KR101970963B1 - DNA aptamer binding specifically to yellow fever virus envelope protein domain III (YFV EDIII) and uses thereof - Google Patents

Abstract

The present invention relates to a DNA aptamer specifically bound with yellow fever virus envelope protein domain III (YFV EDIII), a composition for diagnosing yellow fever including the same, a yellow fever diagnosis kit, a biosensor for diagnosing yellow fever, and an information providing method for diagnosing yellow fever. By the result of a study performed by inventors of the present invention to develop a new biomarker for the diagnosis of yellow fever, it is confirmed that the DNA aptamer having specific binding ability with YFV EDIII has strong binding force and excellent specificity with YFV EDIII. Therefore, the present invention can be useful when developing the composition for diagnosing yellow fever, the biosensor for diagnosing yellow fever, and the information providing method for diagnosing yellow fever since the present invention is expected to have superior stability better than an ELISA method using existing antibodies. The DNA aptamer comprises a sequence listing of sequence number 6.

Description

DNA aptamer binding specifically to yellow fever virus envelope protein domain III (YFV EDIII) and uses thereof,

The present invention relates to a DNA thermometer which specifically binds to yellow fever virus envelope protein domain III (EDIII), a yellow heat diagnostic composition containing the same, a yellow heat diagnostic kit, a yellow heat diagnostic biosensor, The present invention relates to a method for providing information.

Yellow fever is acute infectious hemorrhagic fever caused by yellow fever virus, a type of flavivirus, which is a fatal infectious disease transmitted through mediator of Egyptian forest mosquito. It develops after 3-6 day incubation period after infection, and symptoms such as fever, myalgia, headache, vomiting and nausea appear. It is known that about 15% of the patients return to the severe stage, and about 50% of the severe patients die within 10-14 days. Although vaccines have been developed, there is no specific treatment for patients who have already developed the disease. Patient therapy is performed mainly for the treatment of hypertension, and it is performed to prevent dehydration, dyspnea, heat, and complications. 200,000 yellow fever epidemics are reported annually, of which 30,000 die.

On the other hand, the yellow fever virus envelope protein domain III (YFV EDIII) is a domain III region located on the surface protein of the yellow fever virus. The flavivirus to which the yellow fever virus belongs is a capsid protein Genomic RNA is located on the outside and the dimer and membrane (M) protein on the outside of the envelope. The envelope protein located at the outermost position of the Flavivirus antigen is composed of domains I, II, and III. Among them, domain III is a site where the viral receptor binds and is a major target of diagnosis and immunological research using serum have. Domain III is highly antigenic and has a linear epitope recognized by a virus-neutralizing monoclonal antibody. Diseases in the same flavivirus are difficult to diagnose serologically because of strong antigen - cross reaction between viruses. For example, it has been reported that most infections were diagnosed by cross-reactivity between three types of dengue fever and St Louis encephalitis. In order to solve this problem, the sequence of the domain III, which has distinct characteristics in viruses of the same genus, is attracting attention.

Currently, tropical endemic diseases such as yellow fever are diagnosed by symptom-based diagnosis, detection of infectious agent by PCR, and immunoassay using antigen-antibody reaction. However, existing methods are not widely used as a cost problem in poor countries with poor medical facilities, or they are not at a suitable level on the scale of sensitivity, screening, and the like. It is required to overcome limitations of existing diagnostic methods and to develop an alien disease detection platform that can be practically used in poverty countries.

On the other hand, aptamers are single-stranded DNA (ssDNA) or RNA with high specificity and affinity for certain substances. Since aptamers have very high affinity for certain substances and are stable, they have been developed in recent years and have been actively applied to therapeutic agents and diagnostic sensors using them. The synthesis of platamer is possible by a relatively simple method, and it is possible to develop new detection methods using cells, proteins and even small organic substances as target substances, and its specificity and stability are much higher than those of already developed antibodies Therefore, it can be applied to therapeutic drug development, drug delivery system, and diagnostic biosensor.

Therefore, diagnosis of yellow fever using a new biomarker has been a major subject for development of an alienated disease detection platform, and studies have been made on it, but it is still not yet available.

