KR101712076B1 - ITGA11 and/or THBS2 as CpG methylation markers for predicting a risk of preterm delivery and use thereof - Google Patents

Abstract

The present invention relates to a composition, a kit and a method for predicting a risk of preterm delivery comprising preparations of measuring a methylation level of CpG parts of one or more types of genes selected from the group consisting of Integrin alpha-11 (ITGA11) and Thrombospondin-2 (THBS2) from a sample of a mother. The composition can contribute to preventing preterm delivery by developing a preterm delivery predicting marker of suggesting a risk of preterm delivery from a mother.

Description

The use of CpG methylation markers ITGA11 and / or THBS2, and its use to predict preterm birth risk (ITGA11 and / or THBS2 as CpG methylation markers for predicting a risk of preterm delivery and use thereof)

The present invention relates to a composition, a diagnostic kit and a diagnostic method for diagnosing the risk of premature birth by detecting the methylation level of the CpG region of the ITGA11 and / or THBS2 gene from a maternal sample.

Preterm birth usually means giving birth before 37 weeks after 20 weeks. The risk of death is high enough to account for about 60% of all infant deaths, and neonatal intensive care is needed for neonatal developmental disorders, respiratory complications, postnatal growth retardation, There is a high morbidity rate for long-term or short-term diseases. In addition, about 75% of preterm birth occurs with premature labor, amniocentesis, and associated cervical incompetence and chorioamnionitis. However, the mechanism associated with preterm delivery is still unclear. Common risk factors for natural labor include genital tract infections, multiple pregnancies, a few thirds of bleeding, and previous preterm delivery history.

The minimum gestational age is 27 weeks and the birth weight is 0.9 kg. The morbidity and mortality of the newborn are known to be influenced primarily by gestational age, or maturity, rather than birth weight. Thus, delaying the delivery of newborns by appropriate treatment to raise maturity when early signs of premature birth come, is a crucial issue for the health and quality of life and costs of mothers and newborns.

Until now, for the treatment of premature labor, maternal use of ant contractions, antibiotics, steroids and progesterone have been used to suppress labor and delay delivery. However, in cases of preterm labor and premature rupture of membranes, the treatment effect of antibiotics on intrauterine infection and inflammation is very limited and it is known that preterm delivery can not be prevented. In addition, women with cervical incompetence have been given cervical cerclage as a treatment and prophylaxis because of the great risk of infection and miscarriage, but this can not be treated as a fundamental treatment, It is known.

Therefore, it is necessary to select maternal risk pregnancies by anticipating the risk of premature birth, to prevent premature birth through appropriate management of them, or to develop an effective treatment method. In addition, the earlier the preterm delivery period, the more likely it is to leave a sequel to the neonate and the degree of sequelae is so severe that it is expected that the incidence of preterm infants and children with disabilities can be significantly reduced if the preterm delivery can be predicted.

A common approach to predicting preterm birth was to identify female populations that should be given special attention in terms of obstetric, demographic and various syndromes (Main et al., Am. J. Obste. Gynecol. , 151: 892-898, 1985), this approach has the problem that the method is not sensitive or specific. To overcome these problems, many studies have been conducted to find biochemical markers for predicting sudden preterm delivery and amniotic membrane wasting. Plasma estradiol-17 beta, progesterone, C Substances such as C-reactive protein have been nominated, but this has also been shown to be less accurate. Therefore, it is necessary to develop a marker that is easier to detect and has high sensitivity and specificity.

Main et al., Am. J. Obste. Gynecol., 151: 892-898 (1985)

Accordingly, the present invention aims to contribute to the prevention of premature birth by identifying predictive markers of preterm delivery indicative of prematurity risk in the mother.

For this purpose, it is an object of the present invention to provide a method for detecting the methylation level of a CpG region of one or more genes selected from the group consisting of ITGA11 (Integrin alpha-11) and THBS2 (Thrombospondin-2) And to provide a composition for diagnosing the risk of premature birth.

As another example, another object of the present invention is to provide a kit for the diagnosis of maternal risk of premature birth comprising the composition.

As another example, another object of the present invention is to provide a method for diagnosing premature rupture, comprising the step of measuring the methylation level of the CpG region of at least one gene selected from the group consisting of ITGA11 and THBS2 from a maternal sample Providing a method of providing the same.

As another example, another object of the present invention is to diagnose the risk of premature birth of a mother, comprising the step of measuring the methylation level of the CpG region of at least one gene selected from the group consisting of ITGA11 and THBS2 from a maternal sample Method.

