KR101888744B1 - Method of providing the information for selecting the drugs for treating EML4-ALK positive non-small-cell lung cancer resistant to ALK inhibitors - Google Patents

Abstract

The present invention provides a biomarker for providing information on drug selection in the treatment of EML4-ALK-positive non-small cell lung cancer resistant to an ALK inhibitor, which comprises an EML4-ALK-positive non-small cell lung cancer Compositions and kits for detecting the level of expression of miR-34a and / or miR-449 to provide information on drug selection in the treatment of < RTI ID = 0.0 > miR-34a < / RTI >

Description

 [0002] Methods for providing information on drug selection for the treatment of EML4-ALK-positive non-small cell lung cancer resistant to ALK inhibitors are provided. inhibitors}

The present invention relates to a method, composition, kit for detecting expression levels of miR-34a and / or miR-449 to provide information on drug selection in the treatment of EML4-ALK-positive non-small cell lung cancer that has acquired resistance to an ALK inhibitor And a pharmaceutical composition for the treatment of the non-small cell lung cancer.

Histone deacetylase (HDAC) inhibitors are a new class of anticancer drugs that induce cell differentiation and death. Histone deacetylase inhibitors target histone deacetylases (HDACs) and affect histone acetylation through the chromatin structure, leading to complex transcription reprogramming, such as reactivation of tumor suppressor genes and cancer Induce the suppression of the gene.

In addition to causing acetylation of the N-terminal lysine residue in core histone proteins, there are also non-histone protein targets important for cancer cell biology such as heat shock protein (HSP90), tubulin or p53 tumor suppressor protein.

Thus, the medical use of histone deacetylase inhibitors is not limited to chemotherapy because histone deacetylase inhibitors have shown efficacy in inflammatory diseases, rheumatoid arthritis and neurodegenerative animal models.

2) hydroxamic acids (trichostatin A, SAHA, LBH-589), 3) cyclic peptides (desipeptide), and 3) cyclic peptides (desipeptide) , 4) benzamides (MS-275, MGCD-0103) (Non-Patent Document 1), and many of these histone deacetylase inhibitors (SAHA, LBH-589 and MS-275) In addition to animal models, histone deacetylase inhibitors such as SAHA, LBH-589 and MS-275 inhibit the growth of various transformed cells in the medium and effectively induce differentiation and apoptosis (Non-Patent Document 2) Have been evaluated in clinical studies for the purpose of treating cancer diseases (Non-Patent Document 3). (Zolinza, Vorinostat), PXD101 (Belinostat), LBH-589 (Panobinostat) and Benzamide compounds MS-275 (Entinostat) and MGCD0103 (Mocetinostat), which are the representative compounds of histone deacetylase inhibitors, ).

Anaplastic Lymphoma kinase (ALK) is a tyrosine kinase receptor that is involved in Ras / Raf / MEK / ERK1 / 2 pathway, JAK (Janus kinase) / STAT pathway signal transducers and activators of transcription pathway, Pl3K (Phosphatidylinositol 3 -kinase) / Akt pathway, which plays an important role in cell proliferation, growth and survival. However, overexpression of ALK results in abnormal proliferation and growth of cancer cells.

EML4 (echinoderm microtubule-associated protein-like 4) -ALK mutation in ALK is known to play an important role in the abnormal proliferation of cancer cells in non-small cell lung cancer. Research and interest in chemotherapy is growing.

ALK inhibitors such as crizotinib and ceritinib have been used as target therapeutics for ALK. They are not only resistant to ALK inhibitors in the treatment of non-small cell lung cancer through ALK inhibitors, Among the lung cancer cell lines resistant to the ALK inhibitor, there is a problem that the mutation resistance of the ALK gene, rather than the resistance of the new mechanism, occurs.

Therefore, it is necessary to study and develop new therapeutic agents that show therapeutic efficacy in patients with EML4-ALK-positive non-small cell lung cancer who have acquired tolerance to ALK inhibitors.

Sonia et al., International Journal of Oncology 33, 637-646, 2008 Paul A. Marks et al., Curr Opin. Oncol. 13, 477-483, 2001 Johnstone. R. W., Nat. Rev. Drug. Discov. 1, 287-299, 2002

It is an object of the present invention to provide a biomarker for providing information on drug selection in the treatment of non-small cell lung cancer acquired resistance to an ALK inhibitor.

The present invention also provides a composition for detecting the expression level of miR-34a and / or miR-449 in order to provide information on drug selection in the treatment of EML4-ALK-positive non-small cell lung cancer that has acquired resistance to an ALK inhibitor, And a method thereof.

It is also an object of the present invention to provide a pharmaceutical composition for the treatment of EML4-ALK-positive non-small cell lung cancer which is resistant to an ALK inhibitor.

In order to accomplish the above object, the present invention provides a method for selecting a drug for the treatment of EML4-ALK-positive non-small cell lung cancer, which is resistant to an ALK inhibitor from a sample isolated from an EML4-ALK-

34a and / or miR-449, comprising the step of determining whether the expression level of miR-34a and / or miR-449 is decreased after administration of the ALK inhibitor.

The present invention also provides information on drug selection for the treatment of EML4-ALK-positive non-small cell lung cancer that has acquired resistance to an ALK inhibitor, including agents capable of measuring the expression levels of miR-34 and / or miR- A kit for detecting miR-34 and / or miR-449 and a kit comprising the same.

The present invention also provides a pharmaceutical composition for co-administration with an ALK inhibitor for the treatment of EML4-ALK-positive non-small cell lung cancer that has acquired resistance to an ALK inhibitor, comprising a histone deacetylase inhibitor or a pharmaceutically acceptable salt thereof .