Korean Patent Publication No. 10-0883703

DISCLOSURE Technical Problem The present invention has been conceived to solve the above-mentioned problems, and it is an object of the present invention to provide a DNA thermometer capable of binding specificity to yellow fever virus envelope protein domain III (YFV EDIII) Thereby completing the present invention.

Accordingly, an object of the present invention is to provide a DNA thermometer that specifically binds to a yellow fever virus envelope protein domain III (YFV EDIII), wherein the DNA oligomer comprises the nucleotide sequence of SEQ ID NO: Thereby providing a DNA thermometer.

Another object of the present invention is to provide a yellow heat diagnostic composition or a yellow heat diagnostic kit comprising a DNA compressomer.

In addition, another object of the present invention is to provide a method for detecting a yellow fever virus envelope protein III (YFV EDIII) -specific DNA extender; And a substrate on which the DNA aptamer is immobilized. The biotensor for yellow heat diagnosis is characterized in that the DNA aptamer comprises the nucleotide sequence of SEQ ID NO: 6.

Still another object of the present invention is to provide a biosensor comprising: (a) injecting a test sample into the biosensor of claim 5; (b) injecting a detection probe including a quantum dot into the biosensor that has processed the sample of the sample of step (a); (c) injecting an acid into the biosensor into which the detection probe containing the quantum dot of (b) is injected; (d) obtaining a solution in which the quantum dots of the step (c) are reacted with the acid; And (e) measuring an ampere (A) of the solution of step (d).

However, the technical problem to be solved by the present invention is not limited to the above-mentioned problems and other problems not mentioned can be clearly understood by those skilled in the art from the following description will be.

In order to achieve the above object, the present invention provides a DNA plasmid that specifically binds to yellow fever virus envelope protein domain III (YFV EDIII) Wherein the DNA strand is a DNA strand.

In one embodiment of the present invention, the YFV EDIII may be a domain protein contained on the surface of a yellow fever virus antigen.

In addition, the present invention provides a yellow heat diagnostic composition comprising a DNA compressomer.

In addition, the present invention provides a yellow heat diagnostic kit comprising a DNA pressure thermometer.

In addition, the present invention relates to a DNA fever-specific expression vector for yellow fever virus envelope protein III (YFV EDIII). And a substrate on which the DNA aptamer is immobilized. The biotensor for yellow heat diagnosis is characterized in that the DNA aptamer is composed of the nucleotide sequence of SEQ ID NO: 6.

In one embodiment of the present invention, the substrate may include a metal electrode layer and a metal nanoparticle layer, and the metal may be gold (Au).

In another embodiment of the present invention, the DNA aptamer may be one which hybridizes with the immobilized sequence and is immobilized on the substrate as a double strand.

(A) injecting a test sample into the biosensor of claim 5; (b) injecting a detection probe including a quantum dot into the biosensor that has processed the sample of the sample of step (a); (c) injecting an acid into the biosensor into which the detection probe containing the quantum dot of (b) is injected; (d) obtaining a solution in which the quantum dots of the step (c) are reacted with the acid; And (e) measuring an ampere (A) of the solution of step (d).

In one embodiment of the present invention, the quantum dot may be Cadmium Sulfide (CdS).

In addition, the present invention provides a method for diagnosing yellow fever comprising administering to a subject a DNA tymator that specifically binds to YFV EDIII.

The present invention also provides a yellow heat diagnostic use of a DNA tympanum specifically binding to YFV EDIII.

As a result of intensive research to develop a novel biomarker for the diagnosis of yellow fever, the inventors of the present invention have found that a DNA potamer having a specific binding ability to yellow fever virus envelope protein domain III (YFV EDIII) DNA Aptamer) has a strong binding force with YFV EDIII and excellent specificity. As a result, it can be expected to have better stability than the ELISA method using existing antibodies. Therefore, a composition for diagnostic of yellow fever, a biosensor for yellow heat diagnosis, an information providing method for yellow fever diagnosis It is expected that it can be usefully used in the development of such devices.

