KR101704121B1 - Biomarker composition for discrimination of vancomycin heteroresistant Staphylococcus aureus ST5 clone type and discrimitic kit using the same - Google Patents

Abstract

The present invention relates to a biomarker composition for discrimination of vancomycin heterogeneous resistant Staphylococcus aureus (hVISA) ST5 clone type comprising at least one gene mutation selected from the group consisting of spa and lpl6, and a kit for use therefor, (HVISA) ST5 clone type, and using the acquired gene mutation as a biomarker composition for hVISA ST5 clone type discrimination, the hVISA ST5 clone type The patient can be promptly and accurately treated. Also, it can be used very usefully because it can develop a hint for clone type identification of hVISA ST5.

Description

TECHNICAL FIELD [0001] The present invention relates to a biomarker composition for discriminating heterozygous vancomycin-resistant Staphylococcus aureus ST5 clones, and a kit for identifying the same. [0001] The present invention relates to a biomarker composition for discriminating vancomycin heterozygous Staphylococcus aureus ST5 clone type and discrimination kit using the same,

The present invention relates to a biomarker composition for the determination of ST5 clone type of heteroresistant vancomycin-intermediate Staphylococcus aureus (hereinafter referred to as hVISA) using a gene mutation obtained by sequencing whole genomes of vancomycin heterogeneous resistant Staphylococcus aureus And a discriminating kit using the same.

Methicillin-resistant Staphylococcus aureus is one of the most important hospital infections in hospitals around the world. Although vancomycin has been extensively used in clinical practice due to the spread of hospital infections caused by MRSA worldwide, MRSA has been increasingly susceptible to vancomycin, making it difficult to treat patients.

Heterologous resistant vancomycin intermediate staphylococcus (heteroresistant vancomycin intermediate staphylococcus aureus ; Hereinafter, hVISA refers to the case where a typical vancomycin MIC belongs to the susceptibility category, but a strain group having MIC ≥ 4 mg / L is included because the vancomycin-resistant individual exists.

In order to detect hVISA, standard diagnosis method called population analysis profiling (PAP) should be performed. Although this method takes a lot of time, it is found that the specificity is not high. Therefore, it is required to develop an appropriate diagnostic method to detect hVISA accurately and quickly.

The frequency and clone types of hVISA have been reported by research institutes, regions, countries and periods in 23 countries, and hVISA indicates that studies should be conducted to reflect regional and country differences. Therefore, the researchers found that the strain of hVISA isolated from Korea was more than 80% of the ST5 clone type commonly found in medical institutions, followed by the ST72 clone type in community infection.

Accordingly, the present inventors have found that hVISA can be diagnosed using a combination of genetic mutations, by identifying mutations of a target gene which is hVISA by selecting the hVISA strains and analyzing the nucleotide sequence of the whole genome.

Korean Patent Laid-Open No. 10-2001-0022777 discloses a genetic assay kit for screening for vancomycin-resistant bacteria. The genetic assay kit for selecting strains resistant to vancomycin and the assay kit for vancomycin resistance However, there is no mention of a group of genes showing different expression by vancomycin resistance in S. aureus of the present invention.

As described above, the present invention provides a biomarker for identifying a ST5 clone type among vancomycin heterogeneous resistant yellow staphylococci by specifically identifying a gene mutation obtained through sequence analysis of whole genome of vancomycin heterogeneous resistant Staphylococcus aureus And a kit for use thereof.

The present invention provides a biomarker composition for discriminating vancomycin heterogeneous resistant Staphylococcus aureus strain ST5 clone using spa or lpl6 gene mutation.

The present invention provides a method for determining ST5 clone type of vancomycin heterogeneous resistant Staphylococcus aureus using the spa or lpl6 gene mutation.

The present invention also provides a vancomycin heterogeneous resistant Staphylococcus aureus (hVISA) ST5 clone type discrimination kit comprising a primer set capable of amplifying a vancomycin heterogeneous resistant Staphylococcus aureus ST5 clone type biomarker.

The present invention relates to a method for screening a genetic mutation specifically expressed in ST5 clone type of vancomycin heterogeneous resistant Staphylococcus aureus (hVISA) and using the obtained mutation as a biomarker composition for identifying hVISA ST5 clone type, By identifying the hVISA ST5 clone type, rapid and accurate treatment is possible for the patient. Also, it is very useful to develop a clone type discrimination kit for hVISA ST5.

The present invention provides a biomarker composition for discriminating vancomycin heterologous vancomycin intermediate Staphylococcus aureus (hVISA) ST5 clone type comprising the mutated spa gene described in SEQ ID NO: 1.

