KR101832610B1 - Soluble recombinant antigen protein of porcine epidemic diarrhea virus and vaccine composition for preventing or treating porcine epidemic diarrhea comprising the same - Google Patents

Abstract

The present invention relates to a water-soluble recombinant antigen protein derived from porcine epidemic diarrhea virus and a vaccine composition for preventing or treating swine epidemic diarrhea comprising the same, which is safer and more economical to prevent porcine epidemic diarrhea (PED) Subunit vaccine has been developed as a strategy to respond more quickly when it occurs. In the case of the live attenuated vaccine of the present invention, it is difficult to respond to the emergence of the new variant virus rapidly due to the inconvenience of long-term subculture (100 times) in animal cells. However, Because it is possible to produce by simple substitution of gene sequence, it can cope quickly. Accordingly, it is expected that the present invention can be used as an oral vaccine together with a vaccine or vaccine carrier for prevention or treatment of swine epidemic diarrhea as an animal medicine.

Description

Technical Field [0001] The present invention relates to a water-soluble recombinant antigen protein derived from a swine pandemic diarrhea virus, and a vaccine composition for preventing or treating swine epidemic diarrhea comprising the same and a vaccine composition for preventing or treating porcine epidemic diarrhea virus,

The present invention relates to a water-soluble recombinant antigen protein derived from porcine epidemic diarrhea virus and a vaccine composition for preventing or treating swine epidemic diarrhea comprising the same.

Porcine epidemic diarrhea (PED) is the most frequent viral disease in domestic pig farms, and it is a pig disease that has a high economic loss due to 90 ~ 100% mortality rate in newborn piglets. In order to prevent such PED, there is a need to develop a subunit vaccine as a strategy that is safer and more economical and can respond more quickly in the event of a disease. The subunit vaccine refers to the use of an antigenic known structure or nonstructural protein that constitutes a pathogenic microorganism as a vaccine antigen protein in a mass production of a recombinant microorganism (Escherichia coli or another expression system).

In Korea, most of the vaccinated PED live vaccines are used, but the biggest problem of these vaccines is that even if they are attenuated, the toxicity is restored because the virus is alive. In addition, in developing the vaccine, it takes a relatively long time to cultivate 100 times in animal cells to weaken the virus. Therefore, it is difficult to promptly respond to viruses with high mutation rate. It is high.

Korean Patent Laid-Open No. 10-2012-0066555 (published on Jun.22, 2012)

It is an object of the present invention to provide a water-soluble recombinant antigen protein derived from porcine epidemic diarrhea virus and a vaccine composition for preventing or treating porcine epidemic diarrhea comprising the same.

In order to achieve the above object, the present invention provides a porcine epidemic diarrhea (PED) virus spike glycoprotein gene represented by SEQ ID NO: 1 or SEQ ID NO: 2.

The present invention also provides a method for producing porcine epidemic diarrhea (PED) virus antigen protein, which comprises culturing the recombinant expression vector containing the gene, the recombinant microorganism transformed with the recombinant expression vector, and the recombinant microorganism .

The present invention also provides a vaccine composition for preventing or treating swine epidemic diarrhea comprising the recombinant microorganism, the culture thereof, or the PED virus antigen protein isolated and purified therefrom as an active ingredient.

The present invention relates to a water-soluble recombinant antigen protein derived from porcine epidemic diarrhea virus and a vaccine composition for preventing or treating swine epidemic diarrhea comprising the same, which is safer and more economical to prevent porcine epidemic diarrhea (PED) Subunit vaccine has been developed as a strategy to respond more quickly when it occurs. In the case of the live attenuated vaccine of the present invention, it is difficult to respond to the emergence of the new variant virus rapidly due to the inconvenience of long-term subculture (100 times) in animal cells. However, Because it is possible to produce by simple substitution of gene sequence, it can cope quickly. Accordingly, it is expected that the present invention can be used as an oral vaccine together with a vaccine or vaccine carrier for prevention or treatment of swine epidemic diarrhea as an animal medicine.