The present invention provides a biomarker for providing information on drug selection in the treatment of EML4-ALK-positive non-small cell lung cancer resistant to an ALK inhibitor, which comprises an EML4-ALK-positive non-small cell lung cancer Compositions and kits for detecting the level of expression of miR-34a and / or miR-449 to provide information on drug selection in the treatment of < RTI ID = 0.0 > miR-34a < / RTI >

FIG. 1 shows the process of constructing a resistant cell line for seritinib, wherein A represents the cell survival rate of the resistant non-small cell lung cancer cell line according to the concentration of seritinib through MTT assay, B represents ALK, AKT, The level of expression of ERK is shown by immunoblot analysis, and C shows the result of treatment with another ALK inhibitor in the resistant cell line.
In FIG. 2, A shows the result of observing the morphology of the resistant cell line for the cell line and seritinib through a phase contrast microscope, and B shows the result of immunoblot analysis for the expression level of the EMT-related protein.
In FIG. 3, A shows the result of xenografting ceritinib resistant cell line and then observing tumor size by administering seritinib. B shows the results of EMT-related gene And the level of expression in the microarray.
In FIG. 4, A shows the acetylation and DNA methylation changes of the histone proteins of the parental cell line and the resistant cell line, B shows the acetylation of the H3K27Ac site, C shows the mRNA of AXL and EMT related genes in the resistant cell line The expression levels of miR-34a and miR-449 miRNAs are shown. D is the result of the expression reduction of miR-34a and miR-449 by deacetylation through the expression analysis of the host.
In FIG. 5, A shows the results of confirming the expression level of EMT-related gene when Ceritinib-resistant cell line treated with Foretinib, which is an AXL inhibitor, was treated with miR-34a and miR- Immunoblot analysis was performed to determine whether the decrease in expression by 449 deacetylation was related to the overexpression and activity of AXL.
In FIG. 6, A is the result of confirming cell proliferation according to miR-34a and miR-449 using MTT assay after transforming miR-34a and miR-449 inhibitor / mimics into seritinib resistant cell line, The expression levels of AKT and ERK in the resistant cell line were confirmed by immunoblot analysis.
Figure 7 shows the results for the ability to regulate the expression of miR-34a and miR-449 by acetylation control through q-PCR, RNA-seq, ChIP-seq assay after treatment with panobinostat on resistant resistant cell lines .
8 shows the results of the colony formation assay of the combination administration of panovinostat in the blast cell line and seritinib resistant cell line in FIG. 8, and B shows p21, cleaved PARP, The expression of cleaved caspase-3 was confirmed by immunoblot analysis.
9 shows the results of immunoblot analysis of the expression levels of AXL, MET and the like by combination treatment of panovinostat and seritinib in serotypic resistant cell lines and B in N-Cadherin and E- The level of expression of Cadherin was confirmed.

The present invention relates to a method for the selection of a drug for the treatment of EML4-ALK-positive non-small cell lung cancer which has acquired resistance to an ALK inhibitor from a biological sample isolated from an EML4-ALK positive non-small cell lung cancer patient,

34a and / or miR-449, comprising the step of determining whether the expression level of miR-34a and / or miR-449 is decreased after administration of the ALK inhibitor.

In addition, the present invention provides information on drug selection for the treatment of EML4-ALK-positive non-small cell lung cancer that has acquired resistance to ALK inhibitors, including agents capable of measuring the expression levels of miR-34a and / or miR- ≪ RTI ID = 0.0 > miR-34a < / RTI >

The present invention also relates to a kit for the detection of miR-34a and / or miR-449 comprising said composition.

The present invention also provides a pharmaceutical composition for co-administration with an ALK inhibitor for the treatment of EML4-ALK-positive non-small cell lung cancer which is resistant to an ALK inhibitor, comprising a histone deacetylase inhibitor or a pharmaceutically acceptable salt thereof .

Hereinafter, the configuration of the present invention will be described in detail.

The present invention is based on the finding that expression of miR-34a and / or miR-449 is reduced in EML4-ALK-positive non-small cell lung cancer patients who have acquired resistance to an ALK inhibitor, the EML4-ALK- Kits and methods for detecting miRNA expression levels of miR-34a and / or miR-449 from a patient's sample to provide information on drug selection in the treatment of lung cancer.

Specifically, the present invention provides a method for the selection of a drug for the treatment of EML4-ALK-positive non-small cell lung cancer which is resistant to an ALK inhibitor from a biological sample isolated from an EML4-ALK positive non-small cell lung cancer patient,

34a and / or miR-449, comprising the step of determining whether the expression level of miR-34a and / or miR-449 is decreased after administration of the ALK inhibitor.

More particularly, the present invention provides a method for determining the expression level of miR-34a and / or miR-449 present in a sample of a non-small cell lung cancer patient who has acquired resistance to an ALK inhibitor and determining the expression level of miR-34a and / When the expression level of miR-449 is decreased, it provides information on the drug selection for the treatment of non-small cell lung cancer to the non-small cell lung cancer patient of the sample.

The present invention uses miRNA biomarkers as a non-invasive tool to provide information on drug selection in the treatment of EML4-ALK-positive non-small cell lung cancer resistant to ALK inhibitors.

