KR101797168B1 - Vesicle with novel protein transduction domain - Google Patents

Abstract

The present invention relates to a vesicle in which a novel protein transduction domain is self-assembled. By using peptides having amino acid sequences represented by sequence number 1, vesicles (for example, liposome) having improved cell or skin penetration can be manufactured. Also, by using vesicles (for example, liposome) manufactured by the present invention, a poorly water soluble material (skin functional material or pharmacologic material) is loaded in the vesicle to be effectively delivered to skin or cells.

Description

Vesicle with novel protein transduction domain containing a novel protein transduction domain

TECHNICAL FIELD The present invention relates to a spherical structure capable of delivering an active ingredient or a useful ingredient to cells or skin, and more particularly, to a spherical structure containing a novel protein transduction domain.

PTD (Protein transduction domain) is able to transport macromolecules that are several times its own molecular weight into cells, and it is also effective for various cell types. Therefore, the active ingredient or active ingredient contained in medicine, functional food or functional cosmetics It has been estimated that it has the potential to penetrate efficiently into cells.

For example, a PTD in combination with a target substance can enter the cell and / or the cell nucleus by translocating the cell membrane in vitro or in vivo . A variety of biomolecules such as antigenic peptides, peptide nucleic acids, antisense oligonucleotides, full length proteins, nanoparticles, and liposomes are known to be able to be delivered via PTD.

Considering that most peptides or nucleic acid-based drugs are difficult to enter into cells and thus limit the development of these substances as therapeutic agents, PTD may double the efficacy of these drugs in vivo It is expected.

These PTDs have been applied by chemical bonding directly to simple compounds or drugs for drug delivery to the skin. However, when the PTD and the drug are mixed, there is a gap in the skin permeation time between the PTD and the drug, and the poorly soluble drug has a limitation in application and may cause a large variation depending on the administration conditions. In addition, the chemical bonding is also limited in its ease of bonding between the active substance and the peptide and in the maintenance of the activity of the active substance.

On the other hand, poorly soluble drugs contain structurally hydrophobic sites of the compounds and are not well soluble in water. In many cases, their practicality is limited due to poor solubility. For example, about 41% or more of new drug products are being abandoned due to poor availability, and about one-third or more of the drugs listed in the US Pharmacopeia are classified as poorly soluble drugs.

Representative examples of poorly soluble drugs include caffeic acid, coenzyme Q10, ursodeoxycholic acid, ilaprazol, paclitaxel, imatinib mesylate, and the like. And these drugs are limited in their use due to their poor availability despite good efficacy.

In order to use such poorly soluble drugs, an additional substance must be added to solve the poor solubility. For example, emulsification using an emulsifier, collection using liposomes, and the like have been widely used in order to generally hydrate a poorly soluble substance.

On the other hand, when the liposome and the PTD are combined, the function of penetration of liposomes through the transappendageal route including the vesicular skin penetration, the penetration enhancing effect, the sweat glands, The penetration of the drug into the skin can be synergistically improved by the simultaneous introduction of the drug penetration into the skin cells of the PTD and the mechanism of increasing the penetration of the skin by the action of the concentration gradient.

Korean Patent Publication No. 10-2011-0046961 (published on May 05, 2011) discloses a cell permeable peptide surface-bound nanoliposome and an anti-atopic composition comprising the same.

In the present invention, a new spherical structure having enhanced cell or skin permeability is developed and provided by using the new PTD developed by the present inventors.

The present invention provides a spherical structure in which amphipathic molecules having hydrophilic sites and hydrophobic sites are formed by self aggregation, wherein the spherical structure contains a peptide having an amino acid sequence as shown in SEQ ID NO: 1 .

In addition, the present invention provides a spherical structure in which an amphipathic molecule prepared by binding a peptide having an amino acid sequence shown in SEQ ID NO: 1 to lipid is formed by self-aggregation. The lipid may be, for example, phosphatidylcholine having a functional group such as maleimide, N-hydroxysuccinimide, amine, carboxylic acid, or hydroxyl bonded thereto; Phosphatidyl ethanolamine; Phosphatidyl glycerol; Phosphatidylserine; Phosphatidylinositol; Ceramide; Sphinganine; Phytosphingosine; Sphingosine; Dimethyl dioctadecylammonium; Diol leuyl trimethyl ammonium propane; And dioctadecenyl trimethyl ammonium propane; Or a derivative thereof.

In the spherical structure of the present invention, the spherical structure may preferably be a spherical structure characterized in that the hydrophobic molecules of the amphipathic molecules are oriented so as to be in contact with each other to form a double-walled hemisphere. At this time, the spherical structure may be, for example, a liposome.

In the spherical structure of the present invention, the peptide having the amino acid sequence shown in SEQ ID NO: 1 is preferably oriented in the outward direction of the spherical structure.

In the spherical structure of the present invention, the spherical structure preferably contains cholesterol in the hydrophobic region.

