KR101906491B1

KR101906491B1 - Composition for Genome Editing comprising Cas9 derived from F. novicida

Info

Publication number: KR101906491B1
Application number: KR1020160160813A
Authority: KR
Inventors: 김진수; 이승환; 김광은
Original assignee: 기초과학연구원
Priority date: 2015-11-30
Filing date: 2016-11-29
Publication date: 2018-12-05
Also published as: KR20170063399A; WO2017095111A1

Abstract

Using the method of the present invention, it is possible to solve the limitations of the CRISPR-Cas9 system using the existing S. pyogene Cas9 protein, so that it can be effectively used for dielectric correction technology.

Description

[0001] The present invention relates to a composition for genetic correction comprising Cas9 derived from F. novicida (Composition for Genome Editing as Cas9 derived from F. novicida)

The present invention relates to a dielectric correction technique using Cas9 protein derived from F. novicida . More specifically, it relates to a ribonucleic acid protein including a Cas9 protein derived from F. novicida and a guide RNA, a composition for correcting a dielectric comprising the ribonucleic acid protein, a method for correcting a dielectric using the ribonucleic acid protein, A method for producing a transformant, and a transformant prepared by the above method are provided.

Currently, the CRISPR-Cas9 system, a type of bacterial immune system, is widely used in various fields because of its ability to specifically and efficiently cut target genes. These Cas9 proteins, also called gene scissors, require recognition of a specific nucleotide sequence (PAM) to cut the target DNA. Typical S. pyogene Cas9 PAM has an NGG sequence, and when considering the double helix DNA structure, a target sequence can be set within the target gene every 8 bp. The Cas9 gene, which is linked to DNA based on the PAM sequence, is cut in a blunt-end format 3 bp before the PAM sequence.

These features of S. pyogen Cas9 give specificity to the target and at the same time have a limited character. Therefore, we would like to reinforce the limitation of existing S. pyogene Cas9 (SpCas9) by using ortholog Cas9 obtained from other bacterial species Research is underway.

The present invention relates to the use of F. novicida ( Francisella novicida ) Cas9 protein.

An example is F. novicida ( Francisella novicida ) Cas9 protein and a guide RNA.

Another example provides a composition for dielectric correction comprising a composition for dielectrophoresis comprising the ribonucleic acid protein, a nucleic acid molecule encoding the same, a recombinant vector comprising the nucleic acid molecule, or a recombinant cell comprising the recombinant vector .

Another example provides a method of dielectric correction comprising introducing a ribonucleic acid protein, a nucleic acid molecule encoding the same, or a recombinant vector comprising the nucleic acid molecule into a cell and / or an organism.

Another example provides a method for producing a transformant comprising the step of introducing the ribonucleic acid protein, a nucleic acid molecule encoding the same, or a recombinant vector comprising the nucleic acid molecule into a cell and / or an organism.

Another example provides a transformant produced by the method for producing a transformant.

Another example provides a nucleic acid molecule encoding the ribonucleic acid protein.

Another example provides a recombinant vector comprising the nucleic acid molecule and a recombinant cell into which the recombinant vector is introduced into a host cell.

Among the Cas9 orthologs known in the art, as one of the studies for discovering a new Cas9 protein that can overcome the shortcomings of the S. pyogene Cas9 protein used in the existing CRISPR-Cas9 system, Francisella target (target; target) at the molecular level and cell level, by removing the Cas9 ortholog (FnCas9) from bacterial species that has the scientific name of novicida to clarify the principle of cutting the gene, there is provided a dielectric correction technology using the same.

According to the above dielectric correction technique, since the limitation of the CRISPR-Cas9 system using the existing S. pyogene Cas9 protein can be overcome, it can be effectively used for dielectric correction. According to a specific embodiment of the present invention, a CRISPR-Cas9 system using F. novicida Cas9 protein is capable of cleaving a junction terminal form at a desired position of a target DNA. Also, according to a specific embodiment of the present invention, a specific gene in a cell can be calibrated with the CRISPR-Cas9 system using F. novicida Cas9 protein. Also, according to a specific embodiment of the present invention, it is possible to efficiently introduce an external gene into a specific gene in a cell using the CRISPR-Cas9 system using the F. novicida Cas9 protein.

As used herein, the term 'genome editing' refers to the loss, alteration, and / or recovery of a gene function by deletion or insertion of a nucleic acid by cleavage at a target site of the target gene Modification) of the signal.

More specifically, one example is Francisella and a ribonucleic acid protein (Cas9 protein-guide RNA complex, also referred to as Cas9 system) comprising Cas9 protein and guide RNA derived from novicida .

Cas9 (CRISPR associated protein 9) is an RNA-guided endonuclease (RGEN), which is one of CRISPR type II RNA-guided DNA endonuclease. I am responsible.

The Cas9 protein used in the gene correction technology provided herein is a protein derived from Francisella novicida , which is available from Protein Data Bank (PDB) accession No. (SEQ ID NO: 1) described in the crystal structure of Francisella novicida Cas9 in complex with sgRNA and target DNA (TGG PAM).

The Francisella The novicida- derived Cas9 protein may be a form that is easy to introduce into cells. For example, the Cas9 protein may be linked to a cell penetrating peptide and / or a protein transduction domain. The protein transfer domain may be a poly-arginine or a TAT protein derived from HIV, but is not limited thereto. Various types of cell penetrating peptide or protein transfer domains other than the above-described examples are well known in the art, so that a person skilled in the art can apply various examples without limitation to the above examples.

In addition, the Cas9 protein or the nucleic acid molecule encoding the Cas9 protein may further include a nuclear localization signal (NLS) sequence. Therefore, the expression cassette containing the nucleic acid molecule encoding the Cas9 protein may contain a regulatory sequence such as a promoter sequence for expressing the Cas9 protein or, in addition, an NLS sequence. Such NLS sequences are well known in the art. In particular, when the Cas9 protein or a ribonucleic acid protein comprising it is applied to eukaryotic cells and / or eukaryotic organisms, the NLS sequence may be required.

The Cas9 protein or a nucleic acid molecule encoding the Cas9 protein may be associated with a tag for isolation and / or purification or a nucleic acid sequence encoding the tag. For example, the tag may be appropriately selected from the group consisting of a small peptide tag such as a His tag, a Flag tag, an S tag, etc., a GST (Glutathione S-transferase) tag, an MBP (Maltose binding protein) tag, It does not.

The term " guide RNA " refers to a target DNA-specific RNA (e.g., an RNA capable of hybridizing with a target site of DNA).

The guide RNA comprises two guide RNAs, namely, a CRISPR RNA (crRNA) having a nucleotide sequence capable of hybridizing with a target region of the gene and an additional trans- activating crRNA (tracrRNA) (part or all) and tracrRNA (part or all) are linked through a linker to form a single guide RNA (RNA) ; sgRNA).

In one example, Francisella The crRNA used in the Cas9 system containing Cas9 protein from novicida can be represented by the following general formula 1:

5 '- (N _cas9 ) m-GUUUCAGUUGCUGAAUUAUUUGGUAAAC-3' (SEQ ID NO: 2)

In the general formula 1,

N _cas9 is a target sequence region containing a nucleotide sequence capable of hybridizing with a gene target site and is determined according to the target region of the target gene, m is an integer of 16 to 24 representing the number of nucleotides contained in the target sequence region, And the nucleotides may be the same or different from each other and may be independently selected from the group consisting of A, U, C and G,

A site containing 28 consecutive nucleotides (GUUUCAGUUGUUAUUAUUUGGUAAAC; SEQ ID NO: 3) located in the 3 'direction of the targeting sequence region is an essential part of the crRNA.

In the present specification, a nucleotide sequence capable of hybridizing with a gene target site is at least 50% identical to the nucleotide sequence of the gene target site (more specifically, the nucleotide sequence of the opposite strand of the strand where PAM is present in the DNA double strand of the gene target site) Means a nucleotide sequence having a sequence complementarity of 60% or more, 70% or more, 80% or more, 90% or more, 95% or more, 99% or more, or 100% ).

Also, Francisella The tracrRNA used in the Cas9 system, including Cas9 protein from novicida, can be represented by SEQ ID NO: 4:

5'- GUACCAAAUAAUUA AUGCUCUGUAAUCAUUUAAAAGUAUUUUGAACGGACCUCUGUUUGACACGUCUGAAUAACUAAAAA -3 '(SEQ ID NO: 4)

In SEQ ID NO: 4, the region containing the underlined 66 nucleotides (AUGCUCUGUAAUCAUUUAAAAGUAUUUAAAAGUAUUUGAGAACGGACCUCUGUUUGACACGUCUGAAUAACUAAAAA; SEQ ID NO: 5) is an essential part of the tracrRNA and can be used to construct the sgRNA.

Also, Francisella The sgRNA used in the Cas9 system containing the novicida- derived Cas9 protein has a structure in which the crRNA region including the target sequence region and the essential region of the Cas9 crRNA and the tracrRNA region including the essential region of the Cas9 tracrRNA are mutated through the nucleotide linker . &Lt; / RTI > More specifically, the sgRNA is a double-stranded RNA molecule in which a crRNA region containing a targeting sequence region and an essential region of a crRNA and a tracrRNA region containing an essential region of the Cas9 tracrRNA are bound to each other, and a 3'- And the 5 ' end of the region may have a hairpin structure connected through a nucleotide linker.