Specifically, the mutated spa gene described in SEQ ID NO: 1 may have the 870th base of the above sequence when compared to the spa gene.

In addition, the present invention provides a biomarker composition for the vancomycin heterogeneous resistant Staphylococcus aureus (hVISA) ST5 clone type identification comprising the amino acid sequence of the spa protein of SEQ ID NO: 2.

Specifically, the amino acid sequence of the spa protein of SEQ ID NO: 2 may be a lysine of the 290th amino acid sequence of the sp protein when compared to the amino acid sequence of the spa protein.

In addition, the present invention provides a biomarker composition for the vancomycin heterogeneous resistant Staphylococcus aureus (hVISA) ST5 clone type discrimination comprising the mutant lpl6 gene of SEQ ID NO: 3.

Specifically, the mutant lpl6 gene of SEQ ID NO: 3 may be a mutant mutant of the 183rd T base of the mutant lpl6 gene of SEQ ID NO: 4.

In addition, the present invention provides a method for detecting DNA comprising the steps of: extracting DNA from a sample; Detecting the mutated spa gene of SEQ ID NO: 1 or the mutated lpl6 gene of SEQ ID NO: 3 from the DNA extracted from the sample; And confirming the detected mutant gene. The present invention also provides a method for identifying a vancomycin heterogeneous resistant Staphylococcus aureus (hVISA) ST5 clone type.

The step of detecting the vancomycin heterogeneous resistant Staphylococcus aureus (hVISA) marker can be performed by DNA sequencing analysis, hybridization by microarray, allele specific PCR, dynamic allele hybridization, PCR-SSCP analysis, RELP analysis , TaqMan analysis, or DNA chip analysis.

The present invention also relates to a vancomycin heterogeneous resistant Staphylococcus aureus (hVISA) ST5 clone type discrimination kit comprising a primer set capable of amplifying the vancomycin heterogeneous resistant Staphylococcus aureus (hVISA) ST5 clone type biomarker to provide.

In addition to the primer set capable of amplifying the discriminating marker of the present invention, the above-mentioned discriminating kit may contain a reagent necessary for the polymerization reaction, for example, dNTP, various kinds of polymerase and coloring agent.

The term " amplifiable primer " refers to a template-directed DNA synthesis under appropriate conditions in an appropriate buffer (e.g., four different nucleoside triphosphates and a polymerase such as DNA, RNA polymerase or reverse transcriptase) Quot; oligonucleotide " The appropriate length of the primer may vary depending on the intended use, but is usually 15 to 30 nucleotides. Short primer molecules generally require a lower temperature to form a stable hybrid with the template. The primer sequence need not be completely complementary to the template, but should be sufficiently complementary to hybridize with the template.

BEST MODE FOR CARRYING OUT THE INVENTION Hereinafter, the present invention will be described in detail with reference to the following examples. However, the following examples are intended to illustrate the contents of the present invention, but the scope of the present invention is not limited to the following examples. Embodiments of the present invention are provided to more fully describe the present invention to those skilled in the art.

< Example  1> Selection of research subjects

All genomic sequence analysis of vancomycin susceptible strains isolated from the same patient and hVISA strains exhibiting vancomycin heterogeneous resistance were performed to compare the ST5 and ST72 strains, which are representative clone types of hVISA strains in Korea, to select mutations of target genes .

< Example  2> Gene group showing gene mutation by vancomycin resistance

One. hVISA ST5  Genes that exhibit gene mutations due to vancomycin resistance in clonal strains

Comparison of two pairs of ST5 strains revealed gene target mutations as shown in Table 1.

Genetic variation when hVISA is expressed in ST5 strain ST Isogenic paired strain Gene VSSA hVISA Mutation description ST5




























407 (VSSA)
437 (hVISA)














SA0020 CAAT - Del 심포치 kdpC T - Del 심포치 spa

C A N290K immunoglobulin G binding protein A

G A G289D G A G289S lpl6 T - Del 심포치 SA1787
T C L69L 심포치
A T L69I SA1789


G A R55R 심포치


C T R55H G T R55S C T E54E SA1791 T C T162A 심포치 SA1794
T C Q100Q 심포치
C T D97N SAS063 T G K3N 심포치 2030 (VSSA)
2039 (hVISA)












SA0020 T A S171T 심포치 spa C A N290K immunoglobulin G binding protein A lpl6 T - Del 심포치 sdrE C T S1052S Ser-Asp rich fibinogen-binding,
bone sialoprotein-binding protein clfA


C T S757S fibinogen-binding protein A,
클링 faktör

T C D758D A C S761S C T D762D SA1247 - TTATCAATTGTAATAC In truncated (response regulator ArlR) SA1269 A G I343I major facilitator superfamily transporter SA1317 G A G100G 심포치 SA1787 G A A79V 심포치 SA1794 C T E4K 심포치 crtM T A Q102H 스칼레 인 synthase

As a result, a number of genes were hypothetical proteins with unknown function, and were identified as spa and lpl6 as the mutated genes when hVISA was introduced in two pairs of ST5.