In the spherical structure of the present invention, the spherical structure may preferably contain the substance to be trapped therein.

On the other hand, the present invention provides a cosmetic composition comprising the spherical structure of the present invention. Also provided is a pharmaceutical composition characterized by containing a spherical structure of the present invention.

(A) dissolving an amphipathic molecule, a peptide having the amino acid sequence shown in SEQ ID NO: 1 and a substance to be captured in a solvent; (B) after the step (a), evaporating the solvent to produce a film; And (c) adding purified water or a buffer to the film after the step (b) to hydrate and then reducing the particle size by applying energy to the film. The amphiphilic molecule may be, for example, a phospholipid.

(A) dissolving an amphipathic molecule prepared by binding a peptide having the amino acid sequence shown in SEQ ID NO: 1 to a lipid and a substance to be captured in a solvent; (B) after the step (a), evaporating the solvent to produce a film; And (c) adding purified water or a buffer to the film after the step (b) to hydrate and then reducing the particle size by applying energy to the film. Preferably, in step (a), the amphipathic molecule prepared by binding a peptide having the amino acid sequence of SEQ ID NO: 1 to a lipid is preferably added to dissolve the amphipathic molecule in a solvent. In this case, the separate amphipathic molecule may be, for example, a phospholipid.

In the method for producing a globular structure of the present invention, the amphipathic molecule prepared by binding a peptide having the amino acid sequence of SEQ ID NO: 1 to the lipid may be, for example, a peptide having an amino acid sequence of SEQ ID NO: 1 The lipid in the form of a film is prepared by dissolving a lipid in a hydrophobic organic solvent, and then volatilizing the organic solvent in a volatile organic solvent by adding a solution containing the peptide to the lipid to induce a binding reaction between the lipid and the peptide having the amino acid sequence shown in SEQ ID NO: The peptide having the amino acid sequence of SEQ ID NO: 1 is dissolved in distilled water together with the ammonium carbonate, and then the pH of the solution is adjusted to pH 8 to 8. The solution containing the peptide having the amino acid sequence of SEQ ID NO: 10. ≪ / RTI > The lipid may be, for example, phosphatidylcholine having a functional group such as maleimide, N-hydroxysuccinimide, amine, carboxylic acid, or hydroxyl bonded thereto; Phosphatidyl ethanolamine; Phosphatidyl glycerol; Phosphatidylserine; Phosphatidylinositol; Ceramide; Sphinganine; Phytosphingosine; Sphingosine; Dimethyl dioctadecylammonium; Diol leuyl trimethyl ammonium propane; And dioctadecenyl trimethyl ammonium propane; Or a derivative thereof.

In the method for producing a spherical structure of the present invention, the step (a) preferably dissolves the cholesterol further in a solvent.

In the method for producing a spherical structure of the present invention, the solvent may be, for example, a mixture of chloroform and methanol.

When the peptide having the amino acid sequence of SEQ ID NO: 1 of the present invention is used, a spherical structure (for example, a liposome) having enhanced cell or skin permeability can be produced.

In addition, when the spherical structure (for example, liposome) produced in the present invention is used as described above, a poorly soluble substance (skin functional substance or pharmacologically effective substance) can be loaded inside the structure and efficiently transported to skin or cells have.

Figure 1 is a map of a general GFP expression vector.
Figure 2 is a map of the TAT-GFP expression vector.
Figure 3 is a map of the PEPl-GFP expression vector.
Figure 4 is a map of the STeP-GFP expression vector.
Figure 5 shows the expression of GFP recombinant protein.
6 shows the results of purification of GFP recombinant protein.
Fig. 7 shows the result of comparing the cell permeability of GFP protein.
Fig. 8 shows the skin permeability comparison result of GFP protein.
Figure 9 shows the chemical structure of lipid (DSPE-PEG3.4K-maleimide) -PTD (STeP peptide).
10 shows the results of particle characterization of self-assembled PTD-liposome- (caffeic acid).
Fig. 11 is a TEM image of the self-assembled PTD-liposome (caffeic acid) (left: liposome- (caffeic acid), right: self-assembled PTD-liposome- (caffeic acid)).
Figure 12 shows the results of particle stability evaluation of self-assembled PTD-liposome- (caffeic acid).
Fig. 13 shows the results of comparing cytoprotective effects of caffeic acid in cell damage caused by oxidative stress.
Fig. 14 shows the results of skin permeability comparison of self-assembled PTD-liposome- (caffeic acid).

Numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated herein by reference in their entirety to better understand the state of the art to which the present invention pertains and the content of the present invention.

As a result of efforts to develop a more efficient peptide capable of delivering a target substance into cells and a drug delivery system using the same, the present inventors have found that a cell permeable peptide described in SEQ ID NO: 1 and a circular spherical body containing the same (for example, Liposomes).

