KR102013798B1 - Method for producing aging model and aging model of cell or animal produced thereby - Google Patents

Abstract

The present application relates to a vector for producing a cell aging model, a method for producing a cell aging model using the same, a cell aging model produced thereby, and a composition for producing a cell aging model comprising the same. The present application also relates to a method for producing an animal aging model and a composition for producing an animal aging model.

Description

METHOD FOR PRODUCING AGING MODEL AND AGING MODEL OF CELL OR ANIMAL PRODUCED THEREBY}

The present application relates to a vector for producing a cell aging model, a method for producing a cell aging model using the same, a cell aging model produced thereby, and a composition for producing a cell aging model comprising the same. The present application also relates to a method for producing an animal aging model and a composition for producing an animal aging model.

Aging of cells involves changes in pathophysiological cell structure and gene expression. Accordingly, various aging models using specific genes and microRNAs associated with aging have been developed, but there is a limit in representing the integrative changes of complex aging. Sustained division and growth of cells leads to a shortening of the telomeres length, a structure at the end of the genome, and this phenomenon has been reported to be associated with disruption of genomic safety and aging. Such telomeres are maintained in length by an enzyme called telomerase, but telomeres may be shortened during enzymatic inhibition or excessive cleavage and aging during pathological conditions. Attempts have been made to establish cellular and animal aging models by inducing shortening of telomeres and have been utilized in various aging studies. Commonly used methods include the use of telomerase inhibitors or cell lines or mice lacking the genes to artificially shorten the length of telomerase, and induce senescence and molecular mechanism studies using these methods. Has been actively performed. However, in the case of repetitive cell culture or experiments using mice, telomeres can be shortened only by inducing cell division through repetitive crosses, so long-term passage and cross-linking act as a major limitation of aging studies. It was. In particular, since neurons do not divide, telomerase enzyme inhibition alone does not induce telomeres shortening, and thus there is a limitation that aging studies using the above method are impossible.

Republic of Korea Patent Publication No. 10-2015-0016588

The number of patients with Alzheimer's dementia and Parkinson's disease, a representative neurodegenerative senile disease, is increasing rapidly in the modern age, but there is no effective treatment due to the lack of identification of the cause of neuronal cell death of several degenerative diseases closely related to aging. Therefore, in order to understand various senile diseases including neurodegenerative diseases and to find appropriate treatment targets, it is necessary to understand the molecular mechanism of aging.

Therefore, in the present application, to overcome the limitations of the aging model targeting the existing telomerase enzyme, to provide a novel aging model manufacturing method including the instant telomeres cleavage using the CRISPR-Cas9 tool. In addition, by using this method to provide an aging model of cells that do not divide as well as dividing cells to study the molecular mechanism of aging and aging linked human diseases.

However, the problem to be solved by the present application is not limited to the above-mentioned problem, another task not mentioned will be clearly understood by those skilled in the art from the following description.

A first aspect of the present disclosure is directed to a DNA sequence encoding a guide RNA (sgRNA) specific for a telomere sequence; DNA sequence encoding Cas9; And one or more promoters operably linked to the DNA sequences.

A second aspect of the present application relates to a cell aging model into which a vector for preparing an aging model according to the first aspect of the present invention is introduced.

A third aspect of the present application relates to a method for producing a cell aging model comprising introducing into an eukaryotic cell an aging model preparation vector according to the first aspect of the present application.

A fourth aspect of the present application relates to a composition for preparing a cell aging model comprising a vector for preparing an aging model according to the first aspect of the present application.

A fifth aspect of the present invention relates to a method for preparing an animal aging model comprising injecting a guide RNA (sgRNA) and Cas9 specific for a telomere sequence into neural tissue of an animal other than a human.

A sixth aspect of the present invention relates to a composition for preparing an animal aging model comprising guide RNA (sgRNA) and Cas9 specific for a telomere sequence.

A seventh aspect of the present application relates to a neurodegenerative disease model into which a vector according to the first aspect of the present invention has been introduced.

The above-mentioned means for solving the problems are merely exemplary, and should not be construed to limit the present invention. In addition to the exemplary embodiments described above, there may be additional embodiments and embodiments described in the drawings and detailed description of the invention.

According to the present invention, CRISPR-Cas9 genome editing technology can be applied to construct an efficient aging model system by cutting the telomeres, and the telomeres cutting technology utilizing CRISPR-Cas9 is applied to the production of senescent cells and animal models. Molecular mechanisms and new targets for neurodegenerative diseases can be used.

In addition, by applying the system of the present invention to conventionally developed cell and animal disease models, it is possible to amplify the lesion phenotype, which is expected to revolutionize the pipeline for verifying new therapeutic agents.

1 is a result of real-time PCR (FIG. 1A) and Southern blot (FIG. 1B) showing telomeres shortening by CRISPR-Cas9 according to an embodiment of the present disclosure.
FIG. 2 shows the results of cell growth analysis (FIG. 2A) and colony formation (FIG. 2B) showing cytotoxicity due to telomere shortening by CRISPR-Cas9 according to an embodiment of the present disclosure.
Figure 3 is a mitochondrial membrane potential analysis (Fig. 3a), oxygen consumption measurement (Fig. 3b and 3c) and cell survival analysis (Fig. 3d) results showing mitochondrial abnormalities due to telomere shortening by CRISPR-Cas9 according to an embodiment of the present application .
4 is a Western blot analysis (FIG. 4A) and a quantitative graph thereof (FIG. 4B) showing protein expression abnormalities by telomeres shortening by CRISPR-Cas9 according to an embodiment of the present disclosure.
FIG. 5 is a Western blot analysis (FIG. 5A) and a quantitative graph thereof (FIG. 5B) showing the promotion of α-synuclein aggregate formation in a CRISPR-Cas9 cell aging model according to one embodiment herein.

DETAILED DESCRIPTION Hereinafter, exemplary embodiments of the present disclosure will be described in detail with reference to the accompanying drawings so that those skilled in the art may easily implement the present disclosure. As those skilled in the art would realize, the described embodiments may be modified in various different ways, all without departing from the spirit or scope of the present invention. In the drawings, parts irrelevant to the description are omitted in order to clearly describe the present application.

Throughout this specification, when a part is said to "include" a certain component, it means that it can further include other components, without excluding the other components unless specifically stated otherwise.

As used throughout this specification, the terms "about", "substantially" and the like are used at, or in the sense of, numerical values when a manufacturing and material tolerance inherent in the stated meanings is indicated, Accurate or absolute figures are used to assist in the prevention of unfair use by unscrupulous infringers. As used throughout this specification, the term "step to" or "step of" does not mean "step for."

Throughout this specification, the term "combination of these" included in the expression of the makushi form means one or more mixtures or combinations selected from the group consisting of constituents described in the expression of the makushi form, wherein the constituents It means to include one or more selected from the group consisting of.

Throughout this specification, description of "A and / or B" means "A, B, or A and B."

The term “operably linked” means that one nucleic acid fragment is combined with another nucleic acid fragment so that its function or expression is affected by the other nucleic acid fragment.

The term “guide RNA” generally refers to an RNA molecule (or collectively a group of RNA molecules) that can bind to a Cas protein and can help target the Cas protein to a specific location within a target polynucleotide (eg, DNA). May be referred to. The guide RNA may comprise a crRNA segment and a tracrRNA segment. As used herein, the term "crRNA" or "crRNA segment" refers to an RNA molecule or portion thereof that comprises a polynucleotide-targeting guide sequence, a stem sequence, and optionally a 5'-overhang sequence. As used herein, the term "tracrRNA" or "tracrRNA segment" includes protein-binding segments (eg, the protein-binding segments may interact with a crisper-linked protein, eg Cas9). Refers to an RNA molecule or a portion thereof. The term "guide RNA" includes a single guide RNA (sgRNA), wherein the crRNA segment and the tracrRNA segment are located in the same RNA molecule. The term "guide RNA" also collectively includes a group of two or more RNA molecules, wherein the crRNA and the tracrRNA segments are located in separate RNA molecules.

