KR101748575B1 - INSulin gene knockout diabetes mellitus or diabetic complications animal model and a method for producing the same - Google Patents

Abstract

The present invention relates to an animal model of INS gene knockout diabetes or diabetic complication and a method for producing the same. More particularly, the present invention relates to a DNA sequence encoding a small guide RNA (sgRNA) and a recombinant protein for producing a diabetic or diabetic complicated animal model The present invention relates to an animal model of diabetes mellitus or diabetic complication and a method for producing the same. The recombinant vector using the specific sgRNA and the CRISPR / Cas9 method for knocking out the INS gene according to the present invention can be used for transforming the DNA strand encoding the INS gene in the transformed animal in whole or in part to prevent diabetes, Can be effectively induced and can accompany diabetes complications. It is very useful to use an animal model of diabetic or diabetic complication according to the present invention which enables long-term studies for the practical prevention or treatment of diabetes mellitus, which is suffering from diabetes mellitus and complications. Therefore, the animal model of INS gene knockout diabetes or diabetic complication according to the present invention can be used variously to identify the mechanism of the related diseases, search for therapeutic substances, and develop diagnostic methods.

Description

[0001] The present invention relates to an INS gene knockout diabetes mellitus or diabetic complication animal model and a method for producing the same,

The present invention relates to an animal model of INS gene knockout diabetes or diabetic complication and a method for producing the same. More particularly, the present invention relates to a method for producing diabetic or diabetic complicated diabetes or a diabetic complicated animal model using a recombinant vector for producing animal models of diabetic or diabetic complications comprising sgRNA (small guide RNA) An animal model of diabetic complication and a method for manufacturing the same.

CRISPR (Clustered Regularly Interspaced Short Palindromic Repeat) is an adaptive immune system to defend against virus attacks and has evolved from bacteria. Upon exposure to the virus, a short segment of the viral DNA is integrated into the CRISPR locus. RNA is transcribed from a portion of the CRISPR locus, including the viral sequence. The corresponding RNA containing the sequence complementary to the viral genome mediates the targeting of the Cas9 protein to the target sequence in the viral genome. The Cas9 protein is cleaved, thereby silencing the virus target. That is, targeted gene regulation is possible based on the CRISPR / Cas system.

The incidence of chronic degenerative diseases such as hypertension, heart disease, arteriosclerosis and diabetic complications is increasing due to the entry into the aging society, lifestyle, dietary life, and social culture. In particular, the number of diabetic complications has risen sharply by at least 12 times over the past 20 years. Type 1 diabetes complications account for approximately 10% of all diabetic complications, and the insulin-deficient beta cells of the pancreas are destroyed, leading to insulin deficiency, leading to hyperglycemia, diabetes, polydipsia and weight loss. In type 2 diabetes complications, which account for about 90% of all diabetic complications, insulin sensitivity cells increase insulin secretion in the pancreatic beta cells in order to overcome insulin resistance that does not respond to insulin at normal levels. Overload of the cells deteriorates the function of insulin secretion is reduced, resulting in hyperglycemia. Thus, a deficiency of beta cell function, defined as a decrease in the function of each beta cell or a decrease in the amount of total beta cells, is a typical characteristic of diabetic complications.

Animals such as mice have evolved a need for animal models of disease using more closely related species because of the significant differences in dimenomening, reproduction, lifespan and behavior with humans, and in the case of primates, the scarcity, As a result of the difficulties in management, there are limitations that can be applied to disease research only in extremely limited fields. Therefore, it is necessary to utilize pigs as a new model animal in biomedical field, Is increasing.

Pigs have been recognized for similarity with human anatomy physiologically and have already been used for the pathological mechanism and treatment of various diseases. Especially, when pigs are valued as economic animals for a long time, It can avoid ethical problems and has a stable breeding system, so it is easy to maintain and manage when developing animal models. Particularly, it is widely recognized that the pancreas of a pig has a similar size, shape, blood flow and endocrine cells to human pancreas. Therefore, it is useful to study human diabetes using pig as a diabetic animal model.

Accordingly, the present inventors prepared a recombinant vector containing sgRNA and Cas9 gene, and knocked out the INS gene efficiently using the recombinant vector to produce an animal model for a diabetic animal model, especially for type 1 diabetes and diabetic complication And completed the present invention.

Korean Patent Publication No. 10-2010-0045192 Korean Patent Publication No. 10-2013-0117165

It is an object of the present invention to provide a recombinant vector for producing an animal model of diabetes or diabetic complication including a DNA sequence coding for sgRNA (small guide RNA) and Cas9 gene and a recombinant vector for the production of an animal model and a diabetic or diabetic complication .

It is another object of the present invention to provide a method for producing a nuclear transfer embryo, comprising: transplanting the transformed cell line into a enucleated oocyte to form a nuclear transfer embryo; And transplanting the nuclear transfer embryos to the tubal duct of a surrogate mother. The present invention also provides an INS gene knockout diabetes or diabetic complication animal model, and an INS gene knockout diabetic or diabetic complication animal model produced by the method.

It is also an object of the present invention to provide a method for screening for a diabetic or diabetic complication improving or therapeutic agent using the INS gene knockout diabetic or diabetic complication animal model.

In order to achieve the above object, the present invention provides a DNA sequence encoding a small guide RNA (sgRNA), which is represented by any one of SEQ ID NOS: 1 and 2; And a Cas9 gene. The recombinant vector for producing an animal model of diabetic or diabetic complication is provided.

In addition, the present invention provides a transformed cell line for producing an animal model of diabetes or diabetic complication, into which said recombinant vector has been introduced.

In addition, the present invention provides a method for producing a nuclear transfer embryo, comprising: transplanting the transformed cell line into a enucleated oocyte to form a nuclear transfer embryo; And transplanting the nuclear transfer embryos into the fallopian tube of a surrogate mother. The present invention also provides a method for producing an animal model of INS gene knockout diabetes or diabetic complication.

In addition, the present invention provides an animal model of INS gene knockout diabetes or diabetic complication produced by the above method.

In addition, the present invention provides a method for preventing or treating diabetic complications or diabetic complications in an animal model of INS gene knockout diabetes or diabetic complication; And 2) comparing the animal model administered with the candidate substance to a control group to which the candidate substance is not administered, when the blood glucose level is decreased by the candidate substance, the diabetes or diabetic complication improvement or treatment is judged to be A method for screening a therapeutic agent for improving diabetic complications.

The recombinant vector using the specific sgRNA and the CRISPR / Cas9 method for knocking out the INS gene according to the present invention can be used for transforming the DNA strand encoding the INS gene in the transformed animal in whole or in part to prevent diabetes, Can be effectively induced and can accompany diabetes complications. It is very useful to use an animal model of diabetic or diabetic complication according to the present invention which enables long-term studies for the practical prevention or treatment of diabetes mellitus, which is suffering from diabetes mellitus and complications. Therefore, the animal model of INS gene knockout diabetes or diabetic complication according to the present invention can be used variously to identify the mechanism of the related diseases, search for therapeutic substances, and develop diagnostic methods.

FIG. 1 is a diagram showing a base in which a recombinant vector according to the present invention induces deletion in the INS gene.
2 is a diagram showing a cleavage map of a recombinant vector according to the present invention.
FIG. 3 is a diagram showing the results of confirming the INS gene knockout sequence in a cell line transformed with a recombinant vector according to the present invention through sequencing.
FIG. 4A is a diagram showing the nucleotide sequence of INS gene knockout through genotyping of pigs with INS gene knockout born in one surrogate mother.
FIG. 4B is a diagram showing a result of confirming the nucleotide sequence of INS gene knockout through a genotyping test on a pig having an INS gene knockout born in a second surrogate mother.
FIG. 4c is a diagram showing a result of confirming the nucleotide sequence of the INS gene knockout through the genotyping test on the pig having the INS gene knockout born in the third surrogate mother.
FIG. 5 is a graph showing the results of confirming the onset of diabetes by analyzing the blood glucose level of pigs with INS gene knockout.
FIG. 6 is a diagram showing the results of confirming the onset of diabetes through immunohistochemical analysis of the pancreas of a pig in which INS gene knockout has been performed.
FIG. 7 is a graph showing the results of confirming the onset of diabetes through analysis of changes in insulin and C-peptide expression in the pancreas of a pig in which INS gene knockout has been performed.

