KR101747786B1 - A process for the enhanced cell proliferation by artificial nanovesicles derived from embryonic stem cells - Google Patents

Abstract

The present invention improves cell proliferation using artificial nano-vesicles derived from embryonic stem cells. Since the artificial nano-vesicle has a cell membrane structure and cytoplasm is protected, it can be efficiently delivered to cells. In addition, it is possible to obtain a sufficient amount as necessary for cell proliferation by artificially synthesizing nano-beacycles which are difficult to obtain naturally, and it is possible to obtain a sufficient amount of nano- It is easy and efficient to obtain the cell proliferation effect by simply treating the cells with the cells, and the embryonic stem that can help the regeneration of the damaged tissue by increasing the proliferation speed of the cells by treating the artificial nano- And to provide a method for enhancing cell proliferation using artificial nano-beacles derived from cells.

Description

The present invention relates to a method for enhancing cell proliferation using artificial nanobesicles derived from embryonic stem cells,

The present invention relates to a method for enhancing cell proliferation using nanobesecle derived from embryonic stem cells, and more particularly, to a method for enhancing cell proliferation using a nanobesecle derived from embryonic stem cells, Thereby increasing the cell proliferation rate.

Cell proliferation is the most basic activity of a cell, which means that one cell divides into two cells and the number of cells increases. Each of the divided cells has a specific function through differentiation and forms various tissues and organs. Therefore, in order to maintain the function of the cells, the aged cells are replaced with new cells, and the damaged parts are caused to proliferate in order to restore the original state.

An important factor influencing cell proliferation is extracellular matrix and growth factors. When cells or tissues are damaged by physical or chemical stimuli, an extracellular matrix is formed by an immune response and a blood coagulation reaction, The cell binds to the extracellular matrix and proliferates, thereby repairing the damaged region.

In addition, TGF-beta (transforming growth factor beta), which is one of the growth factors, can activate a fibroblast capable of synthesizing an extracellular matrix, and the TGF- When activated, the dermal fibroblasts promote the production of extracellular matrix, which can restore damaged cells or tissues.

On the other hand, the interaction between cells and the interaction of biomaterials plays an important role in cell proliferation. Especially, microvesicles play an important role in intercellular interactions.

Microvesicle is a kind of cell organelles having an average size of 100 nm. It is naturally released from the cell membrane in almost all kinds of cells, and has a membrane form of the phospholipid which is the structure of the cell membrane. The mRNA, DNA and protein And the like. These microvesicles are the basic cell tools for metabolism, transport of metabolites, storage of enzymes, and chemical reactions, and mediate the intercellular signaling by transferring mRNA, miRNA and protein between cells.

For example, in the case of microvesicles derived from cancer cells, they may induce changes in normal cells by transferring cancer proteins or miRNAs into surrounding normal cells. In addition, since the cell membrane is directly released, it possesses the antigenic substance of the parent cell, and is used for the research for the treatment of diseases and the development of a vaccine. Patent Publication No. 2011-0002443 (published on Jan. 7, 2011) Suggesting a composition capable of treating and / or diagnosing cancer, inflammatory tissue and the like using a vesicle derived from a mammalian nucleated cell.

In addition, attention has been paid to the function of microbeccicle structure and intercellular signal transduction, and development of techniques for delivering drugs and biomaterials to cells using an artificial dual phospholipid membrane has been actively carried out. , Artificial nanobesicles are widely used in biological experiments because of their high transmission efficiency and the ability to protect the substance to be transferred from the external environment. Open Patent Application No. 2012-0002942 (published Jan. 9, 2012) discloses a method for transferring a therapeutic substance, a diagnostic substance, and / or a backing substance to a vesicle derived from a protoplast of a cell and transferring the substance to a specific cell and tissue .

As a method for producing artificial nano beads, artificial nanobesecle can be prepared by pulverizing cells into a small form by applying a conventional extrusion method or ultrasonic degradation method to a cell suspension. Discloses a method for producing an artificial nanobesecle through a porous filter in the state of concentrating cells using centrifugal force.