In the present invention, the term "miRNA" may be referred to as microRNA or miRs. The length of the miRNA may be about 19 to 25, or 21 to 23 nucleotides in length. Because miRNAs are transcribed from DNA but not translated into proteins, they are encoded by genes that contain non-coding RNAs. miRs are processed from a known primary transcript pri-miRNA into a short stem-loop structure called pre-miRNA and finally processed with the resulting single-stranded miRNA. The premiRNA can form a self-folding structure within the self-complementary region. The structure is then processed by the nuclease in the animal. A mature miRNA molecule is partially complementary to one or more mRNA molecules and can function to regulate transcription of the protein. Identified sequences of miRNAs can be evaluated in publicly available databases such as www.microRNA.org, www.mirbase.org, or www.mirz.unibas.ch/cgi/miRNA.cgi . miRNAs are generally numbered according to a naming convention such as "mir- [number]". The number of miRNAs is assigned according to the sequence found for miRNA species that have already been identified. If the miRNA is found to be similar to a known miRNA of a different organism, the name is provided in the form of [organism identifier] -mir- [number], the name of the select organism identifier. Mature microRNAs usually have the prefix "miR" attached, and gene or precursor miRNAs are prefixed with "mir". In the context of the present invention, any microRNA (miRNA or miR) with the prefix mir- * or miR- * should be understood to include both precursors and / or mature species unless explicitly stated otherwise. For more information on miR nomenclature, see www.mirbase.org or Ambros et al., A uniform system for microRNA annotation, RNA 9: 277-279 (2003).

The nucleotide sequence information of the biomarkers miR-34a and miR-449 of the present invention can be confirmed from a known gene database such as miRBASE (http://www.mirbase.org/). More specifically, the nucleotide sequence of miR-34a is registered with the gene registry number MIMAT0000255 and is shown as SEQ ID NO: 1. The nucleotide sequence of miR-449 is registered with the gene registry number MIMAT0001541 and is shown in Table 1 as SEQ ID NO: 2.

miRNA order SEQ ID NO: 1
(miR-34a-5p) 5 'uggcagugucuuagcugguugu 3' SEQ ID NO: 2
(miR-449) 5 'uggcaguguauuguuagcuggu 3'

Also, in the present invention, miR-34a and miR-449 can be interpreted to include naturally occurring miR-34a and miR-449 as well as functional variants thereof. In one embodiment, the miR-449 can be interpreted to include miR-449a, miR-449b, and miR-449c.

In the present invention, the above-mentioned "EML4-ALK-positive non-small cell lung cancer patient" refers to a patient in which ALK gene mutation occurred among patients with non-small cell lung cancer. The mutation of the ALK gene can be formed from the fusion of the EML4 and the ALK gene. The fusion gene induces cancer by expressing EML4-ALK.

In the present invention, the above-mentioned "EML4-ALK-positive non-small cell lung cancer patient who has acquired resistance to the ALK inhibitor" is used for the expression of miR-34a and / or miR-449 And may include patients with reduced levels. The decreased expression of miR-34a and / or miR-449 may be caused by deacetylation by histone deacetylase (HDAC).

According to the present invention, the decrease in the expression of miR-34a and / or miR-449 is a new mechanism of resistance acquisition obtained from non-small cell lung cancer resistant to ALK inhibitor among EML4-ALK-positive non-small cell lung cancer, and secondary ALK mutation It can be said that when the miR-34a and / or miR-449 is deacetylated by histone deacetylase (HEAC) and the expression level is decreased, resistance to the ALK inhibitor is obtained. .

Wherein said EML4-ALK positive non-small cell lung cancer patient is at least one selected from the group consisting of crizotinib, ceritinib, alectinib, brigatinib, and entrectinib May comprise a patient resistant to an ALK inhibitor, for example a patient having tolerance to ceritinib.

In the present invention, the "biological sample" may be blood, plasma, serum, urine, feces, saliva, tears, spinal fluid, cells, tissue or a combination thereof isolated from patients with non-small cell lung cancer.

In the present invention, the above-mentioned "ALK inhibitor" means a drug which shows a therapeutic effect on the EML4-ALK positive non-small cell lung cancer patient, and which inhibits the kinase activity of EML4-ALK.

In the present invention, when the ALK inhibitor is administered to a patient with non-small cell lung cancer for a predetermined period of time to treat non-small cell lung cancer, the drug is administered for a certain period of time The ALK inhibitor exhibits an extremely low susceptibility to ALK inhibitors, so that when the cancer symptoms do not manifest any improvement, relief, relief, or cure symptoms, or that there is no secondary ALK mutation and the cancer has progressed even after administration of another ALK inhibitor, And the ability to tolerate the disease. In particular, when resistance to an ALK inhibitor is obtained as described above, a decrease in the expression level of miR-34a and / or miR-449 can be said to be an important factor in resistance induction. The progression of the non-small cell lung cancer can be detected by any means capable of imaging and recognizing the occurrence of cancer such as computed tomography (CT), magnetic resonance imaging (MRI), ultrasound, x-ray imaging, mammography, PET scan, The method is not particularly limited as long as it can be confirmed through imaging techniques such as nuclide scans and bone scans.

In the present invention, whether or not the resistance to the ALK inhibitor is obtained can be confirmed at the cell level. In one embodiment, a cell line that is resistant to an ALK inhibitor by continuously treating an EML4-ALK-positive non-small cell lung cancer cell line with an ALK inhibitor is assayed for an ALK inhibitor using MTT assay, colony formation assay, But it is not limited to this.

In the present invention, in order to measure the expression levels of miR-34a and / or miR-449 present in a biological sample, various agents capable of detecting these miRNAs can be used.

In the present invention, the expression "agent capable of measuring expression level" means a substance that can be used to detect the presence of miR-34a and / or miR-449 in a sample of a patient. But are not limited to, for example, primers, probes, antisense oligonucleotides or combinations thereof that are capable of complementarily binding miR-34a and / or miR-449. It is preferred that the primers, probes, and antisense oligonucleotides specifically bind to the base sequences of miR-34a and / or miR-449 and do not specifically bind to the base sequences of other nucleic acid materials. Herein, complementary binding means that the primer, probe, and antisense oligonucleotide are sufficiently complementary to hybridize selectively to the miRNA target under a predetermined hybridization or annealing condition, preferably physiological conditions, and substantially complementary substantially complementary, and perfectly complementary, and is preferably completely complementary.