The targeting sequence and essential regions of the crRNA and essential regions of the tracRNA are as described above. The linker may contain 3 to 5 nucleotides, such as 4 nucleotides, and the nucleotides may be the same or different from each other and may be independently selected from the group consisting of A, U, C and G. In one example, the linker may be, but is not limited to, a nucleotide sequence of 'GAAA'.

For example, the sgRNA may be represented by the following general formula 2:

5 '- (N _cas9 ) _m -GUUUCAGUUGCU- (linker) -AUGCUCUGUAAUCAUUUAAAAGUAUUUUGAGAGGACCUCUGUUUGACACGUCUGAAUAACUAAAAA-3' (SEQ ID NO: 6)

In the general formula 2,

N _cas9 is a target sequence region containing a nucleotide sequence capable of hybridizing with a gene target site and is determined according to the target region of the target gene, m is an integer of 16 to 24 representing the number of nucleotides contained in the target sequence region, Lt; / RTI > may be an integer from 18 to 22;

The linker may comprise from 3 to 5, for example 4, nucleotides,

The target sequence region and the nucleotides included in the linker may be the same or different from each other, and may be independently selected from the group consisting of A, U, C and G, and may be, for example, 'GAAA'.

1 to 3 guanine (G) is added to the 5 'end (i.e., the 5' end of the targeting sequence region of the crRNA) of the crRNA (for example, represented by the general formula 1) or the sgRNA (for example, represented by the general formula 3) As shown in FIG.

The tracrRNA or sgRNA may further comprise a termination site comprising 5 to 7 uracil (U) at the 3'end of an essential part of the tracrRNA (66nt).

Another example provides a guide RNA molecule comprising a crRNA represented by the general formula 1 as described above and a tracrRNA represented by SEQ ID NO: 4, or an sgRNA represented by the general formula 2. [ The guide RNA molecules Francisella may be for use with the novicida- derived Cas9 protein.

The ribonucleic acid protein is delivered in vivo or in a cell to be genetically modified through a recombinant vector containing a sequence encoding the same, and is expressed in vivo or intracellularly to form a ribonucleic acid protein complex or function in vitro lt; RTI ID = 0.0 > Francisella The complex (ribonucleic acid protein) itself is directly introduced into a living body or a cell by a method such as injection, electroporation, or lipofection, and is produced by forming a complex of a guide RNA derived from novicida and Cas9 have.

Another example provides a nucleic acid molecule encoding the ribonucleic acid protein. The nucleic acid molecule Francisella a first nucleic acid molecule encoding the novicida- derived Cas9 protein and a second nucleic acid molecule encoding the guide RNA. The second nucleic acid molecule encoding the guide RNA may be the encoding nucleic acid molecule of the crRNA and the encoding nucleic acid molecule of the tracrRNA or the nucleic acid molecule encoding the sgRNA described above.

Another example provides a recombinant vector comprising the nucleic acid molecule. The recombinant vector is Francisella a second recombinant vector comprising a first recombinant vector comprising a first nucleic acid molecule encoding a novicida- derived Cas9 protein and a second nucleic acid molecule encoding a guide RNA, or a second recombinant vector comprising a first nucleic acid molecule and a second nucleic acid molecule, It can be included together.

Another example provides a recombinant cell comprising said recombinant vector. The recombinant cell may be one prepared by introducing the recombinant vector into an appropriate host cell.

The nucleic acid molecule may be optimized with appropriate codons for expression in the expression system of the host cell to be expressed.

The composition for dielectric correction may be applied to the dielectric modification of cells and / or organisms, and the cells and / or organisms may be eukaryotic or eukaryotic organisms. The eukaryotic and / or eukaryotic organisms may be eukaryotic (e. G., Fungi such as yeast, eukaryotic and / or eukaryotic plant derived cells such as embryonic cells, stem cells, somatic cells, (For example, primates such as humans and monkeys, dogs, pigs, cows, sheep, goats, mice, rats and the like) and eucaryotic plants (such as algae such as green algae, corn, soybean, wheat and rice) It may be selected.

Another example is introducing into a cell and / or organism a composition for genetic correction comprising the ribonucleic acid protein, a nucleic acid molecule encoding the same, a recombinant vector comprising the nucleic acid molecule, or a recombinant cell comprising the recombinant vector And a dielectric layer.

The dielectric correction method provided herein can be applied not only to the cleavage at the target site of the target gene but also to the cleavage terminus generated by the cleavage, thereby making it possible to introduce foreign genes into the genome with high accuracy.

In one example, the dielectric correction may additionally mean introducing (inserting) a foreign gene at the cleavage site, in addition to generating a cleavage at the target site of the target gene of the genome. Thus, the genetic modification composition may further comprise a foreign gene through a recombinant vector or a recombinant vector which is separate from or identical to the nucleic acid molecule encoding the ribonucleic acid protein. In addition, the above-mentioned dielectric correction method may further include the step of introducing a foreign gene into the cell or organism through a recombinant vector or recombinant cell, which is separate from or identical to the nucleic acid molecule encoding the ribonucleic acid protein.

Another example of the present invention includes a step of introducing a ribonucleic acid protein, a nucleic acid molecule encoding the ribonucleic acid protein, a recombinant vector containing the nucleic acid molecule, or a recombinant vector containing the recombinant vector, into a cell or an organism together with a foreign gene A method for introducing a foreign gene into a genome. The foreign gene may be homologous or heterologous to the cell or organism into which the foreign gene is to be introduced and may be introduced by a recombinant vector or recombinant cell which is the same as or different from the nucleic acid molecule encoding the ribonucleic acid protein.

Another example provides a composition for producing a transformant comprising the ribonucleic acid protein, a nucleic acid molecule encoding the same, a recombinant vector comprising the nucleic acid molecule, or a recombinant cell comprising the recombinant vector.

Another example is a method for introducing a recombinant vector comprising the ribonucleic acid protein, a nucleic acid molecule encoding the same, a recombinant vector comprising the nucleic acid molecule, or a recombinant vector comprising the recombinant vector into a cell and / ). &Lt; / RTI > If the transformed organism is a transgenic eukaryote animal or a transformed eukaryotic plant, the method may further comprise the step of culturing and / or differentiating the eukaryotic cell either simultaneously with or subsequent to the step of delivering.

Another example is a recombinant vector comprising the recombinant vector comprising the ribonucleic acid protein, the nucleic acid molecule encoding the same, the nucleic acid molecule, or the recombinant vector containing the recombinant vector (for example, )). &Lt; / RTI >

The cells and / or organisms may be eukaryotic or eukaryotic organisms. The eukaryotic and / or eukaryotic organisms may be eukaryotic (e. G., Fungi such as yeast, eukaryotic and / or eukaryotic plant derived cells such as embryonic cells, stem cells, somatic cells, (For example, primates such as humans and monkeys, dogs, pigs, cows, sheep, goats, mice, rats and the like) and eucaryotic plants (such as algae such as green algae, corn, soybean, wheat and rice) It may be selected.

In the dielectric correction method and the method for producing a transformed organism provided herein, the eukaryotic animal may be excluded from a human, and the eukaryotic cell may include cells isolated from an eukaryotic animal including a human.

In such methods, the ribonucleic acid protein, the nucleic acid molecule encoding it, or a recombinant vector / recombinant cell comprising it may be introduced into cells and / or organisms such as eukaryotes and / or eukaryotic organisms (e.g., Such as by subcutaneous injection, intraperitoneal injection, oral injection, targeted site local injection, electroporation, or lipofection.