In the meantime, research is underway to utilize the intercellular interactions of microvesicles to aid cell proliferation. In particular, in the case of microvesicles derived from embryonic stem cells, adult stem cells can be proliferated And may also increase the expression of early pluripotency genes. However, these conventional technical achievements are limited to the proliferation of stem cells. Therefore, there is a limit to enhance the proliferation of somatic cells without the pluripotency, which is a feature of stem cells.

Published Patent No. 2011-0002443 (published on January 7, 2011) Open Patent No. 2012-0002942 (published on January 9, 2012) Published Patent No. 2014-0118524 (published Oct. 8, 2014)

It is an object of the present invention to improve the proliferation of not only the stem cells but also the somatic cells having no differentiation ability by treating the cell proliferation composition containing the artificial nanobesicles derived from the embryonic stem cells to the cells, The present invention provides a method for improving cell proliferation using artificial nanobesicles derived from embryonic stem cells, which can help regenerate tissues.

In order to accomplish the above object, a method for improving cell proliferation using an artificial nano-beadlet derived from embryonic stem cell according to an embodiment of the present invention includes: preparing cells and a cell culture solution; And a step of treating the cell culture solution with a cell growth composition containing artificial nanobeseca derived from embryonic stem cells and culturing the cell in a cell culture medium treated with the composition, It is preferable that the cell culture medium is a fibroblast or a mesenchymal stem cell. In the step of culturing the cell culture medium, the number of initial somatic cells is 2 × 10 ⁴ to 4 × 10 ⁴ cells / ml, the culture time is 48 Time.
(A) preparing a cell suspension by mixing a phosphate-buffered saline (PBS) with cells obtained by centrifuging an embryonic stem cell culture obtained by culturing embryonic stem cells; (b) passing the cell suspension through a filter to disrupt the cells; And (c) ultracentrifuging the cell suspension containing the shredded cells to obtain an artificial nanobesecle. The filter used herein may be a filter having a size of 0.2 to 30 탆 or a size of 5 to 10 탆 It is preferable to have a hole, and a polycarbonate material may be used.

delete

The embryonic stem cell may be derived from a mammal, and the artificial nano-beacle has a structure in which lipids composed of cell membrane components of embryonic stem cells are separated from each other by a medium membrane.

The lipid bilayer of the artificial nano-vesicle is composed of a targeting molecule, fusogen, cyclodextrin, and polyethylene glycol (PEG), which are components other than the cell membrane, necessary for cell membrane fusion with the target cell , And the like.

The composition for cell proliferation comprising the artificial nano-beques derived from embryonic stem cells is at least one selected from the group consisting of a cell growth factor, an extra cellular matrix (ECM) and a stem cell culture in which stem cells are cultured It is preferable to further include any one or more of them.

The step of treating a cell growth composition containing an artificial nano-beacuse derived from embryonic stem cells is performed once or repeatedly a plurality of times.

Meanwhile, in the composition for cell proliferation including the artificial nano-beacuse derived from embryonic stem cells, the nanobesecle is added to the skin fibroblast culture cultured with the dermal fibroblast at a concentration of not less than 10 μg / ml and less than 100 μg / ml Or may be included at a concentration of 10 쨉 g / ml or more and less than 100 쨉 g / ml for a mesenchymal stem cell culture cultured with mesenchymal stem cells.

delete

The method of enhancing cell proliferation using nanobesecle derived from embryonic stem cells according to the present invention uses artificial nanobesicles derived from embryonic stem cells, wherein the artificial nanobesicles have a cell membrane structure Since the cytoplasm is in a protected state, it can be efficiently delivered to the cells.

In addition, an excessive amount of microbeccule is required for cell proliferation using microbeccles. By virtue of artificially producing and obtaining microbeccles that are difficult to obtain naturally, it is possible to supply a sufficient amount as needed for somatic cell proliferation, It is simple and efficient since the cell proliferation effect can be obtained by simply treating the cells with nanobesecle without complicated processes such as co-culturing with the cells or concentrating the culture.

