performed for 14 other families, and finally p.R372X of TMEM43 was selected.

gene
GenbankID Chr Exon Nucleo Tied amino acid SB162
-284 * 289 * 290 * 291 * 304 305 306 307 308 + + - + + - + + - DTX3L
NM_138287 chr3 One c.G83A p.S28N + + - + -// - + + - MAP2K1
NM_002755 chr15 10 c.A1062C p.Q354H + + - + -// - - - - KIAA1614
NM_020950 chr1 5 c.G2514T p.E838D + + - + + - + -// - PARD3B
NM_057177 chr2 11 c.A1594C p.I532L + + - + -// - + - + HDLBP
NM_001243900 chr2 21 c.G2728A p.G910S + + - + + - -// - - CILP
NM_003613 chr15 5 c.C448G p.R150G + + - + -// - - - - CRYAB
NM_001885 chr11 One c.T79A p.F27I + + - + -// - - - - ZFPM1
NM_153813 chr16 10 c.C1645G p.L549V + + - + -// - + - + MIDN
NM_177401 chr19 5 c.C401T p.S134L + + - + + - + -// + INO80
NM_017553 chr15 6 c.A623G p.K208R + + - + -// - - - - DOK3
NM_001144875 chr5 2 c.C8T p.P3L + + - + -// + - - - TBCE
NM_001079515 chr1 9 c.T794C p.I265T + + - + -// - + - - TMEM43
NM_024334 chr3 12 c.C1114T p.R372X + + - + + - + + - MAML1
NM_014757 chr5 5 c.C2338T p.H780Y + + - + -// + - - - ADCK3
NM_020247 chr1 6 c.C818T p.A273V + + - + -// - + - - MYO5C
NM_018728 chr15 29 c.A3620C p.E1207A + + - + -// - - - - EPC1
NM_001272004 chr10 4 c.T572C p.I191T + + - + + - + + - P4HA2
NM_001017973 chr5 2 c.T80C p.I27T + + - + -// - + + - KIAA1024L
NM_001257308 chr5 One c.T160G p.S54A + + - + -// - + + - ARID1B
NM_017519 chr6 One c.1029_1030
insGCG p.A343del
insAA + + - + -// + - - -

gene
GenbankID Chr Exon Nucleotide amino acid 309 310 324 325 331 332
333 355 369 - - - - + + + - - DTX3L
NM_138287 chr3 One c.G83A p.S28N + + - - + + - - - MAP2K1
NM_002755 chr15 10 c.A1062C p.Q354H - - + + - - + - - KIAA1614
NM_020950 chr1 5 c.G2514T p.E838D + - - - + + - - - PARD3B
NM_057177 chr2 11 c.A1594C p.I532L - - + + - - - - - HDLBP
NM_001243900 chr2 21 c.G2728A p.G910S - - - - - - - - - CILP
NM_003613 chr15 5 c.C448G p.R150G - - + + - - + - - CRYAB
NM_001885 chr11 One c.T79A p.F27I - - - - - - - - - ZFPM1
NM_153813 chr16 10 c.C1645G p.L549V - - - - - - + - - MIDN
NM_177401 chr19 5 c.C401T p.S134L + - + - + - - - - INO80
NM_017553 chr15 6 c.A623G p.K208R - - - - - - + - - DOK3
NM_001144875 chr5 2 c.C8T p.P3L + + - - + - + - - TBCE
NM_001079515 chr1 9 c.T794C p.I265T + - + + + + + - - TMEM43
NM_024334 chr3 12 c.C1114T p.R372X - - - - + + + - - MAML1
NM_014757 chr5 5 c.C2338T p.H780Y + + - - + - + - - ADCK3
NM_020247 chr1 6 c.C818T p.A273V + - - - + + - - - MYO5C
NM_018728 chr15 29 c.A3620C p.E1207A - - - - - - + - - EPC1
NM_001272004 chr10 4 c.T572C p.I191T - - - - + + -// - - P4HA2
NM_001017973 chr5 2 c.T80C p.I27T + - - - + + - - - KIAA1024L
NM_001257308 chr5 One c.T160G p.S54A + - - - + + - - - ARID1B
NM_017519 chr6 One c.1029_1030
insGCG p.A343del
insAA - - - - - - + - -

(+: Affected by disease)