In one embodiment, the agent used to detect the miRNA biomarker of the invention may be an antisense oligonucleotide. The term "antisense oligonucleotide" refers to a nucleic acid-based molecule capable of forming a dimer with a miRNA having a complementary sequence to the sequence of a target miRNA, particularly a miRNA, and the miRNA biomarker of the present invention can be detected Can be used.

In another embodiment, the agent used to detect the miRNA biomarker of the invention may be a primer. The term "primer " means 7 to 50 nucleic acid sequences which can form complementary base pairs in a template strand and serve as a starting point for template strand replication. Primers are usually synthesized but can also be used in naturally occurring nucleic acids. The sequence of the primer does not necessarily have to be exactly the same as the sequence of the template, but is sufficiently complementary that it can hybridize with the template. Additional features that do not alter the primer properties of the primer can be incorporated. Examples of additional features that may be incorporated include, but are not limited to, methylation, capping, substitution of one or more nucleic acids with homologues, and modification between nucleic acids. Preferably, the primers of the present invention may be primers capable of amplifying miRNAs of miR-34a and / or miR-449.

In another embodiment, the agent used to detect an miRNA biomarker of the invention may be a probe. The term "probe" refers to a nucleic acid fragment, such as RNA or DNA, that corresponds to a few bases or hundreds of bases, which can be specifically bound to a target miRNA. Preferably, the probe is labeled so that the presence or absence of a specific miRNA can be readily identified. Selection of suitable probes and hybridization conditions can be modified based on what is known in the art. In one embodiment, the nucleotide sequences of the probes for miR-34a and miR-449 are set forth in Table 2 below with SEQ ID NO: 3 and SEQ ID NO: 4, respectively.

miRNA order SEQ ID NO: 3
(miR-34a-5p probe) 5 'acaaccagctaagacactgcca 3' SEQ ID NO: 4
(miR-449 probe) 5 'accagctaacaatacactgcca 3'

In the present invention, the expression level of miRNA is measured from the sample of a patient to obtain information on drug selection for the treatment of the non-small cell lung cancer when resistance to an ALK inhibitor is obtained in EML4-ALK-positive non-small cell lung cancer. It may be a measure of the amount of miRNA as a process of ascertaining expression levels. This can be done by isolating the miRNA directly or by using a primer or probe for the miRNA.

The level of expression of the miRNA may be an expression level in a biological sample isolated from the patient. The sample may be blood, plasma, serum, urine, feces, saliva, tears, spinal fluid, cell, tissue or a combination thereof isolated from non-small cell lung cancer patients.

Thus, by detecting the expression levels of miR-34a and / or miR-449 when resistance to an ALK inhibitor is obtained in a patient with EML4-ALK positive non-small cell lung cancer, Can provide information on drug selection for the treatment of non-small cell lung cancer patients who have acquired resistance.

In addition, the present invention provides information on drug selection for the treatment of EML4-ALK-positive non-small cell lung cancer that has acquired resistance to ALK inhibitors, including agents capable of measuring the expression levels of miR-34a and / or miR- Gt; miR-34a < / RTI > and / or < RTI ID = 0.0 > miR-449 < / RTI >

The agent capable of measuring the expression level can be applied or applied as it is.

In addition, the composition for detecting miR-34a and / or miR-449 may be provided in the form of a kit.

The kit according to the present invention not only includes detection agents such as primers, probes, antisense oligonucleotides and the like capable of measuring the expression levels of miR-34a or miR-449, but also one or more other component compositions suitable for the assay method, Or device. In one embodiment, the kit may be a gene amplification kit comprising a primer for amplifying a miRNA in a sample. In another embodiment, the kit may be a microarray kit in which a probe capable of specifically binding to miRNA is immobilized on the surface of a fixed substrate.

The kit may include instructions describing how to perform an analysis of the expression levels of biomarkers miR-34a and / or miR-449. The instructions may include instructions on how to determine the expression level of the biomarker in the reference cohort, how to determine the cohort, and how to collect expression data to determine criteria for comparing patients. In addition, the instructions may include instructions for analyzing biomarker expression in a test subject, and instructions for comparing the expression with an expression of a reference cohort and then determining an appropriate chemotherapy for the test patient.

The informational material included in the kit may be a description, instructions, promotional material, or other data associated with the methods described herein and / or the use of reagents for methods described herein. For example, the kit's informational data may be used to provide information about the kit's users, especially when they apply the probability of a human having a positive response to a particular therapeutic agent, E. G., Physical address, e-mail address, web site or telephone number.

In addition, the present invention confirms whether a biological sample isolated from an EML4-ALK-positive non-small cell lung cancer patient has acquired resistance to an ALK inhibitor,

Comprising administering to a patient in need of such treatment a combination of a histone deacetylase inhibitor and an ALK inhibitor for the treatment of EML4-ALK-positive non-small cell lung cancer when tolerance to an ALK inhibitor is obtained.

ALK inhibitor-resistant EML4-ALK-positive non-small cell lung cancer.

The method for providing information for drug selection according to the present invention is characterized by further comprising the step of decreasing the expression of miR-34a and / or miR-449 in the patient who has acquired resistance to the ALK inhibitor among the EML4-ALK- And a step of confirming whether or not it is possible.

In the present invention, the above-described method for detecting miR-34a and / or miR-449 can be applied or applied mutatis mutandis.