The term "nucleic acid", "polynucleotide" or "oligonucleotide" refers to a DNA molecule, an RNA molecule or an analog thereof. As used herein, the terms "nucleic acid", "polynucleotide" and "oligonucleotide" include, but are not limited to, DNA molecules such as cDNA, genomic DNA or synthetic DNA and RNA molecules such as guide RNA, messenger RNA or Synthetic RNA. Moreover, the terms "nucleic acid" and "polynucleotide" as used herein include single-stranded and double-stranded forms.

In addition, intracellular delivery of proteins, RNA, or DNA (including vectors) herein includes electroporation, liposomes, viral vectors, nanoparticles, protein translocation domain (PTD) fusion protein methods, and the like. Various methods known in the art can be carried out using without limitation.

Hereinafter, embodiments and examples of the cell aging model manufacturing vector of the present application, a cell aging model prepared using the same, a cell aging model manufacturing method using the same, a composition for producing a cell aging model, a method for producing an animal aging model and a composition for preparing an animal aging model It will be described in detail with reference to the drawings. However, the present application is not limited to these embodiments, examples and drawings.

A first aspect of the present disclosure is directed to a DNA sequence encoding a guide RNA (sgRNA) specific for a telomere sequence; DNA sequence encoding Cas9; And one or more promoters operably linked to the DNA sequences.

Since the cell aging model by the conventional telomere shortening requires considerable cell incubation time, there are limitations in the research in terms of economic potential and disturbance of the signal transmission system that is unexpected in the process. Using the CRISPR-Cas9 cell aging model according to the present invention, the telomer shortening and aging phenotype is induced within 1 to 2 days, and thus, there is an advantage of enabling rapid and effective aging studies.

For example, a promoter operably linked to the DNA sequence encoding the guide RNA and a promoter operably linked to the DNA sequence encoding Cas9 may be one promoter, but two or more promoters separately linked to each DNA sequence. It may be.

For example, the promoter may be selected and used without limitation from promoters operating in cells known in the art, and promoters that selectively operate at specific stages of development, at specific times, at certain conditions, and at specific sites may be used. This may not be limited.

According to an embodiment of the present disclosure, the telomeres sequence may be a telomeres sequence of human, mouse, rat, rabbit, fruit fly, pig, or monkey, but may not be limited thereto, and according to the purpose of preparing an aging model, telomeres sequence Those skilled in the art can select from eukaryotic cells, plants or animals with no limitation.

According to one embodiment of the present application, the telomeres sequence may include a nucleic acid sequence represented by SEQ ID NO: 1, but may not be limited thereto.

According to one embodiment of the present application, the vector may be viral vector based, for example, may be based on lentiviral vector, but may not be limited thereto.

In the case of using lentiviral vectors, infection of various cell lines including neurons is particularly easy, and stable expression of sgRNA and Cas9 and integration of telomeres within a few days after integration into chromosomes are possible. In addition, the lentiviral vector, together with the AAV virus, can be efficiently used for the production of an aging model through steric stereotype injection into mouse tissue.

According to one embodiment of the present application, the cell aging model preparation vector may include a nucleic acid sequence represented by SEQ ID NO: 2, but may not be limited thereto.

The second aspect of the present application can provide a cell aging model into which a vector for preparing an aging model according to the first aspect of the present invention is introduced.

For example, when the cell aging model is a stem cell, it is possible to prepare an animal aging model using the same, but may not be limited thereto.

According to the exemplary embodiment of the present disclosure, the cell may be a neuron, but may not be limited thereto, and the cell aging model may be introduced by introducing the vector for preparing the aging model into a cell that does not divide or hardly divide in addition to the neuron. It can manufacture.

According to one embodiment of the present application, the neurons may be neurons of humans, mice, rats, rabbits, fruit flies, pigs or monkeys, but may not be limited thereto.

The third aspect of the present application can provide a method for producing a cell aging model comprising introducing into a eukaryotic cell a vector for preparing an aging model according to the first aspect of the present application.

Introducing the vector into eukaryotic cells includes the use of electroporation, liposomes, viral vectors, nanoparticles, protein translocation domain (PTD) fusion protein methods, commercially available reagents, and the like. Various methods known in the art can be performed using without limitation.

According to one embodiment of the present application, the eukaryotic cells may be neurons, but may not be limited thereto.

According to one embodiment of the present application, the neurons may be neurons of humans, mice, rats, rabbits, fruit flies, pigs or monkeys, but may not be limited thereto.

The fourth aspect of the present application can provide a composition for preparing a cell aging model, comprising a vector for producing an aging model according to the first aspect of the present application.

The fifth aspect of the present disclosure can provide a method for preparing an animal aging model comprising injecting guide RNAs (sgRNAs) and Cas9 specific for a telomere sequence into neural tissue of an animal other than a human. The injection may be performed by injection or surgical operation, but may not be limited thereto.

According to one embodiment of the present application, the neural tissue may include a brain, but may not be limited thereto, and may be injected into a central nerve or a peripheral nerve.

According to the present invention, by injecting the Cas9 and telomeres guide RNA into the animal brain, it is possible to induce in vivo aging even for neuronal cells that no longer divide. In other words, senescence-linked lesion phenotype studies that need to be carried out over several decades in existing degenerative brain disease animal models can be performed quickly.

According to one embodiment of the present application, the animal may be a mouse, rat, rabbit, fruit fly, pig, or monkey, but may not be limited thereto.

A sixth aspect of the present disclosure may provide a composition for preparing an animal aging model comprising guide RNA (sgRNA) and Cas9 specific for a telomere sequence. For example, the composition for preparing an animal aging model may further include a biocompatible excipient widely used in the art, which does not cause toxicity, shock, or side effects when injected into an animal neural tissue, but may not be limited thereto. have.

A seventh aspect of the present disclosure can provide a neurodegenerative disease model in which a vector according to the first aspect of the present invention has been introduced.

According to one embodiment of the present application, the neurodegenerative disease may be Parkinson's disease, but may not be limited thereto.

Parkinson's disease is one of the representative neurodegenerative diseases and is closely related to aging of cells. In addition to Parkinson's disease, skin aging, Huntington's disease, stroke, degenerative joint disease, Alzheimer's, senile plaque, osteoporosis, alopecia, multiple sclerosis, vitiligo, atherosclerosis, coronary artery disease, angina pectoris, liver cirrhosis, prostatic hyperplasia, chronic kidney disease, emphysema and diabetes The back is known to be a disease associated with aging of cells.

Since neurodegenerative diseases are known to be closely related to aging of neurons, in particular, neuronal aging models are expected to be useful as models of neurodegenerative diseases such as senile diseases, particularly Parkinson's disease.

Hereinafter, the present invention will be described in more detail with reference to the following examples, but the following examples are for illustrative purposes only and are not intended to limit the scope of the present application.

EXAMPLE

Experiment method

1. Cell Culture and Transfection

Human neuroblastoma cell line SH-SY5Y was incubated at 5% CO ₂ , 95% humidity and 37 ° C. using DMEM containing 10% FBS and 1% antibiotics (penicillin / streptomycin). After mixing the DNA plasmids of each group with Opti-MEM, the transfection reagent, X-tremeGENE, was added and waited at room temperature for 15 to 30 minutes, and then dropped into SH-SY5Y cells and shaken to introduce DNA into the cells.