The present invention provides an animal model of INS gene knockout diabetes or diabetic complication and a method for producing the same.

Hereinafter, the present invention will be described in more detail.

The present invention relates to a DNA sequence encoding a small guide RNA (sgRNA); And a Cas9 gene.

As used herein, the term "vector" means a gene construct comprising a base sequence of a gene operably linked to a suitable regulatory sequence so as to be capable of expressing the gene of interest in a suitable host, A promoter that may be present, any operator sequences for modulating such transcription, and sequences that regulate the termination of transcription and translation. The vector of the present invention is not particularly limited as long as it is replicable in cells, and any vector known in the art may be used, and may be, for example, a plasmid, a cosmid, a phage particle, or a viral vector.

In the present invention, the above-mentioned "recombinant vector" means an expression vector of a desired polypeptide capable of expressing the desired polypeptide at a high efficiency in an appropriate host cell when the coding gene of the desired polypeptide to be expressed is operatively linked , And the recombinant vector can be expressed in host cells. The host cell is preferably a eukaryotic cell. Depending on the type of the host cell, an expression control sequence such as a promoter, a terminator, an enhancer, etc., a sequence for membrane targeting or secretion, And can be variously combined according to the purpose.

In the present invention, the sgRNA can form a complex with the Cas9 protein, and can bring the Cas protein into the target DNA, and can be transcribed from the DNA represented by the nucleotide sequence of SEQ ID NO: 1 or 2. In particular, the sgRNA preferably includes all of the sgRNA transcribed from the DNA represented by the nucleotide sequences of SEQ ID NOS: 1 and 2 for binding with the target DNA, but is not limited thereto.

The relatively small size of the Cas gene (e.g., Cas9 at 4.2 kbp) provides advantages for RNA-guided endonuclease compositions in some applications, such as virus-mediated gene delivery. Additionally, these sgRNAs do not have an off-target effect and therefore do not cause unwanted mutations, deletions, inversions and redundancies.

In the present invention, the Cas9 protein means an essential protein element in the CRISPR / Cas system. When composing a complex with two RNAs called CRISPR RNA (crRNA) and trans-activating crRNA (tracrRNA) To form an active endonuclease or nickase. Genes encoding the Cas9 protein are generally associated with the CRISPR repeat-spacer array, and there are more than 40 different Cas family of proteins. Typically, there are three types of CRISPR-Cas systems, of which type II CRISPR / Cas systems are associated with Cas9 proteins.

In particular, in the present invention, the Cas9 gene encoding the Cas9 protein may be represented by the nucleotide sequence of SEQ ID NO: 3, but the present invention is not limited thereto.

In the present invention, the Cas9 protein is expressed in combination with a fluorescent protein. Specifically, it is preferable to bind Cas9 gene to a gene encoding a fluorescent protein using a linker, for example, a 2A peptide But is not limited thereto. Therefore, it is possible to enhance gene editing efficiency by separating genetically modified cells using fluorescent protein expressed and expressed with Cas9 protein. Diabetes, particularly type 1 diabetes and diabetic complications, can be more effectively induced in an animal model transformed with the recombinant vector produced according to the above method.

The fluorescent protein may be a red fluorescent protein (RFP), a green fluorescent protein (GFP), a yellow fluorescent protein (YFP), a blue fluorescent protein (CFC), DsRED, AsRED, AmCyan, ZsGreen or ZsYellow, However, the present invention is not limited thereto, and any of them may be used as long as the recombinant vector can more easily detect transfected cells.

The restriction enzyme used in the production of the recombinant vector may be EcoRI, BamHI, BglII, HindIII, PvuIII, BbsI, preferably BbsI, and the present invention is not limited thereto.

Variants of the nucleotide sequence represented by SEQ ID NO: 1, 2 or 3 are also included within the scope of the present invention. Although the present invention is modified by deletion, substitution or insertion of an equivalent of the above base sequence, for example, some base sequences, it can function in the same manner as the INS gene knockout sgRNA and Cas9 Is a concept that includes variants that are present. Specifically, the sgRNA and the Cas9 each have at least 70% sequence identity, more preferably at least 80% sequence identity, more preferably at least 90% sequence identity, and most preferably at least 95% sequence identity with the nucleotide sequence of SEQ ID NO: 1, And may include nucleotide sequences having homology with each other. "% Of sequence homology to polynucleotides" is ascertained by comparing the comparison region with two optimally aligned sequences, and a portion of the polynucleotide sequence in the comparison region is the reference sequence for the optimal alignment of the two sequences (I. E., A gap) relative to the < / RTI >

In the present invention, the recombinant vector is characterized in that the base sequence is modified, that is, inserted or deleted, with the base sequence of the INS gene as a target, and the exon 2 represented by the nucleotide sequence of SEQ ID NO: 4 and the base of SEQ ID NO: A modification or insertion or deletion may occur in the base sequence targeting any one or more of the exons 3 represented by the sequence.

More preferably, the recombinant vector of the present invention deletes four bases of SEQ ID NO: 6, deletion of 36 bases of SEQ ID NO: 7, and deletion of 36 bases of SEQ ID NO: 10 in each allele of exon 2 The insertion of one base to be deleted or the deletion of two bases of SEQ ID NO: 11 may occur, and the insertion of one base represented by SEQ ID NO: 8 and the insertion of one base represented by SEQ ID NO: 9 in each allele of exon 3 Deletion of the base may occur. Meanwhile, the nucleotide sequences of SEQ ID NOS: 6 to 11 are merely examples, and the present invention is not limited thereto as long as it is for knocking out the INS gene.

In the present invention, the recombinant vector preferably has a cleavage map as shown in the following figures, but is not limited thereto, provided that it is a vector capable of knocking out the INS gene of the present invention.

[Degree]

In the present invention, the recombinant vector may consist of the nucleotide sequence shown in SEQ ID NO: 12, which is an example only, and thus the present invention is not limited thereto.

The present invention also provides a transformed cell line for producing an animal model of diabetes or a complication of diabetes into which a recombinant vector for producing an animal model of diabetes or diabetic complication including a DNA sequence encoding sgRNA and Cas9 gene is introduced.

In the present invention, the term "cell line" refers to each individual cell line when cells are separated and cultured and subcultured, wherein the cell line can be distinguished from other cell lines by genetic traits, It is said to be maintained.

In the present invention, the cell line may be a marrow cell line, a fibroblast cell line, or a kidney cell line, preferably a fibroblast cell line. The cell line may be more specifically a fetal-derived cell line, and at the same time, a primary cell line may be used. As the cell line of the present invention, a primary renal cell line or a primary fetal fibroblast cell line is more preferably used. It is most preferable to use a primary fetal fibroblast cell line, but the present invention is not limited thereto.

In the present invention, "transformation" means that the genetic property of a living organism is changed by DNA given from outside, that is, when DNA, which is a kind of nucleic acid extracted from a cell of a certain line of an organism, It is a phenomenon that the genetic traits are changed by entering the cell, and it is called transformation, transformation, or transformation. In other words, "transformation" means introducing a gene into a host cell so that the gene can be expressed in the host cell.

The recombinant vector of the present invention can be transformed by introducing the recombinant vector into a cell line by transforming the recombinant vector of the present invention by a method known in the art such as, but not limited to, transient transfection, microinjection, transfection, transduction, cell fusion, calcium phosphate precipitation, liposome-mediated transfection, DEAE dextran-mediated transfection, polybrene- mediated transfection, and electroporation. The transformant can be transformed into a eukaryotic cell, and preferably, it can be transformed using a microscan method.

In the present invention, the transformed cell line may be a cell strain having accession number KCLRF-BP-00374, and the present invention is not limited thereto.

In addition, the present invention provides a method for producing a nuclear transfer embryo, comprising: transplanting the transformed cell line into a enucleated oocyte to form a nuclear transfer embryo; And transplanting the nuclear transfer embryos into a tubal duct of a surrogate mother. The present invention also provides a method for producing an animal model of INS knockout diabetes or diabetic complication.

In the present invention, the "somatic cell nuclear transfer" is a method for producing an animal model of diabetic or diabetic complication, which is a somatic cell nuclear transfer (SCNT) A genetic manipulation technique that can produce offspring without passing through the embryo body is a method of transplanting embryonic stem cells with embryonic stem cells into the nucleus-free embryos to produce embryos and transplanting the embryos into vivo to generate new embryos.

