KR101513766B1 - DNA Aptamer Specifically Binding to Alpha-fetoprotein and Its Use - Google Patents

DNA Aptamer Specifically Binding to Alpha-fetoprotein and Its Use Download PDF

Info

Publication number
KR101513766B1
KR101513766B1 KR1020110012878A KR20110012878A KR101513766B1 KR 101513766 B1 KR101513766 B1 KR 101513766B1 KR 1020110012878 A KR1020110012878 A KR 1020110012878A KR 20110012878 A KR20110012878 A KR 20110012878A KR 101513766 B1 KR101513766 B1 KR 101513766B1
Authority
KR
South Korea
Prior art keywords
afp
dna
dna aptamer
aptamer
binding
Prior art date
Application number
KR1020110012878A
Other languages
Korean (ko)
Other versions
KR20120092938A (en
Inventor
김양훈
엄현주
연승용
Original Assignee
충북대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 충북대학교 산학협력단 filed Critical 충북대학교 산학협력단
Priority to KR1020110012878A priority Critical patent/KR101513766B1/en
Publication of KR20120092938A publication Critical patent/KR20120092938A/en
Application granted granted Critical
Publication of KR101513766B1 publication Critical patent/KR101513766B1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
    • C12Q1/6837—Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/16—Aptamers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2525/00—Reactions involving modified oligonucleotides, nucleic acids, or nucleotides
    • C12Q2525/10—Modifications characterised by
    • C12Q2525/205—Aptamer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/118—Prognosis of disease development

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • Immunology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Pathology (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)
  • Plant Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 AFP(Alpha-fetoprotein)에 특이적으로 결합할 수 있는 DNA 앱타머와 이의 용도에 관한 것이다. 본 발명의 DNA 앱타머는 간암 또는 생식세포종양의 마커 단백질인 AFP와 특이적으로 결합하는 특성을 갖는다. 따라서, 본 발명의 DNA 앱타머는 AFP의 검출 용도 뿐만 아니라, AFP의 수준을 측정함으로써, 간암 및 생식세포종양의 진단 또는 예후 판단 용도로 사용될 수 있다. 본 발명의 DNA 앱타머는 간암 진단에 활용되고 있는 AFP 결합 항체를 대체할 수 있으며, 간암 및 생식세포종양을 보다 신속하고 경제적으로 진단할 수 있을 것으로 기대된다. The present invention relates to a DNA aptamer capable of specifically binding to AFP (Alpha-fetoprotein) and its use. The DNA aptamer of the present invention has the property of specifically binding to AFP which is a marker protein of liver cancer or germ cell tumor. Therefore, the DNA aptamer of the present invention can be used not only for the detection of AFP but also for the purpose of diagnosing liver cancer and germ cell tumors or determining prognosis by measuring the level of AFP. The DNA aptamer of the present invention can replace the AFP-binding antibody used for the diagnosis of liver cancer and is expected to diagnose liver cancer and germ cell tumor more rapidly and economically.

Description

알파태아단백질에 특이적으로 결합하는 ＤＮＡ 앱타머 및 이의 용도{DNA Aptamer Specifically Binding to Alpha-fetoprotein and Its Use} DNA Aptamer Specifically Binding to Alpha Fetoprotein and Its Use Thereof [

본 발명은 알파태아단백질(AFP, Alpha-fetoprotein)에 특이적으로 결합하는 DNA 앱타머 및 이의 용도에 관한 것이다. 보다 상세하게는, 본 발명은 AFP에 특이적으로 결합하는 DNA 앱타머(aptamer), 상기 DNA 앱타머를 유효성분으로 포함하는 AFP(Alpha-fetoprotein) 검출용 키트, 상기 DNA 앱타머를 유효성분으로 포함하는 간암 또는 생식세포종양의 진단 또는 예후판단용 조성물, 상기 DNA 앱타머가 기판상에 고정된 간암 또는 생식세포종양의 진단 또는 예후판단용 마이크로어레이, 간암 또는 생식세포종양의 진단 또는 예후판단에 필요한 정보를 제공하기 위해 환자의 생물학적 시료로부터 상기 DNA 앱타머와 AFP(Alpha-fetoprotein)와의 결합반응을 통해 AFP를 검출하는 방법 및 AFP가 포함된 시료로부터 AFP(Alpha-fetoprotein)를 분리 및 정제하는 방법에 관한 것이다.
The present invention relates to a DNA aptamer that specifically binds to alpha-fetoprotein (AFP) and uses thereof. More particularly, the present invention relates to a DNA aptamer specifically binding to AFP, an AFP (Alpha-fetoprotein) detection kit comprising the DNA aptamer as an active ingredient, a DNA aptamer A microarray for determining the diagnosis or prognosis of liver cancer or germ cell tumor fixed on a substrate, a composition for determining the diagnosis or prognosis of liver cancer or germ cell tumor, A method of detecting AFP through binding reaction of DNA aptamer with AFP (Alpha-fetoprotein) from a biological sample of a patient to provide information, and a method of separating and purifying AFP (Alpha-fetoprotein) from a sample containing AFP .

전 세계적으로 간암은 발병률이 네 번째로 높은 암 질환이며, 매우 높은 사망률을 나타낸다. 현재 간암은 국내 암 질환 발생 순위 중 3위에 랭크되어 있으며, 이로 인한 사망률은 2위에 랭크되어 있다. 이 처럼 간암은 국내에서 흔히 발병되는 질환일 뿐만 아니라, 질환 발생 시 사망으로 직결되는 위험한 질환이다. 2007년 기준 국내 간암 환자는 전체 161,920명의 암환자 중 14,924명을 차지하고 있을 정도로 발생률이 높으며, 연간 인구 10만 명당 22.7명이 간암으로 사망할 정도로 국민건강을 위협하고 있다. 국립암센터의 주요 암의 생존율 통계에 따르면 간암 발병 후 5년 내 생존율은 18.9％로 주요 암 중에서도 생존율이 매우 낮은 암에 속하며, 간암 1기 발견 시 생존율은 50％로 높아지지만, 재발률이 40-80％ 정도로 예후가 불량하여, 초기 진단 및 재발 진단을 통한 질환 관리가 절실하다. 간암의 주요 발병 원인 인자는 HBV (Hepatitis B Virus : B형 간염 바이러스), HCV (Hepatitis C virus : C형 간염바이러스), Aflatoxin인 것으로 알려져 있으며, 알코올 섭취 및 흡연으로 인한 다양한 종류의 화학 물질 흡수, 비만, 경구 피임약 복용, 음용수에 의한 비소 섭취 등의 환경적 인자 등에 의해서도 발병하는 것으로 알려져 있다. 간암은 조기에 혈관 침습을 일으켜 성장 속도가 빠르며, 간암 환자의 약 73-85％는 간 경변 등의 합병증을 동반하고 있어 치료가 매우 어렵다. 뿐만 아니라 간암은 초기 단계에선 특이적인 자각증상이 없이 진행되기 때문에 자각 증상이 발견된다면 이미 병이 많이 진행된 상태로 치료가 어려운 경우가 많다. 현재 간암에 대한 가장 좋은 치료방법은 간 이식과 수술적 절제술 방법이 있다. 하지만 간 이식 방법은 생존율이 매우 높은 편이지만 공여자를 구하기 어렵다는 단점이 있으며, 수술적 간 절제 방법은 긴 생존 기간을 유지할 수 있지만 수술 대상이 될 수 있는 환자가 20％ 이내로 매우 제한적으로 시행될 수 있는 치료 방법으로 알려져 있다. 따라서 간암에 대처하는 최선의 방법은 조기 발견을 통한 화학적 치료 방법 및 간단한 수술적 방법을 이용한 치료가 가장 바람직한 것으로 알려져 있다. 이에 현재 우리나라에서는 간암을 조기 진단하기 위하여 침습적 방법인 간 조직 검사, 비침습적 방법인 영상 및 혈청학적인 검사 등 다양한 검사방법이 활용되고 있다. 현재 혈청학적인 검사를 통한 간암 조기 진단을 위해 간암 마커인 AFP (Alpha-fetoprotein : 알파 태아 단백질)를 이용하고 있다. AFP는 태아의 간조직이나 소화기관에서 만들어지는 혈청 단백질로 출생 후 급격히 감소하여 혈액 내 10 ng/㎖ 정도의 농도로 존재하는 단백질이다. 하지만 간염, 간경변증, 간 종양, 간 내 전이된 암 등등 다양한 간 질환의 발생 시 혈액 내 AFP 수치가 급격히 증가하여 간암 진단 마커로 활용되고 있다. 특히, 혈액 내 AFP 농도가 16-20 ng/㎖ 이상으로 증가하는 경우, 이를 이용한 간 이상에 대한 탐지 정도는 60-62.4％ 이상의 민감도를 가지고 간의 이상을 확인할 수 있으며, 89.4-90.6％ 이상의 특이도를 가지고 있는 것으로 알려져 있다. 특히 혈액 내 AFP 농도가 400-500 ng/ml 이상인 경우는 간암을 의심해야 한다. 이와 같은 특징 때문에 AFP 수치 변화는 간암 치료 결과 및 예후 판정에 활용하기 적합한 바이오 마커로 주목되고 있다. 현재 혈액 내 AFP 수치 측정은 AFP 항체를 이용한 효소결합 면역 흡착법 (Enzyme-Linked Immunosorbent Assay: ELISA), 면역크로마토그래피법 (immunochromatographic assay)이 이용되고 있다. 하지만 이와 같은 기법들의 기반이 되는 AFP 항체는 동물 실험을 동반하기 때문에 자유로운 생산, 정제, 변형에 어려움이 있으며, 단백질로 주변 pH, 온도 등에 대한 안정성 확보에도 어려움이 있다. 뿐만 아니라, AFP 항체의 생산 생산에는 많은 시간과 비용이 요구될 뿐만 아니라, 배치간 변이(batch to batch variation)가 존재하여 순수한 AFP 항체만을 생산 확보하기 매우 어렵다는 단점을 가지고 있다. 이에 효율적으로 간암을 조기에 진단하기 위하여 간암 바이오 마커인 AFP를 특이적으로 탐지 할 수 있는 항체 대체 물질의 개발이 절실한 실정이다. Globally, liver cancer is the fourth highest incidence of cancer, with very high mortality rates. Currently, liver cancer is ranked third in the ranking of cancer diseases in Korea, and the mortality rate is ranked second. Like this, hepatocellular carcinoma is not only a disease that is common in Korea, but also a dangerous disease that directly leads to death in case of disease. As of 2007, the incidence of domestic hepatocellular carcinoma is so high that it accounts for 14,924 out of 161,920 cancer patients, and 22.7 deaths per 100,000 population annually threatens the public health to such an extent that liver cancer deaths occur. The survival rate of major cancers in the National Cancer Center is estimated to be 18.9% within 5 years after the onset of liver cancer. Among the major cancers, survival rate is 50% 80% of patients have poor prognosis, and early diagnosis and disease diagnosis through recurrence diagnosis is urgent. Hepatitis B virus (HBV), hepatitis C virus (HCV), and Aflatoxin are known to be the main causative factors of hepatocellular carcinoma. Various types of chemical absorption, Obesity, oral contraceptive use, and environmental factors such as intake of arsenic by drinking water. Liver cancer causes early vascular invasion and has a rapid growth rate. About 73-85% of liver cancer patients have complications such as liver cirrhosis, which makes treatment very difficult. In addition, liver cancer in the early stages of the symptoms without any specific symptoms, so if the symptoms are already known to have progressed to a lot of disease is often difficult to treat. Currently, the best treatment for liver cancer is liver transplantation and surgical resection. However, the liver transplant method has a very high survival rate, but it has the disadvantage that it is difficult to obtain a donor, and surgical hepatectomy can maintain a long survival period, but it can be performed within 20% It is known as a treatment method. Therefore, it is known that the best way to cope with liver cancer is chemotherapy through early detection and simple surgical treatment. In Korea, various methods such as hepatic biopsy, invasive method, and non - invasive method, such as imaging and serological tests, are used for the early diagnosis of liver cancer. Hepatocellular carcinoma (AFP) (alpha-fetoprotein) is used for the early diagnosis of liver cancer through serological examination. AFP is a serum protein produced in the fetal liver and digestive organs, which is a protein that is present in the blood at a concentration of about 10 ng / ㎖ after birth. However, hepatitis, liver cirrhosis, hepatic tumors, intrahepatic metastatic cancers, and so on, have been used as diagnostic markers for liver cancer. In particular, when the AFP concentration in the blood increases to 16-20 ng / ml or more, the detection rate of liver abnormalities can be confirmed with a sensitivity of 60-62.4% or more, and a specificity of 89.4-90.6% Is known to have. Liver cancer should be suspected especially if AFP concentration in the blood is 400-500 ng / ml or more. Because of these characteristics, changes in AFP levels are attracting attention as biomarkers suitable for the outcome and prognosis of liver cancer. Currently, AFP antibody-based enzyme-linked immunosorbent assays (ELISA) and immunochromatographic assays are used to measure AFP levels in blood. However, the AFP antibody, which is the basis of these techniques, is difficult to produce, purify, and modify freely because it is accompanied by animal experiments, and it is difficult to obtain stability against the surrounding pH and temperature with protein. In addition, production and production of AFP antibody is not only time consuming and costly, but also has a disadvantage in that batch to batch variation exists and it is very difficult to produce pure AFP antibody only. Therefore, in order to diagnose hepatocellular carcinoma efficiently, it is necessary to develop an antibody substitute which can specifically detect hepatoma biomarker AFP.