2. Real time PCR  Telomere Quantification Using

1) Genomic DNA Extraction

The transfected SH-SY5Y cell surface was washed once with 1X PBS, then collected in Eppendorf tubes (E tubes) and centrifuged for 5 minutes at a speed of 2,000 rpm. After 5 minutes, the supernatant was removed and only cell pellets were left. 5 μl of Proteinase K (20 ng / ml) per 500 μl of cell lysis buffer (pH 7.4-Tris 0.1 M, NaCl 0.2 M, EDTA 5 Mm, 0.4% SDS) was added thereto to prepare a mixed solution, and the mixed solution 500 was added to the pellet. Was added and vortexed. Proteinase K was then inactivated by incubation for 2 hours at 55 ° C. heat-block. After 2 hours, 500 μl of phenol: chloroform: isoamyl alcohol = 25: 24: 1 (PCI) was added to each E tube and vortexed. It was then centrifuged for 5 minutes at a speed of 14000 rpm and only 300 μl in the DNA layer was transferred to a new E tube. 30 μl of sodium acetate (3 M), 1/10 of the amount of DNA, was added to 300 μl DNA, and 210 μl of isopropanol, 7/10 of the amount of DNA, was added to the gastric mixture. After centrifugation for 30 minutes at 4 ℃ conditions at a speed of 14,000 rpm, the supernatant was removed, and 500 μl of 70% ethanol per tube was immediately centrifuged for 5 minutes at 14,000 rpm speed. After removing the supernatant, ethanol was dried for 10 minutes, 50 μl of pure distilled water was added, and elution was performed to obtain genomic DNA (gDNA).

2) RT-PCR

The telomeres “Telomere” primer, SYBR green PCR master mix, and the purified gDNA were mixed and placed in a real-time PCR machine (QuantStudio 6 flex Real-Time PCR System, Applied Biosystems) to measure the amount of telomeres. Then, the mixture was normalized to the measured value by mixing with DNA, “36B4u” primer, and SYBR green PCR master mix. The sequence of the primer used is as follows.

Telomere-F: GGTTTTTGAGGGTGAGGGTGAGGGTGAGGGTGAGGGT (SEQ ID NO: 6)

Telomere-R: TCCCGACTATCCCTATCCCTATCCCTATCCCTATCCCTA (SEQ ID NO: 7)

36B4u-F: CAGCAAGTGGGAAGGTGTAATCC (SEQ ID NO: 8)

36B4u-R: CCCATTCTATCATCAACGGGTACAA (SEQ ID NO: 9)

3. Telomere Analysis

After transfecting SH-SY5Y cells with mock vector and telomer gRNA, 72 hours later, genomic DNA was extracted, digested with Hinf1 and Rsa1 restriction enzymes for 40 minutes at 37 ° C, and DNA fragments were subjected to electrophoresis. Was transferred to a nylon membrane to measure the length of the telomere repeat with a digoxigenin-labeled probe.

4. JC -1 Mitochondrial Function Analysis

SH-SY5Y cells were transfected with empty vectors and telomeres gRNAs, then 24 hours later, cells were transferred to 96 well plates and 48 hours later JC-1 analysis was performed. 50 μl of the culture medium and 1 μl of the JC1 staining solution were mixed to prepare a number of wells. 50 μl of the existing medium was removed from the 96 well plate, 50 μl of the JC1 staining solution was added thereto, and then incubated at 37 ° C. for 15 minutes. After 15 minutes, the medium was aspirated and removed, and then 100 μl of JC-1 assay buffer was added and measured by spectrophotometer.

5. Trypan Blue  Cell Survival and Growth Analysis

 1) Cell Viability Assay

SH-SY5Y cells were transfected with empty vectors and telomeres gRNAs, and after 72 hours all were collected in E tubes and centrifuged for 5 minutes at a rate of 300 g. After 5 minutes, the supernatant was removed, PBS was added thereto, washed once, and centrifuged for 5 minutes at a speed of 300 G again. After 5 minutes, the supernatant was removed, and 500 µl of PBS was added to each tube to free the cell pellet. 100 μl of Trypan Blue was added to a new tube, followed by mixing with 100 μl of PBS freed of cell pellet. After standing at room temperature for 2 minutes, 10 μl of the mixed solution was added to the cell count slide, and cell viability (%) was measured using a Countess II Automated Cell Counter (Life Technologies) machine.

 2) Cell Growth Analysis

After transfecting the SH-SY5Y cells with the empty vector and the telomere gRNA, the total number of cells was measured for 4 days by an experimental method such as cell survival analysis.

6. Weston Blot  analysis

After washing the cells in the 6-well plate once with PBS, 500 μl of lysis buffer (1% Nonidet P40 in PBS, pH 7.4) was added per well, collected in an E tube, and lysed for 30 minutes on ice. Thereafter vortexing every 5 minutes for 30 minutes. After 30 minutes, the process of rapid freezing using dry ice and dissolving in ice water was repeated twice. After melting, it was placed in a 4 ℃ centrifuge and centrifuged for 15 minutes at a speed of 13,000 g. After 15 minutes the supernatant (protein) was transferred to a new E tube. The purified protein was mixed 1: 1 with 2 × laemmli buffer (Bio-Rad) (+ beta-mercaptoethanol) and then boiled at 95 ° C. for 5 minutes. Prepared samples were separated according to protein size using an SDS-PAGE gel (100 V, 1 hour 30 minutes). SDS-PAGE gel containing the separated protein was transferred to nitrocellulose membrane (100 V, 1 hour 30 minutes). The membrane to which the protein was transferred was blocked with 5% skim milk for 1 hour. After 1 hour skim milk was removed, the primary antibody (1: 5,000) was added and placed in a 4 ° C shaker for 16 hours. After 16 hours, the primary antibody was removed and then the secondary antibody was added to 5% skim milk in a ratio of 1: 1000 and placed on a nitrocellulose membrane (room temperature, 2 hours). After 2 hours, the secondary antibody was removed, ECL solution (SuperSignal ™ West Pico Chemiluminescent Substrate, Thermo) was added, and protein bands were identified using an X-ray film in the dark.

7. LentiCRISPR - sgRNA Telomere Cloning

The sgTelomere oligomer sequence used in this example is as follows.

F: CACCGTAGGGTTAGGGTTAGGGTTA (SEQ ID NO: 3)

R: AAACTAACCCTAACCCTAACCCTAC (SEQ ID NO: 4)

Alternatively, however, the following oligomer sequences may be used.

F: CACCGTTAGGGTTAGGGTTAGGGTT (SEQ ID NO: 10)

R: AAACAACCCTAACCCTAACCCTAAC (SEQ ID NO: 11)

Each oligomeric pair shown in SEQ ID NOs: 3 and 4 was annealed (1 μl Oligo1 (Forward) (100 μM) + 1 μl Oligo2 (Reverse) (100 μM) + 1 Ul 10X T4 Ligation Buffer + 7 μl distilled water = total 10 Μl, conditions: 95 ° C. 5 min, then reduced to 25 ° C. at a rate of 5 ° C./min)

Dilute the annealed oligomer to pure DW at 1/200, mix 50 μg of the cleavage vector (Lenti CRISPR-V2) + 1 μl of oligomer (1/200) with 10 × T4 ligation buffer, T4 ligase, DW at 16 ° C. Ligation was incubated for 16 hours. The complete sequence of LentiCRISPR V2 is shown in SEQ ID NO: 2. 1 μl of the ligation result was added to 15 μl of Stbl3, mixed gently, and placed on ice for 30 minutes to transform. Thermal shock was applied using a 42 ° C. heat block for 30 seconds and then placed on ice for 5 minutes. 200 μl of SOC medium was added and recovered for 1 hour in a 37 ° C shaker. Plated on pre-warmed agar plates, the next day colonies were identified and incubated in 5 ml medium and sequenced after mini culture miniprep.

Experiment result

One. CRISPR - Cas9  Telomere shortening

lentiCRISPR-Tel-sgRNA was produced and introduced into SH-SY5Y cells to express Cas9 enzyme and telomeres targeting guide RNA (Tel-sgRNA), resulting in a 50% reduction in the amount of telomeres via RTQ-PCR. Confirmed. 1A is a graph showing the results of quantitative determination of the relative amount of telomeres by SH-SY5Y cells expressing lentiCRISPR-control-sgRNA (Cont) and lentiCRISPR-Tel-sgRNA by real-time PCR (n = 3). The amount of telomeres is normalized to the internal loading control for 36B4u.

In addition, Southern blot was performed on the aging model cells expressing the control group and the tel-sgRNA using a probe that recognizes the telomer sequence after DNA extraction. As a result, a significant quantitative decrease of the telomeres was confirmed. FIG. 1B is a telomere length Southern blot analysis using a telomere probe and telomere signal intensity quantitative graphs relative to the total loading DNA amount of the whole genome DNA purified from the control group and the experimental group SH-SY5Y (n = 3).