FIG. 1A shows the results of amplification of the YFV EDIII gene.
FIG. 1B shows the result of observing the high-purity recombinant YFV EDIII protein obtained by FPLC after over-expressing the recombinant YFV EDIII protein.
FIG. 2 is a graph showing the results of sorting and confirming the degree of binding of ssDNA (single strand DNA) and YFV EDIII.
FIG. 3 is a graph showing the results of confirming the Kd value for the YF1 platelet sequence through fluorescence measurement.
FIG. 4 is a schematic diagram of a biosensor for YFV EDIII detection using a DNA compression device.
5A is a graph showing the results of YFV EDIII detection using YF1 platemer when the concentration of YFV EDIII is different.
5B is a graph showing that the detection result of YFV EDIII using YF1 platemer quantitatively appears when the concentration value of YFV EDIII converted to Log is x-axis.
6 is a graph showing changes in relative current values depending on the reaction with each protein in the binding specificity test for the YFV EDIII protein.

As a result of intensive research to develop a novel biomarker for the diagnosis of yellow fever, the inventors of the present invention have found that a DNA potamer having a specific binding ability to yellow fever virus envelope protein domain III (YFV EDIII) DNA Aptamer) has a strong binding force with YFV EDIII and excellent specificity, thus completing the present invention.

Hereinafter, the present invention will be described in detail.

The present invention provides a DNA plasmid that specifically binds to YFV EDIII.

The term " yellow fever virus envelope protein domain III (YFV EDIII) " used in the present invention is a domain III region located on the surface protein of yellow fever virus, Has a structure in which a genomic RNA is located inside a capsid protein and a dimer and a membrane protein of an envelope are outside the protein have. The envelope protein located at the outermost position of the Flavivirus antigen is composed of domains I, II, and III. Among them, domain III is a site where the viral receptor binds and is a major target of diagnosis and immunological research using serum have. Domain III is highly antigenic and has a linear epitope recognized by a virus-neutralizing monoclonal antibody. Diseases in the same flavivirus are difficult to diagnose serologically because of strong antigen - cross reaction between viruses. For example, it has been reported that most infections were diagnosed by cross-reactivity between three types of dengue fever and St Louis encephalitis. In order to solve this problem, the sequence of the domain III, which has distinct characteristics in viruses of the same genus, has been attracting attention. YFV EDIII can be effectively used to detect yellow fever. Yellow fever virus EDIII ), But it is not limited thereto.

As used herein, the term " abtamer " is single stranded DNA (ssDNA) or RNA having high specificity and affinity for a particular material. The existing antibody-based methods are produced using a living body's immune system, so that they are relatively expensive and expensive. In some cases, the stability of the protein is problematic. It is possible to develop new detection methods by using simple methods and can use cell, protein and small organic substances as target substances. Therefore, it is possible to develop new detection methods using YFV For the specific detection of EDIII, DNA platamer was used. Any DNA (ssDNA) or RNA capable of specific detection of YFV EDIII may correspond to the plasmid of the present invention, preferably, it may be composed of the nucleotide sequence of SEQ ID NO: 6, but is not limited thereto.

Further, the present invention provides a yellow heat diagnostic composition comprising the DNA compressomer.

The composition of the present invention may further include a pharmacologically or physiologically acceptable carrier, an excipient, and a diluent in addition to the DNA plasmin. In addition, it may be formulated in the form of oral, granule, tablet, capsule, suspension, emulsion, syrup, aerosol or the like oral preparation, external preparation, suppository, and sterilized injection solution according to a usual method.

Examples of carriers, excipients and diluents that can be included in the composition include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, Cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil. When the composition is formulated, it is prepared using a diluent such as a filler, an extender, a binder, a wetting agent, a disintegrant, a surfactant, or an excipient usually used.

Further, the present invention provides a yellow heat diagnostic kit comprising the DNA compressor.