앱타머는 짧은 길이의 올리고머로 안정된 삼차구조 형성을 통하여 표적 물질과 높은 친화도를 가지고 특이적으로 결합하는 특징을 가지고 있다. 또한 화학적 합성 기법을 이용하여, 단시간, 저비용으로 대량 생산이 가능하며 배치간 변이(batch to batch variation)가 거의 없어 생산적인 측면에서 탁월한 장점을 갖고 있다. 뿐만 아니라, 주변의 pH와 온도에 매우 안정성이 높아 최근 표적 물질의 탐지 및 질환 진단 센서 개발 등 환경, 의료 등 다양한 분야에서의 활용 가능성이 높이 평가되고 있다. Aptamers are characterized by a short-chain oligomer that binds specifically with high affinity to the target material through the formation of a stable tertiary structure. In addition, it can be mass-produced in a short time and at a low cost by using a chemical synthesis technique, and has an excellent advantage in terms of productivity because there is no batch to batch variation. In addition, it is highly stable at the surrounding pH and temperature, and it is highly evaluated for its potential to be used in a variety of fields such as environment and medical care, such as detection of a target substance and development of a disease diagnosis sensor.

본 명세서 전체에 걸쳐 다수의 논문 및 특허문헌이 참조되고 그 인용이 표시되어 있다. 인용된 논문 및 특허문헌의 개시 내용은 그 전체로서 본 명세서에 참조로 삽입되어 본 발명이 속하는 기술 분야의 수준 및 본 발명의 내용이 보다 명확하게 설명된다.
Numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated herein by reference in their entirety to better understand the state of the art to which the present invention pertains and the content of the present invention.

본 발명자들은 간암 또는 생식세포종양의 진단을 위한 AFP에 특이적으로 결합할 수 있는 DNA 앱타머(aptamer)를 개발하기 위해 연구 노력하였다. 그 결과, 간암 또는 생식세포종양 진단 마커 단백질인 AFP(Alpha-fetoprotein)에 특이적으로 결합할 수 있는 DNA 앱타머들을 합성하고 선별하는데 성공하였고, 이들 앱타머가 항체 기반의 간암 진단 방법을 대체할 수 있음을 실험적으로 확인함으로써 본 발명을 완성하였다. The present inventors have made efforts to develop a DNA aptamer capable of specifically binding to AFP for diagnosis of liver cancer or germ cell tumor. As a result, DNA aptamers capable of specifically binding to AFP (alpha-fetoprotein), a marker marker protein for hepatocellular carcinoma or germ cell tumor, were successfully synthesized and screened, and these aptamers could be substituted for antibody- The present inventors have completed the present invention.

따라서, 본 발명의 목적은 AFP(Alpha-fetoprotein)에 특이적으로 결합하는 DNA 앱타머(aptamer)를 제공하는 것에 있다. Accordingly, an object of the present invention is to provide a DNA aptamer that specifically binds to AFP (Alpha-fetoprotein).

본 발명의 다른 목적은 상기 DNA 앱타머를 유효성분으로 포함하는 AFP(Alpha-fetoprotein) 검출용 키트를 제공하는 것에 있다. It is another object of the present invention to provide a kit for detecting AFP (Alpha-fetoprotein) comprising the DNA aptamer as an active ingredient.

본 발명의 또 다른 목적은 상기 DNA 앱타머를 유효성분으로 포함하는 간암 또는 생식세포종양의 진단 또는 예후판단용 조성물을 제공하는 것에 있다. It is still another object of the present invention to provide a composition for the diagnosis or prognosis of liver cancer or germ cell tumor comprising the DNA aptamer as an active ingredient.

본 발명의 또 다른 목적은 상기 DNA 앱타머가 기판상에 고정된 간암 또는 생식세포종양의 진단 또는 예후판단용 마이크로어레이를 제공하는 것에 있다. It is still another object of the present invention to provide a microarray for diagnosing or prognosis of liver cancer or germ cell tumor in which the DNA aptamer is immobilized on a substrate.

본 발명의 또 다른 목적은 간암 또는 생식세포종양의 진단 또는 예후판단에 필요한 정보를 제공하기 위해 환자의 생물학적 시료로부터 상기 DNA 앱타머와 AFP(Alpha-fetoprotein)와의 결합반응을 통해 AFP를 검출하는 방법을 제공한다. It is still another object of the present invention to provide a method for detecting AFP through binding reaction between DNA aptamer and AFP (Alpha-fetoprotein) from a biological sample of a patient to provide information necessary for diagnosis or prognosis of liver cancer or germ cell tumor .

본 발명의 또 다른 목적은 AFP가 포함된 시료로부터 AFP(Alpha-fetoprotein)를 분리 및 정제하는 방법을 제공한다. It is still another object of the present invention to provide a method for separating and purifying AFP (Alpha-fetoprotein) from a sample containing AFP.

본 발명의 목적 및 장점은 하기의 발명의 상세한 설명, 청구의 범위 및 도면에 의해 보다 명확하게 된다.
The objects and advantages of the present invention will become more apparent from the following detailed description of the invention, claims and drawings.

본 발명의 일 양태에 따르면, 본 발명은 AFP(Alpha-fetoprotein)에 특이적으로 결합하는 DNA 앱타머(aptamer)를 제공한다. According to one aspect of the present invention, there is provided a DNA aptamer which specifically binds to AFP (Alpha-fetoprotein).

본 발명의 바람직한 구현예에 의하면, 상기 DNA 앱타머는 서열목록 제1서열 내지 제18서열 중 어느 하나에 개시된 염기서열과 90％ 이상의 동일성을 갖는 염기서열을 갖는 올리고뉴클레오타이드이다. According to a preferred embodiment of the present invention, the DNA aptamer is an oligonucleotide having a nucleotide sequence having 90% or more identity with the nucleotide sequence set forth in any one of SEQ ID NOS: 1 to 18.

본 발명의 보다 바람직한 구현예에 의하면, 상기 DNA 앱타머는 서열목록 제1서열 내지 제18서열 중 어느 하나에 기재된 염기서열을 갖는 올리고뉴클레오타이드이다. According to a more preferred embodiment of the present invention, the DNA aptamer is an oligonucleotide having a nucleotide sequence as set forth in any one of Sequence Listing Nos. 1 to 18.

본 발명의 다른 일 양태에 따르면, 본 발명은 상기 DNA 앱타머를 유효성분으로 포함하는 AFP(Alpha-fetoprotein) 검출용 키트(Kit)를 제공한다. According to another aspect of the present invention, there is provided a kit for detecting AFP (Alpha-fetoprotein) comprising the DNA aptamer as an active ingredient.

본 발명의 또 다른 일 양태에 따르면, 본 발명은 상기 DNA 앱타머(aptamer)를 유효성분으로 포함하는 간암 또는 생식세포종양의 진단 또는 예후판단용 조성물을 제공한다. According to another aspect of the present invention, there is provided a composition for determining the diagnosis or prognosis of liver cancer or germ cell tumor comprising the DNA aptamer as an active ingredient.

본 발명의 또 다른 일 양태에 따르면, 본 발명은 상기 DNA 앱타머가 기판상에 고정된 것을 특징으로 하는 간암 또는 생식세포종양의 진단 또는 예후 판단용 마이크로어레이를 제공한다. According to another aspect of the present invention, there is provided a microarray for diagnosing or prognosing a liver cancer or a germ cell tumor, wherein the DNA aptamer is immobilized on a substrate.

본 발명의 또 다른 일 양태에 따르면, 본 발명은 간암 또는 생식세포종양의 진단에 필요한 정보를 제공하기 위해 환자의 생물학적 시료로부터 상기 DNA 앱타머와 AFP(Alpha-fetoprotein)와의 결합 반응을 통해 AFP를 검출하는 방법을 제공한다. According to another aspect of the present invention, there is provided a method for diagnosing hepatocellular carcinoma or germ cell tumor, comprising the steps of: (a) contacting a biological sample of a patient with a DNA aptamer and an AFP (Alpha-fetoprotein) The method comprising:

본 발명의 또 다른 일 양태에 따르면, 본 발명은 다음의 단계를 포함하는 AFP가 포함된 시료로부터 AFP(Alpha-fetoprotein)를 분리 및 정제하는 방법을 제공한다: (a) 상기 DNA 앱타머가 결합된 지지체에 AFP가 포함된 시료를 접촉시키는 단계; 및 (b) 상기 DNA 앱타머에 결합된 AFP를 분리하는 단계. According to another aspect of the present invention, the present invention provides a method for separating and purifying AFP (Alpha-fetoprotein) from a sample containing AFP comprising the steps of: (a) Contacting the support with a sample containing AFP; And (b) separating the AFP bound to the DNA aptamer.

이하에서 본 발명의 내용을 보다 상세히 설명한다. Hereinafter, the contents of the present invention will be described in more detail.

DNA 앱타머DNA aptamer

본 발명은 간암 마커 단백질인 AFP(Alpha-fetoprotein)에 특이적으로 결합하는 DNA 올리고뉴클레오타이드에 관한 것이다. The present invention relates to DNA oligonucleotides that specifically bind to hepatoma marker protein AFP (Alpha-fetoprotein).

본 명세서에서 용어 "DNA 앱타머(aptamer)"는 특정 분자에 고친화성 및 특이성으로 결합할 수 있는 DNA 핵산 분자를 의미한다. 본 명세서에서 "DNA 앱타머"는 "DNA 올리고뉴클레오타이드"와 혼용하여 사용한다. As used herein, the term "DNA aptamer" refers to a DNA nucleic acid molecule capable of binding with high affinity and specificity to a specific molecule. In the present specification, "DNA aptamer" is used in combination with "DNA oligonucleotide".

본 명세서에서 용어 "올리고뉴클레오타이드"는 일반적으로 길이가 약 200개 미만을 갖는 뉴클레오타이드 중합체를 지칭하며, 이에는 DNA 및 RNA가 포함될 수 있으며, 바람직하게는 DNA 핵산 분자이다. 뉴클레오타이드는 데옥시리보뉴클레오타이드, 리보뉴클레오타이드, 변형된 뉴클레오타이드 또는 염기 및/또는 이들의 유사체, 또는 DNA 또는 RNA 폴리머라제에 의해 또는 합성 반응에 의해 중합체 내로 도입될 수 있는 모든 기질일 수 있다. 뉴클레오타이드 구조에 대한 변형이 존재하는 경우, 이러한 변형은 올리고뉴클레오타이드 중합체의 합성 전에 또는 후에 추가될 수 있다. 뉴클레오타이드 서열은 비-뉴클레오타이드 성분에 의해 중단될 수 있다. 올리고뉴클레오타이드는 합성 후에, 예를 들어 표지와의 결합에 의해 추가로 변형시킬 수 있다. The term "oligonucleotide" as used herein generally refers to a nucleotide polymer having less than about 200 lengths, including DNA and RNA, preferably DNA nucleotide molecules. The nucleotide can be any substrate that can be introduced into the polymer by deoxyribonucleotides, ribonucleotides, modified nucleotides or bases and / or their analogs, or by DNA or RNA polymerases or by synthetic reactions. If a modification to the nucleotide structure is present, such modification may be added before or after the synthesis of the oligonucleotide polymer. The nucleotide sequence may be terminated by a non-nucleotide component. The oligonucleotides can be further modified after synthesis, for example by binding with a label.

본 발명의 DNA 앱타머(aptamer)는 전형적으로는 타겟 분자의 결합에 대한 시험관내 선택법에 의해 얻을 수 있다. 타겟 분자에 특이적으로 결합하는 앱타머를 선택하는 방법은 당 분야에서 공지되어 있다. 예를 들어, 유기 분자, 뉴클레오타이드, 아미노산, 폴리펩타이드, 세포 표면상의 마커분자, 이온, 금속, 염, 다당류가 각 리간드에 특이적으로 결합할 수 있는 앱타머를 분리하는 적절한 타겟 분자가 될 수 있다. 앱타머의 선별은 SELEX 방법으로 공지된 생체내 또는 시험관내 선택 기술을 이용할 수 있다(Ellington et al., Nature 346, 818-22, 1990; 및 Tuerk et al., Science 249, 505-10, 1990). 앱타머의 선별 및 제조에 대한 구체적인 방법은 미국특허 5,582,981, WO 00/20040, 미국특허 5,270,163, Lorsch and Szostak, Biochemistry, 33:973 (1994), Mannironi et al.,Biochemistry 36:9726 (1997), Blind, Proc. Natl. Acad. Sci. USA 96:3606-3610 (1999), Huizenga and Szostak, Biochemistry, 34:656-665 (1995), WO 99/54506, WO 99/27133, WO 97/42317 및 미국특허 5,756,291에 기재되어 있으며, 상기 문헌들은 본 명세서에 참조로써 삽입된다. The DNA aptamers of the present invention are typically obtained by in vitro selection for binding of target molecules. Methods for selecting an aptamer that specifically binds to a target molecule are known in the art. For example, organic molecules, nucleotides, amino acids, polypeptides, marker molecules on the cell surface, ions, metals, salts, polysaccharides can be suitable target molecules for separating aptamers that can specifically bind to each ligand . Screening of the aptamer can utilize in vivo or in vitro selection techniques known in the SELEX method (Ellington et al., Nature 346, 818-22, 1990; and Tuerk et al., Science 249, 505-10, 1990 ). Specific methods for screening and manufacturing the aptamer are described in U.S. Patent 5,582,981, WO 00/20040, U.S. Patent 5,270,163, Lorsch and Szostak, Biochemistry, 33: 973 (1994), Mannironi et al., Biochemistry 36: 9726 Blind, Proc. Natl. Acad. Sci. USA 96: 3606-3610 (1999), Huizenga and Szostak, Biochemistry, 34: 656-665 (1995), WO 99/54506, WO 99/27133, WO 97/42317 and U.S. Patent 5,756,291, Are incorporated herein by reference.