Through the method of this Example it was confirmed that telomeres can be efficiently cleaved by one transfection without passage of cells.

2. CRISPR - Cas9  Cytotoxicity by shortening of telomeres

In the aging cell model by the expression of lentiCRISPR-Tel-sgRNA, the number of cells at day 1, 2, 3, 4 and 5 was analyzed and it was confirmed that significant cell division was suppressed. 2A shows a growth curve graph of gTel-sgRNA and control expressing SH-SY5Y cells (n = 7 per group).

 In addition, it was confirmed that the colony growth was also inhibited in the colony formation analysis through reduction of colony size. 2B shows colony formation assays for gTel-sgRNA and control expressing SH-SY5Y cells. The distribution of colonies was analyzed by the number of colonies by Coomassie staining and image analysis and the average size of individual colonies (n = 3 per group).

3. CRISPR - Cas9  Induction of Mitochondrial Abnormalities by Telomere Shortening

In the case of the JC-1 compound, red fluorescence is strong when the membrane potential of mitochondria is normal, whereas green fluorescence is relatively strong when the membrane potential is damaged. SH-SY5Y cells induced telomere shortening by CRISPR-Cas9 increased the ratio of the relative green fluorescence of JC-1, indicating that membrane potential damage was induced. FIG. 3A shows the results of analysis and quantification of mitochondrial membrane potentials in gCont and gTel expressing SH-SY5Y cells with relative red / green fluorescence intensities of JC-1 reactive to translocation (n = 7).

Oxygen consumption rate was measured by Seahorse to confirm the function of mitochondria. The basal, maximal and reserve capacities of mitochondria were reduced by telomeres. Figure 3b is a result of measuring the oxygen consumption according to the inhibitors (oligomycin, CCCP, rotenone) treatment for gCont and gTel-expressing SH-SY5Y cells (n = 4 control, 3 experimental groups) quantitative value is the protein quantification of each sample Normalized to value. Figure 3c is a graph showing the calculated values of basal, maximal, reserve and proton leaks from the average OCR of each section from the oxygen consumption graph. In particular, in the case of maximal competence, it was markedly affected (FIGS. 3B and 3C).

This mitochondrial dysfunction in the aging model showed a gradual increase in cell death on days 3, 4 and 5. FIG. 3D shows the cell viability according to the date of gCont and gTel expressing SH-SY5Y cells by trypan blue exclusion assay and shows the results calculated as ratio of viable cells to total cell number (n = 7 per group) .

4. CRISPR - Cas9  Abnormal expression of protein due to telomeres shortening

For senescent cell models by expression of lentiCRISPR-Tel-sgRNA, quantitative changes in major mitochondrial-related and Parkinson's disease-related proteins were confirmed by Western blot using specific antibodies. Telomere cleavage resulted in a significant decrease in PGC-1α and NRF-1, genes that play an important role in mitochondrial angiogenesis and antioxidant cell protective functions. FIG. 4 analyzes protein expression (PGC-1a, PINK1, NRF1, AIMP2) in gCont and gTel expressing SH-SY5Y cells using the indicated specific antibodies and quantifies them but shows the results. 4A Representative western blot images using the indicated antibodies, beta-actin was used as internal loading control. 4B is a bar graph quantifying the band intensities on Western blots of each protein via Image J, followed by quantifying the relative expression levels in gTel transfected samples versus gCont (V2) ( n = 3).

The novel fact was that expression of PINK1, a mitochondrial kinase that previously plays an important role in regulating the expression of PGC-1a and in the homeostatic regulation of mitochondria, is also reduced in novel senescent cell models (FIGS. 4A and 4B). In addition, significant accumulation of AIMP2, reported accumulation in the brain of postmortem PD patients, as a substrate protein of parkin, was observed in the senescent cell model by telomeres cleavage (FIGS. 4A and 4B).

In addition to the significant decrease of PGC-1α and its target gene NRF-1 and its mitochondrial kinase and Parkinson gene PINK1, which have been reported to inhibit protein expression in aging and degenerative brain diseases, Parkin's substrate, a representative recessive PD gene, has been significantly reduced. Accumulation of AIMP2 protein, a protein that has been reported to induce selective and gradual killing of dopamine neurons, has been observed, which suggests that cell aging models through telomeres induce changes in major lesion proteins in Parkinson's disease And it suggests that it can be used as a platform for the study of molecular mechanisms of mitochondrial dysfunction.

5. CRISPR - Cas9  Α- in Cell Aging Models Synuclein Aggregate  Promote formation

In order to confirm the change in the aggregate-forming ability of α-synuclein in the senescent cell model, HA-α-synuclein overexpression plasmid and lentiCRISPR-Tel-sgRNA plasmid were co-expressed and compared with the control group. The distribution in% Triton X soluble and insoluble fractions was analyzed by Western blot. Shortening of telomeres by Tel-sgRNA and Cas9 increased the solubility of α-synuclein and increased the distribution to insoluble fractions. FIG. 5A shows Western blot analysis of the distribution of α-synuclein to 1% Triton-X100 soluble / insoluble fraction by HA-α-synuclein co-expression in gCont and gTel-expressed SH-SY5Y cells, FIG. 5B Is a graph quantifying this.

The main lesion phenotype of Parkinson's disease is the expression of protein aggregate leucine consisting of α-synuclein, which is reported to be induced by oxidative stress and phosphorylation or quantitative increase of α-synuclein. Aging contributes to the formation of aggregates of α-synuclein, but research on its mechanism has been lacking. The CRISPR-Cas9 sgTel model of the present application was found to have increased distribution of the α-synuclein into the insoluble fraction as reported in previous mouse experiments, which suggests that the cell aging model of the present invention can be used to study the molecular mechanism of aggregate formation. It is suggested that it can be used not only as a cell model but also as a screening agent for treatment.

All quantitative data except FIGS. 3B and 3C are expressed as mean +/­ standard error, and FIGS. 3B and 3C graphs are shown as mean +/− standard deviation. Two groups of independent sampled t-tests were used for the significance test between the two groups, and ANOVA was analyzed for the significance comparison of three or more groups, and Tukey's post-analysis was compared between the groups (* P <0.05, ** P <0.01, ***). P <0.001).

The above results suggest that the CRISPR-Cas9 aging model according to the present invention faithfully reflects the characteristics of the major phenotypes of existing representative aging models, such as cell division, mitochondrial abnormality, and cytotoxicity, and can be used as a new aging model. It is.

The above description of the present application is intended for illustration, and it will be understood by those skilled in the art that the present invention may be easily modified in other specific forms without changing the technical spirit or essential features of the present application. Therefore, it should be understood that the embodiments described above are exemplary in all respects and not limiting. For example, each component described as a single type may be implemented in a distributed manner, and similarly, components described as distributed may be implemented in a combined form.

The scope of the present application is indicated by the following claims rather than the above description, and it should be construed that all changes or modifications derived from the meaning and scope of the claims and their equivalents are included in the scope of the present application.