In the present invention, "nuclear transfer embryo" refers to an oocyte into which nuclear donor cells have been introduced or fused.

In the present invention, "fusion" means the binding of the nuclear donor cell to the lipid membrane portion of the egg. For example, a lipid membrane can be a plasma membrane or a nuclear membrane of a cell. Fusion can occur by applying electrical stimulation when the nuclear donor cell and the oocyte are adjacent to each other or when the nuclear donor cell is located in the perivitelline space of the recipient oocyte.

In the present invention, the transformed cell line is a nucleus donor cell, which refers to a nucleus of a cell or a cell that transfers nuclei to an egg cell, which is a nuclear receptor.

In the present invention, the oocyte is preferably a mature oocyte which has reached the middle stage of the second meiosis, and may be an oocyte of an animal, preferably a porcine oocyte.

In addition, the present invention provides an animal model of INS gene knockout diabetes or diabetic complication produced by the method for producing an animal model of diabetic or diabetic complication.

In the present invention, "diabetes" means a group of diseases characterized by chronic hyperglycemia due to lack of insulin action due to an absolute or relative deficiency of plasma insulin levels, and accompanying various characteristic metabolic abnormalities. Diabetes is divided into type 1 and type 2, type 1 diabetes was previously called 'child diabetes' and is caused by the inability to produce insulin at all. Type 2 diabetes, which is relatively insufficiently insulin-dependent, is characterized by insulin resistance (insulin resistance that lowers blood sugar and cells do not burn glucose effectively). Type 2 diabetes is caused by environmental factors such as high calorie, high fat, high protein diet, lack of exercise, and stress due to westernization of dietary habits. However, diabetes can also be caused by defects of specific genes, Infection, or drug. In the present invention, the diabetes is preferably type 1 diabetes, but the present invention is not limited thereto.

On the other hand, the diabetes mellitus generally involves diabetes complications, and the animal model of the present invention can be used as an animal model for acute or chronic diabetes complications as well as for diabetes, and more preferably for animal models for chronic diabetes complications But is not limited thereto.

In the present invention, the term "diabetic complication" includes all the various diseases that may occur as a result of persistence of hyperglycemia due to the absence of treatment in a state of high blood sugar due to diabetes, and the complications include hyperglycemia, hyperinsulinemia hyperinsulinemia, hypertriglyceridemia, dyslipidemia, impaired fasting glucose, impaired glucose tolerance, obesity, arteriosclerosis, microangiopathy, renal disease, heart disease, Foot ulcer, arthritis, osteoporosis, diabetic retinopathy, and one or more other ophthalmic diseases.

In the present invention, the term "animal model" refers to an animal having a disease closely resembling a human disease. Diseases in the study of human disease The significance of model animals is due to their physiological or genetic similarities between humans and animals. Biomedical disease models in disease studies Animals provide research materials for various causes of diseases, pathogenesis and diagnosis, and research on disease-related animals to identify disease-related genes and understand the interactions between genes And the basic efficacy and toxicity test of the developed new drug candidates will provide basic data for judging the possibility of practical use.

In the present invention, "animal" or "experimental animal" means any mammal other than a human. The animal includes animals of all ages, including embryos, fetuses, neonates and adults. Animals for use in the present invention can be used, for example, from commercial sources. Such animals include, but are not limited to, laboratory animals or other animals, rabbits, rodents (such as mice, rats, hamsters, gerbils and guinea pigs), cows, sheep, pigs, goats, horses, (Eg, chickens, turkeys, ducks, geese), primates (eg, chimpanzees, monkeys, rhesus monkeys). The most preferred animal is a pig.

Pigs have been recognized for similarity with human anatomy physiologically and have already been used for the pathological mechanism and treatment of various diseases. Especially, when pigs are valued as economic animals for a long time, It can avoid ethical problems and has a stable breeding system, so it is easy to maintain and manage when developing animal models.

The present invention also relates to a method for the treatment or prophylaxis of diabetic complications comprising: 1) administering a diabetic or diabetic complication improving or therapeutic agent candidate to an animal model of diabetic or diabetic complication; And 2) comparing the animal model administered with the candidate substance to a control group to which the candidate substance is not administered, when the blood glucose level is decreased by the candidate substance, the diabetes or diabetic complication improvement or treatment is judged to be A method for screening a therapeutic agent for improving diabetic complications.

"Candidate" in the present invention means a substance to be tested as a diabetes or diabetic complication improving and treating agent and includes any molecule such as an extract, protein, oligopeptide, small organic molecule, polysaccharide, polynucleotide and a wide range of compounds . Such candidate materials also include synthetic materials as well as natural materials.

In the present invention, the terms " improvement "and" treatment "refer to all actions in which the symptom of diabetes or diabetic complications of the animal model is improved or changed by administration of the candidate substance.

In the present invention, "control group" refers to a group which does not apply any manipulation or condition to judge whether or not the experimental result is properly derived. Unlike the experimental group which is set to achieve the direct purpose of the experiment, It is a group that is set up to make it more certain. The control group in the present invention preferably refers to a group not treated with candidate substances in the animal model of diabetes or diabetic complication.

In the present invention, an animal model of diabetes or diabetic complication is a disease model for diabetes or diabetic complication, and the substance obtained by the screening method may be variously used for the search for a therapeutic substance for diabetic or diabetic complication, Can be used to develop an improved or therapeutic agent for diabetes or diabetic complications and their complications.

The redundant contents are taken into consideration in the complexity of the present specification, and terms not otherwise defined herein have the meanings commonly used in the art to which the present invention belongs.

Hereinafter, the present invention will be described in detail with reference to Examples and Experimental Examples in order to facilitate understanding of the present invention. It should be understood, however, that the following examples and experimental examples are illustrative of the present invention and are not intended to limit the scope of the present invention. The embodiments and experimental examples of the present invention are provided to enable those skilled in the art to more fully understand the present invention.

Example  One. CRISPR / Cas 9 system  through INS (insulin) gene knockout recombinant vector

The DNA sequence encoding the sgRNA (small guide RNA) used to prepare the recombinant vector for knocking out the INS gene was prepared using an online CRISPR design tool (http://crispr.mit.edu) specifically, to we used sequence shown in SEQ ID NO: 1 and 2 in Table 1, which in each INS gene recognizes INS gene of swine specifically exon 2 (SEQ ID NO: 4) and exon 3 (SEQ ID NO: 5) Lt; RTI ID = 0.0 > sgRNA < / RTI > The bold-colored letters indicate PAM nucleotide sequences.

Base sequence sgRNA 1 5'-GCTACACGCCCAAGGCCCGT (SEQ ID NO: 1) CGG- 3 ' sgRNA 2 5'-GCCGCAGAAGCGTGGCATCG (SEQ ID NO: 2) TGG- 3 '

The prepared sgRNA was introduced into px458 vector (addgene, MA, USA) using Bbs I restriction enzyme (New England Biolabs, MA, USA). These vectors include sgRNA from the DNA represented by the nucleotide sequences of SEQ ID NOS: 1 and 2, and cas9 (SEQ ID NO: Was used as a template to generate Cas9 mRNA from the DNA sequence. At this time, the Cas9 gene is linked to a gene encoding GFP through the linker 2A peptide, so that Cas9 protein and GFP protein can be expressed at once. FIG. 1 shows the sequence of the INS gene targeted by the recombinant vector produced by the above procedure, and the cleavage map and the entire nucleotide sequence of the recombinant vector are shown in FIG. 2 and SEQ ID NO: 12, respectively.

Example  2. Transformation of fibroblasts using recombinant vectors

Example 1 a was introduced into a recombinant vector into Nucleofector ^TM (LONZA, Basel, Switzerland) by electroporation pig primary (primary) fibroblasts using manufactured. The fibroblasts used were those isolated from PWG micropigs and were cultured in DMEM (Biowest, Naille, France) containing 5% carbon dioxide and 20% fetal bovine serum and 1% penicillin-streptomycin (Gibco, ) ≪ / RTI > medium. After 48 hours of transfection, cell sorting was performed using a FACSAria ^™ cell sorter (BD Bioscience, CA, USA) to enrich for genetically modified cells. The sorted cells were seeded with a limiting dilution method and cultured to make single cell-derived cell lines. Each cell line was serially subcultured in 48, 24, 6 well plates and 100 mm culture dishes. Cells from single cell lines were frozen in liquid nitrogen tanks until used as SCNT donor cells. The transformed cell line obtained through the series of procedures was deposited with the Korean Cell Line Bank (Seoul, Korea) on Oct. 12, 2016, and received the accession number KCLRFBP00374.