The present invention uses the degree of methylation of the CpG region of the above genes as a biomarker based on the results of selecting genes showing significant differences in CpG methylation levels in blood genes between preterm delivery mothers and normal delivery mothers, Of the < / RTI >

In one embodiment of the present invention, maternal admission to premature labor during pregnancy was performed to distinguish between the preterm delivery group of less than 37 weeks and the normal delivery group after 37 weeks. Then, amniotic membrane samples of these pregnant women were collected And methylation arrays and whole transcriptome sequencing were performed to identify genes showing significant methylation and expression changes. Among these genes, genes having a negative correlation with methylation and expression levels were screened. In addition, normal and maternal amniotic samples were further collected, and the difference in methylation level of the screened gene was examined by pyrosequencing, and the amount of gene expression was examined by qRT-PCR to confirm whether there was a negative correlation. In addition, methylation arrays and qRT-PCR were performed on maternal blood samples of normal and preterm infants to determine whether methylation changes in the selected genes were similar to those in amniotic membrane samples.

Furthermore, we identified specific CpG sites that affected gene expression and confirmed that the risk of preterm birth could be predicted by measuring the degree of methylation occurring at specific CpG sites of the gene.

Therefore, in the present invention, hypomethylation occurring at the CpG site of the ITGA11 and / or THBS2 gene is provided as a biomarker capable of diagnosing premature birth or predicting preterm delivery risk.

More specifically, since the CpG sites of the ITGA11 and THBS2 genes are specifically under-methylated in preterm delivery, it is possible to use each of them as a sole biomarker for predicting preterm birth risk, or two or more of them as a complex biomarker .

Accordingly, in one aspect, the present invention relates to a composition for diagnosing asthma risk and a kit comprising the same, which comprises an agent for measuring the methylation level of the CpG region of one or more genes selected from the group consisting of ITGA11 and THBS2 .

The term "diagnosis" or "prediction" in the present invention means that the mother is likely to undergo preterm birth in less than 37 weeks of gestation, is relatively more likely to have preterm birth in less than 37 weeks, And the like. The present invention may be used to delay or prevent premature delivery of maternal mothers who are at high risk of premature birth for less than 37 weeks through special and appropriate care. In addition, the invention can be used clinically to make treatment decisions by early diagnosis of preterm birth of less than 37 weeks and by selecting the most appropriate treatment regimen.

The term "diagnostic markers, diagnostic markers or diagnostic markers" or "markers" in the present invention refers to preterm birth mothers (for example, And maternal births of more than a week), which means bioorganic molecules that show significant differences in maternal samples predicted by preterm delivery compared to normal maternal maternal samples. For purposes of the present invention, it may refer to genes that specifically show DNA methylation changes in maternal samples predicted by premature birth.

 In the present invention, the term "methylation" refers to the attachment of a methyl group to a base constituting DNA. Preferably, the methylation in the present invention means whether methylation occurs in the cytosine of a specific CpG site of a specific gene. When methylation occurs, the binding of transcription factors is hindered and the expression of a specific gene is inhibited. On the other hand, when unmethylated or hypomethylated, the expression of a specific gene is increased.

Genomic DNA of mammalian cells contains 5th methyl-cytosine (5-methylcytosine, 5-mC) base with a methyl group attached to the fifth carbon of the cytosine ring in addition to A, C, G and T do. Methylation of 5-methylcytosine occurs only in C of a CG dinucleotide (5'-mCG-3 ') called CpG, and methylation of CpG inhibits expression of repeated sequences of alu or transposon and genome. Also, since 5-mC of the CpG is naturally deaminated and is likely to become a thymine (T), CpG is a site where most epigenetic changes frequently occur in mammalian cells.

The term "measurement of methylation level" in the present invention means the measurement of the methylation level of the CpG region of the ITGA11 and / or THBS2 gene and includes methylation-specific PCR such as methylation-specific polymerase chain reaction (MSP ), Real-time methylation-specific polymerase chain reaction (PCR), PCR using methylated DNA-specific binding protein, or quantitative PCR. Or by automated base analysis such as pyrosequencing and bisulfite sequencing, but are not limited thereto.

Preferably, the CpG region of the gene refers to a CpG region present on the DNA of the gene. The DNA of the gene includes a promoter region, an open reading frame (ORF), and a terminator (ORF), all of which are necessary to express the gene and include a series of constituent units operably linked to each other. Region. Thus, the CpG site of the ITGA11 and / or THBS2 gene may be present in the promoter region, protein coding region (ORF), or terminator region of the gene of interest. Preferably, the CpG of the gene may be present in the ORF.