Figure 1 shows the result of SDS-PAGE electrophoresis of purified recombinant FnCas9 protein.
FIGS. 2A to 2C show the PAM nucleotide sequence and the cleavage site of FnCas9 on the target DNA,
2a schematically shows in-vitro cleavage analysis using purified recombinant FnCas9 and guide RNA,
2b shows an enlarged view of 2a PCR (PAM Randomized PCR, Stuffer PCR, Overlap PCR)
2c is a logarithmic sequence showing the PAM nucleotide sequence of the fragment obtained by FnCas9 among the data obtained by the targeted deep-sequencing after the in-vitro cleavage experiment and showing the nucleotide sequence information combined.
FIGS. 3A and 3B show the result of plasmid cleavage experiment for identifying the PAM nucleotide sequence recognized by FnCas9,
3a shows the activity of the CCR5 gene by double-guide RNA and single-guide RNA (the target nucleotide sequence is underlined and the GAAA linker connecting the crRNA and the tracrRNA is represented by a dot, respectively) ,
3b shows the result of FnCas9 PAM nucleotide sequence confirmation experiment using plasmid digestion. Plasmid having different PAM nucleotide sequence after the same target nucleotide sequence of gene CCR5 was substituted with single base by site-directed mutation was linearized with restriction enzyme NcoI (RNA guided endonuclease: guide RNA + FnCas9) after treatment with purified FnCas9 and guide RNA complexes, followed by 0.8% agarose gel electrophoresis.
4A to 4C show the result of confirming the 5'-adherent end of the target DNA cleavage site by FnCas9. After the PCR product containing the CCR5 target site was cut into recombinant SpCas9 and FnCas9, the cleaved fragments were subjected to standard Sanger sequencing method. 4a is the result of run-off sequencing of the target CCR5 Locus 1 DNA truncated by the SpCas9 protein, 4b is the standard Sanger sequencing result of the CCR5 Locus 1 DNA truncated by the FnCas9 protein, and 4c is the final nucleotide obtained from the 4b (Sanger sequencing of DNA of the same target, CCR5 locus2, cut by the FnCas9 protein, in order to show that the sequence is due to A-tailing of the polymerase (arrows indicate the sequence of the target CCR5 nucleotide sequence Proteins, and the nucleotide sequence read after the cleaved portion in 4b and 4c represents A-tailing by DNA polymerase, respectively.
FIGS. 5A and 5B show the results of the cell genome correction using intracellular delivery of FnCas9 RNP (RNA-protein complex)
5a is the result of genetic calibration analysis of FnCas9 in K562 cells according to the change of guide RNA length using the T7E1 assay, and the degree of mutation (%) of the target DNA with mutation was indicated by T7E1,
5b was the result of AAVS1 targeted deep-sequencing analysis of the same experimental group and control group used in the T7E1 assay. The degree of mutation (insertion and deletion%) was quantified and histogrammed, and the representative DNA fragment of target DNA cloned by SpCas9 and FnCas9 (Arrows indicate the cleavage site cleaved by each protein).
FIG. 6 shows the results of cytogenetic correction using intracellular delivery of FnCas9 RNP (RNA-protein complex) in various intracellular genes. (A) T7E1 assay and deep- Sequencing of the CCR5 (TS1) site was performed after 48 hours of intracellular delivery using the FnCas9 protein and CCR5 (TS1) -specific sgRNA, and T7E1 enzyme treatment was performed to determine whether the mutation was correctly induced And the star mark represents the product of the PCR product cleaved by T7E1 enzyme and the value shown at the bottom is the value obtained by analyzing the PCR amplification product by NGS (Next Generation Sequencing). (B) HEK293 (NGS) to determine whether mutations were induced by FnCas9 on CCR5 (TS1) gene (CCR5 (TS2), AAVS1, NRAS and EMX1) This is a graph showing the result.
7 is a schematic diagram of insertion of an external gene into a target gene in a cell using FnCas9. Without the promoter, a plasmid containing the GFP gene is prepared and transferred into the cell together with the FnCas9-guide RNA complex. The 5'-junction ends are generated by FnCas9 in the target region of plasmid and intracellular genomic gene, and GFP, which is an external gene, is efficiently combined with NHEJ method and inserted into the intracellular genome gene. The GFP fluorescence signal can be confirmed as the target protein is expressed only in the presence of the internal promoter. Each part of the plasmid and genomic DNA cleaved by FnCas9 was indicated by a red arrow.
FIGS. 8A and 8B show the experimental procedure and results of knock-in of an external gene into an intracellular target gene using FnCas9,
8a shows an experimental design scheme for observing whether an external gene can be efficiently inserted into an intracellular target gene by FnCas9 (transferring sgRNA and FnCas9, which function in a specific gene (CCR5 (TS1)) in HEK293 cells, It is possible to measure the degree of knock-in of intracellular gene by transferring DNA of the type (incomplete end), incorrect (miscommunicate with the target intersection at the junction end), and Correct (match with the target intersection with the end of the junction) A red triangle represents a cut plane by FnCas9),
8b shows the results of a deep-sequencing comparison of insertion efficiency (Knock-in) into specific genes (CCR5 (TS1)) in HEK293 cells by FnCas9 and SpCas9 (the other indel (%), And the complete blue (complete KI; ③) indicates the rate of insertion of the foreign gene perfectly (%). ).

Hereinafter, the present invention will be described in more detail with reference to the following examples, which should not be construed as limiting the scope of the present invention. It will be apparent to those skilled in the art that the embodiments described below may be modified without departing from the essential spirit of the invention.

Example One. FnCas9 Isolation and Purification of Recombinant Proteins

A nucleic acid molecule encoding a (6x) His-tagged form at the C-terminus of the FnCas9 protein (see PDB 5B2O; SEQ ID NO: 1) was cloned into the plasmid (pET28-a; Novagen) using Gibson assembly , And then introduced into a bacterial system bacterial system (Rosetta; Novagen) and cultured at 18 ° C for 24 hours to express the FnCas9 protein, followed by separation and purification using a Ni-NTA column. The purification results are shown in Fig. As shown in Fig. 1, generation of FnCas9 protein having a high-purity state of a size of 185 kDa was confirmed (Fig. 1).

In addition, the guide RNA was in-vitro transcribed by T7 RNA polymerase (New England Biolabs) based on the DNA template, RNA was synthesized according to the manufacturer's instructions, and DNA template was removed using DNAase (Ambion). The RNA transfected by Expin Combo kit (GeneAll) and isopropanol precipitation was purified. The nucleotide sequences of the guide RNAs are summarized in Table 1 below.

RNA type Sequence (5 'to 3') crRNA
(CCR5 Locus 1 target) G UGACAUCAAUUAUUAUACAU GUUUCAGUUGCUGAAUUAUUUGGUAAAC (SEQ ID NO: 7) crRNA
(CCR5 Locus 2 target) G GTAGAGCGGAGGCAGGAGGC GUUUCAGUUGCUGAAUUAUUUGGUAAAC (SEQ ID NO: 8) 트로르르RNA GUACCAAAUAAUUAAUGCUCUGUAAUCAUUUAAAAGUAUUUUGAGAGGACCUCUGUUUGACACGUCUGAAUAACUAAAAA (SEQ ID NO: 4) Single-guide RNA (CCR5 Locus 1 target) G UGACAUCAAUUAUUAUACAU GUUUCAGUUGCU GAAA AUGCUCUGUAAUCAUUUAAAAGUAUUUUGAACGGACCUCUGUUUGACACGUCUGAAUAACUAAAAA (SEQ ID NO: 9) Single-guide RNA (CCR5 Locus 2 target) G GTAGAGCGGAGGCAGGAGGC GUUUCAGUUGCU GAAA AUGCUCUGUAAUCAUUUAAAAGUAUUUUGAACGGACCUCUGUUUGACACGUCUGAAUAACUAAAAA (SEQ ID NO: 10) Single-guide RNA (AAVS1 target) G CUCCCUCCCAGGAUCUCUCUC GUUUCAGUUGCU GAAA AUGCUCUGUAAUCAUUUAAAAGUAUUUUGAACGGACCUCUGUUUGACACGUCUGAAUAACUAAAAA (SEQ ID NO: 11) crRNA
(AAVS1 target, gx18) G CCCUCCCAGGAUCUCUCUC GUUUCAGUUGCUGAAUUAUUUGGUAAAC (SEQ ID NO: 12) crRNA
(AAVS1 target, gx19) G UCCCUCCCAGGAUCCUCUC GUUUCAGUUGCUGAAUUAUUUGGUAAAC (SEQ ID NO: 13) crRNA
(AAVS1 target, gx20) G CUCCCUCCCAGGAUCUCUCUC GUUUCAGUUGCUGAAUUAUUUGGUAAAC (SEQ ID NO: 14) crRNA
(AAVS1 target, gx21) G UCUCCCUCCCAGGAUCUCUCUC GUUUCAGUUGCUGAAUUAUUUGGUAAAC (SEQ ID NO: 15) crRNA
(AAVS1 target, gx22) G CUCUCCCUCCCAGGAUCUCUCUC GUUUCAGUUGCUGAAUUAUUUGGUAAAC (SEQ ID NO: 16) Single-guide RNA (CCR5-TS1 target, gx20) G UGGGGUGGGAUAGGGGAUAC GUUUCAGUUGCUGAAAAUGCUCUGUAAUCAUUUAAAAGUAUUUUGAGAGGACCUCUGUUUGACACGUCUGAAUAACUAAAAA (SEQ ID NO: 17) Single-guide RNA (CCR5-TS2 target, gx20) G UGACAUCAAUUAUUAUACAU GUUUCAGUUGCUGAAAAUGCUCUGUAAUCAUUUAAAAGUAUUUUGAGAGGACCUCUGUUUGACACGUCUGAAUAACUAAAAA (SEQ ID NO: 18) Single-guide RNA (AAVS1 target, gx20) G CUCCCUCCCAGGAUCACUCUC GUUUCAGUUGCUGAAAAUGCUCUGUAAUCAUUUAAAAGUAUUUUGAGAGGACCUCUGUUUGACACGUCUGAAUAACUAAAAA (SEQ ID NO: 19) Single-guide RNA (NRAS target, gx20) G GGUAAGGGGGCAGGGAGGGA GUUUCAGUUGCUGAAAAUGCUCUGUAAUCAUUUAAAAGUAUUUUGAGAGGACCUCUGUUUGACACGUCUGAAUAACUAAAAA (SEQ ID NO: 20) Single-guide RNA (EMX1 target, gx20) G GAGUCCGAGCAGAAGAAGAA GUUUCAGUUGCUGAAAAUGCUCUGUAAUCAUUUAAAAGUAUUUUGAGAGGACCUCUGUUUGACACGUCUGAAUAACUAAAAA (SEQ ID NO: 21)

In Table 1, the underlined portion corresponds to the nucleotide sequence (target sequence) of the target region of the target DNA, and the portion indicated in bold indicates a part of the crRNA in sgRNA (single-guide RNA) by linking crRNA and tracrRNA (GAAA), which shows a part of the crRNA at the 5 'end of the linker and a part of the tracrRNA at the 3' end of the linker (GAAA), respectively.