Example  3. In fibroblasts INS  Confirm gene knockout

PCR was performed to confirm whether or not the INS gene knockout occurred normally in the transfected cells produced in Example 2 above. First, genomic DNA of transformed cells for INS gene knockout confirmation was extracted using a DNA extraction kit (iNtRon Biotechnology, Seongnam-si, Korea) according to the manufacturer's manual. PCR was performed using Pfu Plus 5x master mix (ELPIS biotech, Daejeon, Korea). More specifically, the first PCR was repeated 30 times using the porcine INS gene-specific primers shown in Table 2 in the following manner: the first denaturation at 95 ° C for 5 minutes was repeated once, then 30 Denaturation at 95 [deg.] C for 30 seconds, annealing at 58 [deg.] C for 30 seconds and extension at 72 [deg.] C for 30 seconds were repeated 30 times and finally post-extension at 72 [deg.] C for 10 minutes was repeated once. The second PCR was repeated 35 times using the first PCR product diluted (1: 100) as the template. The specific 35 times PCR method was performed under the same conditions as the first PCR using the primers shown in Table 2 below.

SEQ ID NO: The sequence (5 '- > 3') First PCR 13 Forward primer CTCCTCTCTCGGAGCCCTT 14 Reverse primer TTATTGGGTTTTGGGGTGC The second PCR (exon 2) 15 Forward primer GTCCCCCAGGTCCTCACC 16 Reverse primer CCCACCCTGGAGTGGAAG The second PCR (exon 3) 17 Forward primer GTCGGGGGAGTTTTTAAGGA 18 Reverse primer GGAGCAGCAGGCGCCCTCAG

In addition, the T7 endonuclease I (T7E1) assay was performed. The specifically purified second PCR product was denatured at 95 ° C for 5 minutes and re-annealed at 85 ° C at -2 ° C / second to 25 ° C at -0.1 ° C / second, and then reannealed And digested with T7E1 (ToolGen labs) enzyme at 37 占 폚 for 30 minutes. The second PCR product and the product degraded with T7E1 were electrophoresed using 2% agarose gel in TAE buffer and then visualized using a UV transilluminator. In addition, a second PCR product, presumed to have genetic modification at the target site of the INS gene, was identified by sequencing. Sequencing results for 10 cell lines are shown in FIG. And the base in blue represents the base substituted by the transformation.

As shown in Fig. 3, It was confirmed that a modification including insertion or deletion occurred in the nucleotide sequence within the region of exon 2 or exon 3. In the subsequent experiments, cell lines # 32 and # 33 among the cell lines in which the mutation occurred were used as SCNT nuclear donor cells of the INS gene knockout pig by sgRNA shown in SEQ ID NO: 1, and cell line # 8 was transformed into sgRNA The SCNT nuclear donor cell of INS gene knockout pig was used.

Example  4. Somatic cells of nuclear donor cells Nuclear transfer ( SCNT ; Somatic cell nuclear transfer) and INS  Manufacture of gene knockout pigs

4-1. Pigs used in animal experiments

A total of 3 pigs were used as surrogate mothers in this experiment and were approved by the Institutional Animal Care and Use Committee (IACUC) of MGENPLUS (Korea) Line. The surgical procedure was performed under general anesthesia and proceeded as far as possible to reduce animal pain. The pigs were raised under the general livestock specifications.

4-2. On SCNT  Manufacture of oocytes used

To prepare eggs to be nuclear donor cells to carry out SCNT, porcine eggs collected from local slaughterhouses were transferred to a laboratory under conditions of 0.9% (W / V) NaCl at 25-30 ° C. The oocytes were obtained from an antral follicle (size 3-6 mm in diameter) and cultured in mature medium at 100% wet, 5% carbon dioxide and 39 ° C conditions. After 44 hours, matured oocytes were fixed with a thin glass pipette (diameter 20 μm) in a conditioned medium supplemented with cytochalasin B (5 mg / ml stock (stock), 1.5 μm per 10 ml manipulation medium) And the adjacent cytoplasm was inhaled and denucleated. Later, it was used as a nuclear acceptor cell for SCNT.

4-3. Nuclear donor cell SCNT  Perform

One nucleus donor cell, which was a normal INS gene knockout mutant selected through Example 3, was injected into the perivitelline space of the denucleated oocyte prepared in Example 4-2. The nuclear donor cell membrane is in contact with the cytoplasmic membrane of the oocyte. The oocyte cytoplasmic-membrane complex was fused and activated with an electrical pulse (BTX, two 1.1 kV / cm DC pulses for 60 seconds). The reconstituted embryos were incubated with PZM3 at a temperature of 39 < 0 > C and 5% CO 2 for 14-16 hours with 0.5 uM of the histidine deacetylase inhibitor, Scriptaid.

4-4. INS  gene Knockout pig  Produce

Embryos with intact membranes were injected into the surrogate mother's fallopian tubes (mean 256 embryos) after two days of estrus have passed. Successful pregnancy was confirmed by ultrasonography 28 days after embryo transfer. After about 114 days, the cloned pigs were removed from the surrogate mother's embryos by a c-section.

Example  5. Analysis of genetic traits genotyping  assay) INS  gene Knockout pig  Check knockout

In order to confirm whether or not the INS gene knockout through SCNT was normally performed, tale biopsy was performed for genomic DNA extraction and genotyping of each pig on the day of pig birth. First, a genomic DNA extraction sample was obtained from the tail of a born animal, and each genomic DNA was extracted using a DNA extraction kit (iNtRon Biotechnology, Seongnam-si, Korea) according to the manufacturer's manual. Then, a tail biopsy was carried out in the same manner as in Example 3. The results of the genotype test are shown in Fig.

As shown in Fig. 4, it was confirmed that the same mutant as that found in the transformed cell, that is, the nuclear donor cell, in Example 4 appeared in the INS gene knockout pig produced. This means that even when SCNT is performed on the fetal fibroblast produced by the CRISPR / Cas9 method prepared above, the egg is impregnated with the unchanged nature of the fetus as an individual and the pig is produced as an individual.

In addition, the INS gene knockout according to the present invention was variously confirmed according to the surrogate used in the experiment. More specifically, as shown in Fig. 4A, in one surrogate moth, i) deletion of four bases of SEQ ID NO: 6 and deletion of 36 bases of SEQ ID NO: 7 in each allele of exon 2 , Ii) insertion of one base of SEQ ID NO: 8 and deletion of 23 bases of SEQ ID NO: 9 in each allele of exon 3 were confirmed. As can be seen in Fig. 4B, insertion of one base of SEQ ID NO: 10 and deletion of two bases of SEQ ID NO: 11 were confirmed in each allele of exon 2 in the second surrogate. Finally, as shown in FIG. 4C, in the third surrogate, i) insertion of one base represented by SEQ ID NO: 8 and deletion of 23 bases represented by SEQ ID NO: 9 in each allele of exon 3, ii) Lt; RTI ID = 0.0 > 9 < / RTI > nucleotide deletion in one strand of the DNA strand in each allele of SEQ ID NO: 9. Comprehensively, it was confirmed that insertion of one base, 2, 4, or 36 deletions occurred in exon 2, and insertion of 1 base or deletion of 23 bases occurred in exon 3. As a result, it can be seen that deformation occurs in the range of exon 2 represented by the nucleotide sequence of SEQ ID NO: 4 and exon 3 represented by the nucleotide sequence of SEQ ID NO: 4, Insertions or deletions can occur to produce an animal model in which diabetes or diabetic complications have developed.

Example  6. Expressionism  analysis( phenotyping  assay) INS  gene Knockout pig  Diabetes Check

6-1. Blood glucose level analysis

In order to confirm the knockout of the INS gene in the INS gene knockout pig prepared in Example 4, the blood glucose level was analyzed to confirm the onset of diabetes in the INS knockout pig. The blood glucose level was determined by ACCU-CHEK? Blood glucose meter and test strips (Roche, IN, USA), and the blood glucose levels were checked every 4 hours until the replica pigs died after the blood collection. The results are shown in Fig. Normal blood sugar levels are around 200 mg / dl.