본 발명의 DNA 앱타머는 바람직하게는 서열목록 제 1 서열 내지 제 18 서열 중 어느 하나에 개시된 염기서열을 갖는 올리고뉴클레오타이드이다. 한편, 본 발명의 서열목록 제1서열 내지 제18서열의 DNA 앱타머는 본 명세서 도 3a 내지 도 3e에 도시된 2차 구조를 형성할 것으로 추정된다. The DNA aptamer of the present invention is preferably an oligonucleotide having a nucleotide sequence as set forth in any one of Sequence Listing Nos. 1 to 18. On the other hand, the DNA aptamers of Sequence Listing Nos. 1 to 18 of the present invention are presumed to form the secondary structure shown in Figs. 3A to 3E herein.

또한, 본 발명의 DNA 앱타머는 AFP에 결합하는 특성을 유지하면서, 상기 서열목록 제1서열 내지 제18서열 중 어느 하나의 염기서열과 실질적인 동일성을 나타내는 염기서열을 갖는 올리고뉴클레오타이드도 포함하는 것으로 해석된다. 상기의 실질적인 동일성은, 상기한 본 발명의 뉴클레오타이드 서열과 임의의 다른 서열을 최대한 대응되도록 얼라인하고, 당업계에서 통상적으로 이용되는 알고리즘(Smith and Waterman, Adv. Appl. Math. 2:482(1981) Needleman and Wunsch, J. Mol. Bio. 48:443(1970); Pearson and Lipman, Methods in Mol. Biol. 24: 307-31(1988); Higgins and Sharp, Gene 73:237-44(1988); Higgins and Sharp, CABIOS 5:151-3(1989); Corpet et al., Nuc. Acids Res. 16:10881-90(1988); Huang et al., Comp. Appl. BioSci. 8:155-65(1992) and Pearson et al., Meth. Mol. Biol. 24:307-31(1994))을 이용하여 얼라인된 서열을 분석한 경우에, 최소 90％의 동일성, 보다 바람직하게는 최소 95％의 동일성, 가장 바람직하게는 최소 98％의 동일성을 나타내는 뉴클레오타이드 서열을 의미한다.
The DNA aptamer of the present invention is also interpreted to include an oligonucleotide having a nucleotide sequence that exhibits substantial identity with any one of the nucleotide sequences of SEQ ID NOS: 1 to 18 while retaining the property of binding to AFP . The above-mentioned substantial identity is determined by aligning the nucleotide sequence of the present invention with any other sequence as much as possible and using an algorithm commonly used in the art (Smith and Waterman, Adv. Appl. Math. 2: 482 (1988), Higgins and Sharp, Gene 73: 237-44 (1988), < RTI ID = 0.0 >; Higgins and Sharp, CABIOS 5: 151-3 (1989); Corpet et al., Nuc Acids Res. 16: 10881-90 (1988); Huang et al., Comp. At least 90% identity, more preferably at least 95% identity, in the case of analysis of the aligned sequence, using the amino acid sequence as shown in Table 1 (1992) and Pearson et al., Meth. Mol. Biol. 24: 307-31 Identity, most preferably at least 98% identity to the nucleotide sequence of SEQ ID NO: 1.

AFP(Alpha-fetoprotein) 에 특이적 결합Specific binding to AFP (Alpha-fetoprotein)

인간 "AFP(Alpha-fetoprotein)"은 AFP 유전자에 의해 인코딩된 단백질로서, 태아기 동안에 난황낭(yolk sac) 또는 간에서 생성되는 주요한 혈청 단백질이다. 인간의 태아기 동안에 AFP는 가장 높은 수준으로 유지되고, 출생 이후 점차로 감소하다가 생후 8 내지 12 개월에서 성인에서 측정 가능한 낮은 수준까지로 감소된다. AFP는 간암세포, 정소(testis) 또는 난소(ovary)에서의 생식세포종양(germ cell tumor), 또는 간에서의 전이성 암세포로부터 생성되는 데, 이러한 질병이 존재하는 경우 임산부 또는 태아가 아니더라도 조직이나 혈액에서 높은 수준으로 나타나므로, 간암, 또는 생식세포종양에 대한 진단 마커 단백질로 이용된다. 하기 본 발명의 구체적인 일 실시예에서 입증되는 바와 같이, 본 발명의 AFP 결합 DNA 앱타머는 AFP에 특이적으로 결합하므로, AFP의 검출 또는 분리 정제에 이용될 수 있으며, AFP의 수준을 측정함으로써 간암 또는 생식세포종양의 진단 또는 예후 판단에 응용될 수 있다.
The human "AFP (Alpha-fetoprotein)" is a protein encoded by the AFP gene, which is a major serum protein produced in yolk sac or liver during fetal period. During the human prenatal period, AFP remains at its highest level and gradually decreases after birth, decreasing from 8 to 12 months of age to a measurable low level in adults. AFP is produced from hepatocellular carcinoma cells, germ cell tumors in the testis or ovaries, or metastatic cancer cells in the liver. In the presence of these diseases, even if not pregnant or fetal, , It is used as a diagnostic marker protein for liver cancer or germ cell tumors. As demonstrated in the following specific example of the present invention, the AFP-binding DNA aptamer of the present invention specifically binds to AFP, and thus can be used for detection or separation / purification of AFP. By measuring the level of AFP, It can be applied to the diagnosis or prognosis of germ cell tumors.

AFP의 검출Detection of AFP

본 발명의 DNA 앱타머는 AFP(Alpha-fetoprotein)와 특이적으로 결합하는 특성을 이용하여 AFP를 검출할 수 있다. 본 발명의 AFP 검출은 DNA 앱타머와 AFP의 복합체를 검출하는 방법에 기초한다. 복합체의 검출을 용이하게 하기 위해 본 발명의 DNA 앱타머가 형광물질, 예를 들어 플루오레세인(fulorescein), Cy3 또는 Cy5; 방사성물질, 또는 화학물질, 예를 들어 비오틴(biotin)으로 표지되거나 1차 아민(primary amine)으로 변형된 뉴클레오타이드를 포함할 수 있다. The DNA aptamer of the present invention can detect AFP using a specific binding property to AFP (Alpha-fetoprotein). The AFP detection of the present invention is based on a method for detecting a complex of DNA aptamer and AFP. To facilitate detection of the complex, the DNA aptamer of the present invention may be conjugated to a fluorophore such as fulorescein, Cy3 or Cy5; Radioactive materials, or chemicals, such as nucleotides labeled with biotin or modified with primary amines.

본 발명에서 본 발명의 DNA 앱타머가 고정화된 기판(substrate)을 포함하는 마이크로어레이(microarray)를 사용하여 AFP를 검출할 수 있다. 본 명세서에서 용어"마이크로 어레이"는 기판의 특정의 영역에 유전 물질이 고밀도로 부착된 어레이(배열)를 의미한다. 본 명세서에서 용어 마이크로어레이의 "기판"은 적합한 견고성 또는 반-견고성을 갖는 지지체를 의미하며, 예컨대, 유리, 막(membrane), 슬라이드, 필터, 칩, 웨이퍼, 파이버, 자기성 비드 또는 비자기성 비드, 겔, 튜빙, 플레이트, 고분자, 미소입자 및 모세관을 포함하나 이에 한정되지 않는다. 본 발명의 DNA 앱타머는 상기 기판상에 배열되고 고정화된다. 이와 같은 고정화는 화학적 결합 방법 또는 UV와 같은 공유 결합적 방법에 의해 실시된다. 예를 들어, DNA 올리고뉴클레오타이드는 에폭시 화합물 또는 알데히드기를 포함하도록 변형된 유리 표면에 결합될 수 있고, 또한 폴리라이신 코팅 표면에서 UV에 의해 결합될 수 있다. 또한, 상기 DNA 올리고뉴클레오타이드는 링커 (예: 에틸렌 글리콜 올리고머 및 디아민)를 통해 기판에 결합될 수 있다. In the present invention, AFP can be detected using a microarray including a substrate on which the DNA aptamer of the present invention is immobilized. As used herein, the term "microarray" refers to an array (array) in which dielectric material is attached at a high density to a specific region of a substrate. As used herein, the term "substrate" of a microarray refers to a support having a suitable rigid or semi-rigid support, such as a glass, membrane, slide, filter, chip, wafer, fiber, magnetic bead, , Gels, tubing, plates, polymers, microparticles, and capillaries. The DNA aptamers of the present invention are arranged and immobilized on the substrate. Such immobilization is carried out by a chemical bonding method or a covalent bonding method such as UV. For example, DNA oligonucleotides can be attached to glass surfaces modified to include epoxy compounds or aldehyde groups, and can also be bound by UV on polylysine coating surfaces. In addition, the DNA oligonucleotides may be bound to the substrate via linkers (e.g., ethylene glycol oligomers and diamines).

본 발명의 DNA 앱타머는 예를 들어, 비오티닐화(biotinylated)화될 수 있고, 이는 스트랩트아비딘(streptavidin)이 코팅된 기판상에 성공적으로 결합될 수 있다. 기판상에 고정화된 본 발명의 DNA 앱타머는 AFP와 결합하여 이를 포획할 수 있다. The DNA aptamers of the present invention can be biotinylated, for example, and can be successfully coupled onto a substrate coated with streptavidin. The DNA aptamer of the present invention immobilized on a substrate can bind to and capture AFP.

본 발명에서 AFP(Alpha-fetoprotein) 검출용 조성물은 키트(Kit)의 형태로 제공될 수 있다. 본 발명에서 키트는 서열목록 제 1 서열 내지 제 18 서열 중 어느 하나에 개시된 염기서열 또는 이 서열과 90％ 이상의 동일성을 갖는 염기서열을 갖는 DNA 올리고뉴클레오타이드를 유효성분으로 포함한다. 본 발명에서의 키트는 시료 중의 AFP 검출에 키트를 사용하기 위한 설명서 또는 라벨을 추가로 포함할 수 있다.
In the present invention, the composition for detecting AFP (Alpha-fetoprotein) may be provided in the form of a kit. In the present invention, the kit comprises the nucleotide sequence set forth in any one of SEQ ID NOS: 1 to 18 or a DNA oligonucleotide having a nucleotide sequence having 90% or more identity with the nucleotide sequence as an active ingredient. The kit in the present invention may further include a manual or label for using the kit for detecting AFP in the sample.

간암 또는 생식세포종양의 진단 또는 예후판단Diagnosis or prognosis of liver cancer or germ cell tumors

AFP의 검출 및 분석은 간암 또는 생식세포종양의 스크리닝, 진단, 또는 예후 판단에 유용한 정보를 제공할 수 있다. 구체적으로, 간암 세포 또는 생식세포종양 세포는 AFP를 과다 생성함으로써, 조직 또는 혈액 등에서 AFP의 수준이 정상 대비 높은 수준으로 증가하게 되므로, AFP의 수준을 측정함으로써, 간암 또는 생식세포종양의 진단 또는 예후 판단에 응용할 수 있다. Detection and analysis of AFP can provide useful information for screening, diagnosis, or prognosis of liver cancer or germ cell tumors. Specifically, hepatocellular carcinoma cells or germ cell tumor cells produce excessive levels of AFP, thereby increasing levels of AFP in tissues or blood to a high level. Therefore, by measuring the level of AFP, the diagnosis or prognosis of liver cancer or germ cell tumor It can be applied to judgment.

또한, 본 발명은 간암 또는 생식세포종양의 진단에 필요한 정보를 제공하기 위해 환자의 생물학적 시료로부터 본 발명의 DNA 앱타머와 AFP와의 결합 반응을 통해 AFP를 검출하는 방법을 제공한다. 상기 용어"생물학적 시료"는 혈액, 타액, 누액, 요액, 활액, 점액, 세포, 조직, 및 기타 다른 조직 및 체액을 포함할 수 있으며, 세포 배양 상등액, 파열된 진핵세포 및 세균 발현계 등도 포함하지만, 이에 제한되지는 않는다.
The present invention also provides a method for detecting AFP from a biological sample of a patient through binding reaction between AFP and DNA aptamer of the present invention in order to provide information necessary for diagnosis of liver cancer or germ cell tumor. The term "biological sample" may include blood, saliva, fluids, fluids, synovial fluid, mucus, cells, tissues, and other tissues and body fluids and includes cell culture supernatants, ruptured eukaryotic cells, , But is not limited thereto.

AFP의 분리 및 정제Isolation and purification of AFP

본 발명의 DNA 앱타머의 AFP의 특이적 결합 특성을 이용하면, DNA 앱타머를 AFP의 분리 및 정제에 응용할 수 있다. 본 발명에서 AFP의 분리 및 정제는 DNA 앱타머와 AFP의 결합 복합체를 형성시킨 후, 이 복합체로부터 AFP를 분리시켜 회수하는 결합 분석(binding assay) 방법에 기초하여 이루어진다. 이러한 결합 분석 방법의 예는 당업계에 잘 공지되어 있다. 본 발명의 DNA 앱타머 분자는 비드(bead) 또는 레진(resin)과 같은 지지체에 결합될 수 있으며, 결합된 DNA 앱타머는 리간드인 AFP를 포획(capture)할 수 있다. DNA 앱타머의 지지체로의 결합은 예를 들어, DNA 앱타머를 비오티닐화(biotinylated)화시키고, 지지체의 표면을 스트랩트아비딘(streptavidin)으로 코팅하여, DNA 앱타머를 지지체상에 용이하게 결합시킬 수 있다. 한편, 지지체로서 비드를 사용하는 경우, 상기 AFP가 결합되어 포획된 DNA 앱타머 비드를 용이하게 회수하기 위해서 자성 비드(magnetic bead)를 사용할 수 있다.
By utilizing the specific binding characteristics of AFP of the DNA aptamer of the present invention, DNA aptamers can be applied to the separation and purification of AFP. In the present invention, the separation and purification of AFP is performed based on a binding assay method in which DNA complexes of aptamers and AFP are formed and then AFP is separated from the complex to recover. Examples of such binding assay methods are well known in the art. The DNA aptamer molecule of the present invention can be bound to a support such as a bead or a resin, and the bound DNA aptamer can capture the ligand AFP. Binding of the DNA aptamer to the support can be achieved, for example, by biotinylating the DNA aptamer and coating the surface of the support with streptavidin to facilitate attachment of the DNA aptamer onto the support . On the other hand, when a bead is used as a support, a magnetic bead can be used to easily recover the captured DNA aptamer beads in which the AFP is bound and captured.