Fig. 1 shows PCR results for amplifying P1 (499-636aa) and P2 (637-789aa) genes.
Fig. 2 shows a schematic diagram of construction of pGEX 5x-1 expression vector.
FIG. 3 shows the results of colony PCR for confirming the transformation of P1 and P2 genes.
Fig. 4 shows SDS-PAGE results for confirming expression of P1 and P2 genes.
Figure 5 shows the Western blot results of the purified P1 and P2 proteins.
Fig. 6 shows the results of assaying antigen-specific serum IgG in mice.
Fig. 7 shows the result of neutralizing antibody test.
Figure 8 shows the results of P1 antigen-specific serum IgG assay in guinea pigs.
Fig. 9 shows the results of P2 antigen specific serum IgG assay in guinea pigs.
Fig. 10 shows the result of P1 antigen-specific serum IgG assay in piglets.
Fig. 11 shows the P2 antigen specific serum IgG assay results in piglets.

Therefore, the present inventors used viruses attenuated by subculturing 100 times of wild-type PED virus PPIV, which was isolated from domestic pig farms for the purpose of cloning antigen proteins. The antigen protein was expressed in the Escherichia coli expression system by selecting neutralization antibody epitopes 499 ~ 636aa and 637 ~ 789aa sites in the S1 region of the spike glycoprotein, the outer protein of the virus. In the case of subunit vaccine, the expressed recombinant antigen protein must have a unique structure. When the gene derived from virus is expressed in Escherichia coli, it is often expressed as an insoluble inclusion body. The present inventors introduced GST-P1 and GST-P2 by introducing chaperone co-expression E. coli strain to produce a water-soluble recombinant antigen protein. In order to investigate the antigenicity of the expressed recombinant antigen protein and the generation of the neutralizing antibody, an immunological test was carried out by administering an antigen by injection in a rat model animal. As a result, it was confirmed that both GST-P1 and GST-P2 showed relatively high antigenicity, and the neutralizing antibody titer was also generated at the level of 2 ⁸ ~ 2 ¹⁰ , and thus the present invention was completed.

The present invention provides a porcine epidemic diarrhea (PED) virus spike glycoprotein gene represented by SEQ ID NO: 1 or SEQ ID NO: 2.

The term "PED (porcine epidemic diarrhea) virus" in the present invention belongs to the coronaviridae and has a single strand RNA as a genome, about 28 Kb in length, and has three major constituent proteins, spike protein (180-220 KDa ), Membrane or coat protein (27-32 kDa), and nucleocapsid protein (55-58 kDa).

In the present invention, the term "Spike protein" is a major constituent protein of PED virus. It has a biologically important function of recognizing target cells and fusing viruses and cellular membranes. Some genes in spike proteins can be used as neutralizing epitopes.

The present invention also provides a recombinant expression vector comprising the gene. Preferably, the recombinant expression vector may have the cleavage map of Figure 2, but is not limited thereto.

In the present invention, "vector" means a DNA molecule that is replicated by itself, which is used to carry the clone gene (or another fragment of the clone DNA).

In the present invention, an "expression vector" means a recombinant DNA molecule comprising a desired coding sequence and a suitable nucleic acid sequence necessary for expressing a coding sequence operably linked in a particular host organism. The expression vector may preferably comprise one or more selectable markers. The marker is typically a nucleic acid sequence having a property that can be selected by a chemical method, and includes all genes capable of distinguishing a transformed cell from a non-transformed cell. Examples include, but are not limited to, antibiotic resistance genes such as ampicilin, kanamycin, G418, Bleomycin, hygromycin, chloramphenicol, It can be selected appropriately.

The present invention also provides a recombinant microorganism transformed with the recombinant expression vector. Preferably, the microorganism may be E. coli, and more preferably, the E. coli may be BL21.

In addition, the present invention provides a method for producing porcine epidemic diarrhea (PED) virus antigen protein, comprising the step of culturing the recombinant microorganism. Preferably, the PED virus antigen protein is a water-soluble protein.

The present invention also provides a vaccine composition for preventing or treating swine epidemic diarrhea comprising the recombinant microorganism, the culture thereof, or the PED virus antigen protein isolated and purified therefrom as an active ingredient.

The term " vaccine " in the present invention refers to a biological agent containing an antigen that immunizes a living body, and refers to an immunogen or an antigenic substance that causes immunity to a living body by injection or oral administration to a human or animal for the prevention of infection . In vivo immunity is largely divided into autoimmunity, which is obtained automatically in vivo after infection with pathogenic bacteria, and passive immunization, which is obtained by externally injected vaccine. While autoimmunity has long duration of immune-related antibodies and is characterized by persistent immunity, passive immunization by vaccine acts immediately for the treatment of infectious diseases but has a disadvantage that its persistence is poor.