The peptide of the present invention having the amino acid sequence shown in SEQ ID NO: 1 exhibits amphipathic characteristics and has been confirmed through experiments of the present invention that can be efficiently applied to intracellular delivery of a target substance. The amino acid sequence of SEQ ID NO: 1 may preferably be one encoded by the nucleic acid sequence of SEQ ID NO: In addition, depending on the purpose for which it is required, a peptide for the purpose of realization of the purpose may be bound to the N-terminal or C-terminal of the present amino acid sequence.

The present invention provides a spherical structure in which amphipathic molecules having hydrophilic sites and hydrophobic sites are formed by self aggregation, wherein the spherical structure contains a peptide having an amino acid sequence as shown in SEQ ID NO: 1 . In addition, the present invention provides a spherical structure in which an amphipathic molecule prepared by binding a peptide having an amino acid sequence shown in SEQ ID NO: 1 to lipid is formed by self-aggregation.

When an amphipathic molecule having a hydrophilic part and a hydrophobic part in a molecule is dispersed in a water-soluble solution as an example, a hydrophobic part is self-aggregated (aggregated) to form a spherical structure in which a hydrophobic part is centered. The so-called 'micelle' is called a 'micelle', and the thus formed spherical structure can be utilized as a means for transferring the lipophilic substance by mounting the lipophilic substance on the hydrophobic portion. The amphipathic molecules may also be oriented so that the hydrophobic molecules are in contact with each other when dispersed in a water-soluble solution to form a double-layered membrane. The lipophilic molecule, phospholipid, ). The liposome is a structure in which a hydrophilic part space exists inside and a hydrophobic phospholipid bilayer is formed around the liposome. Liposomes are widely used as a means for transferring water-soluble substances by incorporating water-soluble substances therein. In particular, it has been widely used in cosmetics or pharmaceuticals as a means for the delivery of various useful water-soluble substances to the human body.

Meanwhile, the peptide having the amino acid sequence of SEQ ID NO: 1 of the present invention has amphipathic effect and, when bound to lipid, acts as a partner capable of imparting amphipathicity to the whole lipid. The lipid, which is bound to the peptide having the amino acid sequence shown in SEQ ID NO: 1 and exhibits amphipathic nature, is self-aggregated (or self-assembled) when dispersed in an aqueous solution to form a spherical structure of a single membrane (so- As a representative example, 'phospholipid' is formed. The lipid may be, for example, a phosphatidylcholine having a functional group such as maleimide, N-hydroxysuccinimide, amine, carboxylic acid, or hydroxyl bonded thereto; Phosphatidyl ethanolamine; Phosphatidyl glycerol; Phosphatidylserine; Phosphatidylinositol; Ceramide; Sphinganine; Phytosphingosine; Sphingosine; Dimethyl dioctadecylammonium; Diol leuyl trimethyl ammonium propane; And dioctadecenyl trimethyl ammonium propane; Or a derivative thereof.

On the other hand, the peptide having the amino acid sequence shown in SEQ ID NO: 1 is contained in the spherical structure, and plays a role of helping intracellular or intracutaneous penetration of the spherical structure of the present invention.

On the other hand, the 'peptide having the amino acid sequence of SEQ ID NO: 1' of the present invention can be preferably oriented in the outward direction of the globular structure. According to this structure, the peptide having the amino acid sequence of SEQ ID NO: 1 oriented in the outward direction of the globular structure functions as PTD (protein transduction domain), and the globular structure is easily transferred into cells or skin.

On the other hand, the spherical structure of the present invention may contain cholesterol in a hydrophobic region, thereby stabilizing the structure of the spherical structure.

On the other hand, in the spherical structure of the present invention, the spherical structure may preferably contain the substance to be trapped therein. The material to be collected may be various. In the micelle-type spherical structure, a hydrophobic substance can be loaded therein. In the bilayer membrane-like spherical structure (for example, liposome), a hydrophilic substance can be loaded inside. Examples of the substance to be captured include a physiological functional substance, a skin functional substance, a pharmaceutical substance, and the like, and examples thereof include compounds, peptides, proteins, and the like.

On the other hand, the present invention provides a cosmetic composition comprising the spherical structure of the present invention. As long as it contains the spherical structure of the present invention, it is not necessarily limited to a specific cosmetic formulation, but includes all the formulations.

Also provided is a pharmaceutical composition characterized by containing a spherical structure of the present invention. The pharmaceutical composition is not necessarily limited to a specific pharmaceutical formulation as long as it contains the spherical structure of the present invention, and includes all the formulations.

(A) dissolving an amphipathic molecule, a peptide having the amino acid sequence shown in SEQ ID NO: 1 and a substance to be captured in a solvent; (B) after the step (a), evaporating the solvent to produce a film; And (c) adding purified water or a buffer to the film after the step (b) to hydrate and then reducing the particle size by applying energy to the film. The amphiphilic molecule may be, for example, a phospholipid.