On the other hand, the method of improving the growth rate of cells by treating the artificial nano-beads with the above-mentioned cells can also help regenerate damaged tissues.

FIG. 1 shows a method for producing the artificial nano beads of the present invention and a method for treating the artificial nano beads with the cells.
2 is a transmission electron microscope (TEM) photograph of the artificial nano beads of the present invention.
FIG. 3 shows the result of measurement of the artificial nano-beadlets of the present invention using a nanoparticle analyzer.
FIG. 4 shows the result of analyzing the RNA profile of artificial nano-beadlets and embryonic stem cells of the present invention using a bioanalyzer.
FIG. 5 shows electrophoretic analysis of artificial nano-beads, embryonic stem cells, and dermal fibroblasts of the present invention.
FIG. 6 is a Western blot analysis of the artificial nano-beads, embryonic stem cells, and dermal fibroblasts of the present invention.
FIG. 7 is a photograph of a human embryonic fibroblast treated with artificial nano-beads of the present invention and then photographed with a confocal microscope.
FIG. 8 is a result of electrophoresis analysis of the skin fibroblasts treated with the artificial nano beads of the present invention and the skin fibroblasts not treated with the artificial nano beads.
FIG. 9 is a graph showing cell activity of the dermal fibroblasts after treating the artificial nano beads of the present invention with dermal fibroblasts at different concentrations.
10 is a graph showing the number of cells grown after treating the artificial nano beads of the present invention with dermal fibroblasts of different initial cell numbers.
11 is a result of the wound healing assay of the skin fibroblasts treated with the artificial nano-beadlets of the present invention and the skin fibroblasts not treated with the artificial nano-beads.
FIG. 12 shows the BrdU staining assay results of the skin fibroblasts treated with the artificial nano-beadlets of the present invention and the skin fibroblasts not treated with the artificial nano-beads.
FIG. 13 is a graph showing changes in growth factor expression levels of skin fibroblasts treated with artificial nano-beadlets of the present invention and dermal fibroblasts without treatment of artificial nano-beads with a polymerase chain reaction (hereinafter referred to as PCR) This is a result.
FIG. 14 is a result of Western blot analysis of skin fibroblasts treated with artificial nano beads of the present invention and skin fibroblasts not treated with artificial nano beads.
FIG. 15 is a Western blot analysis of skin fibroblasts treated with artificial nano-beadlets of the present invention and skin fibroblasts not treated with artificial nano-beads after 5 and 10 minutes, respectively.
FIG. 16 shows the results of analysis of skin fibroblasts treated with artificial nano-beadlets of the present invention and skin fibroblasts treated with artificial nano-beads by enzyme-linked immunosorbent assay (ELISA).
FIG. 17 is an image of mesenchymal stem cells treated with artificial nano-beadlets of the present invention and mesenchymal stem cells not treated with artificial nano-beads.
18 shows the results of analysis of the number of cells of mesenchymal stem cells treated with artificial nano-beadlets of the present invention and mesenchymal stem cells not treated with artificial nano-beads.

Hereinafter, preferred embodiments of the present invention will be described in detail with reference to the drawings. Prior to this, terms and words used in the present specification and claims should not be construed as limited to ordinary or dictionary terms, and should be construed in a sense and concept consistent with the technical idea of the present invention.

Throughout this specification, when an element is referred to as "including" an element, it is understood that it may include other elements as well, without departing from the other elements unless specifically stated otherwise.

Each step may be performed differently than the order specified unless explicitly stated in the context of the specific order. That is, each of the steps may be performed in the same order as described, or may be performed substantially concurrently or in the reverse order.

In order to achieve the above object, the present invention provides a method for preparing a cell culture, comprising: culturing a cell to prepare a cell culture liquid; And a method for improving cell proliferation using an artificial nano-vesicle derived from embryonic stem cells, comprising the step of treating the cell culture solution with a composition for cell proliferation comprising artificial nano-vesicle derived from embryonic stem cells will be. At this time, the initial cell number is preferably 2 x 10 ⁴ to 4 x 10 ⁴ cells / ml, more preferably 3 x 10 ⁴ cells / ml in the step of preparing the cell culture liquid, , The effect of nanobesecle is greatest.