In one embodiment, the biological sample can be blood, plasma, serum, urine, feces, saliva, tears, spinal fluid, cells, tissue, or a combination thereof isolated from non-small cell lung cancer patients.

In the present invention, the term " histone deacetylase inhibitor "refers to a drug that acts on an enzyme called histone deacetylase (HDAC) and inhibits its activity. The histone deacetylase inhibitor Inhibits the activity of histone deacetylase, which regulates the expression of a cell, thereby inhibiting cell cycle arrest, inhibiting angiogenesis, controlling immunity, and causing cell death, thereby slowing down or eradicating the production of cancer cells.

In the present invention, the histone deacetylase inhibitor may be selected from the group consisting of Vorinostat, Romodepsin, Chidamide, Trichostatin A, Belinostat, A compound selected from the group consisting of Panobinostat, Entinostat, Valproic acid, Mocetinostat, Abexinostat, Resminostat, Givinostat and Quizinostat (Quisinostat), but the present invention is not limited thereto. In one embodiment of the invention, the histone deacetylase inhibitor may be a panobinostat.

In the present invention, the histone deacetylase inhibitor may be a pharmaceutically acceptable salt thereof as well as the drug itself. The pharmaceutically acceptable salt of said histone deacetylase inhibitor is a concentration which is relatively non-toxic and harmless to the patient and which has a beneficial effect, wherein the side effect caused by this salt does not degrade the beneficial effects of the histone deacetylase inhibitor Or an inorganic addition salt. For example, the pharmaceutically acceptable salt may be an acid addition salt formed using an organic or inorganic acid, and the organic acid may be, for example, formic acid, acetic acid, propionic acid, lactic acid, butyric acid, isobutyric acid, trifluoroacetic acid, , Malonic acid, malonic acid, fumaric acid, succinic acid, succinic acid monoamide, glutamic acid, tartaric acid, oxalic acid, citric acid, glycolic acid, glucuronic acid, ascorbic acid, benzoic acid, phthalic acid, salicylic acid, anthranilic acid, dichloroacetic acid, Sulfonic acid, p-toluenesulfonic acid and methanesulfonic acid-based salts, and the inorganic acid includes, for example, hydrochloric acid, bromic acid, sulfuric acid, phosphoric acid, nitric acid, carbonic acid and boric acid-based salts. Preferably in the hydrochloride or acetate form. Further, it may be an alkali metal salt (sodium salt, kagura salt, etc.) and an alkaline earth metal salt (calcium salt, magnesium salt).

In the present invention, the ALK inhibitor may be a pharmaceutically acceptable salt thereof as well as the drug itself. The pharmaceutically acceptable salt of the ALK inhibitor may be applied or applied as it is to all of the above-mentioned contents for the pharmaceutically acceptable salt of the histone deacetylase inhibitor.

In the present invention, whether or not to acquire tolerance to an ALK inhibitor can be applied or applied as it is to all the contents described above.

In addition, according to the present invention, the histone deacetylase inhibitor has an excellent effect of inhibiting deacetylation of miR-34a and / or miR-449 generated from histone deacetylase in non-small cell lung cancer cells, Can be used effectively.

In the following examples, the present inventors have identified a reduction in expression of miR-34a and / or miR-449 by deacetylation of a novel resistance mechanism against EML4-ALK-positive non-small cell lung cancer resistant to the ALK inhibitor, The antitumor efficacy was confirmed in the resistant strain cell line by treating the histone deacetylase inhibitor and it was confirmed that the synergistic effect on the antitumor effect of the non-small cell lung cancer was shown by using the ALK inhibitor in combination with the histone deacetylase inhibitor Respectively.

Thus, the present invention provides information on drug selection for the treatment of non-small cell lung cancer when resistance to ALK inhibitors is obtained from reduced expression of miR-34a and / or miR-449 in EML4-ALK-positive non-small cell lung cancer And a therapeutic effect can be expected by administering a combination of a histone deacetylase inhibitor and an ALK inhibitor to the non-small cell lung cancer patient.

In addition, the present invention provides a method of detecting drug-induced damage to an ALK inhibitor to provide information of drug selection through expression levels of miR-34a and / or miR-449 detected using the method of detecting miR-34a and / or miR- A1 The present invention provides a diagnostic method for EML4-ALK-positive non-small-cell lung cancer that has acquired resistance.

According to the above diagnostic method, in patients suffering from resistance to an ALK inhibitor according to a decrease in expression of miR-34a and / or miR-449 among patients with EML4-ALK-positive non-small cell lung cancer, histone dehydrogenase Acetylating enzyme inhibitors and ALK inhibitors.

The above-described contents of the histone deacetylase inhibitor and the ALK inhibitor may be directly applied or applied mutatis mutandis.

The present invention also provides a pharmaceutical composition for co-administration with an ALK inhibitor for the treatment of EML4-ALK-positive non-small cell lung cancer which is resistant to an ALK inhibitor, comprising a histone deacetylase inhibitor or a pharmaceutically acceptable salt thereof to provide.

In the present invention, all of the above-mentioned contents can be directly applied or applied as to whether or not the resistance to histone deacetylase inhibitor, ALK inhibitor, EML4-ALK-positive non-small cell lung cancer and ALK inhibitor is obtained.

The histone deacetylase inhibitor has been used for the treatment of cancer, inflammatory diseases and the like. The pharmaceutical composition according to the present invention includes a histone deacetylase inhibitor and an ALK inhibitor to inhibit EML4-ALK-positive non-small cell lung cancer Of lung cancer patients who are resistant to the ALK inhibitor.

Accordingly, the present invention provides therapeutic efficacy of EML4-ALK-positive non-small cell lung cancer in combination with histone deacetylase inhibitor and ALK inhibitor.