<110> Research and Business Foundation SUNGKYUNKWAN UNIVERSITY <120> METHOD FOR PRODUCING AGING MODEL AND AGING MODEL OF CELL OR          ANIMAL PRODUCED THEREBY <130> 1 <160> 11 <170> KoPatentIn 3.0 <210> 1 <211> 6 <212> DNA <213> Mus musculus <400> 1 ttaggg 6 <210> 2 <211> 14873 <212> DNA <213> Artificial Sequence <220> LentiCRISPR V2 full sequence <400> 2 tgatgcggtt ttggcagtac atcaatgggc gtggatagcg gtttgactca cggggatttc 60 caagtctcca ccccattgac gtcaatggga gtttgttttg gcaccaaaat caacgggact 120 ttccaaaatg tcgtaacaac tccgccccat tgacgcaaat gggcggtagg cgtgtacggt 180 gggaggtcta tataagcagc gcgttttgcc tgtactgggt ctctctggtt agaccagatc 240 tgagcctggg agctctctgg ctaactaggg aacccactgc ttaagcctca ataaagcttg 300 ccttgagtgc ttcaagtagt gtgtgcccgt ctgttgtgtg actctggtaa ctagagatcc 360 ctcagaccct tttagtcagt gtggaaaatc tctagcagtg gcgcccgaac agggacttga 420 aagcgaaagg gaaaccagag gagctctctc gacgcaggac tcggcttgct gaagcgcgca 480 cggcaagagg cgaggggcgg cgactggtga gtacgccaaa aattttgact agcggaggct 540 agaaggagag agatgggtgc gagagcgtca gtattaagcg ggggagaatt agatcgcgat 600 gggaaaaaat tcggttaagg ccagggggaa agaaaaaata taaattaaaa catatagtat 660 gggcaagcag ggagctagaa cgattcgcag ttaatcctgg cctgttagaa acatcagaag 720 gctgtagaca aatactggga cagctacaac catcccttca gacaggatca gaagaactta 780 gatcattata taatacagta gcaaccctct attgtgtgca tcaaaggata gagataaaag 840 acaccaagga agctttagac aagatagagg aagagcaaaa caaaagtaag accaccgcac 900 agcaagcggc cgctgatctt cagacctgga ggaggagata tgagggacaa ttggagaagt 960 gaattatata aatataaagt agtaaaaatt gaaccattag gagtagcacc caccaaggca 1020 aagagaagag tggtgcagag agaaaaaaga gcagtgggaa taggagcttt gttccttggg 1080 ttcttgggag cagcaggaag cactatgggc gcagcgtcaa tgacgctgac ggtacaggcc 1140 agacaattat tgtctggtat agtgcagcag cagaacaatt tgctgagggc tattgaggcg 1200 caacagcatc tgttgcaact cacagtctgg ggcatcaagc agctccaggc aagaatcctg 1260 gctgtggaaa gatacctaaa ggatcaacag ctcctgggga tttggggttg ctctggaaaa 1320 ctcatttgca ccactgctgt gccttggaat gctagttgga gtaataaatc tctggaacag 1380 atttggaatc acacgacctg gatggagtgg gacagagaaa ttaacaatta cacaagctta 1440 atacactcct taattgaaga atcgcaaaac cagcaagaaa agaatgaaca agaattattg 1500 gaattagata aatgggcaag tttgtggaat tggtttaaca taacaaattg gctgtggtat 1560 ataaaattat tcataatgat agtaggaggc ttggtaggtt taagaatagt ttttgctgta 1620 ctttctatag tgaatagagt taggcaggga tattcaccat tatcgtttca gacccacctc 1680 ccaaccccga ggggacccga caggcccgaa ggaatagaag aagaaggtgg agagagagac 1740 agagacagat ccattcgatt agtgaacgga tcggcactgc gtgcgccaat tctgcagaca 1800 aatggcagta ttcatccaca attttaaaag aaaagggggg attggggggt acagtgcagg 1860 ggaaagaata gtagacataa tagcaacaga catacaaact aaagaattac aaaaacaaat 1920 tacaaaaatt caaaattttc gggtttatta cagggacagc agagatccag tttggttaat 1980 taaggtaccg agggcctatt tcccatgatt ccttcatatt tgcatatacg atacaaggct 2040 gttagagaga taattagaat taatttgact gtaaacacaa agatattagt acaaaatacg 2100 tgacgtagaa agtaataatt tcttgggtag tttgcagttt taaaattatg ttttaaaatg 2160 gactatcata tgcttaccgt aacttgaaag tatttcgatt tcttggcttt atatatcttg 2220 tggaaaggac gaaacaccgg agacggttgt aaatgagcac acaaaataca catgctaaaa 2280 tattatattc tatgaccttt ataaaatcaa ccaaaatctt ctttttaata actttagtat 2340 caataattag aatttttatg ttcctttttg caaactttta ataaaaatga gcaaaataaa 2400 aaaacgctag ttttagtaac tcgcgttgtt ttcttcacct ttaataatag ctactccacc 2460 acttgttcct aagcggtcag ctcctgcttc aatcattttt tgagcatctt caaatgttct 2520 aactccacca gctgctttaa ctaaagcatt gtctttaaca actgacttca ttagtttaac 2580 atcttcaaat gttgcacctg attttgaaaa tcctgttgat gttttaacaa attctaatcc 2640 agcttcaaca gctatttcac aagctttcat gatttcttct tttgttaata aacaattttc 2700 cataatacat ttaacaacat gtgatccagc tgcttttttt acagctttca tgtcttctaa 2760 aactaattca taatttttgt cttttaatgc accaatattt aataccatat caatttctgt 2820 tgcaccatct ttaattgctt cagaaacttc gaatgctttt gtagctgttg tgcatgcacc 2880 tagaggaaaa cctacaacat ttgttattcc tacatttgtg ccttttaata attctttaca 2940 atagcttgtt caatatgaat taacacaaac tgttgcaaaa tcaaattcaa ttgcttcatc 3000 acataattgt ttaatttcag ctttcgtagc atcttgtttt aataatgtgt gatctatata 3060 tttgtttagt ttcatttttt ctcctatata ttcattttta attttaattc tttaataatt 3120 tcgtctactt taactttagc gttttgaaca gattcaccaa cacctataaa ataaattttt 3180 agtttaggtt cagttccact tgggcgaaca gcaaatcatg acttatcttc taaataaaat 3240 tttagtaagt cttgtcctgg catattatac attccatcga tgtagtcttc aacattaaca 3300 actttaagtc cagcaatttg agttaagggt gttgctctca atgatttcat taatggttca 3360 atttttaatt tcttttcttc tggtttaaaa ttcaagttta aagtgaaagt gtaatatgca 3420 cccatttctt taaataaatc ttctaaatag tctactaatg ttttattttg ttttttataa 3480 aatcaagcag cctctgctat taatatagaa gcttgtattc catctttatc tctagctgag 3540 tcatcaatta catatccata actttcttca taagcaaaaa caaaatttaa tccgttatct 3600 tcttctttag caatttctct acccattcat ttaaatccag ttaaagtttt tacaatatta 3660 actccatatt tttcatgagc gattctatca cccaaatcac ttgttacaaa acttgaatat 3720 agagccggat tttttggaat gctatttaag cgttttagat ttgataattt tcaatcaatt 3780 aaaattggtc ctgtttgatt tccatctaat cttacaaaat gaccatcatg ttttattgcc 3840 attccaaatc tgtcagcatc tgggtcattc ataataataa tatctgcatc atgtttaata 3900 ccatattcaa gcggtatttt tcatgcagga tcaaattctg gatttggatt tacaacattt 3960 ttaaatgttt catcttcaaa tgcatgctct tcaacctcaa taacgttata tcctgattca 4020 cgtaatattt ttggggtaaa tttagttcct gttccattaa ctgcgctaaa aataattttt 4080 aaatcttttt tagcttcttg ctcttttttg tacgtctctg ttttagagct agaaatagca 4140 agttaaaata aggctagtcc gttatcaact tgaaaaagtg gcaccgagtc ggtgcttttt 4200 tgaattcgct agctaggtct tgaaaggagt gggaattggc tccggtgccc gtcagtgggc 4260 agagcgcaca tcgcccacag tccccgagaa gttgggggga ggggtcggca attgatccgg 4320 tgcctagaga aggtggcgcg gggtaaactg ggaaagtgat gtcgtgtact ggctccgcct 4380 ttttcccgag ggtgggggag aaccgtatat aagtgcagta gtcgccgtga acgttctttt 4440 tcgcaacggg tttgccgcca gaacacagga ccggttctag agcgctgcca ccatggacaa 4500 gaagtacagc atcggcctgg acatcggcac caactctgtg ggctgggccg tgatcaccga 4560 cgagtacaag gtgcccagca agaaattcaa ggtgctgggc aacaccgacc ggcacagcat 4620 caagaagaac ctgatcggag ccctgctgtt cgacagcggc gaaacagccg aggccacccg 4680 gctgaagaga accgccagaa gaagatacac cagacggaag aaccggatct gctatctgca 4740 agagatcttc agcaacgaga tggccaaggt ggacgacagc ttcttccaca gactggaaga 4800 gtccttcctg gtggaagagg ataagaagca cgagcggcac cccatcttcg gcaacatcgt 4860 ggacgaggtg gcctaccacg agaagtaccc caccatctac cacctgagaa agaaactggt 4920 ggacagcacc gacaaggccg acctgcggct gatctatctg gccctggccc acatgatcaa 4980 gttccggggc cacttcctga tcgagggcga cctgaacccc gacaacagcg acgtggacaa 5040 gctgttcatc cagctggtgc agacctacaa ccagctgttc gaggaaaacc ccatcaacgc 5100 cagcggcgtg gacgccaagg ccatcctgtc tgccagactg agcaagagca gacggctgga 5160 aaatctgatc gcccagctgc ccggcgagaa gaagaatggc ctgttcggaa acctgattgc 