본 발명은 AFP(Alpha-fetoprotein)에 특이적으로 결합할 수 있는 DNA 앱타머와 이의 용도에 관한 것이다. 본 발명의 DNA 앱타머는 간암 또는 생식세포종양의 마커 단백질인 AFP와 특이적으로 결합하는 특성을 갖는다. 따라서, 본 발명의 DNA 앱타머는 AFP의 검출 용도 뿐만 아니라, AFP의 수준을 측정함으로써, 간암 및 생식세포종양의 진단 또는 예후 판단 용도로 사용될 수 있다. 본 발명의 DNA 앱타머는 간암 진단에 활용되고 있는 AFP 결합 항체를 대체할 수 있으며, 간암을 보다 신속하고 경제적으로 진단할 수 있을 것으로 기대된다.
The present invention relates to a DNA aptamer capable of specifically binding to AFP (Alpha-fetoprotein) and its use. The DNA aptamer of the present invention has the property of specifically binding to AFP which is a marker protein of liver cancer or germ cell tumor. Therefore, the DNA aptamer of the present invention can be used not only for the detection of AFP but also for the purpose of diagnosing liver cancer and germ cell tumors or determining prognosis by measuring the level of AFP. The DNA aptamer of the present invention can replace the AFP-binding antibody used for the diagnosis of liver cancer and is expected to diagnose liver cancer more rapidly and economically.

도 1은 랜덤 DNA 앱타머를 PCR 및 비대칭 PCR 기법을 이용하여 증폭한 후, 스트렙트아비딘 비드를 이용하여 ssDNA만을 선택적으로 회수한 결과와 회수된 ssDNA에 S1 nuclease를 처리한 결과를 아가로스 젤 전기영동을 통하여 확인한 결과이다. 레인 1: 100 bp DNA 마커이고, 레인 2: DNA 앱타머를 PCR 및 비대칭 PCR 기법을 이용하여 증폭한 후, 스트렙트아비딘 비드를 이용하여 ssDNA만을 선택적으로 회수한 결과이며, 레인 3: 스트렙트아비딘 비드를 이용하여 회수한 ssDNA에 S1 nuclease를 처리한 결과이다.
도 2는 AFP 결합 DNA 앱타머 제작을 위한 SELEX 과정에서 각 라운드에서 회수된 AFP 결합 DNA 앱타머가 회수된 양을 나타낸 결과이다.
도 3a 내지 도 3e는 AFP 결합 DNA 앱타머 제작을 위한 SELEX 과정에서 선별된 18개의 AFP 결합 DNA 앱타머 후보군 AFP-1 내지 AFP-18의 2차 구조를 나타낸 도면이다.
도 4는 카르복실기를 가지고 있는 센서 칩 CM5 표면에 AFP를 고정하는 단계를 나타낸 도면이다.
도 5은 도트 블로팅(Dot blotting) 기법을 기반으로 AFP 결합 DNA 앱타머가 AFP와 AFP 항체 간의 결합을 방해하는 것을 확인한 결과로 AFP, AFP 항체, 및 AFP 항체에 특이적으로 결합하는 퍼옥시다아제(peroxidase)가 결합되어 있는 쥐 IgG 항체를 이용하여 분석한 결과이다. 도트(점) 1-18은 AFP 결합 DNA 앱타머인 AFP-1 부터 AFP-18 까지의 160 pmol을 AFP 1.25 ng과 반응시킨 후, PVDF 멤브레인(membrane)에 각각 스포팅(spotting)한 후, 이를 AFP 항체, AFP 항체에 특이적으로 결합하는 퍼옥시다아제(peroxidase)가 결합되어 있는 쥐 IgG 항체를 이용하여 분석한 결과이며, 도트(점) 19는 AFP 10 ng을 PVDF 멤브레인에 스포팅한 후 AFP 항체, AFP 항체에 특이적으로 결합하는 퍼옥시다아제가 결합되어 있는 쥐 IgG 항체를 이용하여 분석한 결과이며, 도트(점) 20은 AFP 항체 10 ng을 PVDF 멤브레인에 스포팅한 후 AFP 항체에 특이적으로 결합하는 퍼옥시다아제가 결합되어 있는 쥐 IgG 항체를 이용하여 분석한 결과이며, 점 21은 퍼옥시다아제가 결합되어 있는 쥐 IgG 항체를 직접 PVDF 멤브레인에 스포팅한 후 직접 분석한 결과이다.
도 6는 AFP 결합 DNA 앱타머를 이용하여 ELISA 기법을 기반으로 AFP를 탐지하는 방법에 대한 모식도로서, 패널 [1]은 AFP의 탐지를 위해 AFP 결합 DNA 앱타머를 이용한 ELISA 법의 모식도를 나타내며, 패널 [2]는 기존 항체를 이용하여 AFP 를 탐지하는 ELISA 법의 모식도를 나타낸 것이다.
도 7는 AFP 결합 앱타머를 이용한 간암 진단 키트(kit)의 모식도를 나타낸 도면이다. 패널 [1]은 AFP에 특이적으로 결합하는 앱타머를 내장한 키트(kit) 모식도를 나타내며, 패널 [2]는 간암으로 의심되는 시료를 AFP 결합 앱타머를 내장하고 있는 간암 진단 키트(kit)와 반응하였을 때, 샘플과 AFP 결합 앱타머의 결합에 의해 간암을 진단하는 시스템에 대한 모식도를 나타낸다. FIG. 1 shows the results of selective amplification of random DNA aptamers using PCR and asymmetric PCR, followed by selective recovery of only ssDNA using streptavidin beads, and treatment of S1 nuclease with recovered ssDNA using agarose gel electrophoresis It is the result confirmed by Youngdong. Lane 1: 100 bp DNA marker, and lane 2: DNA aptamer was amplified by PCR and asymmetric PCR method, and only ssDNA was selectively recovered using streptavidin beads. Lane 3: Streptavidin S1 nuclease treatment of ssDNA recovered using beads.
Figure 2 shows the amount of AFP-bound DNA aptamer recovered in each round in the SELEX procedure for producing AFP-bound DNA aptamers.
FIGS. 3A to 3E are diagrams showing the secondary structure of the AFP-1 to AFP-18 candidate groups of 18 AFP-binding DNA aptamers selected in the SELEX process for producing AFP-coupled DNA aptamers.
4 is a view showing a step of fixing the AFP to the surface of the sensor chip CM5 having a carboxyl group.
FIG. 5 shows that the AFP-binding DNA aptamer interferes with the binding between the AFP antibody and the AFP antibody based on the dot blotting technique. As a result, AFP, AFP antibody, and peroxidase ) Were combined with mouse IgG antibody. Dots (dots) 1-18 were obtained by reacting 160 pmoles of AFP-1 to AFP-18, which are AFP-linked DNA aptamers, with 1.25 ng of AFP, spotting them on PVDF membranes, (Dot) 19 was obtained by spotting 10 ng of AFP on a PVDF membrane, followed by detection of AFP antibody, AFP (anti-AFP antibody), and anti-AFP antibody Dot (dot) 20 was obtained by spotting 10 ng of AFP antibody on a PVDF membrane and then binding to AFP antibody specifically, using a mouse IgG antibody conjugated with a peroxidase that specifically binds to the antibody. Oxidase-conjugated mouse IgG antibody. Point 21 is the result of directly analyzing mouse IgG antibody conjugated with peroxidase directly spotted on PVDF membrane.
FIG. 6 is a schematic diagram of a method for detecting AFP based on ELISA using an AFP-coupled DNA aptamer. Panel [1] shows a schematic diagram of an ELISA method using AFP-bound DNA aptamer for detection of AFP, Panel [2] is a schematic diagram of an ELISA method for detecting AFP using a conventional antibody.
FIG. 7 is a schematic diagram of a liver cancer diagnostic kit using an AFP-binding aptamer. FIG. Panel [1] shows a schematic diagram of a kit containing an aptamer specifically binding to AFP, panel [2] shows a liver cancer diagnostic kit containing AFP-binding appamer, , A system for diagnosing liver cancer by binding a sample to an AFP-binding aptamer is shown.

이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.
Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are only for describing the present invention in more detail and that the scope of the present invention is not limited by these embodiments in accordance with the gist of the present invention .

실시예Example

실시예Example 1:  One: DNADNA 앱타머의Of app tamer 제작  making

1-1. PCR 기법을 활용한 랜덤 DNA 라이브러리 증폭 1-1. Random DNA library amplification using PCR technique

AFP(Alpha-fetoprotein)에 특이적으로 결합하는 DNA 앱타머를 제작하기 위40개의 랜덤 서열을 dA : dG : dC : dT = 1.5 : 1.15 : 1.25 : 1 비율로 포함하고 있는 100bp의 주형 DNA (5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGAT TGCACTTACTATCT-3'; 서열목록 제19서열)와 이를 증폭할 수 있는 프라이머(primer) 한 쌍을 바이오니어(bioneer, Korea)으로부터 주문하여 제작하였다[정방향 프라이머: 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-3'(서열목록 제20서열), 비오티닐화된(biotinylated) 역방향 프라이머: 5'-비오틴-AGATTGCACTTACTATCT-3'(서열목록 제21서열)]. 임의의 DNA 라이브러리는 PCR(Biorad, USA) 기법을 이용하여 증폭하였으며, PCR에 의한 100 bp DNA 라이브러리의 증폭을 위한 반응 조성은 주형 DNA 1-2㎕, 10X PCR 완충용액 5㎕, 각 2.5 mM dNTP 혼합물 4㎕, 25 μM 정방향 프라이머 2㎕, 25μM 비오티닐화된 역방향 프라이머 2㎕, Ex Taq 중합효소(Takara, Japan) 0.3㎕(1unit/㎕)와 34.7 - 35.7㎕의 물로 이루어져 있다. PCR 반응 조건은 우선 94℃에서 5분간 변성시키고, 94℃에서 30초, 52℃에서 30 초, 그리고 72℃에서 30초간 반응을 30주기 반복한 후, 72℃에서 5분간 추가로 신장시키는 반응을 이용하였다. PCR 반응 후 4㎕를 취하여, 2％ 아가로스 겔을 이용하여 정확한 크기의 밴드가 나타나는지를 확인하였다. 나머지 DNA는 PCR 정제 키트(Qiagen, USA)을 이용하여 증폭된 dsDNA만을 회수하였다.
To prepare a DNA aptamer that specifically binds to AFP (Alpha-fetoprotein), 100 bp of template DNA containing 40 random sequences in a ratio of dA: dG: dC: dT = 1.5: 1.15: 1.25: (SEQ ID NO: 19) and a pair of primers capable of amplifying the same were prepared from bioneer (Korea) (forward primer: 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGAT TGCACTTACTATCT- GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-3 '(Sequence Listing 20 sequence), biotinylated reverse primer: 5'-Biotin-AGATTGCACTTACTATCT-3' (Sequence Listing 21 sequence). For the amplification of the 100 bp DNA library by PCR, 1-2 μl of template DNA, 5 μl of 10 × PCR buffer solution, 2.5 μl of each 2.5 mM dNTPs 4 μl of the mixture, 2 μl of 25 μM forward primer, 2 μl of 25 μM biotinylated reverse primer, 0.3 μl (1 unit / μl) of Ex Taq polymerase (Takara, Japan) and 34.7 - 35.7 μl of water. The PCR reaction conditions were first denaturation at 94 ° C for 5 minutes, 30 cycles of reaction at 94 ° C for 30 seconds, 52 ° C for 30 seconds, and 72 ° C for 30 seconds, followed by extension at 72 ° C for 5 minutes Respectively. After the PCR reaction, 4 占 퐇 was taken and 2% agarose gel was used to confirm whether an exact size band appeared. The remaining DNA was recovered from the amplified dsDNA using a PCR purification kit (Qiagen, USA).

1-2. 비대칭(asymmetric) PCR 기법을 활용한 ssDNA 증폭 1-2. SsDNA amplification using asymmetric PCR technique

PCR 기법을 이용하여 증폭한 dsDNA 중 ssDNA만을 증폭하기 위하여 비대칭 PCR를 수행하였다. 비대칭 PCR 반응액의 조성은 상기 단계 1-1에서 획득한 주형 DNA 50㎕, 10X PCR 완충용액 10㎕, 10mM dNTP 혼합물 8㎕, 25μM 정방향 프라이머 10㎕, 25μM 비오티닐화된 역방향 프라이머 1㎕, Ex Taq 중합효소(Takara, Japan) 0.5㎕(1unit/㎕)와 20.5㎕의 물로 구성하였다. 비대칭 PCR 반응 조건은 우선 94℃에서 5분간 변성시키고, 94℃에서 30초, 52℃에서 30초, 그리고 72℃에서 30초간의 반응을 20주기 반복한 후, 72℃에서 5분간 추가 신장시키는 반응을 이용하였다. PCR 반응 후 4㎕를 취하여, 2％ 아가로스젤을 이용하여 정확한 크기의 밴드가 나타나는지 확인하였으며, 나머지 DNA는 PCR 정제 키트(Qiagen, USA)을 이용하여 DNA만을 회수하였다.
Asymmetric PCR was performed to amplify only ssDNA among dsDNA amplified by PCR technique. As for the composition of the asymmetric PCR reaction solution, 50 μl of template DNA obtained in the above step 1-1, 10 μl of 10 × PCR buffer solution, 8 μl of 10 mM dNTP mixture, 10 μl of 25 μM forward primer, 1 μl of 25 μM biotinylated reverse primer, (1 unit / mu l) of Taq polymerase (Takara, Japan) and 20.5 mu l of water. Asymmetric PCR reaction conditions were first denatured at 94 ° C for 5 minutes, followed by 20 cycles of reaction at 94 ° C for 30 seconds, 52 ° C for 30 seconds, and 72 ° C for 30 seconds, followed by extension at 72 ° C for 5 minutes Was used. After the PCR reaction, 4 μl was taken and 2% agarose gel was used to confirm that the correct size band appeared. Only the DNA was recovered using the PCR purification kit (Qiagen, USA).