(A) dissolving an amphipathic molecule and a capture target substance produced by binding a peptide having the amino acid sequence of SEQ ID NO: 1 to lipid in a solvent; (B) after the step (a), evaporating the solvent to produce a film; And (c) adding purified water or a buffer to the film after the step (b) to hydrate and then reducing the particle size by applying energy to the film. Preferably, in step (a), the amphipathic molecule prepared by binding a peptide having the amino acid sequence of SEQ ID NO: 1 to a lipid is preferably added to dissolve the amphipathic molecule in a solvent. In this case, the separate amphipathic molecule may be, for example, a phospholipid. Further, the step of reducing the particle size by applying the energy may be performed by applying ultrasonic waves.

In the present invention, a spherical structure containing a target substance can be produced through the above process. When a phospholipid is used as an amphipathic molecule, it can be produced as a liposome. In the method for manufacturing a spherical structure of the present invention, in order to increase the structural stability of the prototype structure, the cholesterol may be further dissolved in a solvent in step (a). In the method for producing a spherical structure of the present invention, a mixture of chloroform and methanol may be used as the solvent.

The method for producing a globular structure of the present invention is characterized by using a peptide having an amino acid sequence as shown in SEQ ID NO: 1, wherein a method for producing a globular structure using an amphipathic molecule (for example, using a phospholipid (Including production of liposomes) are well known in the art, a detailed description of each step for manufacturing the spherical structure will be omitted.

Meanwhile, in the method for producing a spherical structure of the present invention, the amphipathic molecule prepared by binding a peptide having the amino acid sequence of SEQ ID NO: 1 to the lipid may be, for example, an amino acid 1 by adding a solution containing the peptide having the sequence, and inducing a binding reaction between the lipid and the peptide having the amino acid sequence shown in SEQ ID NO: 1. In this case, the lipid in the form of a film is prepared by dissolving lipid in a hydrophobic organic solvent and then volatilizing the organic solvent to form a film. The solution containing the peptide having the amino acid sequence shown in SEQ ID NO: May be prepared by dissolving the peptide having the amino acid sequence of SEQ ID NO: 2 with ammonia carbonate in distilled water and adjusting the pH to 8 to 10. The lipid may be, for example, phosphatidylcholine having a functional group such as maleimide, N-hydroxysuccinimide, amine, carboxylic acid, or hydroxyl bonded thereto; Phosphatidyl ethanolamine; Phosphatidyl glycerol; Phosphatidylserine; Phosphatidylinositol; Ceramide; Sphinganine; Phytosphingosine; Sphingosine; Dimethyl dioctadecylammonium; Diol leuyl trimethyl ammonium propane; And dioctadecenyl trimethyl ammonium propane; Or a derivative thereof.

As described above, the present invention exhibits enhanced cell penetration or skin permeability through the peptide consisting of the 27 amino acid sequence set forth in SEQ ID NO: 1, and the target substance can be loaded into the structure and transferred into cells or skin.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it will be understood by those skilled in the art that various changes and modifications may be made without departing from the spirit and scope of the invention as defined in the appended claims. It will be obvious. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.

[ Example  1. Cell and skin permeability GFP  Preparation of protein expression vector]

A recombinant protein expression vector was prepared by fusing a peptide having cell and skin permeability and a protein (cargo) to be delivered in order to easily transfer the macromolecular protein or peptide into cells and skin.

In this embodiment, as a target protein (cargo) to be transferred in order to easily analyze the ability of the fusion protein to transfer to cells and skin, a green fluorescence protein (hereinafter referred to as "GFP" ) Were selected.

TAT or PEP1, which is a well-known PTD, is fused to GFP to produce STeP (a peptide having the amino acid sequence of SEQ ID NO: 1, encoded by the nucleic acid sequence of SEQ ID NO: 2) newly developed in the present invention, To compare their abilities.

 (One) pGFP  Vector production

A DNA fragment corresponding to the base sequence of GFP was subcloned into the XhoI and BamHI sites of the plasmid pET15b to prepare pGFP expressing the GFP protein. GFP expressed in this vector is not capable of delivering to cells and skin because the pGFP expression vector is not fused with a peptide having cell and skin permeability and GFP is a hydrophilic polymer protein of about 29 kDa. Therefore, it was prepared as a control for comparison of cell and skin permeability.

The DNA fragment corresponding to the nucleotide sequence of GFP was amplified by PCR using a plasmid pEGFP-C2 (Clontech) with Pfu DNA polymerase to amplify the complete sequence of GFP. The sense primer is 5'-CTCGAGGTGAGCAAGGGCGAGGAGCTG-3 'and the sequence of the antisense primer is 5'-GGATCCTTACTTGTACAGCTCGTCC ATGCCGAG-3'. The PCR product was cut into Xho I-Bam HI and subcloned into the XhoI-BamHI site of pET15b (Invitrogen, Carlsbad, Calif.) To produce pGFP expressing normal GFP protein. Figure 1 is a map of a general GFP expression vector.