Figures 1a and 1b shows the process of identifying the family tree and TMEM43 mutation belonging to the members of the cohort (SB162). After filtering based on the dbSNP database, allele frequency, and genetic pattern, and in TMEM43, mutations in R372X were detected as heterozygotes, and the number of mutations identified in the process of selecting mutations in the genes is shown in Table 3 below.

number step Number of variations One Raw SNV 1296327 2 Annotated variants 1296327 3 Exonic and splicing variants 32705 4 After elimination of synonymous SNV 16118 5 With allele frequency of <1% 3818 6 Not registered in dbSNP + Flagged SNP 1037 7 Inheritance pattern matched 21 8 Phase or segregation checked One

The p.R372X mutation is believed to be inherited as an autosomal dominant. In addition, the p.R372X mutation was not detected in the chromosomes of the Korean control group with normal hearing.

3. Of TMEM43  Expression localization analysis

(3.1) in various mouse tissues TMEM43  Expression confirmation

129Sv / Ev mice were anesthetized with pentobarbital sodium (50 mg / kg). To determine the mRNA expression level of the target factor, the whole cochlea (P1), using TRIZOL ^® (Gibco BRL, Gaithersburg, MD, USA) and RNeasy kit (Qiagen, Valencia, USA), according to the manufacturer's instructions ), Total RNA was extracted from the heart (P120), eyes (P42), brain (P28), kidney (P28), and liver (P28). The cDNA was then synthesized using oligo dT primers and extracted RNA. Using the synthesized cDNA and primer sets specific for TMEM43 and Gapdh, polymerase chain reaction (PCR) was performed, and PCR conditions were as follows: 2 minutes at 95 ° C, followed by 95 20 seconds at &lt; RTI ID = 0.0 &gt; C, &lt; / RTI &gt; Amplification products (15 μl) were electrophoresed on 2% agarose gel and visualized with ethidium bromide. At this time, the TMEM43 and Gapdh specific primer sequences are as follows: TMEM43 forward primer: 5'-CTTCCTGGAACGGCTGAG-3 '(SEQ ID NO: 3) and TMEM43 reverse primer 5'-CACCAGCCTTCCTTCATTCT-3' (SEQ ID NO: 4), Gapdh forward Primer: 5'- ACCACAGTCCATGCCATCAC-3 ') (SEQ ID NO: 5) and Gapdh reverse primer: 5'-CACCACCCTGTTGCTGTAGCC-3' (SEQ ID NO: 6).

Figure 2 shows the results of confirming the organ expressing TMEM43 in the mouse. As shown in Figure 2, it can be seen that TMEM43 is expressed in the inner cochlea.

(3.2) In the mouse inner ear TMEM43  Expression analysis

Rabbit polyclonal antiserum (AbClon) was directed to the NH ₂ -terminus of mouse TMEM43 . Peptide sequence is the same as NH ₂ -SRKEHVKVTSE-COOH (SEQ ID NO: 7). Primary antibodies are rabbit anti-TMEM43 monoclonal antibody (1: 500, Abcam, Ab184164), rabbit anti-TMEM43 polyclonal antibody (1: 100, Novus, Cat # NBP1-84132, Littleton, USA 80120), mouse Anti-mCherry monoclonal (1: 500, Abcam, ab125096), mouse anti-calretinin monoclonal antibody (1: 500, Millipore, MAB1568), goth polyclonal anti-Na ⁺ , K ⁺ - ATPase-α3 antibody (NKA, 1: 250, Santa Cruz, SC-16052), and mouse monoclonal anti-CtBP2 antibody (1: 500, BD Transduction Laboratories, 612044) were used. Secondary antibodies were used at 1: 1000 dilution made from donkey or goth (life technologies).

Mouse inner ear (C57BL / 6, P9 and P15) was fixed in cold 4% paraformaldehyde for about 1 hour. The tissue sample is incubated in a cochlear turns and incubated in a blocking / permeabilizing buffer containing phosphate buffered saline containing 5% goth serum and 0.25% Triton X-100. Produced. Subsequently, the tissue sample was separated from the primary antibody and 4 ^o Incubated at C overnight, washed three times and incubated with fluorescent secondary antibody for 1 hour at room temperature. The tissue sample was then washed with blocking / permeation buffer and with phosphate buffered saline. The tissue sample was mounted on a glass slide using Fluorsave reagent (Calbiochem, 345789), covered with coverslips, and microscopic samples were prepared. Images were obtained from microscope samples using an inverted fluorescence microscope and a confocal laser scanning microscope (LSM710, Zeiss).