In one embodiment, the pharmaceutical composition may be in a form for simultaneous administration of both drugs, including a combination of a histone deacetylase inhibitor and an ALK inhibitor.

In another embodiment, the pharmaceutical composition may be in a form for simultaneous or sequential administration of both drugs, wherein the histone deacetylase inhibitor and the ALK inhibitor are each formulated. In this case, the pharmaceutical composition is a pharmaceutical composition for simultaneous or sequential administration comprising a first pharmaceutical composition comprising a histone deacetylase inhibitor as an active ingredient and a second pharmaceutical composition comprising an ALK inhibitor as an active ingredient . In the case of sequential administration, the order may be reversed.

In the present invention, the pharmaceutical composition may be accompanied by an instruction associated with the package in the form indicated by the governmental authority governing the manufacture, use and sale of the drug, if necessary, It may represent the approval of the agency with respect to animal administration, for example, a label approved by the US Food and Drug Administration for the prescription of the drug.

The pharmaceutical compositions of the present invention may comprise a pharmaceutically acceptable carrier. As used herein, the term "pharmaceutically acceptable carrier" refers to a carrier or diluent that does not substantially stimulate the organism and does not interfere with the biological activity and properties of the administered ingredients. The pharmaceutically acceptable carrier in the present invention may be a mixture of saline, sterilized water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol and one or more components of these components, If necessary, other conventional additives such as an antioxidant, a buffer, and a bacteriostatic agent may be added to formulate into the form of an injection suitable for injection into tissues or organs. In addition, it may be formulated into an isotonic sterile solution or, in some cases, a dry preparation (especially a lyophilized preparation) which may be an injectable solution by adding sterile water or physiological saline. In addition, a target organ specific antibody or other ligand can be used in combination with the carrier so as to specifically act on the target organ.

Also preferably, the composition of the present invention may further include a filler, an excipient, a disintegrant, a binder, a lubricant, and the like. The composition of the present invention may also be formulated using methods known in the art so as to provide rapid, sustained or delayed release of the active ingredient after administration to the mammal.

The term "administering" in the present invention means introducing the composition of the present invention to a patient by any suitable method, and the route of administration of the composition of the present invention may be carried out through various routes of oral or parenteral routes, ≪ / RTI > But are not limited to, intraperitoneal, intravenous, intramuscular, subcutaneous, intradermal, oral, topical, intranasal, intrathecal, rectal.

As used herein, "effective amount" means an amount necessary to delay or totally stop the onset or progression of the particular disease to be treated. In the present invention, the composition may be administered in a pharmaceutically effective amount. It will be apparent to those skilled in the art that the appropriate total daily dose may be determined by the practitioner within the scope of sound medical judgment.

For purposes of the present invention, the specific therapeutically effective amount for a particular patient will depend upon a variety of factors, including the type and extent of the response to be achieved, the specific composition including whether or not other agents are used, the age, weight, And various factors including diet, time of administration, route of administration and minute of composition, duration of treatment, drugs used or co-used with the specific composition, and similar factors well known in the medical field.

Advantages and features of the present invention and methods of achieving them will be apparent with reference to the following Examples and Preparation Examples. It should be understood, however, that the invention is not limited to the disclosed examples and preparations, but may be embodied in many different forms and should not be construed as limited to the exemplary embodiments set forth herein, It is provided to inform the person completely of the scope of the invention.

Manufacturing example  One. In crizotinib  Acquiring resistance to Non-small cell lung cancer  Construction of cell lines

EML4-ALK-positive non-small cell lung cancer cell lines, H3122 and H2228 (each called Parental) cell lines were treated with an ALK inhibitor, ceritinib (Novartis, CH), starting at 0.001 μM and continuously increasing the concentration to 1 μM H3122 and H2228 cell lines were cultured in culture medium supplemented with 1 [mu] M ceritinib to construct resistant resistant non-small cell lung cancer cell lines (H3122 LR-pool and H2228 LR-pool, respectively). Multiple clonal cell lines (named # 1 to # 11) were constructed from single cell isolation from H3122 LR-pool and H2228 LR-pool to perform MTT assay (FIG. 1A) ceritinib) were obtained. In addition, ALK inhibitor-independent resistance was confirmed through cell proliferation of the resistant cell line treated with an ALK inhibitor other than ceritinib (clozotanib, PF-06463922). 1 shows the cell survival rate of the resistant non-small cell lung cancer cell line according to the concentration of seritinib, B shows the expression level of ALK, AKT and ERK by immunoblot analysis, C shows the level of other ALK inhibitor Jotunib and PF-06463922, Pfizer, US).

As shown in FIG. 1B, the activity of ALK, AKT and ERK was inhibited by 1 μM seritinib in the parental cells of each cell line, and the activity of AKT was decreased in the H3122 LR-pool, but the activity of H2228 LR-pool , The activity of AKT failed to decrease. ERK activity was not reduced by seritinib in both resistant-acquired cell lines (H3122 LR-pool, H2228 LR-pool). In addition, the basal expression and activity of ALK were significantly decreased in both resistant cell lines compared with the parental line. In addition, secondary mutation in the ALK kinase domain, which is reported to be associated with resistance to ALK inhibitors, was confirmed by Sanger sequencing, but no secondary mutation was observed in these resistant cell lines. Also, in FIG. 1C, it can be confirmed that cell proliferation is not inhibited even when ALK inhibitor other than seritinib is treated, which means that the results are consistent with the result that the second mutation does not occur. Thus, the present inventors have found that the seritinib resistant cell line constructed by the present inventors is non-dependent on ALK and has acquired resistance to the ALK inhibitor through a new mechanism that is not resistant to secondary mutation .