The embryonic stem cells may be derived from mammals and preferably human, non-human primates, mice, rats, dogs, cats, horses or bees, and are not particularly limited thereto.

The nanobesecle has a structure in which the lipid composed of the cell membrane component of the derived cell is separated from the inside and the outside of the nanobesicle by the medium membrane and has cell membrane lipid, cell membrane protein, nucleic acid and cell component of the cell, Means small, but is not particularly limited thereto.

The artificial nano vesicles are artificially produced vesicles, which are distinguished from naturally-occurring micro vesicles. Micro-vesicles secreted naturally are difficult to obtain in large quantities because they are secreted at a time, Sickle has the advantage of mass production.

The artificial nano-vesicle may be prepared by a method selected from the group consisting of extrusion, sonication, cell lysis, homogenization, freeze-thaw, electroporation, mechanical degradation, chemical treatment and ultracentrifugation It is more preferable that the artificial nano beacycles prepared by using the ultracentrifugation apparatus have the most cytoplasmic components of the embryonic stem cells.

The method for preparing the artificial nanobesecle using the ultracentrifugation method comprises the steps of: (a) preparing a cell suspension by mixing phosphate-buffered saline (PBS) with cells obtained by centrifuging the culture of embryonic stem cells; (b) passing the cell suspension through a filter to disrupt the cells; And (c) ultracentrifuging the cell suspension containing the shredded cells to obtain artificial nanovesech.

At this time, the size of the filter hole is preferably 0.2 to 30 탆, more preferably 5 to 10 탆. When the size of the filter hole is smaller than the above range, the cells do not pass through the filter, the pores are blocked to reduce the yield, and cell crushing does not occur when the size is larger.

The filter material is generally made of a hydrophobic material, metal, polymer, glass, silicone, or the like, which can pass through water, and is preferably made of a polycarbonate material. However, Any material can be used as long as it does not denature the chemical properties.

The lipid bilayer of nanobesecle is selected from the group consisting of a target molecule, fusogen, cyclodextrin and polyethylene glycol (PEG), which are components other than the cell membrane, targeting molecule, cell membrane fusion with the target cell At least one of which is at least one of. Various methods may be used for the components other than the cell membrane to include the lipid of nanobesecycles in the medium membrane, and preferably, they can be added by a chemical modification method of the cell membrane. The chemical modification of the cell membrane may be performed by a technique known in the art. The cell membrane may be chemically modified using a thiol group (-SH) or an amine group (-NH ₂ ), which is a membrane component of the nanovesicule. May be modified.

The composition for cell proliferation comprising an artificial nano-beacle derived from embryonic stem cells further includes at least one selected from the group consisting of a cell growth factor, an extra cellular matrix (ECM), and a stem cell culture solution It is possible.

The step of treating the cell growth composition containing the artificial nano-beacle derived from embryonic stem cells may be carried out once or repeated a plurality of times.

The cell of the cell culture fluid may be a somatic cell or a stem cell, and in the case of a somatic cell, it is preferably selected from a skin fibroblast, a blood cell or an adipocyte, more preferably a dermal fibroblast, but is not particularly limited thereto.

In the case of dermal fibroblasts, it is preferable that the artificial nano-beads in the composition for cell proliferation be contained in an amount of 10 μg / ml or more and less than 100 μg / ml in the culture medium of the dermal fibroblast, Respectively.

In addition, when the cell is a stem cell, it is preferably selected from mesenchymal stem cells, adult stem cells, embryonic stem cells, hematopoietic stem cells or cord blood stem cells, Mesenchymal stem cells, but are not particularly limited thereto.

In the case of mesenchymal stem cells, it is preferable that the artificial nano-beadlets in the cell proliferation composition are contained in an amount of not less than 10 μg / ml and not more than 100 μg / ml with respect to the mesenchymal stem cell culture medium, Was the most active.