In one embodiment, measuring the methylation level of the CpG region of ITGA11 in the present invention may mean measuring the level of methylation of cytosine at the CpG site that appears in the 68667617 to 68668338 base of chromosome 15. In the present invention, nucleotides 68667617 to 68668338 of the above chromosome 15 are represented by SEQ ID NO: 1.

In another embodiment, measuring the methylation level of the CpG region of the ITGA11 gene in the present invention may mean measuring the methylation level of cytosine located at position 68667977 (position 361 of SEQ ID NO: 1) of chromosome 15.

In another embodiment, measuring the methylation level of the CpG region of the THBS2 gene in the present invention may mean measuring the methylation level of the cytosine of the CpG region present in the 169625244 to 169625965 base of chromosome 6. In the present invention, the nucleotides 169625244 to 169625965 of the chromosome 6 are shown in SEQ ID NO: 2.

In another embodiment, in the present invention, the methylation level of the CpG region of the THBS2 gene is measured by measuring the methylation level of the chromosome 6 at position 169625596 (SEQ ID NO: 353), 169625604 (SEQ ID NO: 361) and / or 169625613 Th > (position 370 of SEQ ID NO: 2).

The nucleotide sequence of the chromosome 6 at which the CpG region is located can be found, for example, in Genbank Accession No. NC_000006.11 and the nucleotide sequence of chromosome 15 in NC_000015.9. In the present invention, the nucleotide sequence of the human genome chromosome region is the latest version of The December 2013 Human reference sequence (GRCh37) , The specific sequence of the human genome chromosome region may be changed somewhat as the genome sequence study result is updated and the expression of the human genome chromosome region of the present invention may be different according to the modification . Therefore, the human genome chromosome region expressed in accordance with the December 2013 Human reference sequence (GRCh37) of the present invention is updated with the human reference sequence after the filing date of the present invention, It will be obvious that the scope of the present invention is extended to the modified human genome chromosome region even if it is otherwise changed. Such modifications are readily apparent to those skilled in the art to which the present invention pertains.

In addition, changes in abnormal methylation of maternal genes may be due to methylation changes in genomic DNA obtained from biological samples such as amniotic membrane, amniotic fluid, umbilical cord blood, placenta, cells, whole blood, serum, plasma, vaginal fluid, vaginal secretions, tissues, saliva, sputum or urine The marker of the present invention has an advantage that it is possible to easily diagnose the diagnosis of preterm birth or prediction of premature danger through blood or body fluids.

In the present invention, the agent for measuring the methylation level of the CpG region includes a compound that modifies an unmethylated cytosine base or a methylation-sensitive restriction enzyme, a primer specific to the methylated allele sequence of the gene, and a primer specific to the unmethylated allele sequence Gt; primer. ≪ / RTI >

The compound capable of modifying the unmethylated cytosine base may be bisulfite or a salt thereof, but is not limited thereto, preferably sodium bisulfite. Methods for detecting the methylation of a CpG site by modifying an unmethylated cytosine residue using such bisulfite are well known in the art (e.g., WO 01/26536; US 2003/0148326 A1).

In addition, the methylation sensitive restriction enzyme may be a restriction enzyme capable of specifically detecting the methylation of the CpG site, and may be a restriction enzyme containing CG as a recognition site of the restriction enzyme. For example, SmaI, SacII, EagI, HpaII, MspI, BssHII, BstUI, NotI, and the like. The methylation or non-methylation of the restriction enzyme recognition site at C may or may not be cleaved by restriction enzymes and may be detected by PCR or Southern blot analysis. Other methylation sensitive restriction enzymes than the above restriction enzymes are well known in the art.

As a representative method for measuring the methylation level in the CpG region of the maternal ITGA11 and / or THBS2 gene, a method of obtaining genomic DNA from a biological sample of a patient and modifying a cytosine base that is not methylated in the obtained DNA, After the restriction enzyme treatment, the treated DNA can be amplified by PCR using a primer, and the presence or absence of the amplified product can be determined.