The vaccine composition of the present invention may include a pharmaceutically acceptable carrier. Refers to any component suitable for delivering an antigenic material to an in vivo site and includes, for example, water, saline, phosphate buffered saline, Ringer's solution, dextrose solution, serum containing solution, Hans's solution, , Oils, esters, glycols, and the like.

The carrier of the present invention may contain suitable auxiliary ingredients and preservatives to enhance chemical stability and isotonicity and may include stabilizers such as trehalose, glycine, sorbitol, lactose or monosodium glutamate (MSG) The vaccine composition can be protected against drying. The vaccine composition of the present invention may comprise a suspending liquid such as sterile water or saline (preferably buffered saline).

The vaccine composition of the present invention may contain an amount of any adjuvant sufficient to enhance the immune response to the immunogen. Suitable adjuvants are described in the literature, Takahashi et al. (SAF-1), muramyl peptides, saponin derivatives, mycobacterial cell wall preparations, monophosphates, and the like, which are described in Nature 344: 873-875 (1990) But are not limited to, a polyol lipid A, a micolic acid derivative, a nonionic block copolymer surfactant, Quil A, cholera toxin B subunits, polyphosphazene and derivatives, and immunostimulatory complexes (ISCOMs).

As with all other vaccine compositions, the immunologically effective amount of an immunogen should be determined empirically, and factors considered in this case include immunogenicity, route of administration and the number of immunized administrations administered.

The swine epidemic diarrhea virus antigen protein, which is an antigenic substance in the vaccine composition of the present invention, may be present in various concentrations in the composition of the present invention, but usually the antigenic substance is in a concentration necessary to induce proper level of antibody formation in vivo .

The vaccine composition of the present invention can be used to protect or treat animals susceptible to swine epidemic diarrhea virus infection by administration via the systemic or mucosal route. Administration of the vaccine composition may include, but is not limited to, intramuscular, intraperitoneal, intradermal or subcutaneous injection, oral / dietary, respiratory, mucosal administration to the genitourinary tract.

BEST MODE FOR CARRYING OUT THE INVENTION Hereinafter, the present invention will be described in detail with reference to the following examples. However, the following examples are intended to illustrate the contents of the present invention, but the scope of the present invention is not limited to the following examples. Embodiments of the present invention are provided to more fully describe the present invention to those skilled in the art.

< Example >

1. Spike glycoprotein expression region gene Cloning

1) pMBP-SLONG (499-789) vector

The gene was amplified using PCR in the previously constructed pMBP-SLONG (499-789) vector to clone the P1 (499-636aa; SEQ ID NO: 1) and P2 (637-789aa;

 The construction process of pMBP-SLONG (499-789) vector is as follows. First, PPIV virus was transfected into Vero CCL-81 cells to clone the gene corresponding to the 499-789aa region of the PPIV virus-spiked glycoprotein, and then total mRNA was extracted from the cells using Trizol. Were synthesized. To perform RT-PCR, S_MAL_F 5 'TGAAGGATTTCAGTTACTTTGCCATCATTCAATGAC 3' and S_MAL_R 5 'TCCTGCAGGAATACTCATACTAAAGTTGGTGGG 3' primers were used, respectively. Reverse transcription was performed by adding 5 μl of first strand buffer, 0.1 M DTT, 10 mM dNTP mixture, and 100 U MMLV reverse transcriptase to each well of a solution containing 1 μg of mRNA and 100 pmol S_MAL_R at 65 ° C for 5 min. For 50 minutes at 70 ° C for 15 minutes to synthesize cDNA. PCR was performed using the synthesized cDNA as a template under the following conditions. For PCR, 1 μl cDNA solution, 10 × PCR buffer, 2.5 mM dNTP, Taq polymerase and 1 pmol F / R Primer were mixed with DW, and 50 μl was added. PCR was carried out at 95 ° C for 4 minutes, at 95 ° C for 30 seconds, at 52 ° C for 30 seconds, at 72 ° C for 1 minute, at 72 ° C for 5 minutes, and at 30 cycles. After the PCR reaction, an expected band of 800 bp was confirmed at 1% agarose gel. The remaining reaction products were purified using PCR purification kit and inserted into pGEM T easy vector (Promega) to construct pGEM-SLONG. The pGEM-SLONG expression vector was treated with Xmn I and Sbf I restriction enzymes for 4 hours, and then separated and purified on 1% agarose gel. The pMAL-SLONG expression vector was ligated with the pMAL-c5x-1 expression vector 499-789) expression vector was constructed.