Hereinafter, the technical features of the present invention will be described in detail with reference to embodiments and drawings. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims and their equivalents. shall.

art Nanobecycline  Manufacturing and obtaining

First, mouse embryonic stem cells were cultured in a gelatin-coated 150-mm culture dish until 90% of the initial concentration was proliferated. Then, 8 ml of 2 mM EDTA in phosphate buffered saline (PBS) After incubating in an incubator for 10 minutes, the cells are removed using a pipette to obtain a cell mixture.

The cell mixture was centrifuged to separate the cells, and the separated cells were resuspended in 1 ml of PBS at a concentration of 5 × 10 ⁷ cells / ml. Mu] m, and an artificial nano vesicle is prepared in the same manner as in Fig.

More specifically, 1 ml of 30% OptiPrep and 1 ml of 10% OptiPrep were added to a 5 ml ultracentrifuge tube, and 1 ml of the cell suspension passed through the prepared 5 탆 polycarbonate filter was loaded , And the remaining volume was filled with PBS solution. Thereafter, ultracentrifugation was carried out at 100,000 x g-force for 1 hour, and artificial nanobesecle was obtained between the 30% OptiPrep and the 10% OptiPrep produced after centrifugation.

art Nanobecycline  Morphological characterization

The artificial nanobesicles prepared according to the method of Example 1 were adsorbed on a glow-discharged carbon-coated copper grid for 7 seconds and then stained with 2% uranylacetate for 10 seconds staining), and observed with a transmission electron microscope (JEM101 (Jeol, Japan)).

As shown in FIG. 2, the artificial nano vesicle derived from mouse embryonic stem cells has a spherical phospholipid bilayer form and its size is 100 to 200 nm.

In order to more accurately measure the size of the artificial nanobesicles, artificial nanobesicles were diluted in 1 ml of PBS at a concentration of 5 μg / ml, placed in a cuvette, and analyzed using a dynamic light scattering particle size analyzer (DLS) , And the results are shown in Fig. According to FIG. 3, it was confirmed that the average size of nanobesicles was about 100 nm.

art Nanobecycles  Myocyte analysis

RNA profile analysis was performed using a bioanalyzer to compare cytoplasmic components of artificial nano-beacles and embryonic stem cells produced according to the method of Example 1, and as shown in Fig. 4, RNAs of artificial nano-vesicles and embryonic stem cells The results of this study are as follows.

The mRNA of the artificial nanobase, the embryonic stem cell, and the somatic cell skin fibroblast were extracted and analyzed by electrophoresis.

The results are shown in FIG. 5. Among the three markers, β-actin is a housekeeping gene. The housekeeping gene is a gene that is essential for the cell's life activity and is always expressed in any cell. It is a marker that can be confirmed that the quantification is properly performed. The ESCs, the dermal fibroblasts (SFs) (NVs) derived from artificial nanobesicles.

In addition, Oct3 / 4 and Nanog are essential genes for expressing the competence of embryonic stem cells, and they are expressed only in embryonic stem cells and artificial nano-vesicles other than dermal fibroblasts, and the artificial nano- MRNA < / RTI >

In order to compare proteins expressed in the artificial nanobesicles, proteins of artificial nano-beads, embryonic stem cells, and dermal fibroblasts were extracted and subjected to western blotting. As shown in FIG. 6, It was confirmed that the sickle expresses the protein of the same composition as the embryonic stem cell.

art Nanobecycline  Observation of influx into somatic cells

First, somatic cell mouse embryonic fibroblast (GFP-MEF) is fluorescently stained with green, transferred to a culture dish for confocal microscopy coated with gelatin, and then cultured.