Thus, the formulations of the invention may include primers specific for the methylated allele sequence of the ITGA11 and / or THBS2 gene and primers specific for the unmethylated allele sequence. In the present invention, the term "primer" means a short nucleic acid sequence capable of forming a base pair with a complementary template with a nucleic acid sequence having a short free 3-terminal hydroxyl group and serving as a starting point for template strand copying. The primer can initiate DNA synthesis in the presence of reagents and four different nucleoside triphosphates for polymerization reactions (i. E., DNA polymerase or reverse transcriptase) at appropriate buffer solutions and temperatures. In addition, primers can incorporate additional features that do not alter the primer properties of primers that serve as a starting point for DNA synthesis, as sense and antisense nucleic acids with 7 to 50 nucleotide sequences.

The primer of the present invention can be preferably designed according to the sequence of a specific CpG site to be subjected to methylation analysis and includes a pair of primers capable of specifically amplifying cytosine that has been methylated and not modified by bisulfite, And a primer pair that is not methylated and can specifically amplify cytosine modified by bisulfite.

In addition to the above preparation, the composition and kit may further contain a polymerase agarose, a buffer solution necessary for electrophoresis, and the like.

In another aspect, the present invention relates to a method for diagnosing the risk of premature birth by measuring the level of methylation at the CpG site of one or more genes selected from the group consisting of ITGA11 and THBS2.

In another aspect, the present invention relates to a method for measuring methylation levels at CpG sites of at least one gene selected from the group consisting of ITGA11 and THBS2 to provide information necessary for diagnosis of premature rash.

For example, the present invention relates to a method for providing information necessary for diagnosis of premature rheumatism, comprising the step of measuring the methylation level of the CpG region of at least one gene selected from the group consisting of ITGA11 and THBS2 from a maternal sample .

Specifically, the present invention provides a method for detecting a methylation level of a CpG region of at least one gene selected from the group consisting of ITGA11 and THBS2 from a sample of a mother; And comparing the methylation level to the methylation level of the CpG region of the gene of the control sample.

Preferably, the control sample may be a sample of normal delivery mother.

The method further comprises the step of determining that the mother is at risk for premature birth if the methylation level of the CpG region of the ITGA11 and / or THBS2 gene measured in the maternal sample is lower than the methylation level measured in the control sample can do.

The term "sample" or "biological sample " in the present invention includes any sample having a different methylation level of the ITGA11 and / or THBS2 gene between prematurity risk mothers and normal mothers. Examples include amniotic membrane, amniotic fluid, cord blood, placenta, But are not limited to, samples such as blood (e.g., whole blood, serum, plasma, etc.), vaginal discharge, vaginal fluid, tissue, cells, saliva, sputum or urine.

First, to obtain genomic DNA from a mother and measure the methylation level, the genomic DNA can be obtained by the phenol / chloroform extraction method, SDS extraction method (Tai et al., Plant Mol. Biol. Reporter, 8: 297-303, 1990), Cetyl Trimethyl Ammonium Bromide (Murray et al., Nuc. Res., 4321-4325, 1980) or commercially available DNA extraction kits.

The step of measuring the methylation level of the CpG region of the gene may comprise detecting a compound or methylation sensitive restriction enzyme that modifies the unmethylated cytosine base, a primer specific to the methylated sequence of the gene CpG region, and a primer specific to the unmethylated sequence . ≪ / RTI >

More specifically, the step of treating the genomic DNA in the obtained sample with a compound or methylation-sensitive restriction enzyme that transforms the unmethylated cytosine base; And

And amplifying the processed DNA by PCR using a primer capable of amplifying the methylation site of the gene CpG region by PCR. For example, methylation-specific polymerase chain reaction, real-time methylation-specific polymerase chain reaction, PCR using methylated DNA-specific binding protein, quantitative PCR, Pyrosequencing, and bisulfite sequencing, and measuring the methylation level.

In the above, the compound that transforms the unmethylated cytosine base may be bisulfite, preferably sodium bisulfite. Methods for detecting the methylation of a gene by modifying an unmethylated cytosine residue using such a bisulfite are well known in the art.

In addition, as described above, the methylation-sensitive restriction enzyme may be a restriction enzyme capable of specifically detecting methylation of a specific CpG site and may be a restriction enzyme containing CG as a recognition site of a restriction enzyme, for example, SmaI SacII, EagI, HpaII, MspI, BssHII, BstUI, NotI, and the like.

As described above, the primers can be desirably designed according to the sequence of the specific CpG site to be subjected to the methylation analysis, and can be specifically designed to amplify cytosine that has been methylated and not modified by bisulfite Primer pair and a pair of primers that can specifically amplify cytosine that is not methylated and modified by bisulfite.