5220 cctgagcctg ggcctgaccc ccaacttcaa gagcaacttc gacctggccg aggatgccaa 5280 actgcagctg agcaaggaca cctacgacga cgacctggac aacctgctgg cccagatcgg 5340 cgaccagtac gccgacctgt ttctggccgc caagaacctg tccgacgcca tcctgctgag 5400 cgacatcctg agagtgaaca ccgagatcac caaggccccc ctgagcgcct ctatgatcaa 5460 gagatacgac gagcaccacc aggacctgac cctgctgaaa gctctcgtgc ggcagcagct 5520 gcctgagaag tacaaagaga ttttcttcga ccagagcaag aacggctacg ccggctacat 5580 tgacggcgga gccagccagg aagagttcta caagttcatc aagcccatcc tggaaaagat 5640 ggacggcacc gaggaactgc tcgtgaagct gaacagagag gacctgctgc ggaagcagcg 5700 gaccttcgac aacggcagca tcccccacca gatccacctg ggagagctgc acgccattct 5760 gcggcggcag gaagattttt acccattcct gaaggacaac cgggaaaaga tcgagaagat 5820 cctgaccttc cgcatcccct actacgtggg ccctctggcc aggggaaaca gcagattcgc 5880 ctggatgacc agaaagagcg aggaaaccat caccccctgg aacttcgagg aagtggtgga 5940 caagggcgct tccgcccaga gcttcatcga gcggatgacc aacttcgata agaacctgcc 6000 caacgagaag gtgctgccca agcacagcct gctgtacgag tacttcaccg tgtataacga 6060 gctgaccaaa gtgaaatacg tgaccgaggg aatgagaaag cccgccttcc tgagcggcga 6120 gcagaaaaag gccatcgtgg acctgctgtt caagaccaac cggaaagtga ccgtgaagca 6180 gctgaaagag gactacttca agaaaatcga gtgcttcgac tccgtggaaa tctccggcgt 6240 ggaagatcgg ttcaacgcct ccctgggcac ataccacgat ctgctgaaaa ttatcaagga 6300 caaggacttc ctggacaatg aggaaaacga ggacattctg gaagatatcg tgctgaccct 6360 gacactgttt gaggacagag agatgatcga ggaacggctg aaaacctatg cccacctgtt 6420 cgacgacaaa gtgatgaagc agctgaagcg gcggagatac accggctggg gcaggctgag 6480 ccggaagctg atcaacggca tccgggacaa gcagtccggc aagacaatcc tggatttcct 6540 gaagtccgac ggcttcgcca acagaaactt catgcagctg atccacgacg acagcctgac 6600 ctttaaagag gacatccaga aagcccaggt gtccggccag ggcgatagcc tgcacgagca 6660 cattgccaat ctggccggca gccccgccat taagaagggc atcctgcaga cagtgaaggt 6720 ggtggacgag ctcgtgaaag tgatgggccg gcacaagccc gagaacatcg tgatcgaaat 6780 ggccagagag aaccagacca cccagaaggg acagaagaac agccgcgaga gaatgaagcg 6840 gatcgaagag ggcatcaaag agctgggcag ccagatcctg aaagaacacc ccgtggaaaa 6900 cacccagctg cagaacgaga agctgtacct gtactacctg cagaatgggc gggatatgta 6960 cgtggaccag gaactggaca tcaaccggct gtccgactac gatgtggacc atatcgtgcc 7020 tcagagcttt ctgaaggacg actccatcga caacaaggtg ctgaccagaa gcgacaagaa 7080 ccggggcaag agcgacaacg tgccctccga agaggtcgtg aagaagatga agaactactg 7140 gcggcagctg ctgaacgcca agctgattac ccagagaaag ttcgacaatc tgaccaaggc 7200 cgagagaggc ggcctgagcg aactggataa ggccggcttc atcaagagac agctggtgga 7260 aacccggcag atcacaaagc acgtggcaca gatcctggac tcccggatga acactaagta 7320 cgacgagaat gacaagctga tccgggaagt gaaagtgatc accctgaagt ccaagctggt 7380 gtccgatttc cggaaggatt tccagtttta caaagtgcgc gagatcaaca actaccacca 7440 cgcccacgac gcctacctga acgccgtcgt gggaaccgcc ctgatcaaaa agtaccctaa 7500 gctggaaagc gagttcgtgt acggcgacta caaggtgtac gacgtgcgga agatgatcgc 7560 caagagcgag caggaaatcg gcaaggctac cgccaagtac ttcttctaca gcaacatcat 7620 gaactttttc aagaccgaga ttaccctggc caacggcgag atccggaagc ggcctctgat 7680 cgagacaaac ggcgaaaccg gggagatcgt gtgggataag ggccgggatt ttgccaccgt 7740 gcggaaagtg ctgagcatgc cccaagtgaa tatcgtgaaa aagaccgagg tgcagacagg 7800 cggcttcagc aaagagtcta tcctgcccaa gaggaacagc gataagctga tcgccagaaa 7860 gaaggactgg gaccctaaga agtacggcgg cttcgacagc cccaccgtgg cctattctgt 7920 gctggtggtg gccaaagtgg aaaagggcaa gtccaagaaa ctgaagagtg tgaaagagct 7980 gctggggatc accatcatgg aaagaagcag cttcgagaag aatcccatcg actttctgga 8040 agccaagggc tacaaagaag tgaaaaagga cctgatcatc aagctgccta agtactccct 8100 gttcgagctg gaaaacggcc ggaagagaat gctggcctct gccggcgaac tgcagaaggg 8160 aaacgaactg gccctgccct ccaaatatgt gaacttcctg tacctggcca gccactatga 8220 gaagctgaag ggctcccccg aggataatga gcagaaacag ctgtttgtgg aacagcacaa 8280 gcactacctg gacgagatca tcgagcagat cagcgagttc tccaagagag tgatcctggc 8340 cgacgctaat ctggacaaag tgctgtccgc ctacaacaag caccgggata agcccatcag 8400 agagcaggcc gagaatatca tccacctgtt taccctgacc aatctgggag cccctgccgc 8460 cttcaagtac tttgacacca ccatcgaccg gaagaggtac accagcacca aagaggtgct 8520 ggacgccacc ctgatccacc agagcatcac cggcctgtac gagacacgga tcgacctgtc 8580 tcagctggga ggcgacaagc gacctgccgc cacaaagaag gctggacagg ctaagaagaa 8640 gaaagattac aaagacgatg acgataaggg atccggcgca acaaacttct ctctgctgaa 8700 acaagccgga gatgtcgaag agaatcctgg accgaccgag tacaagccca cggtgcgcct 8760 cgccacccgc gacgacgtcc ccagggccgt acgcaccctc gccgccgcgt tcgccgacta 8820 ccccgccacg cgccacaccg tcgatccgga ccgccacatc gagcgggtca ccgagctgca 8880 agaactcttc ctcacgcgcg tcgggctcga catcggcaag gtgtgggtcg cggacgacgg 8940 cgccgcggtg gcggtctgga ccacgccgga gagcgtcgaa gcgggggcgg tgttcgccga 9000 gatcggcccg cgcatggccg agttgagcgg ttcccggctg gccgcgcagc aacagatgga 9060 aggcctcctg gcgccgcacc ggcccaagga gcccgcgtgg ttcctggcca ccgtcggagt 9120 ctcgcccgac caccagggca agggtctggg cagcgccgtc gtgctccccg gagtggaggc 9180 ggccgagcgc gccggggtgc ccgccttcct ggagacctcc gcgccccgca acctcccctt 9240 ctacgagcgg ctcggcttca ccgtcaccgc cgacgtcgag gtgcccgaag gaccgcgcac 9300 ctggtgcatg acccgcaagc ccggtgcctg aacgcgttaa gtcgacaatc aacctctgga 9360 ttacaaaatt tgtgaaagat tgactggtat tcttaactat gttgctcctt ttacgctatg 9420 tggatacgct gctttaatgc ctttgtatca tgctattgct tcccgtatgg ctttcatttt 9480 ctcctccttg tataaatcct ggttgctgtc tctttatgag gagttgtggc ccgttgtcag 9540 gcaacgtggc gtggtgtgca ctgtgtttgc tgacgcaacc cccactggtt ggggcattgc 9600 caccacctgt cagctccttt ccgggacttt cgctttcccc ctccctattg ccacggcgga 9660 actcatcgcc gcctgccttg cccgctgctg gacaggggct cggctgttgg gcactgacaa 9720 ttccgtggtg ttgtcgggga aatcatcgtc ctttccttgg ctgctcgcct gtgttgccac 9780 ctggattctg cgcgggacgt ccttctgcta cgtcccttcg gccctcaatc cagcggacct 9840 tccttcccgc ggcctgctgc cggctctgcg gcctcttccg cgtcttcgcc ttcgccctca 9900 gacgagtcgg atctcccttt gggccgcctc cccgcgtcga ctttaagacc aatgacttac 9960 aaggcagctg tagatcttag ccacttttta aaagaaaagg ggggactgga agggctaatt 10020 cactcccaac gaagacaaga tctgcttttt gcttgtactg ggtctctctg gttagaccag 10080 atctgagcct gggagctctc tggctaacta gggaacccac tgcttaagcc tcaataaagc 10140 ttgccttgag tgcttcaagt agtgtgtgcc cgtctgttgt gtgactctgg taactagaga 10200 tccctcagac ccttttagtc agtgtggaaa atctctagca gggcccgttt aaacccgctg 10260 atcagcctcg actgtgcctt ctagttgcca gccatctgtt gtttgcccct cccccgtgcc 10320 ttccttgacc ctggaaggtg ccactcccac tgtcctttcc taataaaatg aggaaattgc 10380 atcgcattgt ctgagtaggt gtcattctat tctggggggt ggggtggggc aggacagcaa 10440 gggggaggat tgggaagaca atagcaggca tgctggggat gcggtgggct ctatggcttc 10500 tgaggcggaa agaaccagct ggggctctag ggggtatccc cacgcgccct gtagcggcgc 10560 attaagcgcg gcgggtgtgg tggttacgcg cagcgtgacc gctacacttg ccagcgccct 10620 agcgcccgct cctttcgctt tcttcccttc ctttctcgcc acgttcgccg gctttccccg 10680 tcaagctcta aatcgggggc tccctttagg