Experimental Example  One. Seritinib ( ceritinib ) Characterization of resistant cell lines

EMT (epithelial mesenchymal transition) is a phenomenon that the epithelial polarized phenotype changes into the mesenchymal fibroblastoid phenotype, and it is known to be associated with metastasis and various anticancer drug resistance. The cell morphology of the dendritic cell line and each resistant lineage cell line in this experiment is shown in Fig. 2A.

As shown in FIG. 2A, the H3122 parent cell line has mostly a round shape and proliferates while forming a colony. In the cell line that acquires seritinib resistance, it can be observed that a cell shape change occurs in an elongated form with a protrusion like a stomach. This suggests that the resistant cell line is transformed into a migratory phenotype in comparison with the parental cell line, and the cell characteristics may be changed by EMT. 2B, the expression of EMT-related proteins was analyzed by immunoblot analysis. As a result, the expression and activity of AXL and N-Cadherin were increased and the expression of E-Cadherin was decreased .

Experimental Example  2. In vivo  Xenotransplantation xenograft ) In animal models EMT  Identify relevant gene expression levels

In order to confirm the cell-level results confirmed in Experimental Example 1 in an animal model, when H3122 cell line was xenotransplanted into nude mice and the tumor size reached 300 mm ³ , seritinib was administered at a dose of 50, 75, 87.5, 100 mg / kg And the tumor size was observed and shown in Fig.

As a result, the 50 mg / kg group showed a maximum volume reduction of 34.05% on the 18th day after the administration of the drug, but re-growth occurred after 24 days. The 75 mg / kg group showed a maximum volume reduction of 62.2% after 32 days of drug administration, but re-growth occurred after 48 days. The 87.5 mg / kg group showed a maximum volume reduction of 72.98% at 42 days after the administration of the drug, but re-growth occurred after 62 days. The 100 mg / kg group showed a maximum volume reduction of about 74.25% at 42 days after the administration of the drug, but re-growth occurred after 108 days.

After re-growth, the mice were sacrificed to obtain tumor tissue, RNA was isolated, and the expression levels of EMT-related genes were compared by microarray analysis.

As a result, the expression of the epithelial characteristic gene was high in the control group (0 mpk), whereas the expression of the mesenchymal characteristic genes was increased in the most of the dose group. From the above results, it can be seen that the mouse model obtained resistance to the ALK inhibitor is characteristic of EMT specifically.

Experimental Example  3. Seritinib ( ceritinib ) Resistance of the acquired cell line Hoseong  Genome analysis

DNA-methylation, histone acetylation, and the like of the resistant cell line through RNA-seq, MBD-seq, and ChIP-seq integrated analysis to identify the mechanism of obtaining the ALK inhibitor resistance A genomic integrated analysis was performed, and the results are shown in Fig.

FIG. 4A shows the acetylation and DNA methylation changes of the histone proteins of the parental and resistant cell line, B shows the acetylation of the H3K27Ac site, and C indicates the expression levels of mRNA and miRNA in the resistant cell line , And D is the result of the reduction of expression by deacetylation of miR-34a and miR-449 through a phylogenetic analysis.

As shown in FIG. 4, there was no significant change in DNA methylation in the resistant cell line compared with the parental cell line, but deacetylation was prominent in the H3K27AC region (A and B). Furthermore, mRNA expression of AXL, GAS6 (AXL ligand) and N-Cadherin was increased in the resistant cell lines and expression of tumor suppressor genes including DUSP6 was decreased. In addition, a total of 50 genes with increased expression of mRNA were selected and analyzed for the presence of a downstream gene. As a result, acetylation of H3K27 (transcription initiation site) region of miR-34a and miR-449, which negatively regulate AXL expression, .

Experimental Example  4. Seritinib ( ceritinib ) In the resistant cell line EMT's  Identify relevant characteristics

Recently, AXL is a phosphorylating enzyme receptor that is attracting attention as a new resistance mechanism of lung cancer target therapy, and it is known to have a strong correlation with EMT related genes. In this experiment, the expression of EMT-related genes was examined by treatment with Foretinib, which is an AXL activity inhibitor, in order to examine the function of AXL in the seritinib resistant cell line.

As shown in FIG. 5A, it was confirmed that porutinib completely inhibited the activity of AXL and the expression of N-Cadherin in the resistant cell line, and increased the expression of the decreased E-cadherin again.

miRNA is an RNA composed of about 19 to 25 nucleotides and binds to target mRNA and inhibits gene expression. In particular, miR-34a and miR-449 are targets for AXL and MET, Is high. Thus, in order to confirm whether expression reduction by deacetylation of miR-34a and miR-449 in the resistant cell line is related to overexpression and activity of AXL, miR-34a and miR-449 inhibitors were added to H3122 cells, , MiR-34a and miR-449 mimics were transformed with lipofectamine RNAimax, treated and analyzed by immunoblot.

As a result, it was confirmed that the expression of AXL and N-Cadherin in the resistant cell line was completely suppressed and the expression of E-Cadherin was decreased again, as in FIG. 5A. These results suggest that the decreased expression of miR-34a and miR-449 is an EMT regulator in the resistant cell line.

Experimental Example  5. Seritinib ( ceritinib ) In the resistant cell line miR -34a and miR -449 as the inducer of resistance

In order to identify the functions of miR-34a and miR-449 in cell survival in seritinib resistant cell lines, miR-34a and miR-349 were transfected with inhibitor / mimics by MTT assay in the same manner as in Experimental Example 4, 449 on cell proliferation.