2) Primer synthesis

The primers were prepared based on the inserted gene sequence in pMBP-SLONG (499-789) and the 5 'BamH I, 3' Stop codon & Xho I sequence was inserted as shown in Table 1.

3) PCR cloning

PCR was performed under the following conditions to amplify P1 and P2 genes in the pMBP-SLONG (499-789) vector. 50 ng pMBP-SLONG (499-789), 2X i-MAX II PCR mixture (Intron) and 10 pmol primers were added to each well to give a total volume of 50 μl. 95 ° C for 4 minutes, 95 ° C for 30 seconds, 57 ° C for 30 seconds, 72 ° C for 1 minute, and 72 ° C for 5 minutes. After the PCR reaction, an expected band of about 500 bp was observed at 1% agarose gel (FIG. 1). The remaining reaction products were purified using PCR purification kit and inserted into pGEM T easy vector (Promega) to obtain pGEM-P1 and pGEM-P2 vectors.

2. Construction of Expression Vector and Recombinant Escherichia coli Expression Strain

1) Construction of pGEX 5x-1 expression vector

pGEM-P1 and pGEM-P2 expression vectors were treated with BamH I and Xho I restriction enzymes for 4 hours, respectively, and then separated and purified on 1% agarose gel. Using pGEX 5x-1 expression vector and T4 ligase To construct an expression vector (Fig. 2).

2) Colony PCR

The constructed vector was subjected to heat shcok transformation in E. coli BL21 pTF16 competent cells, followed by colony PCR to confirm transformation (Fig. 3). Colonial PCR conditions are the same as those for P1 & P2 amplification except that a colony grown on an LB plate is used as a template.

3. Confirm protein expression

One colony of the constructed recombinant expression strain was inoculated 1/1000 in 5 ml of LB broth + ampicillin (100 μg / ml) + chloramphenicol (20 μg / ml) and cultured in a shaking incubator at 37 ° C. for 14 hours . The following culture broth was inoculated at a ratio of 1/100 to 500 ml of LB broth + ampicillin (100 μg / ml) + chloramphenicol (20 μg / ml) + L-arabinose (0.5 mg / ml) . If OD = 0.5 ~ 0.6, the cells were allowed to cool in a refrigerator at 4 ℃ for 30 min. Then, 0.1 mM IPTG was added and incubated at 15 ° C for 24 hours with shaking. After the culture was completed, the bacteria were recovered and washed twice in 1X PBS, and the pellet was recovered. The recovered pellet was dissolved in 5 ml of 1XPBS and the bacteria were disrupted by sonication. The shredded solution was separated by centrifugation at 12,000 rpm for 10 minutes at 4 ° C to separate the water-soluble protein compartment and the water-insoluble compartment. The pellet was dissolved in 10 mM Tris-HCl, pH 12.5 and then separated by size on a 12% SDS-PAGE together with a water-soluble protein compartment to primarily detect protein expression (FIG. 4). GST binding affinity column purification (Novagen) was used to purify the expressed protein. The purification conditions were applied in the same manner as described in Novagen's manual. Western blot was performed to confirm that the purified protein was correct. GST monoclonal antibody (1: 2000, abcam) and anti-mouse IgG-HRP (1: 5000, Santacruz) were added to the nitrocellulose membrane at 15V for 1 hour. (Fig. 5).

4. Immunity test in mice for vaccine efficiency verification

1) Experimental animal and antigen treatment

The purified protein was passed through an endotoxin removal column (Thermo) to remove endotoxin. Five female Balb / c mice at 6 weeks of age were placed per group. PBS was administered to the control, and GST-P1 and GST-P2 antigen proteins were subcutaneously administered at a dose of 10 μg per 2 weeks. The same amount of Complete Freund's adjuvant (CFA) was used for the primary antigen administration, and then the same amount of Incomplete Freud's adjuvant (IFA) was injected at Boosting. Blood was collected from retro orbital blood vessels at 0, 2, 4, and 6 weeks of age and serum was separated and stored frozen at -20 ° C until analysis.