In order to obtain artificial nanobesecle from embryonic stem cells, mouse embryonic stem cells were cultured in gelatin-coated 150 mm culture dishes until 90% of the initial concentration was proliferated, followed by removal with 2 mM EDTA in PBS, Separate the cells through a separator. The separated cells were diluted in 1 ml of PBS solution at a concentration of 5 × 10 ⁷ cells / ml, and then an orange fluorescent dye (CMTMR) was added to the cell dilution and incubated for 20 minutes in an incubator. PBS was added and centrifuged Only stained cells are obtained. Thereafter, the artificial nanovesech is produced and separated in the same manner as in Example 1. [

The artificial nanobesicles were treated with the mouse embryonic fibroblasts for 1 hour, 3 hours, and 12 hours, respectively, and then fixated and observed with a confocal microscope. The results are shown in FIG. In Fig. 7, green represents the nucleus of mouse embryonic fibroblasts, orange represents artificial nanobesicles, and blue represents the nucleus of mouse embryonic fibroblasts. The longer the time for treating artificial nanobesecle with mouse embryonic fibroblasts, the more artificial It was found that nanobesecycles were introduced into mouse embryonic fibroblasts through a plasma membrane.

In addition, after 48 hours of treatment with artificial nano vesicles in dermal fibroblasts, mRNA of cells was extracted and subjected to electrophoresis through PCR, as shown in Fig. (+) SFs are artificial nanobesecle treated skin fibroblasts, and Oct3 / 4 and Nanog (+) SFs are skin fibroblasts treated with artificial nanobacils. As the genes are expressed in NVs and (+) SFs, it can be seen that the mRNAs of nanobesecle are present in the skin fibroblasts treated with artificial nanobesicles. Through these two experiments, It was confirmed that it could enter the cell.

art Nanobecycline  Somatic cells by Growth rate  compare

a. Dermal fibroblast  Artificial best suited for activity Nanobecycles  Density setting

The skin fibroblasts were transferred to a culture dish at a concentration of 1 x 10 ⁴ cells / ml and after 48 hours, the initial cell activity was measured with a CCK-8 kit, and the concentration of artificial nanobesecle derived from embryonic stem cells was measured And 0 ~ 500 ㎍ / ㎖, respectively. Cell viability was measured with CCK-8 kit after 24 hours. As a result, the skin fibroblasts treated with artificial nanobecyclo 50 μg / ml showed the highest cell activity.

b. Dermal fibroblast  Optimized initial Cell number  Set

The initial cell number of the dermal fibroblasts was transferred to a culture dish at 1, 3, 5 × 10 ⁴ cells / ml, cultured for 48 hours, and then the artificial nanobesecle was added to the dermal fibroblast Lt; RTI ID = 0.0 > pg / ml < / RTI > After 48 hours, the cells were removed with trypsin to count the number of cells and compared with the number of cells seeded at the early stage. As shown in Fig. 10, the (-) NVs were not detected in the skin fibroblasts (+) NVs means the number of skin fibroblasts treated with artificial nanobesicles, and when the initial number of cells is 3 × 10 ⁴ cells / ㎖, the effect of artificial nanobesecle is most effective I could see a big thing.

c. Confirm cell proliferation comparison

When the skin fibroblasts are transferred to a culture dish and planted to saturate on the bottom of the culture dish, the cells are drawn by straightening on a culture dish with the micropipette tip. After washing the detached cells with PBS solution, they are mixed with the culture solution so that the concentration of artificial nanobesecle is 50 μg / ml. The state of the first cell and the condition after 48 hours of treatment with the artificial nanobesecle were observed under a microscope. As shown in Fig. 11, it can be seen that the skin fibroblasts treated with the artificial nano-bevacilles are more proliferated and migrated and filled with a lot of voids.

In addition, when the cells proliferate, the DNA is replicated. When BrdU (Bromodeoxyuridine) staining is performed, BrdU is inserted between the DNAs of the proliferating cells. After fixing the BrdU, BrdU antibody is added and BrdU fluorescence appears inside the nucleus.

12 shows the result of comparing the activity of cell proliferation by artificial nanobesecle. In FIG. 12, blue indicates the nucleus of the cell, red is the part stained with BrdU, and red part of BrdU is artificial As the fibroblast cells treated with nanobesecle are observed more, the proliferation of the cells becomes more active when the artificial nanobesecle is treated.

art Nanobecycline  Generation and acquisition

The skin fibroblasts were transferred to a culture dish at 3 x 10 ⁴ cells / ml as in Example 5 above, and then treated with artificial nanobesecle derived from embryonic stem cells 48 hours after planting. Forty-eight hours after the treatment, the cells were detached with trypsin, mRNA was obtained, and mRNA levels related to the growth factors were compared by real-time PCR using the primers shown in Table 1 below.