The kit comprises a platemer of the present invention which specifically binds to YFV EDIII, and the platamer may be attached with detection labels such as biotin residues that are widely used in the art. After introducing the labeling substance into the biotin-attached platemater, it can be used for the detection, quantification and diagnosis of YFV EDIII through its analysis. As a labeling substance used for biotin, various known labeling substances for analysis can be used. For example, fluorescence analysis is performed using streptavidin, avidin, Cy3, Cy5, Alexa, BODIPY, Rhodamine or Q-dot . In addition, biomarkers for detection of YFV EDIII may be labeled with conventional labeling substances such as other fluorescent substances, magnetic substances, dye substances, enzymes, radioactive isotopes and the like in addition to biotin residues, microscope,

It can be detected through radioimmnodetection (RAID).

The kit may also be used as a variety of tools or reagents that can be used to qualitatively or quantitatively measure the binding of YFV EDIII in an abatumer to a sample. Examples of the kit include a support (substrate), a buffer solution, a reaction terminator, a solubilizer, May be further included.

In the present invention, a substrate on which an aptamer is immobilized may be selected from the group consisting of polymer, glass, gold, paper and membrane as a solid substrate, for example. More specifically, it is possible to use a hydrophilic polymer such as polystyrene, polyethylene, polypropylene, polyester, polyacrylonitrile, fluororesin, agarose, cellulose, nitrocellulose, dextran, sephadex, sepharose, liposome, carboxymethylcellulose, Polyvinylidene-ether-maleic acid copolymer, amino-acid copolymer, ethylene-maleic acid copolymer, nylon, metal, glass, glass beads, or Magnetic particles and the like can be used. Other solid substrates include cell culture plates, ELISA plates, tubes, and polymeric membranes. The substrate may have any possible shape, for example a spherical (bead), a cylindrical (test tube or well inner surface), a planar (sheet, test strip), more preferably a multiwell plate , 96 wells, 192 wells, 384 wells, 576 wells, etc.).

In addition, the present invention relates to a DNA fever-specific expression vector for yellow fever virus envelope protein III (YFV EDIII). And a substrate on which the DNA aptamer is immobilized.

The substrate on which the DNA aptamer is immobilized is composed of a metal electrode layer and a metal nanoparticle layer of a screen printed gold electrode. The electrode layer and the nanoparticle material can be attracted by an electric field or a magnetic field, (Au), but is not limited thereto. [0031] As shown in FIG.

The DNA aptamer immobilized on the substrate can be hybridized with the immobilized sequence to be fixed on the substrate in a double strand. The DNA strand that binds specifically to YFV EDIII is not limited to any one, But is not limited thereto.

In addition, the immobilized sequence can be hybridized with the YF1 platemaker, immobilized on the substrate by thiol-gold reaction, and preferably 5'-AAG CAG TCC AAC TCG AAC ACA CTG- (CH ₂ ) ₆ -SH- But are not limited thereto.

In one embodiment of the present invention, YFV EDIII was expressed and purified to confirm a specific binding sequence (see Examples 1 to 3). As a result of searching for an alphamer for YFV EDIII using SELEX, the sequence and structure (See Example 4), and the binding force between YFV EDIII and platemer was measured using fluorescence measurement (see Example 5). Further, based on the results of the above experiment, a DNA pressure having excellent stability and binding ability (See Example 6). It was confirmed that the biosensor had excellent specificity for YFV EDIII, and it was confirmed that the biosensor could be used as an information providing method for yellow fever diagnosis (Example 7 Reference).

Accordingly, the present invention provides a biosensor comprising: (a) injecting a test sample into the biosensor of claim 5; (b) injecting a detection probe including a quantum dot into the biosensor that has processed the sample of the sample of step (a); (c) injecting an acid into the biosensor into which the detection probe containing the quantum dot of (b) is injected; (d) obtaining a solution in which the quantum dots of the step (c) are reacted with the acid; And (e) measuring an ampere (A) of the solution of step (d).

The subject sample for the diagnosis of yellow fever can be, but is not limited to, tissue, cell, whole blood, blood, saliva, sputum, cerebrospinal fluid, urine or the like.

Further, the detection probe fills the position with more detection probes as the YFV EDIII is separated from the biosensor probe. Preferably, the detection probe sequence is 5'-GTT CGA GTT GGA CTG CTT CTA GGA TTG CTG GCT CGA AC- (CH ₂ ) ₆ -NH ₂ -3 '.