The target sequences targeted by the guide RNAs are summarized in Table 2 below:

gene Target Sequence (5 'to 3') CCR5 Locus 1 target TGACATCAATTATTATACAT (SEQ ID NO: 22) CCR5 Locus 2 target GTAGAGCGGAGGCAGGAGGC (SEQ ID NO: 23) AAVS1 target, gx20 CTCCCTCCCAGGATCCTCTC (SEQ ID NO: 24) AAVS1 target, gx18 CCCTCCCAGGATCCTCTC (SEQ ID NO: 25) AAVS1 target, gx19 TCCCTCCCAGGATCCTCTC (SEQ ID NO: 26) AAVS1 target, gx21 TCTCCCTCCCAGGATCCTCTC (SEQ ID NO: 27) AAVS1 target, gx22 CTCTCCCTCCCAGGATCCTCTC (SEQ ID NO: 28) CCR5-TS1 target, gx20 TGGGGTGGGATAGGGGATAC (SEQ ID NO: 29) CCR5-TS2 target, gx20 TGACATCAATTATTATACAT (SEQ ID NO: 30) NRAS target, gx20 GGTAAGGGGGCAGGGAGGGA (SEQ ID NO: 31) EMX1 target, gx20 GAGTCCGAGCAGAAGAAGAA (SEQ ID NO: 32)

Example 2. Genetic scissors FnCas9's target PAM in DNA Nucleotide Identify sequences and cleavage sites

In order to identify the principle of FnCas9 recognition and cleavage of the target DNA, a test was carried out in-vitro to identify a PAM nucleotide sequence known to be required for DNA recognition (see FIG. 2A).

First, a library of DNA fragments randomly assigned to a portion of the target DNA nucleotide sequence (CCR5 (Genbank Accession number: U54994.1) and AAVS1 (Genbank Accession number: S51329.1) recognized as PAM was prepared and subjected to deep- A DNA base fragment having the same nucleotide sequence as the specific nucleotide sequence (in the 3 'direction) behind the PAM was extended by overlap PCR to form a final library, which is schematically shown in FIG. 2B.

The primer sequences used in Figure 2b are as follows:

F1 primer: GGACTATCATATGCTTACCGTAACT (SEQ ID NO: 33)

R1 primer: CTCTCCATCCTCTTGCTTTCTTNNNNNNNNNNGAGCTGGGACCACCTTATAT (SEQ ID NO: 34)

F2 primer: AAGAAAGCAAGAGGATGGAGAGCACGCTGTAGGTATCTCAGTTC (SEQ ID NO: 35)

R2 primer: CTACATACCTCGCTCTGCTAATC (SEQ ID NO: 36)

PCR using F1-R1, PCR using F2-R2, and PCR using F1-R2 were performed under the conditions shown in Tables 3 and 4 below:

DNA 10ng Primer F (10 pmol / ul) 1ul Primer R (10 pmol / ul) 1ul dNTP (Beams biotechnology, 10 mM, 5301-16 L) 1ul 5X HF buffer 10ul Phusion enzyme (Thermo, F-530L) 0.5ul DW to 50ul

98 ℃ 30sec 98 ℃ 10sec 65 ℃ 20 sec 72 ℃ 30sec 30 cycles (98 ℃ - 65 ℃ - 72 ℃) 72 ℃ 5min 20 ℃ forever

Then, a complex of recombinant FnCas9 protein (FIG. 1) purified with high purity in Example 1 above and guide RNA (see FIG. 3 a and Table 1) obtained by in-vitro transcription was reacted with the prepared final library products, cleavage was performed to cut a specific target site, and only target (DNA fragments) cut by FnCas9 through targeted deep-sequencing was analyzed.

The targeted deep-sequencing was performed by the following procedure: After digesting the cut DNA of a specific target site into a column form, a library required for Mi-seq analysis was prepared using TruSeq Custom Amplicon v1.5 (Illumina). Then Mi-seq. (Illumina) equipment and analyzed by Cas Analyzer of CRISPR RGEN tool (www.rgenome.net). Insertions / deletions within 5 bp of the CRISPR / Cas9 cleavage site were considered as mutations induced by FnCas9.

Figure 2c shows the results of a logo-plot using WebLogo (http://weblogo.berkeley.edu/logo.cgi) by analyzing only the nucleotide sequence of fragments cleaved by FnCas9 through in-vitro cleavage. As shown in FIG. 2C, the nucleotide sequence of the part recognized as PAM was NGG, which was similar to that of the existing SpCas9. The position of the part directly cut by the protein was 6 bp (5 'direction) Of the 3 bp front blunt-end format truncated by SpCas9.

FIG. 2C shows the logo scheme by Deep-sequencing analysis. In-vitro cleavage experiments were conducted to confirm whether FnCas9 actually recognized NGG-type PAM.

A short-form single-guide RNA was used, in which the crRNA-tracrRNA nucleotide sequence existing in the bacteria was used as a guide RNA for cutting the target DNA, or the crRNA and the tracrRNA were cut and coupled with a GAAA linker to simplify this And Table 1).

Each activity test was performed by in-vitro cleavage experiments to measure the extent to which the target DNA was cleaved. Plasmid (Genbank accession number: U54994.1) containing a nucleotide sequence of a specific target CCR5 gene and various kinds of PAM nucleotide sequences was amplified by T-vector cloning (PCR amplification of a portion corresponding to the CCR5 locus in genomic DNA , Purified by DNA purification kit, ligation to the purchased T-vector) and site-directed mutation (primer containing specific mutations to replace the desired format in the PAM (NGG) region based on T-vector cloned CCR5 plasmid After the plasmid was linearized with restriction enzyme (NcoI), the target RNA corresponding to the target CCR5 nucleotide sequence was purified and treated with recombinant FnCas9 at 37 ° C for 1 hour to obtain the cleaved fragments The pattern was confirmed to be agarose 0.8% gel. The results obtained are shown in Fig. 3B. As shown in FIG. 3B. Only the plasmids carrying the NGG-type PAM nucleotide sequence after the target nucleotide sequence were selectively recognized and cleaved by FnCas9. In addition, even if one of the two guanosines in NGG was substituted with another base, the target was not cut.

In order to further analyze the cleavage site on the target DNA via FnCas9, the cleavage fragments obtained by an in-vitro cleavage assay (cleavage using a complex of CCR5 targeting sgRNA as described in FnCas9 and Table 1) were subjected to standard Finger sequencing sequencing method. For comparison, the same tests were performed using S. pyogene Cas9 (SwissProt Accession number Q99ZW2 (NP_269215.1); SpCas9) and sgRNA for CCR5 Locus 1. The results of the analysis obtained are shown in Fig. 4a (SpCas9, CCR5 Locus 1), 4b (FnCas9, CCR5 Locus 1), and 4c (FnCas9, CCR5 Locus 2). As shown in FIGS. 4A to 4C, SpCas9 is located 3 bp away from the PAM nucleotide sequence (5'-NGG-3 ') in the 5' direction of the target CCR5 nucleotide sequence (that is, the third nucleotide in the 5 '(5'-NGG-3') in the presence of PAM (5'-NGG-3'), while FnCas9 produces a blunt- (NGG) in the opposite strand of the strand where PAM (NGG) is present (i.e., between the 6th nucleotide and the 7th nucleotide in the 5 'direction of the PAM sequence) (I.e., between the third nucleotide and the fourth nucleotide in the 3 'direction of the PAM sequence) 3' apart in the 3 'direction of the 3'-NCC-5' sticky end form.

Example 3. FnCas9 Dielectric correction in the used cell

After identifying the principle that FnCas9 cleaves the target DNA in vitro, it was applied to cell experiments. The recombinant FnCas9 protein purified in Example 1 and the specific target (AAVS1) guide RNA (see Table 1) obtained through in-vitro transcription were mixed at a proper molar ratio (FnCas9 (15 ug): guide RNA (20 ug) = 1: 6) Were mixed and introduced into K562 cells (ATCC) through an electroporation method. Then, the K562 cells were cultured for 72 hours at 37 ° C. Then, each of the cells was transferred to separate the genomic DNA, and the cells were centrifuged and lysed with lysis buffer to separate the genomic DNA. T7E1 assay (electrophoresis after T7E1 (T7 Endonuclease I) treatment at 37 ° C for 20 min after specific PCR amplification in genomic DNA) and targeted deep-sequencing (PCR amplification of target portion of AAVS1 gene followed by Deep- PCR amplification with PCR barcode primers for sequencing, purification using a DNA purification kit followed by sequencing) to determine the frequency (%) of nucleotide sequence variation caused by FnCas9 correction at a specific target site (AAVS1) Respectively.