1-3. ssDNA의 선별 및 회수 1-3. Screening and recovery of ssDNA

비대칭 PCR을 이용하여 증폭한 PCR 산물 중 비오틴이 결합되어 있는 dsDNA 및 ssDNA를 제거하고 순수한 정방향의 ssDNA만을 확보하기 위하여, 상기 단계 1-2 에서 획득한 DNA 50㎕에 증류수 50㎕를 첨가한 후, 스트렙트아비딘(Pierce, USA) 50㎕를 첨가하여 4℃에서 2시간 동안 반응시켰다. 반응이 끝난 후, 반응액은 4℃, 13,000 rpm의 원심분리기를 이용하여 10분간 원심분리한 후, 상층액만을 회수하여 1/10 부피의 3M NaOAc(pH 4.5)와 2-3 부피의 100％ 에탄올을 첨가하여 -70℃에서 1시간 동안 방치하였다. 반응 후에는 4℃에서 13,000 rpm으로 20분간 원심분리하여 DNA만을 회수하였다. 회수한 DNA는 공기 중에서 말린 후, 50㎕의 증류수에 녹였다. 회수한 DNA 중 4㎕를 취하여 2％ 아가로스젤을 이용하여 정확한 크기의 밴드가 나타나는지 확인하였다(도 1, 레인 2 참고). 나머지 DNA 중 2㎕를 취하여 S1 nuclease를 처리하고, 37℃에서 1시간 동안 반응시킨 후, 2％ 아가로스젤을 이용하여 회수한 ssDNA가 완벽하게 제거되었음을 확인하였다(도 1, 레인 3 참고).
50 μl of distilled water was added to 50 μl of DNA obtained in step 1-2 to remove biotin-bound dsDNA and ssDNA from the amplified PCR product using asymmetric PCR, and to ensure pure ssDNA only in pure positive direction, 50 쨉 l of streptavidin (Pierce, USA) was added and reacted at 4 째 C for 2 hours. After completion of the reaction, the reaction mixture was centrifuged at 4,000 rpm for 10 minutes using a centrifuge at 13,000 rpm. Then, only the supernatant was recovered, and 1/10 volume of 3M NaOAc (pH 4.5) Ethanol was added and left at -70 ° C for 1 hour. After the reaction, the DNA was recovered by centrifugation at 4 ° C for 20 minutes at 13,000 rpm. The recovered DNA was dried in air and dissolved in 50 μl of distilled water. 4 μl of the recovered DNA was taken and 2% agarose gel was used to confirm whether an exact size band appeared (see FIG. 1, lane 2). 2 μl of the remaining DNA was treated with S1 nuclease and reacted at 37 ° C. for 1 hour. Then, ssDNA recovered using 2% agarose gel was completely removed (see FIG. 1, lane 3).

실시예 2: SELEX 기법을 이용한 AFP(Alpha-fetoprotein)와 특이적으로 결합하는 DNA 앱타머 선별 Example 2: Selection of DNA aptamers specifically binding to AFP (Alpha-fetoprotein) using SELEX technique

2-1. SELEX에 이용되는 각 용액의 조성 2-1. The composition of each solution used in SELEX

SELEX에 이용한 각 용액의 조성은 다음과 같았다. 즉, 2X 앱타머 선별 용액: 40mM Tris-HCl, 1M NaCl, 10mM imidazole, pH 7.9; 2X 필터 세척 용액: 40mM Tris-HCl, 1M NaCl, 120mM imidazole, pH 7.9; DNA 앱타머 용출 용액: 1X 앱타머 선별 용액.
The composition of each solution used in SELEX was as follows. Namely, 2X aptamer sorting solution: 40 mM Tris-HCl, 1 M NaCl, 10 mM imidazole, pH 7.9; 2X filter wash solution: 40 mM Tris-HCl, 1 M NaCl, 120 mM imidazole, pH 7.9; DNA aptamer eluting solution: 1X aptamer selection solution.

2-2. SELEX에 이용될 DNA 앱타머 구조 제작 2-2. DNA aptamer structure construction for SELEX

AFP(Alpha-fetoprotein)에 특이적으로 결합하는 DNA 앱타머를 선별하기 위하여 기 제작 확보한 ssDNA 40㎕에 증류수 60㎕를 첨가하고, 2X DNA 앱타머 선별 용액 100㎕을 첨가한 후 85℃에서 5분간 끓여 변성(Denaturation) 시킨 후, 상온에서 서서히 식혀 ssDNA 앱타머의 안정한 3차원 구조를 형성하였다.
In order to screen DNA aptamers specifically binding to AFP (Alpha-fetoprotein), 60 μl of distilled water was added to 40 μl of ssDNA prepared in advance. 100 μl of 2 × DNA aptamer screening solution was added thereto, After denaturation by boiling for minutes, the mixture was gradually cooled at room temperature to form a stable three-dimensional structure of ssDNA aptamer.

2-3. 니트로셀룰로오스 여과( nitrocellulose filtration ) 기반의 SELEX 방법을 이용한 AFP ( Alpha - fetoprotein )에 특이적으로 결합하는 DNA 앱타머의 선별 2-3. Nitrocellulose filter (nitrocellulose DNA which specifically binds to fetoprotein) - filtration) based AFP (Alpha using the SELEX method Selection of app tamer

AFP에 특이적으로 결합하는 DNA 앱타머 선별에 사용된 AFP는 geneway사의 Human AFP antigen grade native protein을 이용하였다. 이 AFP를 1X PBS로 녹여 1.0μg/10μl(30.3 pmol)의 농도가 되도록 제조하였다. 이후 상기 단계 2-2에서 제조한 ssDNA 앱타머(303 pmol)와 혼합하여 전체 반응 부피를 210㎕로 맞춘 후 4℃에서 12시간 이상 반응시켰다. 이후, AFP와 특이적으로 결합하는 DNA 앱타머만을 특이적으로 선별하기 위하여 먼저, 니트로셀룰로오스 멤브레인 필터(Nitrocellulose Membrane Filter) (0.45 ㎛ HA; Millipore, Billerica, MA)에 AFP와 ssDNA 앱타머 풀을 반응시킨 반응액을 투과시켰으며, 이후, 1X 세척완충액(washing buffer) (20mM Tris-HCl, 500mM NaCl, 60mM imidazole, pH 7.9) 3 ㎖을 이용하여 니트로셀룰로오스 멤브레인 필터를 세척하였다. 세척과정을 통하여 AFP와 결합하지 못한 ssDNA는 제거하였으며, 니트로셀룰로오스 멤브레인 필터를 투과하지 못한 AFP와 결합한 DNA 앱타머는 별도로 회수하였다. 니트로셀룰로오스 멤브레인 필터에 AFP와 결합한 DNA 앱타머의 회수를 위하여 니트로셀룰로오스 멤브레인 필터를 50㎕ 증류수에 넣고 잘게 분쇄한 뒤 85℃에서 5분간 반응시켰고, 회수된 AFP와 결합된 DNA 앱타머에 동일 부피의 PCI (phenol:chloroform:isoamyl alcohol=25:24:1) 용액을 처리하여 AFP를 제거하였다. 이후, PCI 법을 통해 회수한 AFP가 제거된 DNA 앱타머는 회수 용액의 1/10 부피의 3M NaOAc (pH4.5)와 2-3배 부피의 100％ 에탄올을 첨가하여 -70℃에서 1시간 반응시켰고, 이후 반응액을 4℃에서 13,000 rpm으로 20분간 원심 분리하여 AFP와 특이적으로 결합하는 DNA 앱타머만을 회수하였다. 회수한 DNA는 85℃에서 건조시킨 후, 50㎕의 증류수에 녹였다.
AFP, which was used for screening DNA aptamer specifically binding to AFP, was used by geneway human AFP antigen grade native protein. The AFP was dissolved in 1X PBS to give a concentration of 1.0 μg / 10 μl (30.3 pmol). Then, the mixture was mixed with the ssDNA aptamer (303 pmol) prepared in the step 2-2 to adjust the total reaction volume to 210 μl, followed by reaction at 4 ° C for 12 hours or longer. Then, in order to specifically select only a DNA aptamer that specifically binds to AFP, AFP and an ssDNA aptamer pool were first reacted with a nitrocellulose membrane filter (0.45 占 퐉 HA; Millipore, Billerica, MA) The nitrocellulose membrane filter was then washed with 3 ml of 1X washing buffer (20 mM Tris-HCl, 500 mM NaCl, 60 mM imidazole, pH 7.9). Through the washing process, ssDNA that could not bind to AFP was removed, and DNA aptamer bound to AFP which could not pass through nitrocellulose membrane filter was recovered separately. To recover the DNA aptamer bound to the nitrocellulose membrane filter, a nitrocellulose membrane filter was added to 50 μl of distilled water and finely crushed. The mixture was reacted at 85 ° C for 5 minutes. The DNA aptamer bound to the recovered AFP AFP was removed by treatment with a solution of PCI (phenol: chloroform: isoamyl alcohol = 25: 24: 1). Then, AFP-removed DNA aptamer recovered through PCI method was reacted with 1/10 volume of 3M NaOAc (pH 4.5) and 2-3 times volume of 100% ethanol for recovery for 1 hour at -70 ° C Then, the reaction solution was centrifuged at 13,000 rpm for 20 minutes at 4 ° C to recover only a DNA aptamer that specifically binds to AFP. The recovered DNA was dried at 85 ° C and dissolved in 50 μl of distilled water.

2-4. Negative SELEX을 통한 비특이적 DNA 앱타머 제거 2-4. Elimination of nonspecific DNA aptamers with Negative SELEX

AFP가 아닌 니트로셀룰로오스 필터에 흡착하여 선별된 비특이적인 DNA 앱타머를 제거하기 위하여 SELEX 7회와 8회 사이에 AFP 없이 니트로셀룰로오스 필터에 DNA 앱타머 용액을 흘려주는 네가티브(negative) SELEX을 진행하였다. 1X 앱타머 선별 용액을 이용하여 활성화된 니트로셀룰로오스 필터에 상온에서 냉각시켜 구조가 형성된 ssDNA 앱타머를 반응시킨 후, 니트로셀룰로오스 필터에 결합하지 않고 통과되어 나온 DNA 앱타머 용액을 8회 SELEX에 이용하였다. 이후 SELEX는 총 10회까지 진행하였으며, SELEX의 결합 조건은 횟수가 증가할수록 ssDNA 앱타머와 AFP의 반응 시간을 줄였으며, 횟수가 거듭될수록 반응 조건을 엄격하게 하여 표적 물질인 AFP에 더욱 특이적으로 결합하는 앱타머를 얻고자 하였다.
In order to remove non-specific DNA aptamer adsorbed on the non-AFP nitrocellulose filter, a negative SELEX was performed in which a DNA aptamer solution was flowed into a nitrocellulose filter without AFP between 7 and 8 times of SELEX. The nitrocellulose filter activated with 1X aptamer screening solution was cooled at room temperature to react with the ssDNA aptamer having the structure, and the DNA aptamer solution passed through the nitrocellulose filter without being bound to the nitrocellulose filter was used for SELEX 8 times . After SELEX, the reaction time of ssDNA aptamer and AFP was decreased as the number of times of SELEX was increased. As the number of times was increased, the reaction conditions were tightened and the specificity of the target substance AFP was more specifically We wanted to get a combat aptamer.

실시예 3: 나노 드롭(Nanodrop)을 이용한 각 라운드의 친화성 확인 Example 3: Confirmation of affinity of each round using nanodrop

SELEX를 10회 까지 마친 후 SELEX 진행 여부 및 각 라운드에서 용리된 ssDNA 앱타머의 친화성을 정량적으로 확인하기 위하여 각 라운드에서 용리된 ssDNA의 농도를 나노 드롭(Nano drop)을 이용하여 측정하였다. 나노 드롭(Nano drop)을 활용하여 각 라운드에서 용리된 ssDNA 앱타머 농도를 측정한 결과, 9 라운드의 농도가 215.6 ng/㎕로 가장 높았으며, 10 라운드의 농도는 189.1 ng/㎕로 9 라운드의 결과 보다 농도가 떨어지는 것을 확인할 수 있었으며, 이를 통하여 AFP에 가장 특이적으로 결합하는 최적 앱타머 풀은 9 라운드 풀임을 확인할 수 있었다(도 2 참고).
After completion of the SELEX 10 times, the concentration of ssDNA eluted in each round was measured using a nano drop in order to quantitatively confirm the progress of SELEX and the affinity of eluted ssDNA aptamer in each round. The concentration of ssDNA aptamer eluted in each round was measured by using nano drop. As a result, the concentration of 9 rounds was the highest at 215.6 ng / μl, and the concentration of 10 rounds was 189.1 ng / The concentration was lower than the result, and it was confirmed that the optimal aptamer pool most specifically binding to AFP was a pool of 9 rounds (see FIG. 2).