In addition, the quantum dot may be included in the detection probe and is not limited to any one as long as it can react with the acid. For example, there may be cadmium sulfide (CdS), lead sulfide (PbS) But is not limited to, cadmium.

In addition, the acid is not limited to any one as long as it can react with the quantum dot, for example, nitric acid, sulfuric acid, hydrochloric acid and the like, preferably nitric acid.

Hereinafter, preferred embodiments of the present invention will be described in order to facilitate understanding of the present invention. However, the following examples are provided only for the purpose of easier understanding of the present invention, and the present invention is not limited by the following examples.

Example  One. YFV EDIII  gene Cloning

For amplification of the gene for the yellow fever virus envelope protein domain III (YFV EDIII), the forward primer (5'-CCC GGA TCC TCT GCT CTG ACC CTG AAA GG-3 'containing BamHl restriction enzyme recognition sequence) (SEQ ID NO: 1) and HindIII restriction enzyme recognition sequence (5'-CCC AAG CTT TTT ACC GAT AGA ACC TTC TTT GTG CC-3 ';

The gene codon-optimized YFV EDIII gene sequence (strain Ghana / Asibi / 1927, 573 Ser-683Lys) was used as a template for gene amplification in accordance with E. coli K-12 and i-pfu polymerase And amplified by polymerase chain reaction (PCR). Each step of the polymerase chain reaction is as follows. 1) Incubation at 98 ° C for 20 sec., 2) Incubation at 55 ° C for 20 sec. At the step of combining template and primer, 3) Synthesis of new strand, 72 ° C for 30 seconds, and this step was repeated 20 times.

The amplified YFV EDIII gene was cloned into a pET32a vector containing a (His) 6-tag through a reaction with a restriction enzyme and a DNA ligase, and the vector was used to transform BL21 (DE3) E. coli cells .

Example 2. Expression of YFV EDIII protein

BL21 (DE3) cells transformed with YFV EDIII gene were cultured in LB (Luria Bertani) medium and cultured at 37 ° C until OD (optical density) reached 0.6 at UV 600 nm. After that, IPTG (isopropyl-thio-b-D-galactopyranoside) was added to a final concentration of 1 mM to induce protein expression, followed by culturing at 18 ° C for 20 hours. Protein expression was confirmed by SDS PAGE, and the cells were separated from the culture medium using a centrifuge and washed once with PBS (10 mM sodium phosphate, 150 mM NaCl, pH 8.0) buffer.

Example  3. YFV EDIII  Purification of proteins

To purify YFV EDIII protein expressed in bacterial cell BL21 (DE3) in high purity, cells were dissolved in a lysis buffer (20 mM Tris, 500 mM NaCl, 0.5 mM ß-mercaptoethanol, 5% glycerol, pH 8.0) , Sonicated for 20 minutes using an ultrasonic sonicator to destroy the cells. The proteins and cells in the aqueous phase were separated for 40 minutes at 18,000 rpm using a centrifuge to separate them.

In addition, we used the property that Ni-NTA (Ni-nitrilotriacetic acid) and (His) 6-tag amino acid bind to obtain high purity protein. Specifically, a Ni-NTA column was connected to Fast protein liquid chromatography (FPLC), and YFV EDIII in an aqueous phase was flowed into the column. Since the (His) 6-tag of the protein bound to the Ni-NTA column competitively binds to the compound of the imidazole, the elution buffer (20 mM Tris, 500 mM NaCl, 0.5 mM ß-mercaptoethanol, 300 mM immidazole, pH 8.0) in order to separate YFV EDIII with high purity.

In order to remove the imidazole from the separated protein, the buffer was changed through a desalting column. The purified protein was stored in a storage buffer (50 mM Tris-HCl (pH 8.0), 100 mM NaCl, Mercaptoethanol).