As shown in FIG. 5, the INS gene knockout pig showed a high blood glucose level, indicating that the INS gene knockout was normally performed, so that the INS gene knockout pig could be used as an animal model for diabetes or diabetic complication.

6-2. Immunohistochemistry (IHC; immunohistochemistry ) analysis

In order to confirm that the INS gene knockout was successfully performed in the INS gene knockout pig prepared in Example 4, the β-cells of the pancreatic pancreas were immunohistochemically examined to detect the onset of diabetes in the INS knockout pig. First, the pancreas was isolated from INS gene knockout pigs and fixed in 10% neutral buffered formalin. The fixed tissue was stored in paraffin, and then divided into two groups. The tissue was divided into two groups. To analyze the expression of insulin, one of the two groups was stained with H & E using a general H & E staining kit according to the manufacturer's manual And mouse anti-swine insulin (AbD Serotec, Kidlington, UK) was added to the other group. This was observed with a microscope, and the results are shown in Fig. Wild-type pigs of the same age without knocking out the INS gene were used as positive control.

As shown in Fig. 6, two pigs out of three pigs did not express insulin expression in the pancreas, and the other pig showed very weak insulin expression as compared with the positive control pig. This indicates that the INS gene knockout is normally performed, and that the INS gene knockout pig can be used as an animal model for diabetes or diabetic complication.

6-3. Insulin and C- Peptides  Numerical analysis

Insulin and C-peptide concentrations in the serum were measured by enzyme-linked immunosorbent assay to confirm that the INS gene knockout was successfully performed in the INS gene knockout pig prepared in Example 4, and the onset of diabetes in INS knockout pig was confirmed. Serum used was separated from whole blood of each pig (except dead pig) by centrifugation. Insulin and C-peptide levels in INS gene knockout pigs were determined using pig insulin and C-peptide kits (Mercodia, Uppsala, Sweden) according to the manufacturer's manual. The results are shown in Fig. Wild-type pigs of the same age without knocking out the INS gene were used as positive control.

As shown in FIG. 7, pigs used as positive control groups showed an increase in insulin and C-peptide concentration in plasma after feeding, whereas pigs with INS gene knockout showed similar levels of insulin And C-peptide concentrations. This indicates that the INS gene knockout is normally performed, and that the INS gene knockout pig can be used as an animal model for diabetes or diabetic complication.

Taken together, from the above results, the recombinant vector using the specific sgRNA and CRISPR / Cas9 method for knocking out the INS gene according to the present invention can be obtained by knocking out all or a part of the DNA strand encoding the INS gene in the transformed animal It was confirmed that diabetes can be effectively induced. It is very useful to use a diabetic animal model according to the present invention which enables long-term studies for the practical prevention or treatment of diabetes mellitus, which is suffering from chronic diseases and diabetes mellitus. Therefore, the animal model of INS gene knockout diabetes or diabetic complication according to the present invention can be used variously to identify the mechanism of the related diseases, search for therapeutic substances, and develop diagnostic methods.

Although the present invention has been described in terms of the preferred embodiments mentioned above, it is possible to make various modifications and variations without departing from the spirit and scope of the invention. It is also to be understood that the appended claims are intended to cover such modifications and changes as fall within the scope of the invention.