gttccgattt agtgctttac ggcacctcga 10740 ccccaaaaaa cttgattagg gtgatggttc acgtagtggg ccatcgccct gatagacggt 10800 ttttcgccct ttgacgttgg agtccacgtt ctttaatagt ggactcttgt tccaaactgg 10860 aacaacactc aaccctatct cggtctattc ttttgattta taagggattt tgccgatttc 10920 ggcctattgg ttaaaaaatg agctgattta acaaaaattt aacgcgaatt aattctgtgg 10980 aatgtgtgtc agttagggtg tggaaagtcc ccaggctccc cagcaggcag aagtatgcaa 11040 agcatgcatc tcaattagtc agcaaccagg tgtggaaagt ccccaggctc cccagcaggc 11100 agaagtatgc aaagcatgca tctcaattag tcagcaacca tagtcccgcc cctaactccg 11160 cccatcccgc ccctaactcc gcccagttcc gcccattctc cgccccatgg ctgactaatt 11220 ttttttattt atgcagaggc cgaggccgcc tctgcctctg agctattcca gaagtagtga 11280 ggaggctttt ttggaggcct aggcttttgc aaaaagctcc cgggagcttg tatatccatt 11340 ttcggatctg atcagcacgt gttgacaatt aatcatcggc atagtatatc ggcatagtat 11400 aatacgacaa ggtgaggaac taaaccatgg ccaagttgac cagtgccgtt ccggtgctca 11460 ccgcgcgcga cgtcgccgga gcggtcgagt tctggaccga ccggctcggg ttctcccggg 11520 acttcgtgga ggacgacttc gccggtgtgg tccgggacga cgtgaccctg ttcatcagcg 11580 cggtccagga ccaggtggtg ccggacaaca ccctggcctg ggtgtgggtg cgcggcctgg 11640 acgagctgta cgccgagtgg tcggaggtcg tgtccacgaa cttccgggac gcctccgggc 11700 cggccatgac cgagatcggc gagcagccgt gggggcggga gttcgccctg cgcgacccgg 11760 ccggcaactg cgtgcacttc gtggccgagg agcaggactg acacgtgcta cgagatttcg 11820 attccaccgc cgccttctat gaaaggttgg gcttcggaat cgttttccgg gacgccggct 11880 ggatgatcct ccagcgcggg gatctcatgc tggagttctt cgcccacccc aacttgttta 11940 ttgcagctta taatggttac aaataaagca atagcatcac aaatttcaca aataaagcat 12000 ttttttcact gcattctagt tgtggtttgt ccaaactcat caatgtatct tatcatgtct 12060 gtataccgtc gacctctagc tagagcttgg cgtaatcatg gtcatagctg tttcctgtgt 12120 gaaattgtta tccgctcaca attccacaca acatacgagc cggaagcata aagtgtaaag 12180 cctggggtgc ctaatgagtg agctaactca cattaattgc gttgcgctca ctgcccgctt 12240 tccagtcggg aaacctgtcg tgccagctgc attaatgaat cggccaacgc gcggggagag 12300 gcggtttgcg tattgggcgc tcttccgctt cctcgctcac tgactcgctg cgctcggtcg 12360 ttcggctgcg gcgagcggta tcagctcact caaaggcggt aatacggtta tccacagaat 12420 caggggataa cgcaggaaag aacatgtgag caaaaggcca gcaaaaggcc aggaaccgta 12480 aaaaggccgc gttgctggcg tttttccata ggctccgccc ccctgacgag catcacaaaa 12540 atcgacgctc aagtcagagg tggcgaaacc cgacaggact ataaagatac caggcgtttc 12600 cccctggaag ctccctcgtg cgctctcctg ttccgaccct gccgcttacc ggatacctgt 12660 ccgcctttct cccttcggga agcgtggcgc tttctcatag ctcacgctgt aggtatctca 12720 gttcggtgta ggtcgttcgc tccaagctgg gctgtgtgca cgaacccccc gttcagcccg 12780 accgctgcgc cttatccggt aactatcgtc ttgagtccaa cccggtaaga cacgacttat 12840 cgccactggc agcagccact ggtaacagga ttagcagagc gaggtatgta ggcggtgcta 12900 cagagttctt gaagtggtgg cctaactacg gctacactag aagaacagta tttggtatct 12960 gcgctctgct gaagccagtt accttcggaa aaagagttgg tagctcttga tccggcaaac 13020 aaaccaccgc tggtagcggt ggtttttttg tttgcaagca gcagattacg cgcagaaaaa 13080 aaggatctca agaagatcct ttgatctttt ctacggggtc tgacgctcag tggaacgaaa 13140 actcacgtta agggattttg gtcatgagat tatcaaaaag gatcttcacc tagatccttt 13200 taaattaaaa atgaagtttt aaatcaatct aaagtatata tgagtaaact tggtctgaca 13260 gttaccaatg cttaatcagt gaggcaccta tctcagcgat ctgtctattt cgttcatcca 13320 tagttgcctg actccccgtc gtgtagataa ctacgatacg ggagggctta ccatctggcc 13380 ccagtgctgc aatgataccg cgagacccac gctcaccggc tccagattta tcagcaataa 13440 accagccagc cggaagggcc gagcgcagaa gtggtcctgc aactttatcc gcctccatcc 13500 agtctattaa ttgttgccgg gaagctagag taagtagttc gccagttaat agtttgcgca 13560 acgttgttgc cattgctaca ggcatcgtgg tgtcacgctc gtcgtttggt atggcttcat 13620 tcagctccgg ttcccaacga tcaaggcgag ttacatgatc ccccatgttg tgcaaaaaag 13680 cggttagctc cttcggtcct ccgatcgttg tcagaagtaa gttggccgca gtgttatcac 13740 tcatggttat ggcagcactg cataattctc ttactgtcat gccatccgta agatgctttt 13800 ctgtgactgg tgagtactca accaagtcat tctgagaata gtgtatgcgg cgaccgagtt 13860 gctcttgccc ggcgtcaata cgggataata ccgcgccaca tagcagaact ttaaaagtgc 13920 tcatcattgg aaaacgttct tcggggcgaa aactctcaag gatcttaccg ctgttgagat 13980 ccagttcgat gtaacccact cgtgcaccca actgatcttc agcatctttt actttcacca 14040 gcgtttctgg gtgagcaaaa acaggaaggc aaaatgccgc aaaaaaggga ataagggcga 14100 cacggaaatg ttgaatactc atactcttcc tttttcaata ttattgaagc atttatcagg 14160 gttattgtct catgagcgga tacatatttg aatgtattta gaaaaataaa caaatagggg 14220 ttccgcgcac atttccccga aaagtgccac ctgacgtcga cggatcggga gatctcccga 14280 tcccctatgg tgcactctca gtacaatctg ctctgatgcc gcatagttaa gccagtatct 14340 gctccctgct tgtgtgttgg aggtcgctga gtagtgcgcg agcaaaattt aagctacaac 14400 aaggcaaggc ttgaccgaca attgcatgaa gaatctgctt agggttaggc gttttgcgct 14460 gcttcgcgat gtacgggcca gatatacgcg ttgacattga ttattgacta gttattaata 14520 gtaatcaatt acggggtcat tagttcatag cccatatatg gagttccgcg ttacataact 14580 tacggtaaat ggcccgcctg gctgaccgcc caacgacccc cgcccattga cgtcaataat 14640 gacgtatgtt cccatagtaa cgccaatagg gactttccat tgacgtcaat gggtggagta 14700 tttacggtaa actgcccact tggcagtaca tcaagtgtat catatgccaa gtacgccccc 14760 tattgacgtc aatgacggta aatggcccgc ctggcattat gcccagtaca tgaccttatg 14820 ggactttcct acttggcagt acatctacgt attagtcatc gctattacca tgg 14873 <210> 3 <211> 25 <212> DNA <213> Artificial Sequence <220> 223 teromere primer F <400> 3 caccgtaggg ttagggttag ggtta 25 <210> 4 <211> 25 <212> DNA <213> Artificial Sequence <220> 223 teromere primer R <400> 4 aaactaaccc taaccctaac cctac 25 <210> 5 <211> 423 <212> DNA <213> Mus musculus <400> 5 atggatgtat tcatgaaagg actttcaaag gccaaggagg gagttgtggc tgctgctgag 60 aaaaccaaac agggtgtggc agaagcagca ggaaagacaa aagagggtgt tctctatgta 120 ggctccaaaa ccaaggaggg agtggtgcat ggtgtggcaa cagtggctga gaagaccaaa 180 gagcaagtga caaatgttgg aggagcagtg gtgacgggtg tgacagcagt agcccagaag 240 acagtggagg gagcagggag cattgcagca gccactggct ttgtcaaaaa ggaccagttg 300 ggcaagaatg aagaaggagc cccacaggaa ggaattctgg aagatatgcc tgtggatcct 360 gacaatgagg cttatgaaat gccttctgag gaagggtatc aagactacga acctgaagcc 420 taa 423 <210> 6 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> Telomere-F <400> 6 ggtttttgag ggtgagggtg agggtgaggg tgagggt 37 <210> 7 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> Telomere-R <400> 7 tcccgactat ccctatccct atccctatcc ctatcccta 39 <210> 8 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> 36B4u-F <400> 8 cagcaagtgg gaaggtgtaa tcc 23 <210> 9 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> 36B4u-R <400> 9 cccattctat catcaacggg tacaa 25 <210> 10 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> teromere primer F-1 <400> 10 caccgttagg gttagggtta gggtt 25 <210> 11 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> teromere primer R-1 <400> 11 aaacaaccct aaccctaacc ctaac 25