Example 4: Detection of an alphamer for YFV EDIII using SELEX

Preparation of 1-1.ssDNA (single strand DNA) library

(5'-CACCTAATACGACTCACTATAGCGGATCCGA-N40-CTGGCTCGAACAAGCTTGC-3 '; SEQ ID NO: 3) having a sequence of primer binding sequences for PCR amplification and cloning at both ends and having 90 sequences including 40 random DNA base sequences in the middle, Respectively. (SEQ ID NO: 4), Reverse primer (5'-GCAAGCTTGTTCGAGCCAG-3 '; SEQ ID NO: 5) and Biotin-conjugated Reverse primer (5' -CACCTAATACGACTCACTATAGCGGA-3 ') for PCR amplification and ssDNA generation, -Biotin-GCAAGCTTGTTCGAGCCAG-3 ') was used. All the oligonucleotides used here were synthesized and purified on PAGE by Bionics (Korea).

1-2. Immobilization of YFV EDIII on Ni-NTA magnetic beads

Purified YFV EDIII was immobilized on beads using Dynabeads (Invitrogen, Norway), a magnetic bead that was coated with cobalt on the surface and bound to the His-tag of the protein.

Specifically, 1000 pmole of protein dissolved in 100 μL of protein binding buffer (20 mM Tris, 50 mM NaCl, 5 mM KCl, 5 mM MgCl ₂ , pH 8.0) and 15 μl of bead were washed with binding buffer using an external magnet, And fixed in beads.

1-3. YFV EDIII-specific platemer screening

A specific separation method using magnetism was performed in order to select an ellipsoid specific to YFV EDIII. Specifically, for the most stable structure formation of ssDNA, ssDNA library (500 pmoles) dissolved in 100 uL binding buffer was incubated at 90 ° C for 3 minutes and then incubated at 4 ° C for 30 minutes. Then, YFV EDIII immobilized on magnetic beads was reacted for 1 hour while shaking weakly. The beads were then washed twice with binding buffer to remove ssDNA not associated with YFV EDIII bound to the beads. Then, the protein and the bound ssDNA were eluted with an elution buffer (20 mM Tris, 50 mM NaCl, 5 mM KCl, 5 mM MgCl ₂ , 0.01% tween 20, 300 mM immidazole, pH 8.0) to separate the ssDNA bound to the protein in the magnetic bead Respectively. The eluted ssDNA was precipitated with ethanol, dissolved in 60 μL of distilled water, and then amplified by PCR using i-pfu polymerase (Intron Biotechnology, Korea) using a forward primer and a biotin-coupled reverse primer. To generate ssDNA for the next screening process, the biotin-conjugated PCR product was incubated with coupling buffer (5 mM Tris-HCl, 0.5 mM EDTA, 1 M NaCl) with magnetic beads coated with streptavidin, , 0.005% tween 20, pH 7.5) for 1 hour. After cultivation, 100 μl of 100 mM NaOH was added for 10 min to isolate only ssDNA, and only ssDNA selected using external magnet was obtained. In addition, selection was repeated using the first selected ssDNA for subsequent screening. At this time, the amount of ssDNA and the concentration of YFV EDIII proceeded while being further reduced for strict selection. The concentration of ssDNA eluted in the repeated sorting was measured with a UV spectrometer (Biochrom Libra S22 spectrometer) EDIII, and the selection process was carried out. The degree of bonding (%) is as shown in Fig.

1-4. Arthrometer sequencing and structural analysis

The 11th repeated ssDNA was amplified by PCR using unmodified Forward primer and Reverse primer, cloned into pENTR / TOPO vector (TOPO TA Cloning kit, Invitrogen, USA), and E. coli TOP10 cells (Invitrogen, USA). The ssDNA-inserted clone was purified using a miniprep kit (GeneAll, Korea) and analyzed for its nucleotide sequence (COSMO Genetech, Korea). As a result, the sequence as shown in Table 1 below could be analyzed.