실시예 4: 실시간(Real time) PCR 기법을 이용한 최적 라운드 확인Example 4: Determination of optimal round using real time PCR

SELEX를 10회까지 마친 후 SELEX 진행 여부 및 각 라운드에서 용리된 DNA 앱타머의 친화성을 정량적으로 확인하기 위하여 실시간 PCR을 수행하였다. 먼저 초기 DNA 라이브러리와 네가티브(negative) SELEX 이후인 8 라운드, 9 라운드, 10 라운드에서 용리된 각각의 ssDNA 앱타머들을 PCR을 통하여 증폭하고, 비대칭 PCR을 진행하여 ssDNA를 확보하였다. 각 0, 8, 9, 10 라운드에서 확보된 ssDNA 앱타머는 동일한 농도로 준비하여 동일한 농도의 AFP와 4℃에서 12시간 이상 반응시켰다. 반응액은 니트로셀룰로오스 멤브레인 필터(nitrocellulose membrane filter)에 투과시킨 후, 1X 세척 완충액(washing buffer) 3 ㎖을 이용하여 니트로셀룰로오스 멤브레인 필터를 세척하였다. 세척 과정을 통하여 AFP와 결합하지 못한 ssDNA는 제거하였으며, 니트로셀룰로오스 멤브레인 필터를 투과하지 못한 AFP와 결합한 DNA 앱타머는 따로 회수하였다. 니트로셀룰로오스 멤브레인 필터에 AFP와 결합한 DNA 앱타머의 회수를 위하여 니트로셀룰로오스 멤브레인 필터는 50 ㎕의 증류수에 넣고 잘게 분쇄한 뒤 85℃에서 5분간 반응시켰으며, 회수된 AFP와 결합된 DNA 앱타머에 동일 부피의 PCI를 처리하여 AFP를 제거하였다. 이후, PCI 법을 통해 회수한 AFP가 제거된 DNA 앱타머는 회수 용액의 1/10 부피의 3M NaOAc (pH4.5)와 2-3배 부피의 100％ 에탄올을 첨가하여, -70℃에서 1시간 반응시켰고, 이후 반응액을 4℃에서 13,000 rpm으로 20 분간 원심 분리하여 AFP에 특이적으로 결합하는 DNA 앱타머만을 회수하였다. 회수된 DNA는 85℃에서 건조시킨 후, 50㎕의 증류수에 녹였다. 이를 통하여 획득된 각 ssDNA들은 각각 100, 10-1, 10-2로 희석하여 실시간 PCR의 주형 DNA로 사용하였다. 실시간 PCR은 Biorad사의 iQ SYBR Green Supermix(Bio-rad, USA)를 이용하였으며, 실시간 PCR 반응 조건은 먼저, 94℃에서 5분 변성 이후, 94℃에서 20초, 52℃에서 20초, 그리고 72℃에서 20초간 반응하는 과정을 40주기 반복한 후, 72℃에서 5분간 연장시키는 반응 조건으로 반응을 진행하였다. 실시간 PCR 결과는 10-2로 희석된 샘플을 주형 DNA로 이용한 실험에서 결과를 획득할 수 있었다. 실시간 PCR 효율은 각 라운드별로 각각 71.66％, 72.4％, 56.45％였으며, 8 라운드와 10 라운드에서 획득한 ssDNA를 주형 DNA로 이용한 실시간 PCR 결과 효율은 71.66％, 56.45％로 9 라운드의 결과 보다 효율이 떨어지는 것으로 보아 더 이상 SELEX를 진행이 필요 없음을 확인할 수 있었다(표 1 참고). 이는 나노 드롭(Nano drop)을 이용하여 확인한 각 라운드별 회수 앱타머양 측정 결과와도 일치하는 결과임을 확인할 수 있었다. 나노 드롭(Nano drop) 결과 및 실시간 PCR 결과를 통하여 9 라운드의 앱타머 풀이 AFP와 결합 효율이 가장 높은 것을 확인할 수 있었다. Real-time PCR was performed to confirm the progress of SELEX progression and the affinity of eluted DNA aptamer quantitatively after completing up to 10 times of SELEX. First, the ssDNA aptamers eluted in 8 rounds, 9 rounds, 10 rounds after the initial DNA library and negative SELEX were amplified by PCR and asymmetric PCR was performed to obtain ssDNA. The ssDNA aptamers obtained at 0, 8, 9, and 10 rounds were prepared at the same concentration and reacted with the same concentration of AFP at 4 ° C for 12 hours or more. The reaction solution was passed through a nitrocellulose membrane filter, and then the nitrocellulose membrane filter was washed with 3 ml of 1X washing buffer. Through the washing process, the ssDNA that could not bind to AFP was removed, and the DNA aptamer bound to AFP which could not pass through the nitrocellulose membrane filter was recovered separately. In order to recover the DNA aptamer bound to AFP in the nitrocellulose membrane filter, the nitrocellulose membrane filter was placed in 50 μl of distilled water, finely crushed, and reacted at 85 ° C for 5 minutes. The DNA aptamer bound to the recovered AFP The AFP was removed by treating the volume of PCI. Then, AFP-removed DNA aptamer recovered through the PCI method was recovered by adding 1/10 volume of 3M NaOAc (pH 4.5) to the recovery solution and 2-3 times volume of 100% ethanol, And then the reaction solution was centrifuged at 4,000 rpm at 13,000 rpm for 20 minutes to recover only the DNA aptamer that specifically binds to AFP. The recovered DNA was dried at 85 ° C and dissolved in 50 μl of distilled water. Each of the obtained ssDNAs was diluted to 10 0 , 10 -1 and 10 -2 , respectively, and used as a template DNA for real-time PCR. Real-time PCR was performed at 94 ° C for 20 sec, at 52 ° C for 20 sec, and at 72 ° C for 5 min at 94 ° C for real-time PCR using iQ SYBR Green Supermix (Bio-Rad, USA) For 20 seconds. The reaction was continued for 40 minutes at 72 ° C for 5 minutes. Real-time PCR results could be obtained the results from the experiments with the samples diluted to 10-2 to the template DNA. The real-time PCR efficiency was 71.66%, 72.4% and 56.45% for each round. The efficiency of real-time PCR using ssDNA obtained in 8 rounds and 10 rounds was 71.66% and 56.45% (See Table 1). It is confirmed that this result is consistent with the results of the avalanche measurement of each round by using nano drop. Nano drop results and real - time PCR results showed that the 9 - round aptamer pool showed the highest binding efficiency with AFP.

8R (1 X 10-2) 8R (1 X 10 -2 ) 9R (1 X 10-2) 9R (1 * 10 -2 ) 8R (1 X 10-2) 8R (1 X 10 -2 ) Efficiency(％) Efficiency (%) 71.6671.66 72.472.4 56.4556.45 C(t)C (t) 9.749.74 8.088.08 9.029.02

실시예Example 5:  5: AFPAFP 와 특이적으로 결합하는 ≪ / RTI > DNADNA 앱타머Aptamer 후보군의  Candidate's 클로닝Cloning

나노 드롭(Nano drop)과 실시간 PCR를 통하여 AFP와 결합 효율이 가장 높은 것으로 판단된 9 라운드의 ssDNA 앱타머 풀에 대해 정방향 프라이머: 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-3'(서열목록 제20서열)와 역방향 프라이머: 5'-비오틴-AGATTGCACTTACTATCT-3'(서열목록 제21서열)를 이용한 PCR 수행으로 dsDNA를 획득하였다. 이렇게 획득한 dsDNA는 QIAGEN의 PCR 클로닝 키트를 이용하여 클로닝을 수행하였다. 클로닝은 T-벡터 (50 ng/㎕) 1㎕와 PCR 산물 (20ng/㎕) 4㎕, 라이게이션 마스터 믹스 버퍼 5㎕를 섞어서 16℃에서 30분 동안 반응시키는 조건을 이용하였다. TA 클로닝한 라이게이터(ligater) 10㎕는 200㎕의 DH5α와 섞은 후 42℃에서 1분 30초 동안 열충격(heat shock)을 주고 얼음에 놓아두었다. 여기에 800㎕의 LB broth를 첨가한 후, 37℃에서 1시간 동안 배양하였다. 배양한 후, 200㎕의 용액을 취하여 암피실린(ampicillin, 50㎍/ml), 카나마이신(kanamycin, 50㎍/ml), X-gal(50㎍/ml), IPTG(5㎍/ml)이 포함되어 있는 LB 배양 플레이트(LB plate)에 스프레딩하고, 37℃에서 15시간 동안 배양시킨 후, 40 개의 흰색 콜로니만을 선별하여 솔젠트(solgent, Korea)에 의뢰하여 앱타머의 염기서열을 결정하였으며, 서열 분석을 통하여 중복되지 않는 서열 18개의 AFP 결합 DNA 앱타머 18개를 확보할 수 있었다. 아래 표 2는 니트로셀룰로오스 여과(nitrocellulose filtration) 기반의 SELEX 방법을 활용하여 획득한 AFP 결합 DNA 앱타머 후보군 18개에 대한 서열을 나타낸 것이다. 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-3 '(SEQ ID NO: 20 sequence) and reverse primer (SEQ ID NO: 20) were prepared for the 9 rounds of ssDNA aptamer pool determined to have the highest binding efficiency with AFP through nano drop and real- : 5'-biotin-AGATTGCACTTACTATCT-3 '(SEQ ID No. 21 sequence). The dsDNA thus obtained was cloned using a QIAGEN PCR cloning kit. For cloning, 1 μl of T-vector (50 ng / μl), 4 μl of PCR product (20 ng / μl) and 5 μl of Ligation Master Mix Buffer were mixed and reacted at 16 ° C for 30 minutes. 10 [mu] l of the TA cloned ligater was mixed with 200 [mu] l of DH5 [alpha] and heat shocked at 42 [deg.] C for 1 minute and 30 seconds and placed on ice. 800 占 퐇 of LB broth was added thereto, followed by incubation at 37 占 폚 for 1 hour. After culturing, 200 μl of the solution was treated with ampicillin (50 μg / ml), kanamycin (50 μg / ml), X-gal (50 μg / ml) and IPTG (LB plate), and cultured at 37 DEG C for 15 hours. Then, only 40 white colonies were selected, and the base sequence of aptamer was determined by solgent (Korea) Analysis showed that 18 AFP-binding DNA aptamers could be sequenced without duplication. Table 2 below shows sequences for 18 AFP-binding DNA aptamer candidates obtained by using a SELEX method based on nitrocellulose filtration.

클론 명칭Clone name 선별된 서열 Selected sequence 서열크기 (bp)Sequence size (bp) AFP-1AFP-1 TCTGGAGCATTTCATTTTGTTTGGTCCACTGTCTAGTCGG (서열목록 제1서열)TCTGGAGCATTTCATTTTGTTTGGTCCACTGTCTAGTCGG (SEQ ID No. 1) 4040 AFP-2AFP-2 ATTCGACCTAACGCTCTCAAAGCGCATATTCGCGATAC (서열목록 제2서열)ATTCGACCTAACGCTCTCAAAGCGCATATTCGCGATAC (SEQ ID No. 2) 3838 AFP-3AFP-3 CAGGGTTCAACCCAACATCCCAACATTTTCTTTTGTCGGG (서열목록 제3서열)CAGGGTTCAACCCAACATCCCAACATTTTCTTTTGTCGGG (SEQ ID No. 3) 4040 AFP-4AFP-4 CCACGAAAATACGCTGAATGGTTGTTAAAAGAACTACGCA (서열목록 제4서열)CCACGAAAATACGCTGAATGGTTGTTAAAAGAACTACGCA (SEQ ID No. 4) 4040 AFP-5AFP-5 ACATTTCTACCCACAGGGACTATTCGGCCTCCGTTGACCG (서열목록 제5서열)ACATTTCTACCCACAGGGACTATTCGGCCTCCGTTGACCG (SEQ ID No. 5) 4040 AFP-6AFP-6 CTATGGCCTTCAATTCCATAAGGCATCAGTTCGTGTG (서열목록 제6서열)CTATGGCCTTCAATTCCATAAGGCATCAGTTCGTGTG (SEQ ID NO: 6) 3737 AFP-7AFP-7 CAATCGTACTCGTTCTATAGCTATGGCTAGCTGCTTGCCG (서열목록 제7서열)CAATCGTACTCGTTCTATAGCTATGGCTAGCTGCTTGCCG (SEQ ID NO: 7 sequence) 4040 AFP-8AFP-8 TGTGTAACAGGCCCCAAGGCATGCTCAGCACGCCACTTGG (서열목록 제8서열)TGTGTAACAGGCCCCAAGGCATGCTCAGCACGCCACTTGG (SEQ ID No. 8) 4040 AFP-9AFP-9 GATCTGTTCCTGACCTCGCCGCTATGTCGAGTAATTTCG (서열목록 제9서열)GATCTGTTCCTGACCTCGCCGCTATGTCGAGTAATTTCG (SEQ ID NO: 9) 3939 AFP-10AFP-10 TTATTAGGATCGTAAGAACCGTGCACCCCTTTTTGTGCG (서열목록 제10서열)TTATTAGGATCGTAAGAACCGTGCACCCCTTTTTGTGCG (SEQ ID NO: 10) 3939 AFP-11AFP-11 CTAACCACCGGTACGGGCAACTATGTTTGCTTTCGTCGCA (서열목록 제11서열)CTAACCACCGGTACGGGCAACTATGTTTGCTTTCGTCGCA (SEQ ID NO: 11) 4040 AFP-12AFP-12 CTCTACTCCGACTATAAGGCGGTGGGTATTAAACCTCCTG (서열목록 제12서열)CTCTACTCCGACTATAAGGCGGTGGGTATTAAACCTCCTG (SEQ ID NO: 12) 4040 AFP-13AFP-13 CTTTTGTACACCGACTCAGTTCGTGTATCAACTTTGGTC (서열목록 제13서열)CTTTTGTACACCGACTCAGTTCGTGTATCAACTTTGGTC (SEQ ID NO: 13 sequence) 3939 AFP-14AFP-14 TCTGTGCACTCAGTAGTTGTGCTCCATAATCATGGCTGCA (서열목록 제14서열)TCTGTGCACTCAGTAGTTGTGCTCCATAATCATGGCTGCA (SEQ ID No. 14) 4040 AFP-15AFP-15 CTTCCTACGACCGTTTCAACGTGGTGCCCCCACCAACAGCG (서열목록 제15서열)CTTCCTACGACCGTTTCAACGTGGTGCCCCCACCAACAGCG (SEQ ID NO: 15 sequence) 4141 AFP-16AFP-16 CTCTGGTAGTGTTCAACTTTTCATGCAATCTTTATCGGTG (서열목록 제16서열)CTCTGGTAGTGTTCAACTTTTCATGCAATCTTTATCGGTG (SEQ ID NO: 16 sequence) 4040 AFP-17AFP-17 CCGCCAGAAGGTGCCAAAGCCGGACAAACCTGCGGAACGA (서열번호 제17서열)CCGCCAGAAGGTGCCAAAGCCGGACAAACCTGCGGAACGA (SEQ ID NO: 17 sequence) 4040 AFP-18AFP-18 GCTACCGGGCCTACGTCCGGTTGCCCTCGCTCCACTTAGT (서열번호 제18서열)GCTACCGGGCCTACGTCCGGTTGCCCTCGCTCCACTTAGT (SEQ ID NO: 18 sequence) 4040

실시예Example 6:  6: AFPAFP 결합  Combination DNADNA 앱타머의Of app tamer 구조 결정  Structure determination

AFP 결합 DNA 앱타머 후보군들의 구조는 Rensselear polytechnic institute에서 제공하는 DNA mfold 프로그램을 활용하여 이미지화 할 수 있었다(도 3a 내지 도 3e 참고).
The structures of the AFP-binding DNA aptamer candidates could be imaged using the DNA mfold program provided by the Rensselear polytechnic institute (see Figures 3a-3e).