2) Antigen-specific serum IgG analysis using ELISA

The purified antigen protein or GST protein was diluted in 50 mM sodium bicarbonate buffer (pH 9.6) to a concentration of 10 μg / ml, and then 100 μl was added to a 96-well immuno-plate (SPL) and cultured at 4 ° C. overnight. The coating buffer was removed the next day, washed three times with 1XPBS, and blocked with 0.5% skim milk for 1 hour at room temperature. After blocking, the plate was washed 3 times with 1XPBS, 100 ㎕ of serum diluted 800X in 1XPBS was dispensed, and then incubated at room temperature for 2 hours. After the incubation, the cells were washed three times with 1XPBS, and then 100 μl of Goat anti-mouse IgG HRP (1: 5000, Santacruz) was added and cultured at room temperature for 1 hour. After washing three times with 1X PBS, 100 쨉 l of TMB solution (Sigma) was added and cultured at room temperature for 15 minutes. After the incubation, the reaction was stopped with 0.16 MH ₂ SO ₄ solution, and OD450 nm was measured in a microplate reader (FIG. 6).

5. Neutralizing antibody test

For the neutralization antibody test, PEDV SM98 strain virus and Vero cell were used as infectious hosts. Vero cell growth medium was prepared by adding 5% heat-inactivated FBS, penicillin (100 ug / ml), streptomycin (100 U / ml), amphotericin B / ml) and antibiotics were used. For the virus culture, a medium supplemented with FBS or a medium supplemented with trypsin (2 μg / ml) was used. First, 100 μl of serum was mixed with an equal volume of a-MEM medium and diluted 2-fold, then mixed with 100 μl of 200 TCID / 100 μl virus solution 1: 1 and incubated at 37 ° C. for 1 hour. Immediately before the end of the culture, Vero cells prepared in a monolayer state on a 96-well plate were washed three times with 1XPBS, and then 100 μl of a serum-virus mixture was added and cultured at 37 ° C for 2 hours. After the incubation, 100 μl of the medium containing trypsin (2 μg / ml) was added, and the plate was incubated at 37 ° C. for 3 to 5 days until a cytopathic effect (CPE) occurred. The neutralizing antibody level was measured by observing under the microscope the serum dilution factor of the well before the appearance of the CPE (FIG. 7).

6. To verify vaccine efficiency In the guinea pig  Immunity test

1) Experimental animal and antigen treatment

Six female guinea pigs per 6 weeks were placed per group. The control was not treated and the experimental group was administered subcutaneously three times at intervals of 2 weeks with 100 ㎍ of GST-P1 and GST-P2 antigen proteins, respectively. The same amount of IMS1313 adjuvant was injected in the same dose. Blood was collected from the jugular vein or heart at weeks 0, 4, and 6, and the serum was separated and frozen at -20 ° C.

2) Antigen-specific serum IgG analysis using ELISA

The purified antigen protein was diluted 100 μg / ml in 50 mM sodium bicarbonate buffer (pH 9.6), and 100 μl was added to a 96-well immuno-plate (SPL) and incubated at 4 ° C overnight for 12 hours. The coating buffer was removed the next day, washed 3 times with 1XPBS, and blocked with 0.5% skim milk for 1 hour at room temperature. After blocking, the plate was washed 3 times with 1XPBS, 100 ㎕ of serum diluted 1000 times with 1XPBS was dispensed and incubated at room temperature for 2 hours. After incubation, the cells were washed three times with 1XPBS, and then 100 μl of Goat anti-guinea pig IgG HRP (1: 5000) was added and incubated at room temperature for 1 hour. After washing three times with 1X PBS, 100 μl of TMB solution (Sigma) was added and cultured at room temperature for 15 minutes. After the incubation, the reaction was stopped with 0.16 MH ₂ SO ₄ solution and OD450 nm was measured in a microplate reader (FIGS. 8 and 9).

7. For vaccine efficiency verification In piglets  Immunity test

1) Experimental animal and antigen treatment

Three piglets weighing 25-35 kg were placed per group. The control was not treated, and the experimental groups were administered with 500 ㎍ of GST-P1 and GST-P2 antigen proteins, respectively, at 2-week intervals for 3 times. The same amount of IMS1313 adjuvant was injected in the same dose. Blood was collected from the jugular vein or heart at 0, 2, 4, and 6 weeks of age, and the serum was separated and stored frozen at -20 ° C.