Aptamer candidate sequence (5 '- > 3') YF1 (90 mer) CACCTAATACGACTCACTATAGCGGATCCGAATATATCTCCTTA GTTCGAGTTGGACTGCTTCTAGGATTGCTGGCTCGAAC AAGCTTGC

Example  5. Protein analysis using fluorescence measurements Abtamer  Bond strength measurement

400 pmole of YFV EDIII was mixed with 10 uL of megnetic beads and then incubated in 100 uL binding buffer (20 mM Tris, 50 mM NaCl, 5 mM KCl, 5 mM MgCl2, pH 8.0) for 1 hour. The unbound YFV EDIII was washed twice with binding buffer to separate. Subsequently, the cells were incubated with various concentrations of 6-FAM-labeled platemers for 1 hour, and unbound aptamers were removed by washing. The amount of 6-FAM-labeled ssDNA pyramid conjugated to YFV EDIII-immobilized magnetic beads was determined by fluorescence measurement (1420 Victor multilabel counter, PerkinElmer, USA) by separating only 6-FAM labeled ssDNA bound to YFV EDIII using a magnet, USA). As a result, as shown in Fig. 3 and Table 2 below, the kd value of DNA plasmers having the YF1 base sequence could be measured.

Abtamer Kd (nM) YF1 12.2 nM

Example  6. Optimization of detection condition and production of biosensor

In order to detect YFV EDIII with DNA plasmers excised in Example 4, a biosensor having excellent detection sensitivity was designed using a stripping voltammetry technique. 4 is a schematic diagram of a biosensor for detecting YFV EDIII using the DNA plasmid of the present invention.

First, gold nanoparticles were adsorbed on a gold electrode of SPGE (Screen Printed Gold Electrode) chip and immobilized on a 5'-AAG CAG TCC AAC TCG AAC ACA CTG- (CH ₂ ) ₆ -SH-3 ' ) And YF1 platamer (5'-GTT CGA GTT GGA CTG CTT CTA GGA TTG CTG GCT CGA AC-3 ') are immobilized on the gold surface by thiol-gold reaction. Then, YFV EDIII to be detected is added and reacted for 40 minutes. Then, when washed with distilled water, the YF1 aptamer specifically reacting with YFV EDIII binds to the protein, and the corresponding immobilized sequence remains as a single strand. Finally, the detection probe sequence (5'-GTT CGA GTT GGA CTG CTT CTA GGA TTG CTG GCT CGA AC- (CH ₂ ) ₆ -NH ₂ -3 ') linked to a cadmium sulfide quantum dot (CdS) The reaction mixture was washed with distilled water and then transferred to a 1 mL acetate / bismuth buffer (0.1 M acetate buffer, 400 μg / L bismuth, pH 4.5) with 70 μL of 1 M nitric acid for one hour. The resulting solution was subjected to stripping square wave voltammetry .

As more YFV EDIII binds to the biosensor surface probe, the more probe probe sequence fills it, and cadmium sulfide reacted with nitric acid releases a large amount of cadmium ions into the solution. It is possible to observe the metal ion as a peak on the stripping voltammetry technique graph which detects very high specificity and sensitivity, and it is possible to quantitatively analyze by signal-on method.

Based on electrochemistry, the YFV EDIII was detected using the selected YF1 calibrator. As a result, as shown in FIG. 5A and FIG. 5B, it was confirmed that the current value increases as the concentration of YFV EDIII increases (1 pM - 100 nM) (see FIG. 5A). A graph plotting the current value on the y-axis and the concentration of YFV EDIII converted to Log on the x-axis was derived. The detection limit of YFV EDIII was quantitatively determined through the prepared biosensor, and the detection limit was 0.10 pM (See FIG. 5B).

Example 7. Confirmation of Binding Specificity of YFV EDIII Detection Compression Tumor

For DNA aptamer to be used as a biosensor, the binding specificity that does not react with other proteins in the blood is important in addition to the target YFV EDIII. To confirm whether the DNA aptamer selectively binds, binding specificity Respectively. At this time, the concentration of each protein was adjusted to 10 nM in PBS and detected.

As a result, as shown in Fig. 6, it was confirmed that YFV EDIII was excellent in specificity. In particular, CHIKV among the contrasted proteins was found to be a surface protein of a tropical infectious virus similar to YFV, and does not bind to DNA plasmers developed in the present invention, although it is generally known to have a high cross-reactivity between tropical infectious diseases . This means that the DNA aptamer of the present invention reacts with YFV EDIII with high binding specificity. It was also highly specific compared to the serum protein HSA.