As a result, cell proliferation was increased by about 20% in the miR-449 inhibitor treated group compared with the negative control group in the dendritic cells, and cell proliferation was increased in the miR-449 mimics treated group compared with the negative control group in the two- Was inhibited by about 40% or more (Fig. 6A). In addition, the activity of AKT and ERK, which are representative cell survival signal transduction factors, was examined by immunoblot analysis under the same conditions. As a result, both miR-34a and miR-449 mimics inhibited the activity of ERK and showed a synergistic effect (Fig. 6B). In the case of miR-34a and miR-449 inhibitors, ERK activity was increased, but seritinib treatment inhibited similar inhibition to negative control.

These results suggest that the miR-34a and miR-449 inhibitors promote ERK activity and tumorigenesis, but are completely inhibited by seritinib in the parent cells, indicating that the parental cells are still ALK-dependent lung cancer cell lines , miR-34a and miR-449 did not affect the sensitivity of seritinib. On the other hand, miR-34a and miR-449 were shown to be important resistance inducers in resistant cell lines.

Experimental Example  6. Seritinib ( ceritinib ) In the resistant cell line Panovinostat on (Panobinostat)  by miR -34a and miR -449 of Deacetylation  Check for adjustability

To determine whether deacetylation and expression of miR-34a and miR-449 could be regulated by panobinostat, a histone deacetylase inhibitor, in the seritinib resistant cell line, Panobinostat was treated with panovinostat followed by q -PCR (real time quantitative RT-PCR), RNA-seq and ChIP-seq analyzes were performed. At this time, q-PCR was carried out using TaqMan 占 MicroRNA Assays (Life Technologies, USA) and probes and primers contained therein according to the manufacturer's method.

As shown in FIG. 7, it was found that the panovinostat increases acetylation at the H3K27AC region of the resistant cell line. Although the expression level of miR-34a was not changed by panovinostat, it was confirmed that acetylation and expression of miR-449 having the same target as AXL were increased.

Experimental Example  7. Seritinib ( ceritinib ) In the resistant cell line miR -34a and miR The possibility of overcoming tolerance by controlling deacetylation of -449

Colony formation was performed to confirm the monoterpic effect and the combined effect of each of panovinostat and seritinib.

As a result, a single effect of each drug was observed in the two blastocysts, but no combined effect was observed, and a synergistic effect was shown in the resistant acquisition cell line (Fig. 8A). In addition, immunoblot analysis revealed that the combination of povinolostat and seritinib induced the expression of p21, a CDK inhibitory protein (CIP / KIP family), known as G1 arrest induction protein, and apoptosis-related proteins cleaved PARP and cleaved caspase-3 (Fig. 8B). In addition, it was confirmed that expression of N-Cadherin and proteins such as AXL and MET targeted by miR-34a and miR-449 were decreased and expression of E-Cadherin was decreased again (FIGS. 9A and 9B) .

These results indicate that although povinolostat failed to increase the expression of miR-34a, the resistance of seritinib from AXL and EMT regulation through increased acetylation and expression of miR-449 competitively acting on the same target It can be overcome. Furthermore, the decrease in expression due to deacetylation of miR-34a and miR-449 is an important factor in the resistance mechanism of ceritinib, and as a new therapeutic method to overcome this, a combination of histone deacetylase inhibitor and ceritinib Strategy.

<110> University-Industry Foundation, Yonsei University          JEUK Co., Ltd. <120> Method of providing the information for selecting the drugs for          treating EML4-ALK positive non-small-cell lung cancer resistant          to ALK inhibitors <130> P16U16C1193 <160> 4 <170> Kopatentin 2.0 <210> 1 <211> 22 <212> RNA <213> Homo sapiens <400> 1 uggcaguguc uuagcugguu gu 22 <210> 2 <211> 22 <212> RNA <213> Homo sapiens <400> 2 uggcagugua uuguuagcug gu 22 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> miR-34a-5p probe <400> 3 acaaccagct aagacactgc ca 22 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> miR-449 probe <400> 4 accagctaac aatacactgc ca 22

Claims (15)

To provide information for the selection of drugs for the treatment of EML4-ALK-positive non-small cell lung cancer that has acquired resistance to ALK inhibitors from biological samples isolated from patients with EML4-ALK positive non-small cell lung cancer,
A method of detecting the expression level of miR-34a and / or miR-449, comprising ascertaining whether the level of expression of miR-34a and / or miR-449 is decreased after administration of an ALK inhibitor,
Wherein said ALK inhibitor is selected from the group consisting of crizotinib, ceritinib, alectinib, brigatinib and entrectinib, wherein miR-34a and / Or miR-449. The method according to claim 1,
A method of detecting an expression level of miR-34a and / or miR-449, wherein the biological sample is blood, plasma, serum, urine, feces, saliva, tears, spinal fluid, cell or tissue. The method according to claim 1,
Expression levels of miR-34a and / or miR-449 can be determined by real-time RT-PCR, transcriptional assays and RNA-Seq, in situ hybridization assays, 34a and / or miR-449, wherein the expression level of miR-34a and / or miR-449 is measured by a chip (DNA chip). delete delete miR-34a for providing information on drug selection for treatment of EML4-ALK positive non-small cell lung cancer that has acquired resistance to an ALK inhibitor, including an agent capable of measuring the expression level of miR-34a and / or miR- / Or &lt; / RTI &gt; miR-449,
Wherein the ALK inhibitor is selected from the group consisting of crizotinib, ceritinib, alectinib, brigatinib and entrectinib. The method according to claim 6,
A composition capable of measuring the level of expression of miR-34a and / or miR-449 is an antisense oligonucleotide, primer or probe complementary to miR-34a or miR-449. A kit for detecting miR-34a and / or miR-449 comprising the composition of any one of claims 6 and 7. delete delete delete delete delete delete delete

Images