In the case of spa, the 290th amino acid was substituted with lysine (Iysin, K) in asparagin (N) and the deletion mutation was observed in asparagin (N), the 61st amino acid in the lpl6 gene.

In addition, in the case of spa, SA1787 and SA1789, amino acid substitution at a specific position frequently occurs, and it is expected to be a main site of a gene target for diagnosis of hVISA.

2. hVISA ST72  Genes that exhibit gene mutations due to vancomycin resistance in clonal strains

Two pairs of ST72 strains were compared and the gene target mutation appeared as shown in Table 2.

Genetic variation when hVISA is expressed in ST72 strain ST Isogenic paired strain Gene VSSA hVISA Mutation description ST
72








407 (VSSA)
437 (hVISA)
SAKOR
_01962 GTTGATGTTTGACTGATGTTGTTTTGATGTTGG - Del Phage protein SAKOR
_01989 - T In Tetracenomycin polyketide synthesis O-methyltransferase tcmP 1577 (VSSA)
1599 (hVISA)






SAKOR
_00550
T C S1226S Fibronectin-binding protein SdrD
T C S1228S SAKOR
_00575 GC - Del Threonine / Serine Exporter SAKOR
_00786 T - Del 심포치 SAKOR
_00918 T - Del Putative cytosolic protein SAKOR
_01022 GGG - Del Spermidine / putrescine transport system permease protein pot8 SAKOR
_01891 A - Del Transposase SAKOR
_02393 GGAC - Del Multidrug resistance protein B

As a result, compared with ST5, the frequency of gene mutation was lower in ST72 than in ST5, and a large number of gene deletion mutations were found in most cases. However, a gene target commonly found when two ST72 strains were hVISA was found And no mutations in the spa and lpl6 genes identified in the ST5 strain were observed.

BEST MODE FOR CARRYING OUT THE INVENTION Hereinafter, the present invention will be described in detail with reference to the following examples. However, the following examples are intended to illustrate the contents of the present invention, but the scope of the present invention is not limited to the following examples. Embodiments of the present invention are provided to more fully describe the present invention to those skilled in the art.