Korea Cell Line Research Foundation KCLRFBP00374 20161012

<110> MGENPLUS CO., LTD. <120> INSulin gene knockout diabetes mellitus or diabetic complications          animal model and a method for producing same <130> p1-3 <160> 18 <170> KoPatentin 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> sgRNA coding DNA sequence <400> 1 gctacacgcc caaggcccgt 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> sgRNA coding DNA sequence <400> 2 gccgcagaag cgtggcatcg 20 <210> 3 <211> 4269 <212> DNA <213> Artificial Sequence <220> <223> Cas9 coding DNA sequence <400> 3 atggactata aggaccacga cggagactac aaggatcatg atattgatta caaagacgat 60 gacgataaga tggccccaaa gaagaagcgg aaggtcggta tccacggagt cccagcagcc 120 gacaagaagt acagcatcgg cctggacatc ggcaccaact ctgtgggctg ggccgtgatc 180 accgacgagt acaaggtgcc cagcaagaaa ttcaaggtgc tgggcaacac cgaccggcac 240 agcatcaaga agaacctgat cggagccctg ctgttcgaca gcggcgaaac agccgaggcc 300 acccggctga agagaaccgc cagaagaaga tacaccagac ggaagaaccg gatctgctat 360 ctgcaagaga tcttcagcaa cgagatggcc aaggtggacg acagcttctt ccacagactg 420 gaagagtcct tcctggtgga agaggataag aagcacgagc ggcaccccat cttcggcaac 480 atcgtggacg aggtggccta ccacgagaag taccccacca tctaccacct gagaaagaaa 540 ctggtggaca gcaccgacaa ggccgacctg cggctgatct atctggccct ggcccacatg 600 atcaagttcc ggggccactt cctgatcgag ggcgacctga accccgacaa cagcgacgtg 660 gacaagctgt tcatccagct ggtgcagacc tacaaccagc tgttcgagga aaaccccatc 720 aacgccagcg gcgtggacgc caaggccatc ctgtctgcca gactgagcaa gagcagacgg 780 ctggaaaatc tgatcgccca gctgcccggc gagaagaaga atggcctgtt cggaaacctg 840 attgccctga gcctgggcct gacccccaac ttcaagagca acttcgacct ggccgaggat 900 gccaaactgc agctgagcaa ggacacctac gacgacgacc tggacaacct gctggcccag 960 atcggcgacc agtacgccga cctgtttctg gccgccaaga acctgtccga cgccatcctg 1020 ctgagcgaca tcctgagagt gaacaccgag atcaccaagg cccccctgag cgcctctatg 1080 atcaagagat acgacgagca ccaccaggac ctgaccctgc tgaaagctct cgtgcggcag 1140 cagctgcctg agaagtacaa agagattttc ttcgaccaga gcaagaacgg ctacgccggc 1200 tacattgacg gcggagccag ccaggaagag ttctacaagt tcatcaagcc catcctggaa 1260 aagatggacg gcaccgagga actgctcgtg aagctgaaca gagaggacct gctgcggaag 1320 cagcggacct tcgacaacgg cagcatcccc caccagatcc acctgggaga gctgcacgcc 1380 attctgcggc ggcaggaaga tttttaccca ttcctgaagg acaaccggga aaagatcgag 1440 aagatcctga ccttccgcat cccctactac gtgggccctc tggccagggg aaacagcaga 1500 ttcgcctgga tgaccagaaa gagcgaggaa accatcaccc cctggaactt cgaggaagtg 1560 gtggacaagg gcgcttccgc ccagagcttc atcgagcgga tgaccaactt cgataagaac 1620 ctgcccaacg agaaggtgct gcccaagcac agcctgctgt acgagtactt caccgtgtat 1680 aacgagctga ccaaagtgaa atacgtgacc gagggaatga gaaagcccgc cttcctgagc 1740 ggcgagcaga aaaaggccat cgtggacctg ctgttcaaga ccaaccggaa agtgaccgtg 1800 aagcagctga aagaggacta cttcaagaaa atcgagtgct tcgactccgt ggaaatctcc 1860 ggcgtggaag atcggttcaa cgcctccctg ggcacatacc acgatctgct gaaaattatc 1920 aaggacaagg acttcctgga caatgaggaa aacgaggaca ttctggaaga tatcgtgctg 1980 accctgacac tgtttgagga cagagagatg atcgaggaac ggctgaaaac ctatgcccac 2040 ctgttcgacg acaaagtgat gaagcagctg aagcggcgga gatacaccgg ctggggcagg 2100 ctgagccgga agctgatcaa cggcatccgg gacaagcagt ccggcaagac aatcctggat 2160 ttcctgaagt ccgacggctt cgccaacaga aacttcatgc agctgatcca cgacgacagc 2220 ctgaccttta aagaggacat ccagaaagcc caggtgtccg gccagggcga tagcctgcac 2280 gagcacattg ccaatctggc cggcagcccc gccattaaga agggcatcct gcagacagtg 2340 aaggtggtgg acgagctcgt gaaagtgatg ggccggcaca agcccgagaa catcgtgatc 2400 gaaatggcca gagagaacca gaccacccag aagggacaga agaacagccg cgagagaatg 2460 aagcggatcg aagagggcat caaagagctg ggcagccaga tcctgaaaga acaccccgtg 2520 gaaaacaccc agctgcagaa cgagaagctg tacctgtact acctgcagaa tgggcgggat 2580 atgtacgtgg accaggaact ggacatcaac cggctgtccg actacgatgt ggaccatatc 2640 gtgcctcaga gctttctgaa ggacgactcc atcgacaaca aggtgctgac cagaagcgac 2700 aagaaccggg gcaagagcga caacgtgccc tccgaagagg tcgtgaagaa gatgaagaac 2760 tactggcggc agctgctgaa cgccaagctg attacccaga gaaagttcga caatctgacc 2820 aaggccgaga gaggcggcct gagcgaactg gataaggccg gcttcatcaa gagacagctg 2880 gtggaaaccc ggcagatcac aaagcacgtg gcacagatcc tggactcccg gatgaacact 2940 aagtacgacg agaatgacaa gctgatccgg gaagtgaaag tgatcaccct gaagtccaag 3000 ctggtgtccg atttccggaa ggatttccag ttttacaaag tgcgcgagat caacaactac 3060 caccacgccc acgacgccta cctgaacgcc gtcgtgggaa ccgccctgat caaaaagtac 3120 cctaagctgg aaagcgagtt cgtgtacggc gactacaagg tgtacgacgt gcggaagatg 3180 atcgccaaga gcgagcagga aatcggcaag gctaccgcca agtacttctt ctacagcaac 3240 atcatgaact ttttcaagac cgagattacc ctggccaacg gcgagatccg gaagcggcct 3300 ctgatcgaga caaacggcga aaccggggag atcgtgtggg ataagggccg ggattttgcc 3360 accgtgcgga aagtgctgag catgccccaa gtgaatatcg tgaaaaagac cgaggtgcag 3420 acaggcggct tcagcaaaga gtctatcctg cccaagagga acagcgataa gctgatcgcc 3480 agaaagaagg actgggaccc taagaagtac ggcggcttcg acagccccac cgtggcctat 3540 tctgtgctgg tggtggccaa agtggaaaag ggcaagtcca agaaactgaa gagtgtgaaa 3600 gagctgctgg ggatcaccat catggaaaga agcagcttcg agaagaatcc catcgacttt 3660 ctggaagcca agggctacaa agaagtgaaa aaggacctga tcatcaagct gcctaagtac 3720 tccctgttcg agctggaaaa cggccggaag agaatgctgg cctctgccgg cgaactgcag 3780 aagggaaacg aactggccct gccctccaaa tatgtgaact tcctgtacct ggccagccac 3840 tatgagaagc tgaagggctc ccccgaggat aatgagcaga aacagctgtt tgtggaacag 3900 cacaagcact acctggacga gatcatcgag cagatcagcg agttctccaa gagagtgatc 3960 ctggccgacg ctaatctgga caaagtgctg tccgcctaca acaagcaccg ggataagccc 4020 atcagagagc aggccgagaa tatcatccac ctgtttaccc tgaccaatct gggagcccct 4080 gccgccttca agtactttga caccaccatc gaccggaaga ggtacaccag caccaaagag 4140 gtgctggacg ccaccctgat ccaccagagc atcaccggcc tgtacgagac acggatcgac 4200 ctgtctcagc tgggaggcga caaaaggccg gcggccacga aaaaggccgg ccaggcaaaa 4260 aagaaaaag 4269 <210> 4 <211> 200 <212> DNA <213> Sus scrofa <400> 4 ctcacccccc gccatggccc tgtggacgcg cctcctgccc ctgctggccc tgctggccct 60 ctgggcgccc gccccggccc aggccttcgt gaaccagcac ctgtgcggct cccacctggt 120 ggaggcgctg tacctggtgt gcggggagcg cggcttcttc tacacgccca aggcccgtcg 180 ggaggcggag aaccctcagg 200 <210> 5 <211> 189 <212> DNA <213> Sus scrofa <400> 5 caggtgccgt ggagctgggc ggaggcctgg gcggcctgca ggccctggcg ctggaggggc 60 ccccgcagaa gcgtggcatc gtggagcagt gctgcaccag catctgttcc ctctaccagc 120 tggagaacta ctgcaactag gccgcccctg agggcgcctg ctgctccccg caccccaaaa 180 cccaataaa 189 <210> 6 <211> 4 <212> DNA <213> Artificial Sequence <220> <223> knockout sequence <400> 6 cccg 4 <210> 7 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> knockout sequence <400> 7 gtggcatcgt ggagcagtgc tgc 23 <210> 8 <211> 1 <212> DNA <213> Artificial Sequence <220> <223> knockout sequence <400> 8 c 1 <210> 9 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> knockout sequence <400> 9 cggggagcgc ggcttcttct acacaaggcc cg 32 <210> 10 <211> 1 <212> DNA <213> Artificial Sequence <220> <223> knockout sequence <400> 10 a 1 <210> 11 <211> 2 <212> DNA <213> Artificial Sequence <220> <223> knockout sequence <400> 11 cc 2 <210> 12 <211> 9291 <212> DNA <213> Artificial Sequence <220> <223> recombinant vector <400> 12 gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc tgttagagag 60 ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac gtgacgtaga 120 aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat ggactatcat 180 atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt gtggaaagga 240 cgaaacaccg ctacacgccc aaggcccgtg ttttagagct agaaatagca agttaaaata 300 aggctagtcc gttatcaact tgaaaaagtg gcaccgagtc ggtgcttttt tgttttagag 360 ctagaaatag caagttaaaa taaggctagt ccgtttttag cgcgtgcgcc aattctgcag 420 acaaatggct ctagaggtac ccgttacata acttacggta aatggcccgc ctggctgacc 480 gcccaacgac ccccgcccat tgacgtcaat agtaacgcca atagggactt tccattgacg 540 tcaatgggtg gagtatttac ggtaaactgc ccacttggca gtacatcaag tgtatcatat 600 gccaagtacg ccccctattg acgtcaatga cggtaaatgg cccgcctggc attgtgccca 660 gtacatgacc ttatgggact ttcctacttg gcagtacatc tacgtattag tcatcgctat 720 taccatggtc gaggtgagcc ccacgttctg cttcactctc cccatctccc ccccctcccc 780 acccccaatt ttgtatttat ttatttttta attattttgt gcagcgatgg gggcgggggg 840 gggggggggg cgcgcgccag gcggggcggg gcggggcgag gggcggggcg gggcgaggcg 900 gagaggtgcg gcggcagcca atcagagcgg cgcgctccga aagtttcctt ttatggcgag 960 gcggcggcgg cggcggccct ataaaaagcg aagcgcgcgg cgggcgggag tcgctgcgac 1020 gctgccttcg ccccgtgccc cgctccgccg ccgcctcgcg ccgcccgccc cggctctgac 1080 tgaccgcgtt actcccacag gtgagcgggc gggacggccc ttctcctccg ggctgtaatt 1140 agctgagcaa gaggtaaggg tttaagggat ggttggttgg tggggtatta atgtttaatt 1200 acctggagca cctgcctgaa atcacttttt ttcaggttgg accggtgcca ccatggacta 1260 taaggaccac gacggagact acaaggatca tgatattgat tacaaagacg atgacgataa 1320 gatggcccca aagaagaagc ggaaggtcgg tatccacgga gtcccagcag ccgacaagaa 1380 gtacagcatc ggcctggaca tcggcaccaa ctctgtgggc tgggccgtga tcaccgacga 1440 gtacaaggtg cccagcaaga aattcaaggt gctgggcaac accgaccggc acagcatcaa 1500 gaagaacctg atcggagccc tgctgttcga cagcggcgaa acagccgagg ccacccggct 1560 gaagagaacc gccagaagaa gatacaccag acggaagaac cggatctgct atctgcaaga 1620 gatcttcagc aacgagatgg ccaaggtgga cgacagcttc ttccacagac tggaagagtc 1680 cttcctggtg gaagaggata agaagcacga gcggcacccc atcttcggca acatcgtgga 1740 cgaggtggcc taccacgaga agtaccccac catctaccac ctgagaaaga aactggtgga 1800 cagcaccgac aaggccgacc tgcggctgat ctatctggcc ctggcccaca tgatcaagtt 1860 ccggggccac ttcctgatcg agggcgacct gaaccccgac aacagcgacg tggacaagct 1920 gttcatccag ctggtgcaga cctacaacca gctgttcgag gaaaacccca tcaacgccag 1980 cggcgtggac gccaaggcca tcctgtctgc