 (2) pTAT - GFP  Vector production

PTAT-GFP expressing GFP fused with HIV-1 TAT was prepared by the following method. First, two oligonucleotides were prepared and synthesized as double-stranded oligonucleotides encoding nine amino acids of HIV-1 TAT. The sequence encoding the 9 amino acids of HIV-1 TAT is the 5'-TAGGAAGAAGCGGAGACAGCGACGAAGAC-3 'in the upper chain and the 5'-TCGAGTCTTCGTCGCTGTCTCCGCTTCTTCC-3' in the lower chain. The double-stranded oligonucleotides were subcloned directly into NdeI-XhoI of pGFP to construct pTAT-GFP expressing the TAT-GFP protein. Figure 2 is a map of the TAT-GFP expression vector.

 (3) pPEP1 - GFP  Vector production

PPEP1-GFP expressing GFP fused with PEP1 was prepared by the following method. First, two oligonucleotides top chain 5'-TATGAAAGAAACCTGGTGGGAAACCTGGTGGACCGAATGGAGCCAGCCGAAAAAAAAACGTAAAGTGC-3 'and the bottom chain 5'-TCGAGCACTTTACGTTTTTTTTTCGGCTGAGACCATTCGGTCCACCAGGTTTCCCACCAGGTTTCTTTCC-3' is synthesized oligonucleotides made double-stranded coding for peptide PEP1.

The double-stranded oligonucleotides were subcloned directly into NdeI-XhoI of pGFP to produce pPEP1-GFP expressing the PEP1-GFP protein. Figure 3 is a map of the PEPl-GFP expression vector.

 (4) pSTeP - GFP  Vector production

PSTeP-GFP expressing the STeP-fused GFP of the present invention was prepared by the following method. First, two oligonucleotides top chain 5'-TATG AAAGAAACCTGGTGGGAAACCTGGTGGACCGAATGGTCCCAGCCGTATGGCCGTAAAAAACGTCGTCAGCGTCGTCGTC-3 'and the bottom chain 5'- TCGAGACGACGACGCTGACGACGTTTTTTACGGCCATACGGCTGGGACCATTCGGTCCACCAGGTTTCCCACCAGGTTTCTTTCC-3' is synthesized oligonucleotides made double-stranded STeP encoding the peptide. The double-stranded oligonucleotides were subcloned directly into NdeI-XhoI of pGFP to construct pSTeP-GFP expressing the STeP-GFP protein. Figure 4 is a map of the STeP-GFP expression vector.

[ Example  2. GFP  Expression of Recombinant Protein]

In this Example, the protein was expressed from the recombinant vectors produced in the above Example. Four kinds of expression vectors were introduced into E. coli And transformed into Rosetta-gami 2 (DE3) cells. The transformed bacterial cells were cultured at 37 ° C until the OD ₆₀₀ value reached 0.6 using 1,000 ml of LB medium containing ampicillin, and further incubated for 24 hours with 0.5 mM IPTG at 22 ° C to obtain GFP Expression of the protein was induced.

To confirm the presence or absence of each GFP protein expression, cultured cells before and after induction of the target protein by adding IPTG were harvested and subjected to SDS-PAGE electrophoresis, followed by protein staining with Coomassie brilliant blue .

As a result, it was confirmed that a protein having a size of 29.35 kDa of GFP, 30.54 kDa of TAT-GFP, 32.18 kDa of PEP1-GFP and 32.95 kDa of STeP-GFP was expressed as shown in Fig. Figure 5 shows the expression of GFP recombinant protein.

[ Example  3. GFP  Purification of Recombinant Protein]

In this example, the proteins expressed in each of the above examples were subjected to cell disruption, and purified by pure purification using only His tag-affinity column. The four GFP proteins were purified using the same method as described below.

After transfection of pET15-GFP, pTAT-GFP, pPEP1-GFP and pSTeP-GFP transformed cells with 1X Native Buffer (50 mM NaPO5, 0.5 M NaCl) using an ultrasonic machine, it was centrifuged to remove the inclusion body and cytoplasm (Supernatant).

4 kinds of GFP protein has both the His ₆ tagged (tagging), because using such a characteristic cell destruction after each supernatant was separated by centrifugation and Ni ^{2 +} -NTA affinity column (Nitrilotriacetic acid Sepharose affinity column, GE Healthcare, USA ).

Column equilibrium and GFP protein binding were performed using 1X Native buffer. Washing and elution were carried out by preparing Imidazole at 1X Native buffer. Pure separation Purified GFP protein was dialyzed using a stabilization buffer (50 mM NaPO4, 0.1 M NaCl, 10% Glycerol, pH 7.5). The final products obtained here were named GFP, Tat-GFP, PEP1-GFP and STeP-GFP, respectively. 6 shows the results of purification of GFP recombinant protein.