<110> University of Ulsan Foundation for Industry Cooperation <120> Biomarker composition for discrimination of vancomycin          heteroresistant Staphylococcus aureus ST5 clone type and          discrimitic kit using the same <130> ADP-2014-0414 <160> 4 <170> Kopatentin 2.0 <210> 1 <211> 1353 <212> DNA <213> SPA <400> 1 ttgaaaaaga aaaacattta ttcaattcgt aaactaggtg taggtattgc atctgtaact 60 ttaggtacat tacttatatc tggtggcgta acacctgctg caaatgctgc gcaacacgat 120 gaagctcaac aaaatgcttt ttatcaagtg ttaaatatgc ctaacttaaa cgctgatcaa 180 cgtaatggtt ttatccaaag ccttaaagat gatccaagcc aaagtgctaa cgttttaggt 240 gaagctcaaa aacttaatga ctctcaagct ccaaaagctg atgcgcaaca aaataacttc 300 aacaaagatc aacaaagcgc cttctatgaa atcttgaaca tgcctaactt aaacgaagcg 360 caacgtaacg gcttcattca aagtcttaaa gacgacccaa gccaaagcac taatgtttta 420 ggtgaagcta aaaaattaaa cgaatctcaa gcaccgaaag ctgataacaa tttcaacaaa 480 gaacaacaaa atgctttcta tgaaatcttg aatatgccta acttaaacga agaacaacgc 540 aatggtttca tccaaagctt aaaagatgac ccaagccaaa gtgctaacct attgtcagaa 600 gctaaaaagt taaatgaatc tcaagcaccg aaagcggata acaaattcaa caaagaacaa 660 caaaatgctt tctatgaaat cttacattta cctaacttaa acgaagaaca acgtaacggc 720 ttcatccaaa gccttaaaga cgatccttca gtgagcaaag aaattttagc agaagctaaa 780 aagctaaacg atgctcaagc accaaaagag gaagacaaca aaaaacctgg taaagaagac 840 ggcaacaaac ctggcaaaga agacggcaaa aagcctggta aagaagacaa caaaaaacct 900 ggtaaagaag acggcaacaa gcctggtaaa gaagacaaca acaaacctgg caaagaagac 960 ggcaacaagc ctggtaaaga agacaacaac aagcctggta aagaagacgg caacaagcct 1020 ggtaaagaag acggcaacaa acctggtaaa gaagacggca acggagtaca tgtcgttaaa 1080 cctggtgata cagtaaatga cattgcaaaa gcaaacggca ctactgctga caaaattgct 1140 gcagataaca aattagctga taaaaacatg atcaaacctg gtcaagaact tgttgttgat 1200 aagaagcaac cagcaaacca tgcagatgct aacaaagctc aagcattacc agaaactggt 1260 gaagaaaatc cattcatcgg tacaactgta tttggtggat tatcattagc cttaggtgca 1320 gcgttattag ctggacgtcg tcgcgaacta taa 1353 <210> 2 <211> 450 <212> PRT <213> SPA <400> 2 Met Lys Lys Lys Asn Ile Tyr Ser Ile Arg Lys Leu Gly Val Gly Ile   1 5 10 15 Ala Ser Val Thr Leu Gly Thr Leu Leu Ile Ser Gly Gly Val Thr Pro              20 25 30 Ala Ala Asn Ala Ala Gln Asp Ala Gln Asn Ala Phe Tyr          35 40 45 Gln Val Leu Asn Met Pro Asn Leu Asn Ala Asp Gln Arg Asn Gly Phe      50 55 60 Ile Gln Ser Leu Lys Asp Asp Ser Ser Gln Ser Ala Asn Val Leu Gly  65 70 75 80 Glu Ala Gln Lys Leu Asn Asp Ser Gln Ala Pro Lys Ala Asp Ala Gln                  85 90 95 Gln Asn Asn Phe Asn Lys Asp Gln Gln Ser Ala Phe Tyr Glu Ile Leu             100 105 110 Asn Met Pro Asn Leu Asn Glu Ala Gln Arg Asn Gly Phe Ile Gln Ser         115 120 125 Leu Lys Asp Asp Ser Ser Gln Ser Thr Asn Val Leu Gly Glu Ala Lys     130 135 140 Lys Leu Asn Glu Ser Gln Ala Pro Lys Ala Asp Asn Asn Phe Asn Lys 145 150 155 160 Glu Gln Gln Asn Ala Phe Tyr Glu Ile Leu Asn Met Pro Asn Leu Asn                 165 170 175 Glu Glu Gln Arg Asn Gly Phe Ile Gln Ser Leu Lys Asp Asp Pro Ser             180 185 190 Gln Ser Ala Asn Leu Leu Ser Glu Ala Lys Lys Leu Asn Glu Ser Gln         195 200 205 Ala Pro Lys Ala Asp Asn Lys Phe Asn Lys Glu Gln Gln Asn Ala Phe     210 215 220 Tyr Glu Ile Leu His Leu Pro Asn Leu Asn Glu Glu Gln Arg Asn Gly 225 230 235 240 Phe Ile Gln Ser Leu Lys Asp Asp Pro Ser Val Ser Lys Glu Ile Leu                 245 250 255 Ala Glu Ala Lys Lys Leu Asn Asp Ala Gln Ala Pro Lys Glu Glu Asp             260 265 270 Asn Lys Lys Pro Gly Lys Glu Asp Gly Asn Lys Pro Gly Lys Glu Asp         275 280 285 Gly Lys Lys Pro Gly Lys Glu Asp Asn Lys Lys Pro Gly Lys Glu Asp     290 295 300 Gly Asn Lys Pro Gly Lys Glu Asp Asn Asn Lys Pro Gly Lys Glu Asp 305 310 315 320 Gly Asn Lys Pro Gly Lys Glu Asp Asn Asn Lys Pro Gly Lys Glu Asp                 325 330 335 Gly Asn Lys Pro Gly Lys Glu Asp Gly Asn Lys Pro Gly Lys Glu Asp             340 345 350 Gly Asn Gly Val His Val Val Lys Pro Gly Asp Thr Val Asn Asp Ile         355 360 365 Ala Lys Ala Asn Gly Thr Thr Ala Asp Lys Ile Ala Ala Asp Asn Lys     370 375 380 Leu Ala Asp Lys Asn Met Ile Lys Pro Gly Gln Glu Leu Val Val Asp 385 390 395 400 Lys Lys Gln Pro Ala Asn His Ala Asp Ala Asn Lys Ala Gln Ala Leu                 405 410 415 Pro Glu Thr Gly Glu Glu Asn Pro Phe Ile Gly Thr Thr Val Phe Gly             420 425 430 Gly Leu Ser Leu Ala Leu Gly Ala Ala Leu Ala Gly Arg Arg Arg         435 440 445 Glu Leu     450 <210> 3 <211> 288 <212> DNA <213> lpl6 <400> 3 atgatgggtt atttaaaaag acttgtattg tacatagtta ttatggttat gagtgttttt 60 ataataggtt gtgataaatc aagcgatact gcagaaaatc caaaagaagg ttcaaaagaa 120 gcacaaatta aaaagagttt ttcgaaaacg ttagatatgt atccaattaa gaatctcgag 180 aactatatga caaagaagga tatcgtgatg gcgaatttaa aaaaggtgat aaagggactt 240 ggacaatatc aacagatttt gctaaaagca acaagcaagg tgaaatga 288 <210> 4 <211> 795 <212> DNA <213> lpl6 <400> 4 atgatgggtt atttaaaaag acttgtattg tacatagtta ttatggttat gagtgttttt 60 ataataggtt gtgataaatc aagcgatact gcagaaaatc caaaagaagg ttcaaaagaa 120 gcacaaatta aaaagagttt ttcgaaaacg ttagatatgt atccaattaa gaatctcgag 180 aatctatatg acaaagaagg atatcgtgat ggcgaattta aaaaaggtga taaagggact 240 tggacaatat caacagattt tgctaaaagc aacaagcaag gtgaaatgaa tagcgaaggt 300 atggtactac attttaatag aaatacgagg acagcaacag gatattatac tgtaagaaca 360 acttatgatg aagtggataa gttggcacgc gaaaaaaaat atcgtgttga atttaaaaac 420 aataagatag ttctattgga caaagtagaa gatgaaaatc ttaaacaaaa aatagaaaat 480 tttaaatttt tcgggcaata tgccgatttt aaagacttga aaaattataa aaatggaaga 540 atatctagca atgaaaatgt tccttattat gaagcagagt acaaaaggaa taatagtgat 600 ggaaatgtaa aaaaacttag agaaaagtac ccaattacaa ccaagcagtc tccaatatta 660 aaactgcata tagacggcga tattaaaggt agctcagttg gatataaaca gatagaatac 720 acattttcta aggagaaaga tgatgagact tttatgagtg attttttgaa cttcggtcca 780 tcacacagta aatag 795