cagactgagc aagagcagac ggctggaaaa 2040 tctgatcgcc cagctgcccg gcgagaagaa gaatggcctg ttcggaaacc tgattgccct 2100 gagcctgggc ctgaccccca acttcaagag caacttcgac ctggccgagg atgccaaact 2160 gcagctgagc aaggacacct acgacgacga cctggacaac ctgctggccc agatcggcga 2220 ccagtacgcc gacctgtttc tggccgccaa gaacctgtcc gacgccatcc tgctgagcga 2280 catcctgaga gtgaacaccg agatcaccaa ggcccccctg agcgcctcta tgatcaagag 2340 atacgacgag caccaccagg acctgaccct gctgaaagct ctcgtgcggc agcagctgcc 2400 tgagaagtac aaagagattt tcttcgacca gagcaagaac ggctacgccg gctacattga 2460 cggcggagcc agccaggaag agttctacaa gttcatcaag cccatcctgg aaaagatgga 2520 cggcaccgag gaactgctcg tgaagctgaa cagagaggac ctgctgcgga agcagcggac 2580 cttcgacaac ggcagcatcc cccaccagat ccacctggga gagctgcacg ccattctgcg 2640 gcggcaggaa gatttttacc cattcctgaa ggacaaccgg gaaaagatcg agaagatcct 2700 gaccttccgc atcccctact acgtgggccc tctggccagg ggaaacagca gattcgcctg 2760 gatgaccaga aagaccgagg aaaccatcac cccctggaac ttcgaggaag tggtggacaa 2820 gggcgcttcc gcccagagct tcatcgagcg gatgaccaac ttcgataaga acctgcccaa 2880 cgagaaggtg ctgcccaagc acagcctgct gtacgagtac ttcaccgtgt ataacgagct 2940 gaccaaagtg aaatacgtga ccgagggaat gagaaagccc gccttcctga gcggcgagca 3000 gaaaaaggcc atcgtggacc tgctgttcaa gaccaaccgg aaagtgaccg tgaagcagct 3060 gaaagaggac tacttcaaga aaatcgagtg cttcgactcc gtggaaatct ccggcgtgga 3120 agatcggttc aacgcctccc tgggcacata ccacgatctg ctgaaaatta tcaaggacaa 3180 ggacttcctg gacaatgagg aaaacgagga cattctggaa gatatcgtgc tgaccctgac 3240 actgtttgag gacagagaga tgatcgagga acggctgaaa acctatgccc acctgttcga 3300 cgacaaagtg atgaagcagc tgaagcggcg gagatacacc ggctggggca ggctgagccg 3360 gaagctgatc aacggcatcc gggacaagca gtccggcaag acaatcctgg atttcctgaa 3420 gtccgacggc ttcgccaaca gaaacttcat gcagctgatc cacgacgaca gcctgacctt 3480 taaagaggac atccagaaag cccaggtgtc cggccagggc gatagcctgc acgagcacat 3540 tgccaatctg gccggcagcc ccgccattaa gaagggcatc ctgcagacag tgaaggtggt 3600 ggacgagctc gtgaaagtga tgggccggca caagcccgag aacatcgtga tcgaaatggc 3660 cagagagaac cagaccaccc agaagggaca gaagaacagc cgcgagagaa tgaagcggat 3720 cgaagagggc atcaaagagc tgggcagcca gatcctgaaa gaacaccccg tggaaaacac 3780 ccagctgcag aacgagaagc tgtacctgta ctacctgcag aatgggcggg atatgtacgt 3840 ggaccaggaa ctggacatca accggctgtc cgactacgat gtggaccata tcgtgcctca 3900 gagctttctg aaggacgact ccatcgacaa caaggtgctg accagaagcg acaagaaccg 3960 gggcaagagc gacaacgtgc cctccgaaga ggtcgtgaag aagatgaaga actactggcg 4020 gcagctgctg aacgccaagc tgattaccca gagaaagttc gacaatctga ccaaggccga 4080 gagaggcggc ctgagcgaac tggataaggc cggcttcatc aagagacagc tggtggaaac 4140 ccggcagatc acaaagcacg tggcacagat cctggactcc cggatgaaca ctaagtacga 4200 cgagaatgac aagctgatcc gggaagtgaa agtgatcacc ctgaagtcca agctggtgtc 4260 cgatttccgg aaggatttcc agttttacaa agtgcgcgag atcaacaact accaccacgc 4320 ccacgacgcc tacctgaacg ccgtcgtggg aaccgccctg atcaaaaagt accctaagct 4380 ggaaagcgag ttcgtgtacg gcgactacaa ggtgtacgac gtgcggaaga tgatcgccaa 4440 gagcgagcag gaaatcggca aggctaccgc caagtacttc ttctacagca acatcatgaa 4500 ctttttcaag accgagatta ccctggccaa cggcgagatc cggaagcggc ctctgatcga 4560 gacaaacggc gaaaccgggg agatcgtgtg ggataagggc cgggattttg ccaccgtgcg 4620 gaaagtgctg agcatgcccc aagtgaatat cgtgaaaaag accgaggtgc agacaggcgg 4680 cttcagcaaa gagtctatcc tgcccaagag gaacagcgat aagctgatcg ccagaaagaa 4740 ggactgggac cctaagaagt acggcggctt cgacagcccc accgtggcct attctgtgct 4800 ggtggtggcc aaagtggaaa agggcaagtc caagaaactg aagagtgtga aagagctgct 4860 ggggatcacc atcatggaaa gaagcagctt cgagaagaat cccatcgact ttctggaagc 4920 caagggctac aaagaagtga aaaaggacct gatcatcaag ctgcctaagt actccctgtt 4980 cgagctggaa aacggccgga agagaatgct ggcctctgcc ggcgaactgc agaagggaaa 5040 cgaactggcc ctgccctcca aatatgtgaa cttcctgtac ctggccagcc actatgagaa 5100 gctgaagggc tcccccgagg ataatgagca gaaacagctg tttgtggaac agcacaagca 5160 ctacctggac gagatcatcg agcagatcag cgagttctcc aagagagtga tcctggccga 5220 cgctaatctg gacaaagtgc tgtccgccta caacaagcac cgggataagc ccatcagaga 5280 gcaggccgag aatatcatcc acctgtttac cctgaccaat ctgggagccc ctgccgcctt 5340 caagtacttt gacaccacca tcgaccggaa gaggtacacc agcaccaaag aggtgctgga 5400 cccccaccctg atccaccaga gcatcaccgg cctgtacgag acacggatcg acctgtctca 5460 gctgggaggc gacaaaaggc cggcggccac gaaaaaggcc ggccaggcaa aaaagaaaaa 5520 ggaattcggc agtggagagg gcagaggaag tctgctaaca tgcggtgacg tcgaggagaa 5580 tcctggccca gtgagcaagg gcgaggagct gttcaccggg gtggtgccca tcctggtcga 5640 gctggacggc gacgtaaacg gccacaagtt cagcgtgtcc ggcgagggcg agggcgatgc 5700 cacctacggc aagctgaccc tgaagttcat ctgcaccacc ggcaagctgc ccgtgccctg 5760 gcccaccctc gtgaccaccc tgacctacgg cgtgcagtgc ttcagccgct accccgacca 5820 catgaagcag cacgacttct tcaagtccgc catgcccgaa ggctacgtcc aggagcgcac 5880 catcttcttc aaggacgacg gcaactacaa gacccgcgcc gaggtgaagt tcgagggcga 5940 caccctggtg aaccgcatcg agctgaaggg catcgacttc aaggaggacg gcaacatcct 6000 ggggcacaag ctggagtaca actacaacag ccacaacgtc tatatcatgg ccgacaagca 6060 gaagaacggc atcaaggtga acttcaagat ccgccacaac atcgaggacg gcagcgtgca 6120 gctcgccgac cactaccagc agaacacccc catcggcgac ggccccgtgc tgctgcccga 6180 caaccactac ctgagcaccc agtccgccct gagcaaagac cccaacgaga agcgcgatca 6240 catggtcctg ctggagttcg tgaccgccgc cgggatcact ctcggcatgg acgagctgta 6300 caaggaattc taactagagc tcgctgatca gcctcgactg tgccttctag ttgccagcca 6360 tctgttgttt gcccctcccc cgtgccttcc ttgaccctgg aaggtgccac tcccactgtc 6420 ctttcctaat aaaatgagga aattgcatcg cattgtctga gtaggtgtca ttctattctg 6480 gggggtgggg tggggcagga cagcaagggg gaggattggg aagagaatag caggcatgct 6540 ggggagcggc cgcaggaacc cctagtgatg gagttggcca ctccctctct gcgcgctcgc 6600 tcgctcactg aggccgggcg accaaaggtc gcccgacgcc cgggctttgc ccgggcggcc 6660 tcagtgagcg agcgagcgcg cagctgcctg caggggcgcc tgatgcggta ttttctcctt 6720 acgcatctgt gcggtatttc acaccgcata cgtcaaagca accatagtac gcgccctgta 6780 gcggcgcatt aagcgcggcg ggtgtggtgg ttacgcgcag cgtgaccgct acacttgcca 6840 gcgccctagc gcccgctcct ttcgctttct tcccttcctt tctcgccacg ttcgccggct 6900 ttccccgtca agctctaaat cgggggctcc ctttagggtt ccgatttagt gctttacggc 6960 acctcgaccc caaaaaactt gatttgggtg atggttcacg tagtgggcca tcgccctgat 7020 agacggtttt tcgccctttg acgttggagt ccacgttctt taatagtgga ctcttgttcc 7080 aaactggaac aacactcaac cctatctcgg gctattcttt tgatttataa gggattttgc 7140 cgatttcggc ctattggtta aaaaatgagc tgatttaaca aaaatttaac gcgaatttta 7200 acaaaatatt aacgtttaca attttatggt gcactctcag tacaatctgc tctgatgccg 7260 catagttaag ccagccccga cacccgccaa cacccgctga cgcgccctga cgggcttgtc 7320 tgctcccggc atccgcttac agacaagctg tgaccgtctc cgggagctgc atgtgtcaga 7380 ggttttcacc gtcatcaccg aaacgcgcga gacgaaaggg cctcgtgata cgcctatttt 7440 tataggttaa tgtcatgata ataatggttt cttagacgtc aggtggcact tttcggggaa 7500 atgtgcgcgg aacccctatt tgtttatttt tctaaataca ttcaaatatg tatccgctca 7560 tgagacaata accctgataa atgcttcaat aatattgaaa aaggaagagt atgagtattc 7620 aacatttccg tgtcgccctt attccctttt ttgcggcatt ttgccttcct gtttttgctc 7680 acccagaaac gctggtgaaa gtaaaagatg ctgaagatca gttgggtgca cgagtgggtt 7740 acatcgaact ggatctcaac agcggtaaga tccttgagag ttttcgcccc gaagaacgtt 7800 ttccaatgat gagcactttt aaagttctgc tatgtggcgc ggtattatcc cgtattgacg 7860 ccgggcaaga gcaactcggt cgccgcatac actattctca gaatgacttg gttgagtact 7920 caccagtcac agaaaagcat cttacggatg gcatgacagt aagagaatta tgcagtgctg 7980 ccataaccat gagtgataac actgcggcca acttacttct gacaacgatc ggaggaccga 8040 aggagctaac cgcttttttg cacaacatgg gggatcatgt aactcgcctt gatcgttggg 8100 aaccggagct gaatgaagcc ataccaaacg acgagcgtga caccacgatg cctgtagcaa 8160 tggcaacaac gttgcgcaaa ctattaactg gcgaactact tactctagct tcccggcaac 8220 aattaataga ctggatggag gcggataaag ttgcaggacc acttctgcgc tcggcccttc 8280 cggctggctg gtttattgct gataaatctg gagccggtga gcgtggaagc cgcggtatca 8340 ttgcagcact ggggccagat ggtaagccct cccgtatcgt agttatctac acgacgggga 8400 gtcaggcaac tatggatgaa cgaaatagac agatcgctga gataggtgcc tcactgatta 8460 agcattggta actgtcagac caagtttact catatatact ttagattgat ttaaaacttc 8520 atttttaatt taaaaggatc taggtgaaga tcctttttga taatctcatg accaaaatcc 8580 cttaacgtga gttttcgttc cactgagcgt cagaccccgt agaaaagatc aaaggatctt 8640 cttgagatcc tttttttctg cgcgtaatct gctgcttgca aacaaaaaaa ccaccgctac 8700 cagcggtggt ttgtttgccg gatcaagagc taccaactct ttttccgaag gtaactggct 8760 tcagcagagc gcagatacca aatactgtcc ttctagtgta gccgtagtta ggccaccact 8820 tcaagaactc tgtagcaccg cctacatacc tcgctctgct aatcctgtta ccagtggctg 8880 ctgccagtgg cgataagtcg tgtcttaccg ggttggactc aagacgatag ttaccggata 8940 aggcgcagcg gtcgggctgc acggggggtt cgtgcacaca gcccagcttg gagcgaacga 9000 cctacaccga actgagatac ctacagcgtg agctatgaga aagcgccacg cttcccgaag 9060 ggagaaaggc ggacaggtat ccggtaagcg gcagggtcgg aacaggagag cgcacgaggg 9120 agcttccagg gggaaacgcc tggtatcttt atagtcctgt cgggtttcgc cacctctgac 9180 ttgagcgtcg atttttgtga tgctcgtcag gggggcggag cctatggaaa aacgccagca 9240 acgcggcctt tttacggttc ctggcctttt gctggccttt tgctcacatg t 9291 <210> 13 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> forward primer for PCR <400> 13 ctcctctctc ggagccctt 19 <210> 14 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for PCR <400> 14 ttattgggtt ttggggtgc 19 <210> 15 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> forward primer for PCR <400> 15 gtcccccagg tcctcacc 18 <210> 16 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for PCR <400> 16 cccaccctgg agtggaag 18 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> forward primer for PCR <400> 17 gtcgggggag tttttaagga 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for PCR <400> 18 ggagcagcag gcgccctcag 20