Claims (21)

DNA sequences encoding guide RNAs (sgRNAs) specific for telomere sequences;
DNA sequence encoding Cas9; And
One or more promoters operably linked to said DNA sequences
Comprising, and comprising a nucleic acid sequence represented by SEQ ID NO: 2, a vector for producing an aging model of an animal other than a cell or a human.
The method of claim 1,
The telomeres sequence is a telomeres sequence of human, mouse, rat, rabbit, fruit flies, pigs or monkeys, cells or animals for aging models of humans except humans.
The method of claim 1,
Wherein the telomere sequence comprises a nucleic acid sequence represented by SEQ ID NO: 1, a vector for preparing an aging model for cells or animals other than humans.
The method of claim 1,
A vector for producing an aging model of a cell or animal other than human, which is viral vector based.
The method of claim 4, wherein
A vector for producing an aging model of a cell or animal other than human, based on a lentiviral vector.
delete An aging model of an animal other than a cell or a human, wherein a vector for preparing an aging model of the cell or an animal other than a human is introduced.
The aging model of an animal other than a cell or a human according to claim 7, wherein the cell is a neuron.
The method of claim 8,
Aging model of cells or animals other than humans, wherein the neurons are neurons of humans, mice, rats, rabbits, fruit flies, pigs or monkeys.
A method of producing a cell aging model, comprising introducing into a eukaryotic cell a vector for producing an aging model of an animal other than a cell or a human according to claim 1.
The method of claim 10,
The eukaryotic cells are neurons, cell aging model manufacturing method.
The method of claim 11,
The neurons are neurons of humans, mice, rats, rabbits, fruit flies, pigs or monkeys, cell aging model manufacturing method.
A composition for producing a cell aging model, comprising a vector for producing an aging model of a cell or an animal other than a human according to claim 1.
Guide RNA and Cas9 specific for a telomere sequence comprising the nucleic acid sequence of SEQ ID NO: 1; Or injecting an aging model manufacturing vector according to claim 1 into neural tissues of animals other than humans.
The method of claim 14,
The neural tissue comprises a brain, animal aging model manufacturing method.
The method of claim 14,
The animal is a mouse, rat, rabbit, fruit flies, pigs or monkeys, animal aging model manufacturing method.
Guide RNA and Cas9 specific for a telomere sequence comprising the nucleic acid sequence of SEQ ID NO: 1; Or a vector for producing an aging model according to claim 1, comprising a composition for producing an animal aging model.
A neurodegenerative disease model of an animal other than a cell or a human, wherein a vector for preparing an aging model of the cell or an animal other than a human is introduced.
19. The neurodegenerative disease model of any animal other than cells or humans according to claim 18, wherein the neurodegenerative disease is Parkinson's disease.
Inoculating the vector of claim 1 into an animal model other than a cell or a human; And
A method for screening a drug for preventing or treating aging, comprising: administering a candidate drug to an animal model other than the cell or human, and measuring gene and protein expression of PGC-1α, NRF-1 or PINK1.
Inoculating the vector of claim 1 into an animal model other than a cell or a human; And
A method of screening a drug for preventing or treating neurodegenerative diseases, comprising: administering a candidate drug to an animal model other than the cell or human, and measuring gene and protein expression of PGC-1α, NRF-1 or PINK1.

Images