Target Primers, 5 '- > 3' Forward Reverse β-actin ACGTTGACATCCGTAAAGAC GCAGTAATCTCCTTCTGCAT VEGF-alpha AAACGAACGTACTTGCAGAT GTGACATGGTTAATCGGTCT TGF-beta TTGACGTCACTGGAGTTGTA CCACGTGGAGTTTGTTATCT

According to FIG. 13, the expression levels of VEGF-a and TGF-beta, which are growth factors of skin fibroblasts treated with nanobesecycine, are 2 times and 4 times higher, respectively.

As described above in Example 5, the dermal fibroblasts were transferred to a culture dish at 3 x 10 ⁴ cells / ml, and after 48 hours, they were treated with the artificial nanobesicles derived from embryonic stem cells. Forty-eight hours after the treatment, the cells were removed with trypsin, and the degree of expression of the protein associated with the cell increase was compared.

Fig. 14 is a quantitative comparison of the amounts of β-actin expressed in artificial nano-bead-treated skin fibroblasts and untreated dermal fibroblasts in the same quantitative manner. In skin fibroblasts treated with artificial nano- The expression of PCNA and Ki-67, which are associated with the growth of the collagen I protein, is high and the amount of collagen I protein is high.

In addition, as shown in FIG. 15, when the amount of p-MAPK protein, which is an intermediate product produced in the signal transduction process related to cell proliferation, was examined, it was confirmed that more amount was expressed in artificial nanobesecle-treated skin fibroblast . In this case, (+) 5 min represents the amount of protein expressed after 5 minutes of treatment with artificial nanovesech and (+) 10 min after 10 minutes, and the amount of protein expressed increases with time after treatment Able to know.

One of the functions of dermal fibroblasts was to generate growth factors, and an enzyme-linked immunosorbant assay (ELISA) was performed to confirm that the effect of the artificial nanobesicles on the growth factor production function was mediated. As shown in FIG. 16, TGF-beta levels of artificial nanobase-treated skin fibroblasts and untreated skin fibroblasts were measured, and the amount of TGF-beta expressed in artificial nanobase-treated skin fibroblasts High.

art Nanobecycline  Stem cells by Growth rate  compare

The mesenchymal stem cells extracted from mice were transferred to a culture dish at a concentration of 1 × 10 ⁴ cells / ml, and after 48 hours, the mesenchymal stem cells were treated with artificial nano-beads. At this time, the concentration of artificial nano-beadlets was set to 50 / / ml, which is the most effective concentration for cell activity according to the result of Example 5.

The culture medium was changed after 24 hours of treatment with the artificial nano-beadlets. The culture medium was again cultured for 24 hours as shown in Fig. 17. In order to compare the cell proliferation rate, the mesenchymal stem cells were removed with trypsin, , And the results are shown in Fig. At this time, control is a mesenchymal stem cell that has not been treated with artificial nanobesecle.

According to FIG. 18, mesenchymal stem cell (ES NVS) treated with artificial nano-beads showed higher growth rate than mesenchymal stem cells (control) not treated with artificial nano-beads.

The results of Examples 1 to 7 above show that the artificial nano-beads derived from embryonic stem cells of the present invention prepared according to Example 1 have an RNA profile similar to that of embryonic stem cells and are characteristic of embryonic stem cells It is known that cytoplasmic components are similar to each other, for example, by expressing proteins associated with differentiation potential.

In addition, artificial nano-beads can be introduced into somatic cells and improve cell proliferation after entry. This is because the skin fibroblasts treated with artificial nano-beads are more effective than the skin fibroblasts not treated with artificial nano- The more proteins associated with the increase, and the more growth factors are produced.