3 is a result confirming that TMEM43 is expressed in the inner ear of 4 to 5 days old and 20 days old mice. As shown in Figure 3, it can be seen that TMEM43 is expressed in the supporting cells around the inner hair cells. Figure 4 shows the results of confirming the expression of TMEM43 in the inner ear of 4, 15 and 20 days old mice. As shown in FIG. 4, in mice, TMEM43 is expressed in the inner ear, and even if time passes, it can be seen that it is continuously expressed in supporting cells around inner hair cells in the inner ear. In addition, the expression pattern of TMEM43 was consistent with that of spontaneous activity (not shown).

4. TMEM43  Mouse deficient and Of TMEM43  p. R372X  Construction and Phenotypic Analysis of Mutant Transgenic Mouse

(4.1) CRISPR Of Cas9  Using technology TMEM43  Deficient ( TMEM43 knockin ) Mouse and Of TMEM43  p. R372X  Making a mouse with mutation

TMEM43-R372X Knock-in (C57BL / 6J; 129S- ^TMEM43tm1Cby ) mouse model was constructed using the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) method.

5 shows the process of making a transformed animal with a p.R372X variant of TMEM43. In this model, arginine (R) was substituted with a stop codon at position 372 of the TMEM43 protein (gene ID: NM_028766). Based on the off-target profile and distance to the mutation site, gRNAs were constructed. Two gRNA candidates located close to the mutation site ( TMEM43 gRNA1: 5′-TTAGAGCAGCCCACAGCGGT CGG- 3 ′ (SEQ ID NO: 8); TMEM43 gRNA2: 5'- CCGATTAGAGCAGCCCACAG CGG- 3 '(SEQ ID NO: 9)) was evaluated. CCG stands for Protospacer Adjacent Motif (PAM) sequence.

To measure gRNA activity, a SURVEYOR assay was performed using the SURVEYOR Mutation Detection Kit (IDT) according to the manufacturer's instructions. Based on the identified gRNAs, single stranded oligodeoxynucleotide donors (ssODNs) were designed and synthesized. The 160 bp donor DNA contains two homologous arms flanking the mutation introduced at exon 12 corresponding to position 1114 of the TMEM43 gene (C-> T). In addition, to prevent the repaired genome from being retargeted by the Cas9 complex, additional variations corresponding to the second stop codon were introduced. 62 C57BL / 6J embryos were injected via the cytoplasm with a CRISPR cocktail comprising ssODN donor, gRNA transcription TMEM43, and Cas9 mRNA. 49 of the 62 embryos were screened for selection and transplanted into 2 CD1 mice. All females were pregnant and gave birth to 9 offspring F0. Female F0 was crossed with wild-type male C57BL / 6J mice, and after obtaining F1, germline transmission of germ cells was confirmed. In all mice, the presence or absence of point mutations at target locations was analyzed by PCR and sequencing. To confirm the genotype, genomic DNA was extracted from the tail of about 1 mm to about 2 mm using the DNeasy ^® Blood & Tissue Kit (Qiagen, Hilden, Germany). Using genomic DNA (5 μL), 25 mM MgCl ₂ , 2 mM dNTPs, 10 pM primer, and 0.02 U TOYOBO KOD Hot Start DNA Polymerase (Invitrogen / Life Technologies, Billerica, Massachusetts, USA) PCR was performed, with PCR conditions as follows: 2 minutes at 95 ° C., followed by 20 times at 95 ° C., 10 seconds at 59 ° C., 35 times to 10 seconds at 72 ° C., and 10 minutes at 72 ° C. At this time, to confirm the presence of the knock-in allele, the primer sequence is as follows: forward primer 5'-ccacagTGGACTGGTTTCCT-3 '(SEQ ID NO: 10), and reverse primer 5'-GGCTTCACTCCAGCTTTTTG-3' (SEQ ID NO: 11). The size of the amplification product by the primer sequence is about 213 bp. The amplified product was reconfirmed by Sanger sequencing (Macrogen Inc., Seoul, KOR).