Claims (8)

A biomarker composition for the determination of ST5 clone type heteroresistant vancomycin intermediate Staphylococcus aureus (hVISA) ST5 containing the mutated spa gene described in SEQ ID NO: 1. 2. The transgenic non-homologous yellow staphylococcus (hVISA) ST5 clone type strain according to claim 1, wherein the mutated spA gene of SEQ ID NO: 1 is A in the sequence of SEQ ID NO: Biomarker composition for discrimination. (HVISA) ST5 clone type identifying biomarker composition comprising the amino acid sequence of the spa protein described in SEQ ID NO: 2. 4. The method according to claim 3, wherein the amino acid sequence of the spa protein of SEQ ID NO: 2 is vancomycin heterologous-resistant yellow staphylococcus (hVISA), which is lysine at the 290th amino acid of the sequence, ST5 clone type biomarker composition for discrimination. (HVISA) ST5 clone type identifying biomarker composition comprising the mutant lpl6 gene described in SEQ ID NO: 3. [Claim 7] The mutant lpl6 gene of claim 5, wherein the 183 &lt; th &gt; T base of the non-mutant lpl6 gene of SEQ ID NO: ST5 clone type biomarker composition. Extracting DNA from the sample;
Detecting the mutated spa gene of SEQ ID NO: 1 or the mutated lpl6 gene of SEQ ID NO: 3 from the DNA extracted from the sample; And
(HVISA) ST5 clone type identification method comprising the step of identifying the mutated gene. A vancomycin heterogeneous resistant Staphylococcus aureus (hVISA) ST5 clone type discrimination kit comprising a primer set capable of amplifying the vancomycin heterogeneous resistant Staphylococcus aureus ST5 clone type identifying biomarker of claim 1 or 5.