[ Example  4. Cell and skin permeability GFP  Cell permeation analysis of protein]

In this example, intracellular permeation using GFP green fluorescence was observed in HaCaT (human keratinocyte) cells in order to compare the cell permeability of the four purified GFP proteins in the above examples.

HaCaT (human keratinocyte) cells were cultured on a culture slide for 24 hours. After the culture medium was removed, cells were treated with GFP and cell permeable GFP proteins (PEP1-GFP, TAT-GFP, and STeP-GFP) three times with HBSS. Cells were treated with stocks so that the concentration of each protein was 10 mM when the cells were treated. The cells were diluted 1/10 in the medium to a final concentration of 10 μM, followed by culturing for 2 hours. After 2 hours, the medium was removed, and the cells were washed with PBS. Then, the cells were fixed with cold methanol at -20 ° C for 10 minutes. Cells were washed thoroughly with PBS, stained with PBS (diluted 1/5000), and stained for 10 minutes with light blocked. Washed thoroughly with PBS, mounted, and analyzed using a confocal scanning laser microscope.

As a result, the intracellular green fluorescence of the STeP-GFP protein-treated group appeared to be the brightest, indicating that STeP significantly enhanced the intracellular permeation effect. Fig. 7 shows the result of comparing the cell permeability of GFP protein.

[ Example  5. Cell and skin permeability GFP  Skin permeation analysis of protein]

A Franz cell (diameter 9 mm) was used to determine whether the permeation of GFP protein was enhanced by STeP in cells as well as in the skin.

Pig skin (0.7 mm thick, Medikinetics) was mounted between the top and bottom of the cell and treated with 300 μl of 50 μM GFP protein on top of it. After 24 hours, the pig skin was removed and washed three times with PBS. After washing, the cryo molds were treated with an OCT embedding matrix (Cell Path Ltd., UK) and the tissues were frozen at -70 ° C. The frozen tissues were cross-sectioned at a thickness of 7 μm at -20 ° C. using a cryotome (HM520, Germany) to prepare slice slides. In order to stain the nuclei of skin cells, tissue slices fixed on a slide glass were stained with PBS (DAPI) diluted 1/5000, blocked with light for 10 minutes, Lt; / RTI > Mounted and analyzed using a conforma scanning laser microscope.

As a result of the experiment, it was confirmed that GFP was not delivered into the pig skin tissue at all but the STeP-GFP of the present invention could be efficiently delivered into the skin. Fig. 8 shows the skin permeability comparison result of GFP protein. In FIG. 8, 'LUT Image' is an image in which the contrast is improved by using a look up table (LUT).

[ Example  6. Lipid- PTD (DSPE-PEG-PTD)  Produce]

In this example, a self-assembled PTD-liposome manufacturing technology was developed.

In the self-assembled PTD-liposome of the present invention, 'self-assembly' means that the peptide having the amino acid sequence shown in SEQ ID NO: 1 forms a membrane of the liposome in a state in which it is bound to the phospholipid, whereby the peptide having the amino acid sequence shown in SEQ ID NO: Quot; means participating in the manufacture of the liposome as a member of the membrane component.

The self-assembled PTD-liposome of the present embodiment is a PTD-liposome that is incorporated into self-assembled PTD-liposomes without the hassle of synthesizing PTD to physiologically active substances, To be transmitted to the user.

For the preparation of self-assembled PTD-liposomes, lipid-PTD was prepared by the following method. First, DSPE-PEG3.4K-maleimide was prepared by dissolving DSPE-PEG3.4K-maleimide (lipid, 1 equiv.) In dichloromethane and evaporating at 50 ° C to remove the organic solvent Prepared. The PTD solution was prepared by dissolving PTD (STeP peptide: KETWWETWWTEWSQPYGRKKRRQRRRC, SEQ ID NO: 1) (3 equiv.) And ammonium carbonate (3 equiv.) In distilled water and adjusting the pH to about 9 with a buffer solution (pH 9.6) And prepared separately.

The PTD solution prepared above was placed in DSPE-PEG 3.4K maleimide prepared in film form and subjected to a hydration and stirring process (4 hours) at 37 ° C to prepare maleimide of DSPE-PEG 3.4K-maleimide Induced the maleimide-thiol reaction between the 'C' amino acids of the STeP peptides. After completion of the reaction, freeze-drying and separation and purification were carried out. Figure 9 shows the chemical structure of the lipid (DSPE-PEG3.4K-maleimide) -PTD (STeP peptide) prepared in this example.

[ Example  7. Cafe Iksan Enclosed  Self-assembly PTD - Liposomal  Produce]

Liposomes are artificial membranes composed of phospholipids, which can be used as an encapsulated structure to encapsulate internal substances in liquid phase. Retention of the entrapped material in the liposome can be affected by the composition of the lipid. Two important lipid classes are phospholipids and cholesterol. The phospholipid plays a role of constituting the membrane of the liposome, and the cholesterol has the hydrophilic hydroxyl group and the hydrophobic ring, and stabilizes the chain of the saturated fatty acid in the cell membrane by the van der Waals bond, thereby reducing the fluidity of the cell membrane and imparting firmness Function.