(4.2) Of TMEM43  p. R372X  Transgenic Mice with Mutations SEM  analysis

TMEM43 ^{+ / +} and TMEM43 ^{+ / tm1Cby at} 2, 7 and 13 months of age Cochleae were isolated from mice and in 2% paraformaldehyde solution diluted in 0.1 M sodium cacodylate buffer (pH 7.4) containing 2.5% glutaraldehyde. , And fixed at room temperature for 1 hour. Bony capsules were dissected and the lateral wall, Reissner's membrane and the protective membrane removed. The corti organ is excised and in solution containing 0.1 M sodium cacodylate buffer (pH 7.4), 2 mM calcium chloride, 2.5% glutaraldehyde and 3.5% sucrose, at 4 ° C. Fixed overnight. After the tissues were fixed, tissue samples were prepared using an osmium tetroxide-thiocarbohydrazide method and observed by scanning electron microscopy. Subsequently, the tissue sample was dehydrated in an ethanol solution having a concentration gradient, dried and platinum coated using a sputter coater (E1030; Hitachi, Tokyo, Japan). The surface of the Corti organ was captured with a cold-field emission scanning microscope (SU8220, Hitachi, Tokyo, Japan) operating at 10 or 15 kV. Microscopic images were obtained using ImageJ software (National Institutes of Health, http://rsbweb.nih.gov/ij/).

6 shows TMEM43 ^{+ / +} and TMEM43 ^{+ / tm1Cby} at 2, 7, and 13 months of age. Scanning transcription microscopy images showing inner border cells and border cells in the retinal lamina of mouse hair cells. Here, green and light green represent inner border cells, and orange and yellow represent border cells, respectively. As shown in FIG. 6, TMEM43 ^{+ / tm1Cby} It can be seen that the area of the inner border cells and border cells of the mouse is reduced compared to the area of the border cells and border cells of the wild-type mouse. As the inner border cells and border cells shrink and decrease, it is expected that auditory nerve translocation is suppressed.

(4.3) Of TMEM43  p. R372X  Transgenic Mice with Mutations ABR  analysis

ABR was performed in an anechoic room. Mice were dosed with levomepromazin chlorhydrate (0.1 mg), and about 3.5 mg of ketamine chlorhydrate (15 mg) was anesthetized by intraperitoneal injection. The ABR collected and analyzed the response to a short tone burst calibrated in the range of 4 to 32 kHz. Electroencephalograms were recorded via stainless steel electrodes subcutaneously in the vertex and ipsilateral mastoids using a standard digital averaging system. At all sound levels, 500 responses to tone bursts were synchronous averaging. ABRs above the threshold consisted of regular intervals of waves (I to IV). The tone burst level varied from 10 dB to 120 dB SPL peak-equivalent, while the ABR threshold was obtained with the minimum stimulus level required to produce at least one repeatable wave IV 40.3 mV. 7 shows mean ABR thresholds for 4, 8, 16, and 32 kHz in TMEM43 ^{+ / +} and TMEM43 ^{+ / tm1Cby} mice at 6 and 9 months of age. As shown in FIG. 7, TMEM43 ^{+ / tm1Cby} Mice can be seen that the ABR threshold is higher than the wild-type ABR threshold.