The measurement of the methylation level can be performed according to a method known in the art, for example, by performing electrophoresis to detect a band at a desired position. For example, when a compound that modifies an unmethylated cytosine residue is used, two kinds of primer pairs, that is, a pair of primers capable of specifically amplifying cytosine that has been methylated and not modified by bisulfite, The degree of methylation can be determined according to the presence or absence of the PCR product amplified by the primer pair capable of specifically amplifying cytosine modified by the Fight. Preferably, the methylation can be determined by treating the sample genomic DNA with bisulfite, amplifying the CpG region of the gene by PCR, and analyzing the base sequence of the amplified region using a bisulfite genomic sequencing method .

In the case where restriction enzymes are used, it is judged that the gene is methylated when there is PCR result in the DNA treated with the restriction enzyme in the state that the PCR product is displayed in the mock DNA, If there is no PCR result in the DNA treated with the enzyme, it can be judged whether or not the gene is methylated by judging that the gene is unmethylated, which is obvious to a person skilled in the art. In the above, mock DNA refers to a sample DNA that has been separated from the sample and has not undergone any treatment.

According to this method, it can be predicted that there is a risk of premature birth if the CpG region of the ITGA11 and THBS2 genes in the maternal sample is specifically measured in a low-methylated state.

Therefore, according to the present invention, the risk of premature birth can be easily determined by effectively checking whether methylation of CpG in ITGA11 and / or THBS2 gene is methylated.

The present invention can be used to early diagnose the risk of premature birth, prevent premature birth, and prevent serious complications and sequelae of newborn infants such as neonatal morbidity and cerebral palsy.

FIG. 1 is a graph comparing CpG methylation value and relative mRNA expression level of THBS2 in amniotic membrane samples of normal and premature mothers (Position 1 is 169625596th of the chromosome 6, Position 2 is 169625604th of the chromosome 6, Position 3 indicates the 169625613th position of chromosome 6) (* P < 0.05).
FIG. 2 is a graph comparing the CpG methylation value and relative mRNA expression level of ITGA11 in amniotic membrane samples of normal and premature mothers (* P <0.05).
FIG. 3 is a graph showing CpG methylation value and relative mRNA expression level of ITGA11 in blood samples of normal and premature mothers.

Hereinafter, the present invention will be described in detail with reference to examples. However, the following examples are illustrative of the present invention, and the present invention is not limited by the following examples.

Example  1. Research subjects

From June 2014 to September 2015, women who were admitted to Ewha Womans University Mokdong Hospital (Korea) during the pregnancy were admitted to the premature labor department. (N = 5), and the amniotic membrane of the mother was sampled and the methylation array was performed. In addition, whole transcriptome sequencing was used to screen genes with significant expression differences in amniotic membrane of preterm and normal mothers. (N = 16) and the preterm group (n = 19) were further sampled for methylation and expression, and methylation and pyrosequencing were performed for methylation The level difference was verified and qRT-PCR method was used to investigate the gene expression level and the negative correlation was verified. In addition, methylation arrays and qRT-PCR were performed in the blood of normal (n = 13) and preterm (n = 17) mothers and the methylation patterns of these genes were examined in the same manner as in amniotic membrane.

Example 2. Extraction of genomic DNA

Genomic DNA was extracted using Qiagen mini kit (Qiagen) in the collected amniotic membrane. The extraction method was carried out according to the manufacturer's manual. The extracted genomic DNA was quantitated using a spectrophotometer. The DNA state was confirmed by electrophoresis on 1% agarose gel.

Example 3. Bisulfite treatment

When bisulfite is treated with genomic DNA, cytosine at the 5'-CpG-3 'site of the DNA sequence is retained as it is, but when it is unmethylated, it is converted to uracil, Can be measured. Thus, genomic DNA was treated with bisulfite to distinguish between methylated cytosine and unmethylated cytosine. First, ~ 700 ng of genomic DNA was treated according to the manufacturer's manual using Zymo EZ DNA Methylation Kit (Zymoresearch Inc.), and the bisulfite-treated DNA thus prepared was dissolved in H ₂ O and stored at -20 ° C Lt; / RTI &gt;

Example 4:

A DNA methylation microarray was performed using the Infinium (®) Human Methylation 450K BeadChip. Following the manufacturer's instructions, the bisulfite-treated DNA was amplified, fragmented, precipitated and resuspensioned and hybridized to the BeadChip. After washing, BeadChip was scanned using HiScan SQ system (Illumina) and β value was calculated using Genome Studio software (Illumina). The degree of DNA methylation is expressed as a value of 0 to 1, and a value of 0 means that the corresponding CpG site is completely unmethylated, and 1 means completely methylated.