(18 bp target sequence), gx19 (19 bp target sequence), gx20 (20 bp target sequence), gx21 (21 bp target sequence) and gx22 (22 bp target sequence) in Table 1 while changing the length of the target sequence of the guide RNA FIG. 5A shows the result of analysis in the T7E1 assay when the sgRNA and the recombinant FnCas9 were mixed and transferred to K562 cells. As shown in Fig. 5A, it was confirmed that a significant mutation was caused by AAVS1 site correction by FnCas9 on genomic DNA.

The results of quantifying the degree of mutation by deep-sequencing are shown in FIG. 5B. As shown in Fig. 5B, when the length of the target sequence of the guide RNA was changed in the experimental group, the length of gX22 was used, and FnCas9 could generate a mutation at a frequency similar to that of the existing SpCas9 (SwissProt Accession number Q99ZW2 (NP_269215.1) As shown in the results obtained in vitro (Fig. 2C and 4A-4C), FnCas9 shows a position to be cleaved from the PAM sequence portion when the mutation pattern generated in the intracellular AAVS1 site was comparatively analyzed by SpCas9 and FnCas9 In the case of using FnCas9, genomic correction was performed in a state where DNA was removed in various lengths, which shows that gene correction can be efficiently performed by FnCas9 in higher animal cells.

In addition to the AAVS1 target of K562 cells, FnCas9 was used to confirm that it could be applied to various kinds of genes and cell types. FnCas9 and guide RNA were mixed in the same molar ratio as that of 562 cells (FnCas9 (15 ug): guide RNA (20 ug) = 1: 6) and introduced into HEK293 cells (ATCC) through electroporation. HEK293 cells were transferred in this manner using guide RNA containing various target sequences of various targets (CCR5 (TS1), CCR5 (TS2), AAVS1, EMX1, NRAS) (see Table 1 target sequence). Genomic DNA was purified 48 hours after the transfer of FnCas9 and guide RNA into HEK293 cells. After PCR for all the target genes, T7E1 assay and deep-sequencing assay were performed to calculate the rate of mutation induction. Respectively.

Figure 6 (a) shows the result of T4E1 assay and deep-sequencing after CCR5 (TS1) gene correction of HEK293 cell genome. Using the FnCas9 protein and CCR5 (TS1) -specific sgRNA, the CCR5 (TS1) site was amplified after 48 hours from the intracellular delivery and the T7E1 enzyme treatment revealed that the mutation was correctly induced compared to the normal gene. The PCR product shows the products cleaved by the T7E1 enzyme, and the values shown at the bottom are the values analyzed by NGS (Next Generation Sequencing). Figure 6 (b) shows deep-sequencing (NGS) of mutation induced by FnCas9 on CCR5 (TS1) gene of HEK293 cell line and several genes (CCR5 (TS2), AAVS1, NRAS and EMX1) This is a graph showing the result of checking.

As shown in FIG. 6, it can be confirmed that FnCas9 can effectively induce mutation in various genes (CCR5, AAVS1, EMX1, and NRAS) of various kinds of high-level cells (K562 and HEK293).

Example 4. FnCas9 Introduction of external gene using

By cleavage of the gene specific region by FnCas9, an external gene can be introduced at a desired position in addition to cleavage and specific target site in the cell. Because FnCas9 generates the 5'-junction termini of the truncation point when cutting the target, the foreign gene is inserted into the desired site of the genomic DNA in a manner similar to non homologous end joining (NHEJ) High efficiency can be introduced. When a plasmid that does not contain a promoter and is unable to express an external GFP gene is transferred into a cell together with a complex of FnCas9 and a guide RNA, a plasmid into the cell and genomic DNA of the cell The target points are respectively cut by FnCas9, and they can be attached to each other by using the respective joint ends formed at the cutting points. In this case, when a marker protein (GFP) gene is inserted into the intracellular genomic DNA at a desired position, a fluorescent signal is displayed as a protein is expressed using an internal promoter. Thus, the efficiency of insertion of the foreign gene into the intracellular genome-specific region can be compared with that of the existing SpCas9 protein by the junction end generated by the target DNA cleavage of FnCas9.

This process is schematically shown in Fig. As shown in FIG. 7, a plasmid containing no GFP gene without a promoter was prepared and transferred into the cell together with the FnCas9-guide RNA complex. The 5'-junction ends are generated by FnCas9 in the target region of plasmid and intracellular genomic gene, and GFP, which is an external gene, is efficiently combined with NHEJ method and inserted into the intracellular genome gene. The GFP fluorescence signal can be confirmed as the target protein is expressed only in the presence of the internal promoter. Each part of the plasmid and genomic DNA cleaved by FnCas9 was indicated by an arrow.

In order to confirm efficient foreign gene insertion by the FnCas9 protein, an experiment was conducted in which a short DNA fragment was inserted into a specific gene in a cell (tartget: CCR5 (TS1)). FnCas9 and guide RNA were mixed with the same molar ratio (FnCas9: guide RNA: 1: 6) as in the mutagenesis experiment, and the target DNA fragments to be inserted were further mixed at a ratio of FnCas9: guideRNA: DNA = 1: 6: and then introduced into HEK293 cells (ATCC) through an electroporation method.

The inserted DNA fragments were constructed in the form of Blunt (non-conjugate end), Incorrect (miscommunicate with the cut edge of the target portion of the dielectric at the junction end), and Correct (match with the cut edge of the target portion of the dielectric at the end of the junction) , The specific sequence of which is shown in Figure 8a (the triangle represents the cleavage plane by FnCas9) and the following:

(BLUNT

5'GTTTAATTGAGTTGTCATATGTTAATAACGGTAT3 'forward (SEQ ID NO: 37)

5 'ATACCGTTATTAACATATGACAACTCAATTAAAC3' rear (SEQ ID NO: 38)

INCORRECT

5 'CTCGTTTAATTGAGTTGTCATATGTTAATAACGGTAT3' forward (SEQ ID NO: 39)

5 'GAGATACCGTTATTAACATATGACAACTCAATTAAAC3' rear (SEQ ID NO: 40)

CORRECT

5 'GGAGTTTAATTGAGTTGTCATATGTTAATAACGGTAT3' forward (SEQ ID NO: 41)

5 'TCCATACCGTTATTAACATATGACAACTCAATTAAAC3' rear (SEQ ID NO: 42)

Each of the prepared DNAs was simultaneously transferred to HEK293 cells as described above and FnCas9 and guide RNA. After 48 hours, the genomic DNA was purified, and the region of interest of the CCR5 gene was amplified by PCR and then subjected to deep- (Total sequence analysis including CATATG) was inserted to determine how much the foreign gene knocked-in (KI) into the intracellular gene. For comparison, the same test was carried out using SpCas9.

The results of the knock-in efficiency deep-sequencing comparison with the specific gene (CCR5 (TS1)) in HEK293 cells by the obtained FnCas9 and SpCas9 are shown in the following Tables 5 and 8B.

FnCas9 (-) RNP only Blunt Incorrect Correct Others 0.056 40.455 51.439 3.837 55.763 Partial KI 0.006 0.004 30.577 83.759 0.289 Full KI 0.006 0.004 0.011 0 35.216 SpCas9 (-) RNP only Blunt Incorrect Correct Others 0.09 99.321 62.544 94.414 94.284 Partial KI 0 0.018 34.231 0.008 0.198 Full KI 0 0 1.406 0 0.939

The other indel of the Y axis in FIG. 8B represents the percentage (%) in which the entire mutation is induced, the dark gray part KI is the ratio (%) of partial external gene insertion, and the complete KI It represents the percentage (%) of perfectly inserted foreign genes. As shown in Table 5 and FIG. 8, when the FnCas9 is used in the case of using SpCas9, which has been commonly used, foreign DNA can be inserted accurately without unnecessary insertion and deletion due to the characteristic of cutting the target DNA so that the terminal ends are generated (For reference, partial FnCas9 and crrect end fragment DNA fragment of FIG. 8B showed partial FNI insertion (partial KI), and the lower part (light gray part) These results show that FnCas9 can be used to efficiently and precisely calibrate an external gene by inserting it into a specific gene in a high-level cell.