From the above, it is meant that the DNA plasmid YF1 developed in the present invention not only has a very high binding specificity to YFV EDIII but also can be used as a biosensor in a complex biological sample.

For reference, the list of the sequence listing of the present invention is shown in Table 3 below.

Sequence List designation order SEQ ID NO: 1 YFV EDIII Forward primer CCC GGA TCC TCT GCT CTG ACC CTG AAA GG SEQ ID NO: 2 YFV EDIII Reverse primer CCC AAG CTT TTT ACC GAT AGA AGA ACC TTC TTT GTG CC SEQ ID NO: 3 ssDNA library cacctaatacgactcactatagcggatccgannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnctggctcgaacaagcttgc
SEQ ID NO: 4 Forward primer cacctaatac gactcactat agcgga SEQ ID NO: 5 Reverse primer gcaagcttgt tcgagccag SEQ ID NO: 6 YF1 Aptamer GTTCGAGTTGGACTGCTTCTAGGATTGCTGGCTCGAAC

It will be understood by those skilled in the art that the foregoing description of the present invention is for illustrative purposes only and that those of ordinary skill in the art can readily understand that various changes and modifications may be made without departing from the spirit or essential characteristics of the present invention. will be. It is therefore to be understood that the above-described embodiments are illustrative in all aspects and not restrictive.

<110> POSTECH ACADEMY-INDUSTRY FOUNDATION          MD Healthcare Inc. <120> DNA aptamer binding specifically to yellow fever virus envelope          protein domain III (YFV EDIII) and uses thereof <130> MP18-244 <160> 6 <170> KoPatentin 3.0 <210> 1 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> YFV EDIII Forward primer <400> 1 cccggatcct ctgctctgac cctgaaagg 29 <210> 2 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> YFV EDIII Reverse primer <400> 2 cccaagcttt ttaccgatag aagaaccttc tttgtgcc 38 <210> 3 <211> 90 <212> DNA <213> Artificial Sequence <220> <223> ssDNA library <400> 3 cacctaatac gactcactat agcggatccg annnnnnnnn nnnnnnnnnn nnnnnnnnnn 60 nnnnnnnnnn nctggctcga acaagcttgc 90 <210> 4 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 4 cacctaatac gactcactat agcgga 26 <210> 5 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer <400> 5 gcaagcttgt tcgagccag 19 <210> 6 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> YF1 Aptamer <400> 6 gttcgagttg gactgcttct aggattgctg gctcgaac 38

Claims (9)

As a DNA typing reagent that specifically binds to yellow fever virus envelope protein domain III (YFV EDIII)
Wherein the DNA stranded DNA comprises the nucleotide sequence of SEQ ID NO: 6. The method according to claim 1,
Wherein the YFV EDIII is a domain protein contained in the surface of a yellow fever virus antigen. 11. A yellow heat diagnostic composition comprising the DNA thermometer of claim 1. A yellow heat diagnostic kit comprising the DNA thermometer of claim 1. Yellow fever virus envelope protein domain III (YFV EDIII) -specific DNA extender; And a substrate on which the DNA aptamer is immobilized.
Wherein the DNA hypertrophy comprises the nucleotide sequence of SEQ ID NO: 6. 6. The method of claim 5,
Wherein the substrate comprises a metal electrode layer and a metal nanoparticle layer, and the metal is gold (Au). 6. The method of claim 5,
Wherein the DNA aptamer is hybridized with a fixed sequence and fixed on a substrate with a double strand. A method for providing information for the diagnosis of yellow fever, comprising the steps of:
(a) injecting a test sample into the biosensor of claim 5;
(b) injecting a detection probe including a quantum dot into the biosensor that has processed the sample of the sample of step (a);
(c) injecting an acid into the biosensor into which the detection probe containing the quantum dot of (b) is injected;
(d) obtaining a solution in which the quantum dots of the step (c) are reacted with the acid; And
(e) measuring a current (Ampere; A) of the solution in the step (d). 9. The method of claim 8,
Wherein the quantum dot is Cadmium Sulfide (CdS).

Images