Example 5. Whole transcriptome sequencing [

Total RNA was isolated from the amniotic membrane using TRIzol® RNA Isolation Reagents (Life Technologies, Carlsbad, Calif.) And sequenced using Agilent RNA 6000 Nano Kit (Agilent, Santa Clara, CA) Respectively. Total RNA was prepared using a TruSeq stranded total RNA sample preparation kit (illumina, San Diego, Calif.). The cDNA was synthesized by ligation of 1 ng of total RNA, ligation with appropriate primers, and quantified by real time PCR. Sequencing of each library was performed with illumina NextSeq500, clusters of cDNA libraries were generated by TruSeq flow cell and sequenced with TruSeq 200 cycle SBS kit. The raw image data was converted to sequence data and stored in FASTQ format.

Example 6. Correlation analysis

Differential methylated regions (DMR), which showed a significant difference in methylation between the normal and preterm premolar membranes, and genes that showed differential expression of genes (DEG) in both groups The correlation was analyzed. Also, GOterm analysis was performed using Gene set enrichment analysis (GSEA).

Example 7. Pyrosequencing

To amplify the methylation gene of the candidate gene, each designed primer was used to amplify the bisulfite pretreated DNA.

THBS2 forward primer: GGAGGTGGAGAGGAATTAGTAGGA (SEQ ID NO: 3)

THBS2 Reverse primer: AAACCTAACCCCAATACTTATCCTAAC (SEQ ID NO: 4)

ITGA11 Forward primer: GTATTTGTAGGTTTTTTTGGATTGATTGT (SEQ ID NO: 5)

ITGA11 Reverse primer: ATCCCTATTTAAAATACACACAAAAATTTC (SEQ ID NO: 6)

The PCR conditions were amplified using Surecycler-8800 (Agilent) at 95 ° C for 10 min, 45 cycles (30 sec at 95 ° C, 30 sec at 48 ° C, 30 sec at 72 ° C) and 5 min at 72 ° C. Biotin-conjugated amplification products were coupled to beads with binding buffer with streptavidin-sepharose beads for pyrosequencing analysis. The amplified product-bound streptavidin-sepharose beads were adsorbed on a PSQ 96 sample platel with a 96 magnetic ejectable microcylinder, denatured and washed. Then, a primer for base analysis [THBS2: GTTTTGTAGTATAAGTTTTTAGGG (SEQ ID NO: 7), ITGA11: TTGGTTTATATATTTGGTGA (SEQ ID NO: 8) , The beads were put into the annealing buffer and denatured at 80 DEG C for 2 minutes. At the room temperature, the quantitative methylation of normal and preterm premature ejaculation genes was verified using PyroMark ID (Qiagen) complementarily binding the base analyte and amplification products.

Example 8. Quantitative real-time PCR (qRT-PCR)

To investigate the expression levels of mRNAs of candidate genes that showed significant differences in methylation and mRNA profiling in normal and preterm infants. Total RNA was separated from amniotic membrane and blood, RNA QC was performed, and cDNA synthesis was performed. The oligonucleotide synthesized to amplify a specific site was used to analyze RNA expression of a candidate gene through qRT-PCR. The qRT-PCR conditions were 95 ° C for 10 minutes and then 40 cycles (95 ° C for 15 seconds, annealing temperature 62 ° C for 60 seconds, dissociation stage (95 ° C for 15 seconds, 62 ° C for 20 seconds, and 95 Lt; 0 &gt; C for 15 seconds). The primer sequences used are summarized in Table 1.

Type of primer The primer sequence (5 '- &gt; 3') PCR product size (bp) ITGA 11 Forward GGC GCT CAG CCT GTG G (SEQ ID NO: 9) 144 ITGA 11 Reverse CCC ACG ACC AGC CAC TTA TT (SEQ ID NO: 10) THBS2 Forward CCT YGC AAA TGG GTG TGA CG (SEQ ID NO: 11) 152 THBS2 Reverse AAA GCT GGG GAA GGA AGC TC (SEQ ID NO: 12)