On the other hand, self-assembled PTD-liposome (self-assembled PTD-liposome- (caffeic acid)) containing caffeic acid was prepared by mixing lipid-PTD produced by the above method with phospholipid, cholesterol and caffeic acid. The concrete method is as follows. The lipid / drug film was prepared by dissolving the phospholipid: cholesterol: lipid-PTD: caffeic acid in a chloroform: methanol mixture (1: 1, volume ratio) in an 8: 2: 1: 1 ratio by weight and then evaporating the solvent. After hydration with purified water, liposomes were prepared by sonication, lyophilized and stored.

On the other hand, the physicochemical properties of self-assembled PTD-liposome-caffeic acid were analyzed by confirming the particle size, particle size distribution and inclusion rate of the liposome. At this time, caffeic acid (liposome-caffeic acid) encapsulated in a common liposome was analyzed as a control group to demonstrate superiority of skin permeability of caffeic acid by self-assembled PTD-liposome.

Particle size, particle size distribution, and surface charge were confirmed using electrophoretic light scattering (ELS). The results were as shown in FIG. 10, it was confirmed that the self-assembled PTD-liposome- (caffeic acid) had a liposome having a relatively uniform particle size distribution with an average diameter of about 250 nm. 10 shows the results of particle characterization of self-assembled PTD-liposome- (caffeic acid).

In addition, it was confirmed that the surface charge of the self-assembled PTD-liposome changed from a negative value to a positive value compared with the ordinary liposome-caffeic acid. These results suggest that the PTD is oriented on the outer surface in the self-assembled PTD-liposome of the present invention. The peptide (STeP) having the amino acid sequence of SEQ ID NO: 1 of the present invention is an amphipathic peptide, but is more hydrophilic than hydrophobic. In the case of such a hydrophilic peptide, it is expected that the liposome will be located in the external or internal hydrophilic environment during the production of the liposome. The zeta potential analysis result (change from - to +) in FIG. 10 indicates that STeP is exposed to the external surface environment of the liposome And it was found.

On the other hand, the morphology of the self-assembled PTD-liposome was observed using a transmission electron microscope (TEM). As a result, it was confirmed that the particle size of the self-assembled PTD-liposome- (caffeic acid) was somewhat larger than that of the liposome-caffeic acid. Further, although the liposome containing the PTD-lipid was prepared, It was confirmed that it was structurally similar to liposome. Fig. 11 is a TEM image of the self-assembled PTD-liposome (caffeic acid) (left: liposome- (caffeic acid), right: self-assembled PTD-liposome- (caffeic acid)).

On the other hand, in order to confirm the particle stability in the aqueous solution, the particle size change was observed by using the electrophoresis light scattering method. As a result, it was confirmed that all the liposome- (caffeic acid) and self-assembled PTD-liposome- (caffeic acid) did not change significantly in particle size and particle size distribution until 24 hours as shown in Fig. Figure 12 shows the results of particle stability evaluation of self-assembled PTD-liposome- (caffeic acid).

[ Example  8. Self-assembly PTD - Liposome - ( Cafe Iksan ) ≪ / RTI >

In order to confirm that the self-assembled PTD-liposome-caffeic acid increases the intracellular permeability by increasing the intracellular permeation than the caffeic acid and liposome-caffeic acid, the cell damage of the caffeic acid from oxidative stress (hydrogen peroxide, H ₂ O ₂ ) The protective effect was compared and observed.

HaCaT cells cultured in DMEM medium containing 10% FBS were divided into 2 × 10 ⁴ 96-well plates and cultured for 16 hours, followed by washing twice with HBSS. Caffeic acid and caffeic acid encapsulated in liposome and self-assembled PTD liposomal caffeic acid were treated with cells to a final concentration of 12.5 μM and cultured for 24 hours. The supernatant was removed, washed twice with HBSS, and incubated with 0.75 mM H ₂ O ₂ for 2 hours and 30 minutes. After the incubation, the supernatant was removed, and the WST solution was diluted 1: 9 in the medium to treat the cells. After incubation for 3 hours, the absorbance values were measured at 450 nm, and cell viability was calculated. The antioxidant activities of caffeic acid, liposome-encapsulated caffeic acid and self-assembled PTD liposomal caffeic acid were compared.

As a result, as shown in FIG. 13, it was confirmed that the antioxidant effect of the self-assembled PTD liposomal caffeic acid was about three times higher at the same concentration than that of caffeic acid. Fig. 13 shows the results of comparing cytoprotective effects of caffeic acid in cell damage caused by oxidative stress. These results suggest that PTD liposomal caffeic acid facilitates cell permeation by PTD and that the antioxidative effect of PTD liposomal caffeic acid is higher than that of caffeic acid and general liposome.