Claims (18)

A recombinant vector for producing an animal model of diabetes or diabetic complication comprising the nucleotide sequence shown in SEQ ID NO:
The method according to claim 1,
The recombinant vector comprises a nucleotide sequence encoding the sgRNA of SEQ ID NO: 2; A recombinant vector comprising the Cas9 gene of SEQ ID NO: 3.
The method according to claim 1,
Wherein the recombinant vector comprises a structure in which a Cas9 gene and a gene encoding a fluorescent protein are bound to each other.
delete delete The method according to claim 1,
Wherein said recombinant vector has a cleavage map as set forth in the following figures.
[Degree]

delete A transformed cell line for the production of an animal model of diabetic or diabetic complication, wherein the recombinant vector of any one of claims 1 to 3 and 6 is introduced.
9. The method of claim 8,
Wherein the cell line is an oocyte, fibroblast or kidney cell line.
9. The method of claim 8,
Wherein said transformed cell line is Accession No. KCLRF-BP-00374.
Transplanting the transformed cell line of claim 8 into an enucleated oocyte obtained from an animal other than a human to form a nuclear transfer embryo; And
The method of containing, INS gene knockout diabetes or diabetic complications in animal models; step to implant the challenge of the animals except for human nuclear transfer embryo to the surrogate mother.
An INS gene knockout diabetic or diabetic complication animal model produced by the method of claim 11.
13. The method of claim 12,
An animal model of INS gene knockout diabetes or diabetic complication, wherein said animal model is a pig.
delete delete 13. The method of claim 12,
Wherein the diabetes is Type 1 diabetes. An INS gene knockout diabetic or diabetic complication animal model.
13. The method of claim 12,
The diabetic complication may be selected from the group consisting of hyperglycemia, hyperinsulinemia, hypertriglyceridemia, lipid metabolism disorder, fasting glucose insufficiency, impaired glucose tolerance, obesity, arteriosclerosis, microvascular disease, kidney disease, heart disease, foot ulcer, arthritis, osteoporosis and diabetic Retinopathy, an INS gene knockout diabetic or diabetic complication animal model.
1) administering to the animal model of INS gene knockout diabetes or diabetic complication of claim 12 a candidate for diabetic or diabetic complication improvement or therapeutic agent; And
2) comparing the animal model administered with the candidate substance to a control group in which the candidate substance is not administered, and when the blood glucose level is decreased by the candidate substance, determining the animal model as diabetes mellitus or diabetic complication improvement or remedy, A method of improving complications or screening a therapeutic agent.

Images