Experiment result

The CpG site showed a statistically significant difference in methylation between amniotic membrane of the maternal group (n = 5) and normal group (n = 5) through the methylation array. The total CpG site was 1,255 CpG, The number of genes that showed significant mRNA expression in amniotic membrane of normal group was 1,500. Among these genes, there were 90 genes having a negative correlation. In addition, GSEA analysis of the above 90 genes revealed that ITGA11 and THBS2 genes were associated with premature birth. Table 2 shows the location of the CpG site showing significant methylation expression changes in adjusted and maternal mothers.

gene Genebank registration number Target ID chromosome CpG site ITGA11 NM_001004439 cg09430158 15 chr15: 68667977
THBS2
NM_003247.2
cg00438284
6 chr6: 169625596 (Position 1)
chr6: 169625604 (Position 2)
chr6: 169625613 (Position 3)

Amniotic membrane samples were further collected from normal pregnant women (n = 16) and premature pregnant women (n = 19) for ITGA11 and THBS2 genes, which showed significant methylation changes in maternal and normal maternal groups. , And the amount of gene expression was examined by qRT-PCR method to verify whether there was a negative correlation. As a result, it was confirmed that the ITGA11 and THBS2 genes were significantly hypomethylated in the premature group and the expression of the genes was significantly regulated (see FIGS. 1 and 2).

Blood samples were taken from normal (n = 13) and maternal (n = 17) pregnant women and methylation of the gene was performed via a methylation array in order to examine whether the pattern of methylation in amniotic membrane samples was the same in blood samples And whether they were related to preterm delivery. As a result, it was confirmed that the ITGA11 gene was significantly hypomethylated and the mRNA expression level was significantly regulated (up regulation) in the blood of the premature-mothers mother in the normal group, as in the amniotic membrane sample (see FIG. 3 ).

Therefore, it was confirmed that significant methylation changes of ITGA11 and THBS2 genes were related to maternal preterm birth and could be used to predict preterm birth.

<110> Ewha University - Industry Collaboration Foundation <120> ITGA11 and / or THBS2 as CpG methylation markers for predicting a          risk of preterm delivery and use thereo <130> DPP20165225 <150> KR10-2016-0090182 <151> 2016-07-15 <160> 12 <170> Kopatentin 1.71 <210> 1 <211> 722 <212> DNA <213> Homo sapiens <220> <221> gene <222> (1) 722 <223> chr15: 68667617-68668338 <400> 1 taggggcatc agggaggggt ttcactggag gagccgagag ctcgagggaa caaaggagag 60 attattcctt tagtgaggcc tttctctccc tctctctcca tggaaaatgg aatctcctcc 120 agcccctgtg agtttggtgg ctaatgggtt caagatgggt ctggggaagc gctgagagca 180 gcaagtccaa atgcctgccc agtggggacc ccggggctgc cctggctggg ggttgggtgt 240 agatggagaa tctggcccag gacctgccca aggggagaag ttggcacctg caggtcttcc 300 tggactgact gcaggggctt gtggttcacc ttggctcaca catctggtga ggcctggcct 360 cgtgggggct agggaaacga gagcccctct gtttgcacat cccttactct ccctccataa 420 agtcctatca gacactggaa acctttgtgt gcattttaaa cagggacata tacatgatga 480 ttaattttat gtgtcaactt gactgggcca cggggtgcct agatatatgg ccaaacgtca 540 ttctgggtgt ttctgtgagg gtgttttttg catgagatta acacttagat ctgtaggcta 600 aggaaagcaa atcacccttc ctaatgtggg tgggcctcat ccaatcagtc gaagggcaga 660 acagaacaaa atgactgacc ctcccttgag aaagagaatt ctccctggac cctaccccag 720 ac 722 <210> 2 <211> 722 <212> DNA <213> Homo sapiens <220> <221> gene <222> (1) 722 <223> chr6: 169625244-169625965 <400> 2 caagtcctcc tggtctgggt tgaacacaag ccggcagttg tccctgtcat cggggacgcc 60 atcgttgtca tcatcagggt cacaggcgtc gccctggccg tctctgtcat ggtcagcctg 120 gttggcgttg gagatgtagg ggcagttgtc ctggttgttc tggtggccgt cgtcatctat 180 gtcctcgttg ttgtcacact ggtccccaac aaggtcattg tccacgtcgg tctaggggat 240 ggggcgtgag agaaacagca gaggactgcc agtttgagga ggtggagagg aaccagcagg 300 acgcaagcct gagagccggc ctcctcgtcc tgcagcacaa gccccagggc cacgcagggg 360 cggctggccc gaggtcacac tgaccctgac gtcaggacaa gcactggggc caggcctctc 420 ggtccaggaa tctctccacc ctctgccacc tctccacagt aattcacttc actaaaggaa 480 gatgtgcttc ttcgctggaa aagcatgaac taccaggtaa ttatgtctct tttttacacc 540 atttgcgcca tttacaccat ttacatcata ggataatata tcctatgagc tgcatcaaga 600 taactgtcct cccttgtctc tttcaaacgc aaacctggaa atgaagccaa ttcctatgtt 660 ggcatcagga aaatggggag agaattctgt gaagacacaa cctcgctcca gctgatgagg 720 tg 722 <210> 3 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> THBS2 Forward primer <400> 3 ggaggtggag aggaattagt agga 24 <210> 4 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> THBS2 Reverse primer <400> 4 aaacctaacc ccaatactta tcctaac 27 <210> 5 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> ITGA11 Forward primer <400> 5 gtatttgtag gtttttttgg attgattgt 29 <210> 6 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> ITGA11 Reverse primer <400> 6 atccctattt aaaatacaca caaaaatttc 30 <210> 7 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> THBS2 primer <400> 7 gttttgtagt ataagtttta ggg 23 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ITGA11 primer <400> 8 ttggtttata tatttggtga 20 <210> 9 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> ITGA11 Forward primer <400> 9 ggcgctcagc ctgtgg 16 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ITGA11 Reverse primer <400> 10 cccacgacca gccacttatt 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> THBS2 Forward primer <400> 11 cctygcaaat gggtgtgacg 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> THBS2 Reverse primer <400> 12 aaagctgggg aaggaagctc 20