On the other hand, the growth rate of artificial nano-beadlet-treated stem cells is about twice that of untreated stem cells, and artificial nano-beadlets also affect the growth of stem cells.

As a result, it was confirmed that the artificial nano-beads derived from embryonic stem cells of the present invention are effective for proliferation of stem cells and somatic cells, and it can be expected that the artificial nano-beads can be utilized for regenerating damaged tissues.

Claims (15)

Preparing a cell and a cell culture solution; And
Treating the composition for cell proliferation comprising the artificial nano-beacuse derived from embryonic stem cells, and culturing the cell in a cell culture medium treated with the composition,
Wherein the cell is a skin fibroblast or a mesenchymal stem cell, wherein the cell proliferation is improved by using an artificial nano-vesicle derived from embryonic stem cells. The method according to claim 1,
A method for improving cell proliferation using an artificial nano-vesicle derived from embryonic stem cells, wherein the number of initial cells is 2 × 10 ⁴ to 4 × 10 ⁴ cells / ml in the step of preparing the cells and the cell culture liquid . The method according to claim 1,
The artificial nanobesecle is a synthetic nanobiscycle,
(a) preparing a cell suspension by mixing a phosphate-buffered saline (PBS) with cells obtained by centrifuging an embryonic stem cell culture in which embryonic stem cells have been cultured;
(b) passing the cell suspension through a filter to disrupt the cells; And
and (c) ultracentrifuging the cell suspension containing the shredded cells to obtain an artificial nanobesocyte. The method of claim 1, wherein the cell suspension is cultured using an artificial nanobiscyle derived from embryonic stem cells. How to improve. The method of claim 3,
Wherein the filter has a pore size of 5 to 10 mu m, wherein the artificial nanobesecle derived from embryonic stem cells is used to enhance cell proliferation. The method of claim 3,
Wherein the filter is made of a polycarbonate material. The method for enhancing cell proliferation using an artificial nanobiscyle derived from embryonic stem cells. The method according to claim 1,
Wherein the embryonic stem cell is derived from a mammal. ≪ RTI ID = 0.0 > 21. < / RTI > The method according to claim 1,
The artificial nanobesecle is a method for improving cell proliferation using artificial nano-beads derived from embryonic stem cells, characterized by having a structure in which lipids composed of cell membrane components of embryonic stem cells are separated from each other by a medium membrane . 8. The method of claim 7,
The lipid bilayer of the artificial nano-vesicle is composed of a targeting molecule, fusogen, cyclodextrin, and polyethylene glycol (PEG), which are components other than the cell membrane, necessary for cell membrane fusion with the target cell , Wherein the cell proliferation is improved by using an artificial nano-beacuse derived from embryonic stem cells. The method according to claim 1,
The composition for cell proliferation comprising the artificial nano-beques derived from embryonic stem cells is at least one selected from the group consisting of a cell growth factor, an extra cellular matrix (ECM) and a stem cell culture in which stem cells are cultured The method comprising the steps of: (a) culturing the stem cell-derived artificial nanobesecle; The method according to claim 1,
The step of treating a cell growth composition containing an artificial nano-beacuse derived from embryonic stem cells into the cell culture liquid is carried out once or repeatedly a plurality of times, using artificial nano-beads derived from embryonic stem cells A method for enhancing cell proliferation. delete delete The method according to claim 1,
In the composition for cell proliferation containing the artificial nano-beacuse derived from embryonic stem cells, the nano-beacycin is contained in the skin fibroblast culture cultured in the skin fibroblast at a concentration of 10 / / ml or more and less than 100 / / ml Wherein the cell proliferation is enhanced by using an artificial nano-beacuse derived from embryonic stem cells. delete The method according to claim 1,
In the composition for cell proliferation including the artificial nano-beacuse derived from embryonic stem cells, the nano-bevacycal is preferably at least 10 ㎍ / ㎖ and less than 100 ㎍ / ㎖ in the mesenchymal stem cell culture cultured with the mesenchymal stem cells Wherein the method comprises the steps of: (a) culturing the stem cell-derived artificial nanobesecle;

Images