<110> INSTITUTE FOR BASIC SCIENCE &Lt; 120 > Composition for Genome Editing " novicida <130> DPP20165073KR <150> KR 10-2015-0168794 <151> 2015-11-30 <160> 42 <170> Kopatentin 2.0 <210> 1 <211> 1636 <212> PRT <213> Artificial Sequence <220> <223> Cas9 derived from Francisella novicida <400> 1 Met Asn Phe Lys Ile Leu Pro Ile Ale Ile Asp Leu Gly Val Lys Asn 1 5 10 15 Thr Gly Val Phe Ser Ala Phe Tyr Gln Lys Gly Thr Ser Leu Glu Arg 20 25 30 Leu Asp Asn Lys Asn Gly Lys Val Tyr Glu Leu Ser Lys Asp Ser Tyr 35 40 45 Thr Leu Leu Met Asn Asn Arg Thr Ala Arg Arg His Gln Arg Arg Gly 50 55 60 Ile Asp Arg Lys Gln Leu Val Lys Arg Leu Phe Lys Leu Ile Trp Thr 65 70 75 80 Glu Gln Leu Asn Leu Glu Trp Asp Lys Asp Thr GIn Gln Ala Ile Ser 85 90 95 Phe Leu Phe Asn Arg Arg Gly Phe Ser Phe Ile Thr Asp Gly Tyr Ser 100 105 110 Pro Glu Tyr Leu Asn Ile Val Pro Glu Gln Val Lys Ala Ile Leu Met 115 120 125 Asp Ile Phe Asp Asp Tyr Asn Gly Glu Asp Asp Leu Asp Ser Tyr Leu 130 135 140 Lys Leu Ala Thr Glu Gln Glu Ser Lys Ile Ser Glu Ile Tyr Asn Lys 145 150 155 160 Leu Met Gln Lys Ile Leu Glu Phe Lys Leu Met Lys Leu Cys Thr Asp 165 170 175 Ile Lys Asp Asp Lys Val Ser Thr Lys Thr Leu Lys Glu Ile Thr Ser 180 185 190 Tyr Glu Phe Glu Leu Leu Ala Asp Tyr Leu Ala Asn Tyr Ser Glu Ser 195 200 205 Leu Lys Thr Gln Lys Phe Ser Tyr Thr Asp Lys Gln Gly Asn Leu Lys 210 215 220 Glu Leu Ser Tyr Tyr His His Asp Lys Tyr Asn Ile Gln Glu Phe Leu 225 230 235 240 Lys Arg His Ala Thr Ile Asn Asp Arg Ile Leu Asp Thr Leu Leu Thr 245 250 255 Asp Asp Leu Asp Ile Trp Asn Phe Asn Phe Glu Lys Phe Asp Phe Asp 260 265 270 Lys Asn Glu Glu Lys Leu Gln Asn Gln Glu Asp Lys Asp His Ile Gln 275 280 285 Ala His Leu His His Phe Val Phe Ala Val Asn Lys Ile Lys Ser Glu 290 295 300 Met Ala Ser Gly Gly Arg His Arg Ser Gln Tyr Phe Gln Glu Ile Thr 305 310 315 320 Asn Val Leu Asp Glu Asn Asn His Gln Glu Gly Tyr Leu Lys Asn Phe 325 330 335 Cys Glu Asn Leu His Asn Lys Lys Tyr Ser Asn Leu Ser Val Lys Asn 340 345 350 Leu Val Asn Leu Ile Gly Asn Leu Ser Asn Leu Glu Leu Lys Pro Leu 355 360 365 Arg Lys Tyr Phe Asn Asp Lys Ile His Ala Lys Ala Asp His Trp Asp 370 375 380 Glu Gln Lys Phe Thr Glu Thr Tyr Cys His Trp Ile Leu Gly Glu Trp 385 390 395 400 Arg Val Gly Val Lys Asp Gln Asp Lys Lys Asp Gly Ala Lys Tyr Ser 405 410 415 Tyr Lys Asp Leu Cys Asn Glu Leu Lys Gln Lys Val Thr Lys Ala Gly 420 425 430 Leu Val Asp Phe Leu Leu Glu Leu Asp Pro Cys Arg Thr Ile Pro Pro 435 440 445 Tyr Leu Asp Asn Asn Asn Arg Lys Pro Pro Lys Cys Gln Ser Leu Ile 450 455 460 Leu Asn Pro Lys Phe Leu Asp Asn Gln Tyr Pro Asn Trp Gln Gln Tyr 465 470 475 480 Leu Gln Glu Leu Lys Lys Leu Gln Ser Ile Gln Asn Tyr Leu Asp Ser 485 490 495 Phe Glu Thr Asp Leu Lys Val Leu Lys Ser Ser Lys Asp Gln Pro Tyr 500 505 510 Phe Val Glu Tyr Lys Ser Ser Asn Gln Gln Ile Ala Ser Gly Gln Arg 515 520 525 Asp Tyr Lys Asp Leu Asp Ala Arg Ile Leu Gln Phe Ile Phe Asp Arg 530 535 540 Val Lys Ala Ser Asp Glu Leu Leu Leu Asn Glu Ile Tyr Phe Gln Ala 545 550 555 560 Lys Lys Leu Lys Gln Lys Ala Ser Ser Glu Leu Glu Lys Leu Glu Ser 565 570 575 Ser Lys Lys Leu Asp Glu Val Ile Ala Asn Ser Gln Leu Ser Gln Ile 580 585 590 Leu Lys Ser Gln His Thr Asn Gly Ile Phe Glu Gln Gly Thr Phe Leu 595 600 605 His Leu Val Cys Lys Tyr Tyr Lys Gln Arg Gln Arg Ala Arg Asp Ser 610 615 620 Arg Leu Tyr Ile Met Pro Glu Tyr Arg Tyr Asp Lys Lys Leu His Lys 625 630 635 640 Tyr Asn Asn Thr Gly Arg Phe Asp Asp Asp Asn Gln Leu Leu Thr Tyr 645 650 655 Cys Asn His Lys Pro Arg Gln Lys Arg Tyr Gln Leu Leu Asn Asp Leu 660 665 670 Ala Gly Val Leu Gln Val Ser Pro Asn Phe Leu Lys Asp Lys Ile Gly 675 680 685 Ser Asp Asp Leu Phe Ile Ser Lys Trp Leu Val Glu His Ile Arg 690 695 700 Gly Phe Lys Lys Ala Cys Glu Asp Ser Leu Lys Ile Gln Lys Asp Asn 705 710 715 720 Arg Gly Leu Leu Asn His Lys Ile Asn Ile Ala Arg Asn Thr Lys Gly 725 730 735 Lys Cys Glu Lys Glu Ile Phe Asn Leu Ile Cys Lys Ile Glu Gly Ser 740 745 750 Glu Asp Lys Lys Gly Asn Tyr Lys His Gly Leu Ala Tyr Glu Leu Gly 755 760 765 Val Leu Leu Phe Gly Glu Pro Asn Glu Ala Ser Lys Pro Glu Phe Asp 770 775 780 Arg Lys Ile Lys Lys Phe Asn Ser Ile Tyr Ser Phe Ala Gln Ile Gln 785 790 795 800 Gln Ile Ala Phe Ala Glu Arg Lys Gly Asn Ala Asn Thr Cys Ala Val 805 810 815 Cys Ser Ala Asp Asn Ala His Arg Met Gln Gln Ile Lys Ile Thr Glu 820 825 830 Pro Val Glu Asp Asn Lys Asp Lys Ile Ile Leu Ser Ala Lys Ala Gln 835 840 845 Arg Leu Pro Ala Ile Pro Thr Arg Ile Val Asp Gly Ala Val Lys Lys 850 855 860 Met Ala Thr Ile Leu Ala Lys Asn Ile Val Asp Asp Asn Trp Gln Asn 865 870 875 880 Ile Lys Gln Val Leu Ser Ala Lys His Gln Leu His Ile Pro Ile Ile 885 890 895 Thr Glu Ser Asn Ala Phe Glu Phe Glu Pro Ala Leu Ala Asp Val Lys 900 905 910 Gly Lys Ser Leu Lys Asp Arg Arg Lys Lys Ala Leu Glu Arg Ile Ser 915 920 925 Pro Glu Asn Ile Phe Lys Asp Lys Asn Asn Arg Ile Lys Glu Phe Ala 930 935 940 Lys Gly Ile Ser Ala Tyr Ser Gly Ala Asn Leu Thr Asp Gly Asp Phe 945 950 955 960 Asp Gly Ala Lys Glu Glu Leu Asp His Ile Ile Pro Arg Ser His Lys 965 970 975 Lys Tyr Gly Thr Leu Asn Asp Glu Ala Asn Leu Ile Cys Val Thr Arg 980 985 990 Gly Asp Asn Lys Asn Lys Gly Asn Arg Ile Phe Cys Leu Arg Asp Leu 995 1000 1005 Ala Asp Asn Tyr Lys Leu Lys Gln Phe Glu Thr Thr Asp Asp Leu Glu 1010 1015 1020 Ile Glu Lys Lys Ile Ala Asp Thr Ile Trp Asp Ala Asn Lys Lys Asp 1025 1030 1035 1040 Phe Lys Phe Gly Asn Tyr Arg Ser Phe Ile Asn Leu Thr Pro Gln Glu 1045 1050 1055 Gln Lys Ala Phe Arg His Ala Leu Phe Leu Ala Asp Glu Asn Pro Ile 1060 1065 1070 Lys Gln Ala Val Ile Arg Ala Ile Asn Asn Arg Asn Arg Thr Phe Val 1075 1080 1085 Asn Gly Thr Gln Arg Tyr Phe Ala Glu Val Leu Ala Asn Asn Ile Tyr 1090 1095 1100 Leu Arg Ala Lys Lys Glu Asn Leu Asn Thr Asp Lys Ile Ser Phe Asp 1105 1110 1115 1120 Tyr Phe Gly Ile Pro Thr Ile Gly Asn Gly Arg Gly Ile Ala Glu Ile 1125 1130 1135 Arg Gln Leu Tyr Glu Lys Val Asp Ser Asp Ile Gln Ala Tyr Ala Lys 1140 1145 1150 Gly Asp Lys Pro Gln Ala Ser Tyr Ser His Leu Ile Asp Ala Met Leu 1155 1160 1165 Ala Phe Cys Ile Ala Ala Asp Glu His Arg Asn Asp Gly Ser Ile Gly 1170 1175 1180 Leu Glu Ile Asp Lys Asn Tyr Ser Leu Tyr Pro Leu Asp Lys Asn Thr 1185 1190 1195 1200 Gly Glu Val Phe Thr Lys Asp Ile Phe Ser Gln Ile Lys Ile Thr Asp 1205 1210 1215 Asn Glu Phe Ser Asp Lys Lys Leu Val Arg Lys Lys Ala Ile Glu Gly 1220 1225 1230 Phe Asn Thr His Arg Gln Met Thr Arg Asp Gly Ile Tyr Ala Glu Asn 1235 1240 1245 Tyr Leu Pro Ile Leu Ile His Lys Glu Leu Asn Glu Val Arg Lys Gly 1250 1255 1260 Tyr Thr Trp Lys Asn Ser Glu Glu Ile Lys Ile Phe Lys Gly Lys Lys 1265 1270 1275 1280 Tyr Asp Ile Gln Gln Leu Asn Asn Leu Val Tyr Cys Leu Lys Phe Val 1285 1290 1295 Asp Lys Pro Ile Ser Ile Asp Ile Gln Ile Ser Thr Leu Glu Glu Leu 1300 1305 1310 Arg Asn Ile Leu Thr Thr Asn Asn Ile Ala Ala Thr Ala Glu Tyr Tyr 1315 1320 1325 Tyr Ile Asn Leu Lys Thr Gln Lys Leu His Glu Tyr Tyr Ile Glu Asn 1330 1335 1340 Tyr Asn Thr Ala Leu Gly Tyr Lys Lys Tyr Ser Lys Glu Met Glu Phe 1345 1350 1355 1360 Leu Arg Ser Leu Ala Tyr Arg Ser Glu Arg Val Lys Ile Lys Ser Ile 1365 1370 1375 Asp Asp Val Lys Gln Val Leu Asp Lys Asp Ser Asn Phe Ile Ile Gly 1380 1385 1390 Lys Ile Thr Leu Pro Phe Lys Lys Glu Trp Gln Arg Leu Tyr Arg Glu 1395 1400 1405 Trp Gln Asn Thr Thr Ile Lys Asp Asp Tyr Glu Phe Leu Lys Ser Phe 1410 1415 1420 Phe Asn Val Lys Ser Ile Thr Lys Leu His Lys Lys Val Arg Lys Asp 1425 1430 1435 1440 Phe Ser Leu Pro Ile Ser Thr Asn Glu Gly Lys Phe Leu Val Lys Arg 1445 1450 1455 Lys Thr Trp Asp Asn Asn Phe Ile Tyr Gln Ile Leu Asn Asp Ser Asp 1460 1465 1470 Ser Arg Ala Asp Gly Thr Lys Pro Phe Ile Pro Ala Phe Asp Ile Ser 1475 1480 1485 Lys Asn Glu Ile