Claims (13)

A composition for diagnosing premature labor, comprising an agent for measuring the methylation level of the CpG region of at least one gene selected from the group consisting of ITGA11 (Integrin alpha-11) and THBS2 (Thrombospondin-2)
The agent for measuring the methylation level of the CpG region of the above-
Compounds or methylation sensitive restriction enzymes that modify unmethylated cytosine bases;
A primer specific for the methylated sequence of the CpG region of the gene; And
RTI ID = 0.0 &gt; unmethylated &lt; / RTI &gt; sequences.
Compositions for the diagnosis of premature rupture. delete 2. The composition of claim 1, wherein the compound that modifies the unmethylated cytosine base is bisulfite or a salt thereof. The composition of claim 1, wherein the methylation sensitive restriction enzyme is Sma I, Sac II, Eag I, Hpa II, Msp I, Bss HII, Bst UI or Not I. The composition according to claim 1, wherein the CpG site of the ITGA11 gene comprises CpG which appears in the nucleotide sequence of SEQ ID NO: 1 (68667617 to 68668338th of chromosome 15). The composition according to claim 1, wherein the CpG site of the THBS2 gene comprises CpG that appears in the nucleotide sequence of SEQ ID NO: 2 (169625244 to 169625965 th of chromosome 6). 7. A composition comprising a composition according to any one of claims 1 and 6 to 6,
Diagnostic kit for prematurity risk. Measuring the methylation level of the CpG region of at least one gene selected from the group consisting of ITGA11 and THBS2 from the maternal sample;
How to provide information necessary to diagnose premature rupture. 9. The method according to claim 8, wherein the step of measuring the methylation level of the CpG region of the gene comprises:
Treating the genomic DNA in the obtained sample with a compound or methylation-sensitive restriction enzyme that modifies the unmethylated cytosine base; And
The DNA thus processed is subjected to methylation-specific polymerase chain reaction and real-time methylation-specific polymerase chain reaction (PCR) using a primer capable of amplifying the methylation site of the gene CpG region reaction, PCR using methylated DNA-specific binding protein, quantitative PCR, pyrosequencing, and bisulfite sequencing to determine the methylation level. 10. The method of claim 9, wherein the compound that modifies the unmethylated cytosine base is bisulfite or a salt thereof. 10. The method of claim 9, wherein the methylation sensitive restriction enzyme is SmaI, SacII, EagI, HpaII, MspI, BssHII, BstUI or NotI. 9. The method according to claim 8, wherein the CpG site of the ITGA11 gene comprises CpG which appears in the nucleotide sequence of SEQ ID NO: 1 (68667617 to 68668338th of chromosome 15). 9. The method according to claim 8, wherein the CpG site of the THBS2 gene comprises CpG that appears in the nucleotide sequence of SEQ ID NO: 2 (169625244 to 169625965 th of chromosome 6).

Images