<110> SEOUL NATIONAL UNIVERSITY HOSPITAL <120> Marker TMEM43 for diagnosing sensorineural hearing loss and uses          about <130> PN117550 <160> 13 <170> KopatentIn 2.0 <210> 1 <211> 400 <212> PRT <213> homo sapiens <400> 1 Met Ala Ala Asn Tyr Ser Ser Thr Ser Thr Arg Arg Glu His Val Lys   1 5 10 15 Val Lys Thr Ser Ser Gln Pro Gly Phe Leu Glu Arg Leu Ser Glu Thr              20 25 30 Ser Gly Gly Met Phe Val Gly Leu Met Ala Phe Leu Leu Ser Phe Tyr          35 40 45 Leu Ile Phe Thr Asn Glu Gly Arg Ala Leu Lys Thr Ala Thr Ser Leu      50 55 60 Ala Glu Gly Leu Ser Leu Val Val Ser Pro Asp Ser Ile His Ser Val  65 70 75 80 Ala Pro Glu Asn Glu Gly Arg Leu Val His Ile Ile Gly Ala Leu Arg                  85 90 95 Thr Ser Lys Leu Leu Ser Asp Pro Asn Tyr Gly Val His Leu Pro Ala             100 105 110 Val Lys Leu Arg Arg His Val Glu Met Tyr Gln Trp Val Glu Thr Glu         115 120 125 Glu Ser Arg Glu Tyr Thr Glu Asp Gly Gln Val Lys Lys Glu Thr Arg     130 135 140 Tyr Ser Tyr Asn Thr Glu Trp Arg Ser Glu Ile Ile Asn Ser Lys Asn 145 150 155 160 Phe Asp Arg Glu Ile Gly His Lys Asn Pro Ser Ala Met Ala Val Glu                 165 170 175 Ser Phe Met Ala Thr Ala Pro Phe Val Gln Ile Gly Arg Phe Phe Leu             180 185 190 Ser Ser Gly Leu Ile Asp Lys Val Asp Asn Phe Lys Ser Leu Ser Leu         195 200 205 Ser Lys Leu Glu Asp Pro His Val Asp Ile Ile Arg Arg Gly Asp Phe     210 215 220 Phe Tyr His Ser Glu Asn Pro Lys Tyr Pro Glu Val Gly Asp Leu Arg 225 230 235 240 Val Ser Phe Ser Tyr Ala Gly Leu Ser Gly Asp Asp Pro Asp Leu Gly                 245 250 255 Pro Ala His Val Val Thr Val Ile Ala Arg Gln Arg Gly Asp Gln Leu             260 265 270 Val Pro Phe Ser Thr Lys Ser Gly Asp Thr Leu Leu Leu Leu His His         275 280 285 Gly Asp Phe Ser Ala Glu Glu Val Phe His Arg Glu Leu Arg Ser Asn     290 295 300 Ser Met Lys Thr Trp Gly Leu Arg Ala Ala Gly Trp Met Ala Met Phe 305 310 315 320 Met Gly Leu Asn Leu Met Thr Arg Ile Leu Tyr Thr Leu Val Asp Trp                 325 330 335 Phe Pro Val Phe Arg Asp Leu Val Asn Ile Gly Leu Lys Ala Phe Ala             340 345 350 Phe Cys Val Ala Thr Ser Leu Thr Leu Leu Thr Val Ala Ala Gly Trp         355 360 365 Leu Phe Tyr Arg Pro Leu Trp Ala Leu Leu Ile Ala Gly Leu Ala Leu     370 375 380 Val Pro Ile Leu Val Ala Arg Thr Arg Val Pro Ala Lys Lys Leu Glu 385 390 395 400 <210> 2 <211> 1203 <212> DNA <213> homo sapiens <400> 2 atggccgcga attattccag taccagtacc cggagagaac atgtcaaagt taaaaccagc 60 tcccagccag gcttcctgga acggctgagc gagacctcgg gtgggatgtt tgtggggctc 120 atggccttcc tgctctcctt ctacctaatt ttcaccaatg agggccgcgc attgaagacg 180 gcaacctcat tggctgaggg gctctcgctt gtggtgtctc ccgacagcat ccacagtgtg 240 gctccggaga atgaaggaag gctggtgcac atcattggcg ccttacggac atccaagctt 300 ttgtctgatc caaactatgg ggtccatctt ccggctgtga aactgcggag gcacgtggag 360 atgtaccaat gggtagaaac tgaggagtcc agggagtaca ccgaggatgg gcaggtgaag 420 aaggagacga ggtattccta caacactgaa tggaggtcag aaatcatcaa cagcaaaaac 480 ttcgaccgag agattggcca caaaaacccc agtgccatgg cagtggagtc attcatggca 540 acagccccct ttgtccaaat tggcaggttt ttcctctcgt caggcctcat cgacaaagtc 600 gacaacttca agtccctgag cctatccaag ctggaggacc ctcatgtgga catcattcgc 660 cgtggagact ttttctacca cagcgaaaat cccaagtatc cagaggtggg agacttgcgt 720 gtctcctttt cctatgctgg actgagcggc gatgaccctg acctgggccc agctcacgtg 780 gtcactgtga ttgcccggca gcggggtgac cagctagtcc cattctccac caagtctggg 840 gataccttac tgctcctgca ccacggggac ttctcagcag aggaggtgtt tcatagagaa 900 ctaaggagca actccatgaa gacctggggc ctgcgggcag ctggctggat ggccatgttc 960 atgggcctca accttatgac acggatcctc tacaccttgg tggactggtt tcctgttttc 1020 cgagacctgg tcaacattgg cctgaaagcc tttgccttct gtgtggccac ctcgctgacc 1080 ctgctgaccg tggcggctgg ctggctcttc taccgacccc tgtgggccct cctcattgcc 1140 ggcctggccc ttgtgcccat ccttgttgct cggacacggg tgccagccaa aaagttggag 1200 tga 1203 <210> 3 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> TMEM43 F-primer <400> 3 cttcctggaa cggctgag 18 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TMEM43 R-primer <400> 4 caccagcctt ccttcattct 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Gapdh F-primer <400> 5 accacagtcc atgccatcac 20 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Gapdh R-primer <400> 6 caccaccctg ttgctgtagc c 21 <210> 7 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> partial TMEM43 <400> 7 Ser Arg Lys Glu His Val Lys Val Thr Ser Glu   1 5 10 <210> 8 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> guide RNA1 <400> 8 uuagagcagc ccacagcggu cgg 23 <210> 9 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> guide RNA2 <400> 9 ccgauuagag cagcccacag cgg 23 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> F-primer for detecting the presence of the knock-in allele <400> 10 ccacagtgga ctggtttcct 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> R-primer for detecting the presence of the knock-in allele <400> 11 ggcttcactc cagctttttg 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> target of gRNA1 <400> 12 accgctgtgg gctgctctaa 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> target of gRNA2 <400> 13 ctgtgggctg ctctaatcgg 20