Val Glu Ala Ile Ile Asp Ser Phe Thr Ser Lys Asn 1490 1495 1500 Ile Phe Trp Leu Pro Lys Asn Ile Glu Leu Gln Lys Val Asp Asn Lys 1505 1510 1515 1520 Asn Ile Phe Ala Ile Asp Thr Ser Lys Trp Phe Glu Val Glu Thr Pro 1525 1530 1535 Ser Asp Leu Arg Asp Ile Gly Ile Ala Thr Ile Gln Tyr Lys Ile Asp 1540 1545 1550 Asn Asn Ser Arg Pro Lys Val Arg Val Lys Leu Asp Tyr Val Ile Asp 1555 1560 1565 Asp Asp Ser Lys Ile Asn Tyr Phe Met Asn His Ser Leu Leu Lys Ser 1570 1575 1580 Arg Tyr Pro Asp Lys Val Leu Glu Ile Leu Lys Gln Ser Thr Ile Ile 1585 1590 1595 1600 Glu Phe Glu Ser Ser Gly Phe Asn Lys Thr Ile Lys Glu Met Leu Gly 1605 1610 1615 Met Lys Leu Ala Gly Ile Tyr Asn Glu Thr Ser Asn Asn Lys Leu Ala 1620 1625 1630 Ala Ala Leu Glu 1635 <210> 2 <211> 29 <212> RNA <213> Artificial Sequence <220> <223> crRNA, characterized by comprising a targeting sequence comprising 16-24 or 18-22 nucleotides, eacg of which is independently seleected from a, u, c and g <400> 2 nguuucaguu gcugaauuau uugguaaac 29 <210> 3 <211> 28 <212> RNA <213> Artificial Sequence <220> <223> essential sequence of crRNA <400> 3 guuucaguug cugaauuauu ugguaaac 28 <210> 4 <211> 80 <212> RNA <213> Artificial Sequence <220> <223> tracrRNA <400> 4 guaccaaaua auuaaugcuc uguaaucauu uaaaaguauu uugaacggac cucuguuuga 60 cacgucugaa uaacuaaaaa 80 <210> 5 <211> 66 <212> RNA <213> Artificial Sequence <220> <223> essential sequence of tracrRNA <400> 5 augcucugua aucauuuaaa aguauuuuga acggaccici guuugacacg ucugaauaac 60 uaaaaa 66 <210> 6 <211> 80 <212> RNA <213> Artificial Sequence <220> <223> sgRNA, where "n" at position 1 represents a targeting sequence comprising 16-24 or 18-22 nucleotides and " n " at position 14 spreading sequence comprising 3-5 nucleotides, each of The nucleotides are independently selected from a, u, c, and g <400> 6 nguuucaguu gcunaugcuc uguaaucauu uaaaaguauu uugaacggac cucuguuuga 60 cacgucugaa uaacuaaaaa 80 <210> 7 <211> 49 <212> RNA <213> Artificial Sequence <220> <223> crRNA for CCR5 Locus 1 target <400> 7 gugacaucaa uuauuauaca uguuucaguu gcugaauuau uugguaaac 49 <210> 8 <211> 49 <212> RNA <213> Artificial Sequence <220> <223> crRNA for CCR5 Locus 2 target <400> 8 ggtagagcgg aggcaggagg cguuucaguu gcugaauuau uugguaaac 49 <210> 9 <211> 103 <212> RNA <213> Artificial Sequence <220> <223> Single-guide RNA for CCR5 Locus 1 target <400> 9 gugacaucaa uuauuauaca uguuucaguu gcugaaaaug cucuguaauc auuuaaaagu 60 auuuugaacg gaccucuguu ugacacgucu gaauaacuaa aaa 103 <210> 10 <211> 103 <212> RNA <213> Artificial Sequence <220> <223> Single-guide RNA for CCR5 Locus 2 target <400> 10 ggtagagcgg aggcaggagg cguuucaguu gcugaaaaug cucuguaauc auuuaaaagu 60 auuuugaacg gaccucuguu ugacacgucu gaauaacuaa aaa 103 <210> 11 <211> 103 <212> RNA <213> Artificial Sequence <220> <223> Single-guide RNA for AAVS1 target <400> 11 gcucccuccc aggauccici cguuucaguu gcugaaaaug cucuguaauc auuuaaaagu 60 auuuugaacg gaccucuguu ugacacgucu gaauaacuaa aaa 103 <210> 12 <211> 47 <212> RNA <213> Artificial Sequence <220> <223> crRNA for AAVS1 target, gx18 <400> 12 gcccucccag gauccucucg uuucaguugc ugaauuauuu gguaaac 47 <210> 13 <211> 48 <212> RNA <213> Artificial Sequence <220> <223> crRNA for AAVS1 target, gx19 <400> 13 gucccuccca ggauccucuc guuucaguug cugaauuauu ugguaaac 48 <210> 14 <211> 49 <212> RNA <213> Artificial Sequence <220> <223> crRNA for AAVS1 target, gx20 <400> 14 gcucccuccc aggauccici cguuucaguu gcugaauuau uugguaaac 49 <210> 15 <211> 50 <212> RNA <213> Artificial Sequence <220> <223> crRNA for AAVS1 target, gx21 <400> 15 gucucccucc caggauccuc ucguuucagu ugcugaauua uuugguaaac 50 <210> 16 <211> 51 <212> RNA <213> Artificial Sequence <220> <223> crRNA for AAVS1 target, gx22 <400> 16 gcucucccuc ccaggauccu cucguuucag uugcugaauu auuugguaaa c 51 <210> 17 <211> 103 <212> RNA <213> Artificial Sequence <220> <223> Single-guide RNA for CCR5-TS1 target, gx20 <400> 17 gugggguggg auaggggaua cguuucaguu gcugaaaaug cucuguaauc auuuaaaagu 60 auuuugaacg gaccucuguu ugacacgucu gaauaacuaa aaa 103 <210> 18 <211> 103 <212> RNA <213> Artificial Sequence <220> <223> Single-guide RNA for CCR5-TS2 target, gx20 <400> 18 gugacaucaa uuauuauaca uguuucaguu gcugaaaaug cucuguaauc auuuaaaagu 60 auuuugaacg gaccucuguu ugacacgucu gaauaacuaa aaa 103 <210> 19 <211> 103 <212> RNA <213> Artificial Sequence <220> <223> Single-guide RNA for AAVS1 target, gx20 <400> 19 gcucccuccc aggauccici cguuucaguu gcugaaaaug cucuguaauc auuuaaaagu 60 auuuugaacg gaccucuguu ugacacgucu gaauaacuaa aaa 103 <210> 20 <211> 103 <212> RNA <213> Artificial Sequence <220> <223> Single-guide RNA for NRAS target, gx20 <400> 20 ggguaagggg gcagggaggg aguuucaguu gcugaaaaug cucuguaauc auuuaaaagu 60 auuuugaacg gaccucuguu ugacacgucu gaauaacuaa aaa 103 <210> 21 <211> 103 <212> RNA <213> Artificial Sequence <220> <223> Single-guide RNA for EMX1 target, gx20 <400> 21 ggaguccgag cagaagaaga aguuucaguu gcugaaaaug cucuguaauc auuuaaaagu 60 auuuugaacg gaccucuguu ugacacgucu gaauaacuaa aaa 103 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CCR5 Locus 1 target <400> 22 tgacatcaat tattatacat 20 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CCR5 Locus 2 target <400> 23 gtagagcgga ggcaggaggc 20 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> AAVS1 target, gx20 <400> 24 ctccctccca ggatcctctc 20 <210> 25 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> AAVS1 target, gx18 <400> 25 ccctcccagg atcctctc 18 <210> 26 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> AAVS1 target, gx19 <400> 26 tccctcccag gatcctctc 19 <210> 27 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> AAVS1 target, gx21 <400> 27 tctccctccc aggatcctct c 21 <210> 28 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> AAVS1 target, gx22 <400> 28 ctctccctcc caggatcctc tc 22 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CCR5-TS1 target, gx20 <400> 29 tggggtggga taggggatac 20 <210> 30 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CCR5-TS2 target, gx20 <400> 30 tgacatcaat tattatacat 20 <210> 31 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NRAS target, gx20 <400> 31 ggtaaggggg cagggaggga 20 <210> 32 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> EMX1 target, gx20 <400> 32 gagtccgagc agaagaagaa 20 <210> 33 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> F1 primer <400> 33 ggactatcat atgcttaccg taact 25 <210> 34 <211> 52 <212> DNA <213> Artificial Sequence <220> <223> R1 primer <400> 34 ctctccatcc tcttgctttc ttnnnnnnnn nngagctggg accaccttat at 52 <210> 35 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> F2 primer <400> 35 aagaaagcaa gaggatggag agcacgctgt aggtatctca gttc 44 <210> 36 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> R2 primer <400> 36 ctacatacct cgctctgcta atc 23 <210> 37 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Blunt DNA fragment forward <400> 37 gtttaattga gttgtcatat gttaataacg gtat 34 <210> 38 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Blunt DNA fragment rear <400> 38 ataccgttat taacatatga caactcaatt aaac 34 <210> 39 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> Incorrect DNA fragment forward <400> 39 ctcgtttaat tgagttgtca tatgttaata acggtat 37 <210> 40 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> Incorrect DNA fragment rear <400> 40 gagataccgt tattaacata tgacaactca attaaac 37 <210> 41 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> Correct DNA fragment forward <400> 41 ggagtttaat tgagttgtca tatgttaata acggtat 37 <210> 42 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> Correct DNA fragment rear <400> 42 tccataccgt tattaacata tgacaactca attaaac 37