2) Antigen-specific serum IgG analysis using ELISA

The purified antigen protein was diluted 100 μg / ml in 50 mM sodium bicarbonate buffer (pH 9.6), and 100 μl was added to a 96-well immuno-plate (SPL) and incubated at 4 ° C overnight for 12 hours. The coating buffer was removed the next day, washed 3 times with 1XPBS, and blocked with 0.5% skim milk for 1 hour at room temperature. After blocking, the plate was washed 3 times with 1XPBS, 100 ㎕ of serum diluted 1000 times with 1XPBS was dispensed and incubated at room temperature for 2 hours. After incubation, the cells were washed three times with 1XPBS, and then 100 μl of Goat anti-pig IgG HRP (1: 5000) was added and incubated at room temperature for 1 hour. After washing three times with 1X PBS, 100 μl of TMB solution (Sigma) was added and cultured at room temperature for 15 minutes. After the incubation, the reaction was stopped with 0.16 MH ₂ SO ₄ solution and OD450 nm was measured in a microplate reader (FIGS. 10 and 11).

<110> SNU R & DB FOUNDATION <120> Soluble recombinant antigen protein of porcine epidemic diarrhea          virus and vaccine composition for preventing or treating porcine          epidemic diarrhea comprising the same <130> ADP-2016-0227 <160> 2 <170> Kopatentin 2.0 <210> 1 <211> 416 <212> DNA <213> porcine epidemic diarrhea virus <400> 1 ccgttacttt gccatcattc aatgaccatt cttttgttaa tattactgtc tctgcggctt 60 ttggtggtca tagtggtgcc aacctcattg catctgacac tactatcaat gggtttagtt 120 ctttctgtgt tgacactaga caatttacca ttacactgtt ttataacgtt acaaacagtt 180 atggttatgt gtctaagtca caggatagta attgcccttt caccttgcaa tctgttaatg 240 attacctgtc ttttagcaaa ttttgtgttt caaccagcct tttggctggt gcttgtacca 300 tagatctttt tggttaccct gagttcggta gtggtgttaa gtttacgtcc ctttattttc 360 aattcacaaa gggtgagttg attactggca cgcctaaacc acttcaaggt gtcacg 416 <210> 2 <211> 461 <212> DNA <213> porcine epidemic diarrhea virus <400> 2 ccgacgtttc ttttatgact ctggatgtgt gtaccaagta tactatctat ggctttaaag 60 gtgagggtat tattaccctt acaaattcta gctttttggc aggtgtttat tatacatctg 120 attctggaca gttgttagcc tttaagaatg tcactagtgg tgctgtttat tctgttacgc 180 catgttcttt ttcagagcag gctgcatatg ttgatgatga tatagtgggt gttatttcta 240 gtttgtctaa ctccactttt aacaatacca gggagttgcc tggtttcttc taccattcta 300 atgatggctc caattgtaca gagcctgtgt tggtgtatag taacataggt gtctgtaaat 360 ctggcagtat tggctatgtc ccacttcagg atggccaagt caagattgca cccatggtta 420 ctgggaatat tagtattccc accaacttta gtatgagtat t 461

Claims (9)

delete delete delete delete (1) preparing a first recombinant microorganism transformed with a first recombinant expression vector comprising Porcine epidemic diarrhea (PED) virus spike glycoprotein gene represented by SEQ ID NO: 1;
(2) preparing a second recombinant microorganism transformed with a second recombinant expression vector comprising Porcine epidemic diarrhea (PED) virus spike glycoprotein gene represented by SEQ ID NO: 2; And
(3) culturing the transformed first recombinant microorganism and the second recombinant microorganism. 2. The method of claim 1, wherein the recombinant microorganism is a recombinant microorganism. [Claim 6] The method according to claim 5, wherein the microorganism is E. coli. 7. The method according to claim 6, wherein the E. coli is BL21. delete A first recombinant microorganism transformed with a first recombinant expression vector comprising the PED virus spike glycoprotein gene represented by SEQ ID NO: 1 and a second recombinant expression vector comprising the PED virus spike glycoprotein gene represented by SEQ ID NO: 2 A vaccine composition for preventing or treating porcine epidemic diarrhea comprising, as an active ingredient, a water-soluble recombinant antigen protein of a mixed culture of transformed second recombinant microorganisms or PED virus isolated and purified therefrom.

Images