실시예 7: SPR을 이용한 AFP와 결합하는 앱타머 후보군의 친화도 테스트Example 7: Affinity test of candidate aptamer binding to AFP using SPR

7-1. AFP에 특이적으로 결합하는 앱타머 후보군들의 각 친화도를 정량하기 위한 AFP가 코팅된 센서 칩 제작 실험 7-1. AFP-coated sensor chip fabrication experiment to quantify each affinity of aptamer candidates specifically binding to AFP

AFP와 상기 실시예 6에서 획득한 앱타머 후보군과의 친화도를 정량하기 위하여, 본 발명자들은 SPR 검출 시스템 기기인 BIAcore 3000(BIACORE)을 이용하여 표면 플라즈몬 공명(Surface Plasmon Resonance, SPR) 실험을 실시하였다. AFP와 앱타머 후보군과의 친화도를 정량하기 위하여 표면이 카르복실기로 코팅된 센서 칩 CM5(GE Healthcare)을 이용하였다. 센서 칩 CM5는 0.1M N-hydroxysuccinimide (NHS)와 0.4 M N-ethyl-N'-(dimethyl aminopropyl)carbodiimide(EDC) 혼합액을 5㎕/min의 속도로 10분 동안 칩에 흘려 활성화시켜 카르복실기를 반응성이 더 좋은 N-히드록시석신이미드 에스테르(N-hydroxysuccinimide ester)로 바꾸어주었다. NHS-에스테르(ester)로 활성화된 센서 칩 CM5의 표면에 AFP를 고정하기 위하여 10 mM 소디엄 아세테이트(sodium acetate)(pH 5.0) 완충액에 100 ㎍/㎖의 농도로 녹아 있는 AFP 용액을 5㎕/min의 속도로 10분 동안 처리하여 칩 표면을 AFP로 코팅하였다(도 4 참고). AFP가 고정된 센서 칩은 1M 에탄올아민 하이드로클로라이드(pH 8.5)를 5㎕/min의 속도로 10분 동안 칩에 흘려줌으로써 남아 있는 반응기를 불활성시켰다. 이를 통하여 다른 시약 및 DNA 앱타머가 칩 표면에 직접 결합하는 것을 방지하였으며, 각 실험 후 센서 칩은 10 mM EDTA로 재생시켰다. 속도 변수는 BIA 평가프로그램(BIACORE)으로 수득, 정량하였다.
In order to quantify the affinity between the AFP and the aptamer candidate group obtained in Example 6, the present inventors conducted a surface plasmon resonance (SPR) experiment using BIAcore 3000 (BIACORE) which is an SPR detection system device Respectively. A sensor chip CM5 (GE Healthcare) whose surface was coated with a carboxyl group was used to quantify affinity between AFP and aptamer candidate group. The sensor chip CM5 was activated by flowing a mixture of 0.1 M N-hydroxysuccinimide (NHS) and 0.4 M N-ethyl-N '- (dimethylaminopropyl) carbodiimide (EDC) Was converted into the better N-hydroxysuccinimide ester. To immobilize AFP on the surface of the sensor chip CM5 activated with NHS-ester, 5 μl / well of AFP solution dissolved in a concentration of 100 μg / ml in 10 mM sodium acetate (pH 5.0) min for 10 minutes to coat the chip surface with AFP (see FIG. 4). The sensor chip with AFP immobilized inactivated the remaining reactor by flowing 1M ethanolamine hydrochloride (pH 8.5) at the rate of 5 μl / min into the chip for 10 minutes. This prevented other reagents and DNA aptamers from binding directly to the chip surface. After each experiment, the sensor chip was regenerated with 10 mM EDTA. Rate variables were obtained and quantified by the BIA evaluation program (BIACORE).

7-2. AFP 결합 DNA 앱타머 후보군의 친화력 측정 7-2. Affinity measurement of AFP-binding DNA aptamer candidates

AFP에 가장 높은 친화력을 가지는 앱타머를 선별하기 위하여 확보된 AFP 결합 DNA 앱타머 후보군은 HBS2P 버퍼(GE Healthcare)에 각 1μM, 2μM, 3μM의 농도로 녹여 준비하였다. 제작된 DNA 앱타머는 아무것도 결합시키지 않은 센서칩(채널 1), AFP가 고정된 센서칩(채널 2)에 DNA 앱타머 후보군을 다양한 농도(각 1μM, 2μM, 3μM)로 주입함으로써 AFP와 AFP 결합 DNA 앱타머 후보군간의 친화도를 정량화할수 있었다. 각 AFP에 결합하는 AFP 결합 DNA 앱타머 후보군의 해리상수 (Kd, dissociation) 수득 결과 AFP 결합 DNA 앱타머 후보군 중 AFP-4 앱타머의 해리상수가 8.87 X 10-11M으로 AFP에 대해 가장 높은 친화도 값을 가지고 있음을 확인 할 수 있었다(표 3 참고). The AFP-binding DNA aptamer candidates obtained for screening the highest affinity aptamers in AFP were prepared by dissolving them in HBS2P buffer (GE Healthcare) at concentrations of 1 μM, 2 μM and 3 μM, respectively. The DNA aptamers were prepared by injecting DNA aptamer candidates at various concentrations (1 μM, 2 μM, and 3 μM each) into a sensor chip (channel 1) and AFP-immobilized sensor chip (channel 2) We were able to quantify the affinity between the aptamer candidates. A dissociation constant of the AFP-binding DNA aptamer candidate group binding to each AFP was obtained. As a result, the dissociation constant of AFP-4 aptamer among AFP-binding DNA aptamer candidate groups was 8.87 X 10 -11 M, (See Table 3).

Figure 112011010392135-pat00001
Figure 112011010392135-pat00001

7-3. SPR 분석을 통한 AFP 항체와 AFP 간의 친화력 측정 7-3. Determination of affinity between AFP antibody and AFP through SPR analysis

AFP 항체와 AFP 결합 DNA 앱타머간의 친화력 차이를 확인하기 위하여 AFP가 코팅되어 있는 센서칩에 AFP 항체를 농도별로 반응시켰다. AFP 항체는 50nM, 20nM, 10nM, 5nM, 1nM, 0.5nM, 0.1nM의 농도로 준비되었으며, 아무것도 결합되지 않은 센서칩(채널 1)과 AFP가 고정된 센서칩(채널 2)에 20㎕/min의 속도로 2분 동안 주입하였다. 반응 결과 AFP에 대한 AFP 항체의 친화도를 정량화할 수 있었으며, AFP 항체와 AFP간의 결합력에 대한 해리상수(Kd, dissociation)는 1.15 X 10-9M으로 AFP 결합 DNA 앱타머 후보군 보다 높은 친화도 값을 가짐을 확인할 수 있었다.
In order to confirm the difference in affinity between AFP antibody and AFP - bound DNA aptamer, AFP antibody was reacted with AFP - coated sensor chip by concentration. AFP antibody was prepared at a concentration of 50 nM, 20 nM, 10 nM, 5 nM, 1 nM, 0.5 nM and 0.1 nM, and 20 μL / min of the sensor chip (channel 1) For 2 minutes. As a result, the affinity of AFP antibody against AFP could be quantified. The dissociation constant (Kd, dissociation) of the binding force between AFP antibody and AFP was 1.15 X 10 -9 M, which was higher than that of AFP-binding DNA aptamer candidate As shown in Fig.

실시예 8: AFP 결합 앱타머 후보군에 의한 AFP와 AFP 항체간의 결합 저해Example 8: Inhibition of binding between AFP and AFP antibodies by AFP-binding aptamer candidates

AFP 결합 앱타머 후보군이 AFP와 AFP 항체간의 결합을 방해할 수 있는 지를 확인하기 위하여 본 발명자들은 도트 블로팅(dot blotting) 실험을 수행하였다. 이를 위하여 먼저 기 선별하여 확보된 18개의 AFP 결합 앱타머 후보군(150 pmol)과 AFP(1 ng)를 4℃에서 12 시간 이상 반응시켰다. 반응 후 AFP 결합 앱타머 후보군과 AFP 복합체를 메탄올로 활성화시킨 PVDF 멤브레인(membrane)에 스포팅(spotting)하였다. 이어서, PVDF 멤브레인을 PBS(pH 7.2)로 15분 동안 실온에서 세척하였으며, 이후 5％ 탈지유(skim milk)를 이용하여 비특이적인 반응이 일어날 수 있는 멤브레인을 블로킹하였다. 이후, 스포팅이 되어 있는 멤브레인은 AFP 항체, AFP 항체와 특이적으로 결합하는 퍼옥시다아제(peroxidase)가 결합되어 있는 쥐 IgG 항체 순으로 순차적으로 반응을 진행하였으며, 반응과 반응 사이에는 0.5％ Tween 20이 포함되어 있는 PBS를 이용하여, 멤브레인을 세척하였다. 반응이 끝난 멤브레인에서 시그널은 ECL kit (GE Healthcare)를 이용하여 확인하였다(도 5 참고). 이를 통하여 AFP 항체와 AFP 사이의 특이적인 결합 사이트에 결합하는 AFP-5, AFP-18 앱타머를 확인할 수 있었다. 이는 AFP와의 결합력이 높은 것과는 별개의 결과로 AFP 결합 앱타머가 AFP와 AFP 항체 사이의 특이적인 결합을 차단할 수 있음을 확인할 수 있었다(도 5 참고).
In order to confirm whether the AFP-binding aptamer candidate group can interfere with the binding between the AFP and the AFP antibody, the present inventors performed dot blotting experiments. For this purpose, 18 AFP-binding aptamer candidates (150 pmol) and AFP (1 ng) were reacted at 4 ° C for 12 hours or longer. After the reaction, the AFP-bound aptamer candidate group and the AFP complex were spotted on a PVDF membrane activated with methanol. The PVDF membrane was then washed with PBS (pH 7.2) for 15 minutes at room temperature and then blocked with a 5% skim milk to allow for nonspecific reactions. Thereafter, the spotted membrane was sequentially reacted with AFP antibody and rat IgG antibody conjugated with peroxidase specifically binding to AFP antibody, and 0.5% Tween 20 was added between the reaction and reaction The membranes were washed using PBS included. Signals from the reacted membranes were identified using an ECL kit (GE Healthcare) (see FIG. 5). As a result, AFP-5 and AFP-18 aptamers binding to specific binding sites between AFP antibody and AFP were identified. It was confirmed that AFP-bound aptamers can block specific binding between AFP and AFP antibody as a result of being different from high binding affinity with AFP (see FIG. 5).

이상으로 본 발명의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현 예일 뿐이며, 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다. While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the same is by way of illustration and example only and is not to be construed as limiting the scope of the present invention. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.