Claims

A recombinant vector comprising said nucleic acid molecule, or a recombinant cell comprising said recombinant vector, wherein said recombinant vector comprises a ribonucleic acid protein comprising a Francisla novicida- derived Cas9 protein and a guide RNA, a nucleic acid molecule encoding said ribonucleic acid protein, / RTI >

The composition for insertion of a foreign gene according to claim 1, wherein the Casil protein derived from Francisella novicida is an amino acid sequence of SEQ ID NO: 1.

The method of claim 1, wherein the guide RNA
A dual guide RNA comprising CRISPR RNA (crRNA) and trans- activating crRNA (tracrRNA), or
A single guide RNA (sgRNA)
A composition for insertion of a foreign gene.

4. The composition for inserting a foreign gene according to claim 3, wherein the crRNA is represented by Formula 1 and the tracrRNA is represented by SEQ ID NO:
5 '- (N _cas9 ) m-GUUUCAGUUGCUGAAUUAUUUGGUAAAC-3' (SEQ ID NO: 2)
In the general formula 1,
N _cas9 is a targeting sequence region comprising a nucleotide sequence capable of hybridizing with a gene target site,
m is an integer of 16 to 24, which represents the number of nucleotides contained in the targeting sequence region, and m nucleotides are selected from the group consisting of A, U, C and G, respectively;
5'-AUGCUCUGUAAUCAUUUAAAAGUAUUUUGAACGGACCUCUGUUUGACACGUCUGAAUAACUAAAAA-3 '(SEQ ID NO: 4).

4. The composition for inserting a foreign gene according to claim 3, wherein the sgRNA is represented by the general formula 2:
5 '- (N _cas9 ) m-GUUUCAGUUGCU- (linker) -AUGCUCUGUAAUCAUUUAAAAGUAUUUUGAACGGACCUCUGUUUGACACGUCUGAAUAACUAAAAA-3' (SEQ ID NO: 6)
In the general formula 2,
N _cas9 is a targeting sequence region comprising a nucleotide sequence capable of hybridizing with a gene target site,
m is an integer of 16 to 24 representing the number of nucleotides contained in the targeting sequence region,
Wherein the linker comprises 3 to 5 nucleotides,
The nucleotide sequences included in the targeting sequence region and the linker are selected from the group consisting of A, U, C and G, respectively.

5. The composition for inserting a foreign gene according to claim 4, wherein the crRNA represented by the general formula (1) further comprises 1 to 3 guanines (G) at the 5 'terminus.

6. The composition for inserting a foreign gene according to claim 5, wherein the sgRNA represented by the general formula 2 further comprises 1 to 3 guanines (G) at the 5 'terminus.

8. The composition according to any one of claims 1 to 7, further comprising a nuclear localization signal (NLS) or a coding nucleic acid molecule thereof,

8. The composition according to any one of claims 1 to 7, wherein the ribonucleic acid protein comprises Francella novicida- derived Cas9 protein produced ex vivo and an exogenously generated guide RNA.

delete

8. The composition according to any one of claims 1 to 7 for use in eukaryotic or eukaryotic organisms.

13. The composition according to claim 12, further comprising a nuclear localization signal (NLS) or an encoded nucleic acid molecule thereof.

8. The composition according to any one of claims 1 to 7, further comprising a foreign gene.

A method for the isolation of a eukaryotic cell or an eukaryotic organism other than a human, comprising the step of introducing the foreign gene insertion composition according to any one of claims 1 to 7 and a foreign gene into a eukaryotic cell, Foreign gene insertion method.

The foreign gene insertion method according to claim 15, wherein the foreign gene insertion composition comprises a ribonucleic acid protein including an exogenously produced Casella protein derived from Francisella novicida and an exogenously generated guide RNA.

16. The foreign gene insertion method according to claim 15, wherein the foreign gene insertion composition further comprises a nuclear localization signal (NLS) or an encoded nucleic acid molecule thereof.

16. The method of claim 15, wherein the step of introducing is performed by direct site injection, electroporation, or lipofection.

delete

A method for producing a transformed eukaryotic cell or a non-human eukaryotic organism comprising the step of introducing the foreign gene insertion composition according to any one of claims 1 to 7 and a foreign gene into isolated eukaryotic cells or eukaryotic organisms excluding humans (2).

21. The method according to claim 20, wherein the composition for inserting a foreign gene comprises a ribonucleic acid protein including an exogenously produced Casella protein derived from Francisella novicida and an in vitro generated guide RNA.

21. The method according to claim 20, wherein the composition for inserting a foreign gene further comprises a nuclear localization signal (NLS) or an encoded nucleic acid molecule thereof.

21. The method of producing a transformant according to claim 20, wherein said introducing step is carried out by direct site injection, electroporation, or lipofection.

A transformant of a eukaryotic cell or a eukaryotic organism other than a human, prepared by the method for producing a transformant of claim 20.

25. The transformant of claim 24, wherein the eukaryotic organism is a mammal or eukaryotic plant other than human.