Claims (21)

A polynucleotide comprising a contiguous nucleotide sequence selected from the nucleotide sequence of the exon region of the TMEM43 gene or a complement thereof to detect a TMEM43 mutation of p.R372X in the amino acid sequence of SEQ ID NO: 1, or c.C1114T in the nucleotide sequence of SEQ ID NO: 2 A composition for diagnosing sensorineural hearing loss comprising red polynucleotides. The diagnostic composition of claim 1, wherein the mutation comprises a variation of the nucleotide sequence with respect to standard genomic DNA. The diagnostic composition of claim 2, wherein the variation in nucleotide sequence comprises substitution of one or more nucleotide sequences with respect to standard genomic DNA. delete The diagnostic composition of claim 1, wherein the polynucleotide is 10 to 100 nucleotides in length. The diagnostic composition of claim 1, wherein the sensorineural hearing loss disease is auditory neuropathy. Identifying the nucleotide sequence of genomic DNA isolated from the individual; And
Comparing the identified nucleotide sequence of the genomic DNA with a standard nucleotide sequence to identify a mutation in the genomic DNA, wherein the mutation is c.C1114T in the nucleotide sequence of SEQ ID NO: 2 for the diagnosis of sensorineural hearing loss disease A method for detecting mutations in genomic DNA to provide information. 8. The method of claim 7, wherein the mutation of the genomic DNA comprises a change of nucleotide sequence relative to standard genomic DNA. The method of claim 8, wherein the variation in nucleotide sequence comprises substitution of one or more nucleotide sequences with respect to standard genomic DNA. delete A polynucleotide comprising a contiguous nucleotide sequence selected from the nucleotide sequence of the exon region of the TMEM43 gene or a complement thereof to detect a TMEM43 mutation of p.R372X in the amino acid sequence of SEQ ID NO: 1, or c.C1114T in the nucleotide sequence of SEQ ID NO: 2 A composition for predicting prognosis for cochlear implant surgery in patients with sensorineural hearing loss comprising red polynucleotides. The diagnostic composition of claim 11, wherein the mutation comprises a change in nucleotide sequence relative to standard genomic DNA. The diagnostic composition of claim 12, wherein the variation in nucleotide sequence comprises substitution of one or more nucleotide sequences with respect to standard genomic DNA. delete The diagnostic composition of claim 11, wherein the polynucleotide is 10 to 100 nucleotides in length. The diagnostic composition of claim 11, wherein the sensorineural hearing loss disease is auditory neuropathy. Identifying the nucleotide sequence of genomic DNA isolated from the individual; And
Comparing the identified nucleotide sequence of the genomic DNA to a standard nucleotide sequence to identify a mutation of the genomic DNA, wherein the mutation is c. C1114T in the nucleotide sequence of SEQ ID NO: 2, wow of a sensorineural hearing loss patient A method of detecting mutations in genomic DNA to provide information for predicting prognosis for transplant surgery. The method of claim 17, wherein the variation of the genomic DNA comprises a variation of the nucleotide sequence relative to standard genomic DNA. The method of claim 18, wherein the variation in nucleotide sequence comprises substitution of one or more nucleotide sequences with respect to standard genomic DNA. delete A sensory neurological hearing loss disease non-human animal model comprising a TMEM43 mutation of p.R372X in the amino acid sequence of SEQ ID NO: 1 or c.C1114T in the nucleotide sequence of SEQ ID NO: 2.

Images