[ Example  9. Self-assembly PTD - Liposome - ( Cafe Iksan ) ≪ / RTI >

A Franz cell (diameter 9 mm) was used to see if skin permeation of caffeic acid was improved by self-assembled PTD-liposomes.

Pig skin (0.7 mm thick, Medikinetics) was mounted between the top and bottom of the cell, and 300 μl of 4 mM caffeic acid, liposome- (caffeic acid), and self-assembled PTD-liposome- (caffeic acid) were applied to the top. At the bottom, we filled the buffer. After 24 hours, the sample at the bottom was taken. The collected samples were quantified by HPLC. C18 (4.6 × 250 ㎜ reversed phase) was used as the HPLC column and flowed at a flow rate of 0.7 ml / min and detected at a wavelength of 330 nm using a UV absorbance detector.

As a result, as shown in Fig. 14, caffeic acid was not permeated at all, while the general liposome showed 3.9% of the loaded peptide and 5.84% of self-assembled PTD-liposome- (caffeic acid) It was confirmed that the liposome- (caffeic acid) showed about a 1.5 times higher penetration effect. Fig. 14 shows the results of skin permeability comparison of self-assembled PTD-liposome- (caffeic acid).

<110> Bioceltran <120> Vesicle with novel protein transduction domain <130> YP-16-230 <160> 2 <170> KoPatentin 3.0 <210> 1 <211> 27 <212> PRT <213> Artificial Sequence <220> <223> Protein transduction domain, STeP <400> 1 Lys Glu Thr Trp Trp Glu Thr Trp Trp Thr Glu Trp Ser Gln Pro Tyr   1 5 10 15 Gly Arg Lys Lys Arg Arg Gln Arg Arg Arg Cys              20 25 <210> 2 <211> 81 <212> DNA <213> Artificial Sequence <220> <223> Polynucleotide coding protein transduction domain, STeP <400> 2 aaagaaacct ggtgggaaac ctggtggacc gaatggtccc agccgtatgg ccgtaaaaaa 60 cgtcgtcagc gtcgtcgttg t 81

Claims (19)

In liposomes formed by self-aggregation of phospholipids,
The phospholipid,
A liposome characterized in that the peptide consisting of the amino acid sequence of SEQ ID NO: 1 is linked to thioether.
delete The method according to claim 1,
The phospholipid,
DSPE-PEG-maleimide.
delete delete The method according to claim 1,
The peptide consisting of the amino acid sequence of SEQ ID NO:
Wherein the liposome is oriented outwardly of the liposome.
The method according to claim 1,
The liposome may contain,
Wherein the cholesterol is bound to a hydrophobic region.
The method according to claim 1,
The liposome may contain,
Wherein the liposome contains a substance to be trapped therein.
A cosmetic composition for percutaneous administration comprising the liposome of claim 1.
A pharmaceutical composition for transdermal administration, which comprises the liposome of claim 1.
delete delete (A) dissolving the amphipathic molecule and the capture target substance, which are prepared by binding a peptide composed of the amino acid sequence shown in SEQ ID NO: 1 to a phospholipid with thioether, in a solvent;
(B) after the step (a), evaporating the solvent to produce a film;
(C) adding purified water or a buffer to the film after the step (b) to hydrate the liposome, and then reducing the particle size by applying energy;
The amphiphilic molecule prepared by thioether-bonding a peptide composed of the amino acid sequence of SEQ ID NO: 1 to the phospholipid,
1 by adding a solution containing a peptide having an amino acid sequence shown in SEQ ID NO: 1 to a phospholipid in the form of a film to induce a thioether bond reaction between a phospholipid and a peptide having an amino acid sequence shown in SEQ ID NO: 1, The phospholipid in the form of a film is prepared by dissolving a phospholipid in a hydrophobic organic solvent and then volatilizing the organic solvent to form a film,
The solution containing the peptide consisting of the amino acid sequence set forth in SEQ ID NO: 1 is prepared by dissolving the peptide consisting of the amino acid sequence set forth in SEQ ID NO: 1 together with ammonia carbonate in distilled water and adjusting the pH to 8 to 10 . &Lt; / RTI &gt;
14. The method of claim 13,
The step (a)
A method for producing a liposome, which comprises dissolving an additional phospholipid in a solvent in addition to an amphipathic molecule prepared by binding a peptide composed of the amino acid sequence of SEQ ID NO: 1 to a thioether in a phospholipid.
delete delete 14. The method of claim 13,
The phospholipid,
DSPE-PEG-maleimide. &Lt; / RTI &gt;
14. The method of claim 13,
The step (a)
Wherein the cholesterol is further dissolved in a solvent.
14. The method of claim 13,
The solvent may be,
Wherein the liposome is a mixture of chloroform and methanol.

Images