<110> Chungbuk National University Industry Academic Cooperation Foundation <120> DNA Aptamer Specifically Binding to Alpha-fetoprotein and Its Use <160> 21 <170> KopatentIn 1.71 <210> 1 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer binding to AFP <400> 1 tctggagcat ttcattttgt ttggtccact gtctagtcgg 40 <210> 2 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer binding to AFP <400> 2 attcgaccta acgctctcaa agcgcatatt cgcgatac 38 <210> 3 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA Aptamer binding to AFP <400> 3 cagggttcaa cccaacatcc caacattttc ttttgtcggg 40 <210> 4 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer binding to AFP <400> 4 ccacgaaaat acgctgaatg gttgttaaaa gaactacgca 40 <210> 5 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer binding to AFP <400> 5 acatttctac ccacagggac tattcggcct ccgttgaccg 40 <210> 6 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer binding to AFP <400> 6 ctatggcctt caattccata aggcatcagt tcgtgtg 37 <210> 7 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer binding to AFP <400> 7 caatcgtact cgttctatag ctatggctag ctgcttgccg 40 <210> 8 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer binding to AFP <400> 8 tgtgtaacag gccccaaggc atgctcagca cgccacttgg 40 <210> 9 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer binding to AFP <400> 9 gatctgttcc tgacctcgcc gctatgtcga gtaatttcg 39 <210> 10 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer binding to AFP <400> 10 ttattaggat cgtaagaacc gtgcacccct ttttgtgcg 39 <210> 11 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer binding to AFP <400> 11 ctaaccaccg gtacgggcaa ctatgtttgc tttcgtcgca 40 <210> 12 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer binding to AFP <400> 12 ctctactccg actataaggc ggtgggtatt aaacctcctg 40 <210> 13 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer binding to AFP <400> 13 cttttgtaca ccgactcagt tcgtgtatca actttggtc 39 <210> 14 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer binding to AFP <400> 14 tctgtgcact cagtagttgt gctccataat catggctgca 40 <210> 15 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer binding to AFP <400> 15 cttcctacga ccgtttcaac gtggtgcccc caccaacagc g 41 <210> 16 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer binding to AFP <400> 16 ctctggtagt gttcaacttt tcatgcaatc tttatcggtg 40 <210> 17 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer binding to AFP <400> 17 ccgccagaag gtgccaaagc cggacaaacc tgcggaacga 40 <210> 18 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer binding to AFP <400> 18 gctaccgggc ctacgtccgg ttgccctcgc tccacttagt 40 <210> 19 <211> 100 <212> DNA <213> Artificial Sequence <220> <223> template DNA for selecting DNA aptamer binding to AFP <400> 19 ggtaatacga ctcactatag ggagatacca gcttattcaa ttnnnnnnnn nnnnnnnnnn 60 nnnnnnnnnn nnnnnnnnnn nnagattgca cttactatct 100 <210> 20 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> PCR forward primer <400> 20 ggtaatacga ctcactatag ggagatacca gcttattcaa tt 42 <210> 21 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> PCR reverse primer <400> 21 agattgcact tactatct 18 <110> Chungbuk National University Industry Academic Cooperation Foundation <120> DNA Aptamer Specifically Binding to Alpha-fetoprotein and Its Use <160> 21 <170> Kopatentin 1.71 <210> 1 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer binding to AFP <400> 1 tctggagcat ttcattttgt ttggtccact gtctagtcgg 40 <210> 2 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer binding to AFP <400> 2 attcgaccta acgctctcaa agcgcatatt cgcgatac 38 <210> 3 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA Aptamer binding to AFP <400> 3 cagggttcaa cccaacatcc caacattttc ttttgtcggg 40 <210> 4 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer binding to AFP <400> 4 ccacgaaaat acgctgaatg gttgttaaaa gaactacgca 40 <210> 5 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer binding to AFP <400> 5 acatttctac ccacagggac tattcggcct ccgttgaccg 40 <210> 6 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer binding to AFP <400> 6 ctatggcctt caattccata aggcatcagt tcgtgtg 37 <210> 7 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer binding to AFP <400> 7 caatcgtact cgttctatag ctatggctag ctgcttgccg 40 <210> 8 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer binding to AFP <400> 8 tgtgtaacag gccccaaggc atgctcagca cgccacttgg 40 <210> 9 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer binding to AFP <400> 9 gatctgttcc tgacctcgcc gctatgtcga gtaatttcg 39 <210> 10 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer binding to AFP <400> 10 ttattaggat cgtaagaacc gtgcacccct ttttgtgcg 39 <210> 11 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer binding to AFP <400> 11 ctaaccaccg gtacgggcaa ctatgtttgc tttcgtcgca 40 <210> 12 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer binding to AFP <400> 12 ctctactccg actataaggc ggtgggtatt aaacctcctg 40 <210> 13 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer binding to AFP <400> 13 cttttgtaca ccgactcagt tcgtgtatca actttggtc 39 <210> 14 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer binding to AFP <400> 14 tctgtgcact cagtagttgt gctccataat catggctgca 40 <210> 15 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer binding to AFP <400> 15 cttcctacga ccgtttcaac gtggtgcccc caccaacagc g 41 <210> 16 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer binding to AFP <400> 16 ctctggtagt gttcaacttt tcatgcaatc tttatcggtg 40 <210> 17 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer binding to AFP <400> 17 ccgccagaag gtgccaaagc cggacaaacc tgcggaacga 40 <210> 18 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer binding to AFP <400> 18 gctaccgggc ctacgtccgg ttgccctcgc tccacttagt 40 <210> 19 <211> 100 <212> DNA <213> Artificial Sequence <220> <223> template DNA for selecting DNA aptamer binding to AFP <400> 19 ggtaatacga ctcactatag ggagatacca gcttattcaa ttnnnnnnnn nnnnnnnnnn 60 nnnnnnnnnn nnnnnnnnnn nnagattgca cttactatct 100 <210> 20 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> PCR forward primer <400> 20 ggtaatacga ctcactatag ggagatacca gcttattcaa tt 42 <210> 21 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> PCR reverse primer <400> 21 agattgcact tactatct 18

Claims (11)

AFP(Alpha-fetoprotein)에 특이적으로 결합하는 DNA 앱타머(aptamer)로서, 상기 DNA 앱타머는 서열목록 제4서열에 개시된 염기서열을 갖는 올리고뉴클레오타이드인 것을 특징으로 하는 DNA 앱타머.
A DNA aptamer that specifically binds to AFP (Alpha-fetoprotein), wherein the DNA aptamer is an oligonucleotide having a nucleotide sequence as set forth in Sequence Listing 4.
삭제delete 삭제delete 제 1 항의 DNA 앱타머를 유효성분으로 포함하는 AFP(Alpha-fetoprotein) 검출용 키트(Kit).
An AFP (Alpha-fetoprotein) detection kit (kit) comprising the DNA aptamer of claim 1 as an active ingredient.
제 1 항의 DNA 앱타머를 유효성분으로 포함하는 간암 또는 생식세포종양의 진단 또는 예후판단용 조성물.
A composition for the diagnosis or prognosis of hepatoma or germ cell tumor comprising the DNA aptamer of claim 1 as an active ingredient.
제 1 항의 DNA 앱타머가 기판상에 고정된 것을 특징으로 하는 간암 또는 생식세포종양의 진단 또는 예후판단용 마이크로어레이.
A microarray for diagnosing or prognosing a liver cancer or germ cell tumor, wherein the DNA aptamer of claim 1 is immobilized on a substrate.
간암 또는 생식세포종양의 진단 또는 예후판단에 필요한 정보를 제공하기 위해 환자의 생물학적 시료로부터 상기 제 1 항의 DNA 앱타머와 AFP(Alpha-fetoprotein)와의 결합 반응을 통해 AFP를 검출하는 방법.
A method for detecting AFP from a biological sample of a patient through binding reaction of AFP (Alpha-fetoprotein) with the DNA aptamer of claim 1 to provide information necessary for diagnosis or prognosis of liver cancer or germ cell tumor.
다음의 단계를 포함하는 AFP가 포함된 시료로부터 AFP(Alpha-fetoprotein)를 분리 및 정제하는 방법:
(a) 상기 제 1 항의 DNA 앱타머가 결합된 지지체에 AFP가 포함된 시료를 접촉시키는 단계; 및
(b) 상기 DNA 앱타머에 결합된 AFP를 분리하는 단계.
A method for separating and purifying AFP (Alpha-fetoprotein) from a sample containing AFP comprising the steps of:
(a) contacting a sample containing AFP to a support to which the DNA aptamer of claim 1 is bound; And
(b) separating the AFP bound to the DNA aptamer.
제 4 항에 있어서, 서열목록 제1서열 내지 제3서열 및 제5서열 내지 제18서열 중 어느 하나에 개시된 염기서열을 갖는 올리고뉴클레오타이드인 DNA 앱타머를 유효성분으로서 더욱 포함하는 것을 특징으로 하는 AFP(Alpha-fetoprotein) 검출용 키트(Kit).
5. The DNA fragment according to claim 4, which further comprises, as an active ingredient, DNA aptamer which is an oligonucleotide having a nucleotide sequence as set forth in any one of SEQ ID NOS: 1 to 3 and 5 to 18, (Alpha-fetoprotein) detection kit.
제 5 항에 있어서, 서열목록 제1서열 내지 제3서열 및 제5서열 내지 제18서열 중 어느 하나에 개시된 염기서열을 갖는 올리고뉴클레오타이드인 DNA 앱타머를 유효성분으로서 더욱 포함하는 것을 특징으로 하는 간암 또는 생식세포종양의 진단 또는 예후판단용 조성물.
6. The method according to claim 5, further comprising, as an effective component, DNA aptamer which is an oligonucleotide having a nucleotide sequence as set forth in any one of SEQ ID NOS: 1 to 3 and 5 to 18 SEQ ID NO: Or a germ cell tumor.
제 6 항에 있어서, 서열목록 제1서열 내지 제3서열 및 제5서열 내지 제18서열 중 어느 하나에 개시된 염기서열을 갖는 올리고뉴클레오타이드인 DNA 앱타머를 유효성분으로서 더욱 포함하는 것을 특징으로 하는 간암 또는 생식세포종양의 진단 또는 예후판단용 마이크로 어레이.
The method of claim 6, further comprising, as an effective component, DNA aptamer which is an oligonucleotide having a nucleotide sequence as set forth in any one of SEQ ID NOS: 1 to 3 and 5 to 18 SEQ ID NO: Or a microarray for the diagnosis or prognosis of germ cell tumors.
KR1020110012878A 2011-02-14 2011-02-14 DNA Aptamer Specifically Binding to Alpha-fetoprotein and Its Use KR101513766B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020110012878A KR101513766B1 (en) 2011-02-14 2011-02-14 DNA Aptamer Specifically Binding to Alpha-fetoprotein and Its Use

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020110012878A KR101513766B1 (en) 2011-02-14 2011-02-14 DNA Aptamer Specifically Binding to Alpha-fetoprotein and Its Use

Publications (2)

Publication Number Publication Date
KR20120092938A KR20120092938A (en) 2012-08-22
KR101513766B1 true KR101513766B1 (en) 2015-04-20

Family

ID=46884716

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020110012878A KR101513766B1 (en) 2011-02-14 2011-02-14 DNA Aptamer Specifically Binding to Alpha-fetoprotein and Its Use

Country Status (1)

Country Link
KR (1) KR101513766B1 (en)

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101460450B1 (en) * 2013-09-05 2014-11-12 충북대학교 산학협력단 DNA aptamer specifically binding to cadmium and uses thereof
KR101541221B1 (en) * 2013-09-26 2015-08-03 충북대학교 산학협력단 DNA aptamer specifically binding to PrfA protein of Listeria monocytogenes and uses thereof
CN107561285B (en) * 2016-03-25 2019-03-22 上海宝藤生物医药科技股份有限公司 A kind of fetoprotein reagent based on nucleic acid aptamer fluorescence probe AFP5
CN111551722A (en) * 2020-05-27 2020-08-18 济南大学 Preparation and application of magnetic sodium alginate composite material with dual functions of recognition and catalysis

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050113297A1 (en) 2003-08-22 2005-05-26 Potentia Pharmaceuticals, Inc. Compositions and methods for enhancing phagocytosis or phagocyte activity

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050113297A1 (en) 2003-08-22 2005-05-26 Potentia Pharmaceuticals, Inc. Compositions and methods for enhancing phagocytosis or phagocyte activity

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
GenBank AC139170.2(2005.4.27)

Also Published As

Publication number Publication date
KR20120092938A (en) 2012-08-22

Similar Documents

Publication Publication Date Title
JP7372927B2 (en) Biomolecular probes and detection methods for detecting gene and protein expression
US9322024B2 (en) Aptamers screening method based on graphene without target immobilization and the aptamers obtained from the method
EP2290100A2 (en) Kits for displacement Sandwich Immuno-PCR
US9487774B2 (en) Compositions, methods, and kits for identifying candidate molecules from encoded chemical libraries
CN109337909B (en) Aptamer for detecting liver cancer drug-resistant cell strain and application thereof
JPWO2015045666A1 (en) Fluid device, exosome analysis method, biomolecule analysis method, and biomolecule detection method
KR101513766B1 (en) DNA Aptamer Specifically Binding to Alpha-fetoprotein and Its Use
KR101759401B1 (en) DNA aptamer specifically binding to SPINK1 protein and Use thereof
KR101670135B1 (en) DNA Aptamer Specifically Binding to LCN2 (Lipocalin 2) protein and Its Use
WO2013020139A1 (en) Aptamer for the capture, diagnosis, enumeration, and eradication of circulating tumor cells
KR101716055B1 (en) Development of new protein detection system using DNA aptamer and uses thereof
KR102403628B1 (en) Method for Obtaining Profiles for Population of Target Molecules of a Sample
KR100930974B1 (en) DNA aptamer binding to Retinol Binding Protein 4 with specificity and production method thereof
KR101541221B1 (en) DNA aptamer specifically binding to PrfA protein of Listeria monocytogenes and uses thereof
KR101716054B1 (en) DNA Aptamer Specifically Binding to Cystatin B protein and Uses Thereof
KR101372362B1 (en) DNA Aptamer Specifically Binding to Invasion Plasmid Antigen H Protein from Shigella sonnei and Its Use
KR102498862B1 (en) Method for analyzing exosomes in liquid biopsy sample
KR102029803B1 (en) DNA Aptamer Specifically Binding to Prathyroid Hormone and Uses Thereof
KR101069590B1 (en) Single-stranded DNA aptamers specifically binding to CEA
KR101901025B1 (en) DNA Aptamer Specifically Binding to HbA1c protein and Uses Thereof
KR102177672B1 (en) Multiplex PCR method using Aptamer
US9890418B1 (en) Method of detecting nucleic acids with enhanced signal using dual-functional capture particles
KR101651212B1 (en) DNA Aptamer Capable of Specifically Binding to Surface of Living Cell of Shigella sonnei and Uses Thereof
JP2021171047A (en) Complex of lna probe and graphene oxide and nucleic acid detection method using the same
KR20230057233A (en) Method of Detecting Target RNA Molecule and Target Protein Simultaneously and Kit for the Same Method

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
FPAY Annual fee payment

Payment date: 20190510

Year of fee payment: 5

R401 Registration of restoration