KR101229878B1 - Composition for the treatment of alcoholism comprising a rice or its extracts - Google Patents

Abstract

The present invention relates to a composition for preventing and treating alcoholism, including rice, rice pears or extracts thereof, including new varieties Milyang 263.
Milyang No. 263 provided by the present invention is a rice plant having a giant black pear giant including a giant pear development gene, and has improved the maturation problem of the conventional pear cultivars. Contains ingredients In particular, the rice, including Miryang No. 263 is effective in the prevention and treatment of alcoholism by the functional ingredient can be used in pharmaceutical compositions or health foods, can create a new demand of rice and enhance the competitiveness of the rice industry.

Description

Composition for the treatment of alcoholism comprising a rice or its extracts}

The present invention relates to a composition for preventing and treating alcoholism, including rice, rice pears or extracts thereof, including new varieties Milyang 263.

Alcoholism is a chronic disease that comes from a variety of genetic, psychological and environmental factors. According to the current state of alcoholism-related harm in Korea, the lifetime prevalence of alcohol use disorder combined with alcohol abuse and alcohol dependence is estimated to be 16.2% of the population (2006, Ministry of Health and Welfare), and the one-year prevalence rate is 5.6%. It is estimated at 1.8 million. In addition, the socio-economic loss costs such as medical expenses, early death, damage to property, and productivity decline caused by alcohol consumption amounted to 23.43 trillion won (2.8% of GDP) in 2006. In particular, the direct and indirect medical expenses due to drinking alcohol increased by 1.9 times from four trillion 200 billion won (2005) to 6.11 trillion won (2009). (2010, National Health Insurance Corporation).

The prevalence of alcoholics in Korea is world-class, and there is no reason to explain clearly other than the social drinking culture based on the high prevalence of alcoholics. Currently, there is no treatment for alcoholism other than some therapeutic drugs (naltrexone, acamprosate, etc.) in parallel with the psychological approach.

Natural plants have attracted much attention as a source of physiologically active substances including antioxidants, anti-inflammatory and anti-cancer, and antioxidants in natural plants play an important role for the detoxification of free radicals generated in vivo. It has been found to be a system for preventing the occurrence of oxygen, a system for stabilizing free radicals rapidly, and a system for regenerating damage caused by free radicals.

 Anthocyanin in black rice known as black rice is known to be effective in preventing cancer and strengthening immunity in addition to the strong antioxidant effects mentioned above. Black rice is rich in minerals and has alkalinity. Alkaline foods are effective in preventing various inflammatory diseases by neutralizing the body oxidized with various pollutants and food oxides. In particular, the highest content of selenium in minerals, selenium in black rice is known to not only activate hepatocytes but also inhibit hepatocyte destruction.

 Glutinous rice is equivalent to non-glutinous rice, also called nami (?? 米) or spice (?? 米). Normally, non-rice cooked rice is translucent, and the glutinous rice is milky opaque and can be distinguished. In addition, starch of glutinous rice is mostly composed of amylopectin, and glutinous rice is known to have high stickiness and digestion better than non-glutinous rice. Recently, the prolamin component of glutinous rice extract has been reported to be effective in gastric ulcer.

Giant embryos, which contain most of the functional ingredients of rice, are 2 to 5 times larger than normal seeds. Antioxidant vitamins such as retinol, lutein, tocopherol, lysine, riboflavin, thiamine, phytosterol and palmic acid, and oleic acid It is known that the content of various functional ingredients such as hypertension prevention and neurostable substance gamma-aminobutyric acid (GABA) is superior to other varieties.

Recent reports have shown that the removal of free radicals by antioxidants plays an important role in the metabolism of gamma-aminobutyric acid (GABA) in the brain.

On the other hand, the rice industry is currently facing a serious crisis due to an increase in rice imports, a decrease in domestic rice cultivation area, and a decrease in rice consumption. However, demand for functional rice is increasing significantly along with the increasing interest in the health of the people. Therefore, in order to foster a competitive rice industry, it is urgent to develop various functional rice varieties that improve the quality of rice and meet the needs of consumers.

Giant rice cultivars among functional rice cultivars have been developed by treating seeds with mainly MNU (Hong et al., 2006; Hirosh et al., 2001) or gamma rays (Kageyama et al., 2001). Giant embryo genes are located on chromosome 7 of rice (Nagasawa, 2002; Koh, 1996) and are known to be caused by mutations in cytochrome P450 gene specific sequences (Cahoon et al., US Patent No Us 2003/0126645). A1).

However, such huge baechu rice varieties known to this time is not large enough to the size of the pear and poor ripening is disadvantageous to mechanical harvesting, such as combines, there is a disadvantage in somewhat falling in the characteristics of cooking and sensory. In addition, it is necessary to further enhance the nutritional components such as anthocyanin, the situation is required to develop a new breed that can solve this.

Accordingly, the present inventors studied to overcome the problems of the prior art as described above, to complete the present invention by finding that the rice, pear or extract of rice, including the superior system rice is effective in preventing and treating alcohol poisoning. It became.

Accordingly, an object of the present invention is to solve the disadvantages of the existing varieties, and provides a composition for preventing and treating alcoholism comprising a grain of rice or extracts thereof, including a rice plant having a black bolster giant pear with enhanced nutritional ingredients, etc. will be.

The present invention features a composition for preventing or treating alcoholism, including rice, rice pears or extracts thereof.

In another aspect, the present invention is characterized by another health food for preventing or improving alcoholism, including rice, rice pear or extract thereof.

Milyang No. 263 provided by the present invention is a rice plant having a giant black pear giant including a giant pear development gene, and has improved the maturation problem of the conventional pear cultivars. Contains ingredients In particular, the rice, including Miryang No. 263 is effective in the prevention and treatment of alcoholism by the functional ingredient can be used in pharmaceutical compositions or health foods, can create a new demand of rice and enhance the competitiveness of the rice industry.

Figure 1 is a grain photograph showing the size and brown color of the pear of the Black Shrimp giant pear rice plant 'Miyang No. 263'.
Figure 2 is a diagram showing the amino acid sequence of the ge ^t gene involved in the development of the giant embryo and the portion where the mutation occurred.
3 is a comparative graph showing the change in alcohol intake during the entire experiment period by type of brown rice for the alcoholic rats.
Figure 4 is a comparison graph showing the change in alcohol intake during the entire experimental period for the type of germinated brown rice crushed for alcoholic rats.

The present invention relates to a composition for preventing or treating alcoholism including rice, rice pears or extracts thereof. Specifically, the pear seed rice 'YR23517Acp79' is used as a model and the black rice rice variety 'Josaeng Black Sack' is used as a copy. It is related to the alcohol poisoning prevention and treatment effect of rice, including 'Miyang No. 263', a rice plant chain with a large black pear cultivation by artificial breeding.

In the present invention, the embryo (胚) may be named as an embryo, seed as a part of the future plant in the plant seed tissue.

'Miyang No. 263' provided by the present invention is a rice plant having a giant black pear embryo containing a genomic development gene ge ^t mutated to a gene sequence of cytochrome P450 by cultivating rice pollen, and the present invention is the plant It provides a composition for preventing or treating alcoholism comprising the grains themselves or extracts thereof.

Hereinafter, the present invention will be described in detail.

First, 'YR23517Acp79' used as a model in the present invention may be selected by the following process as a rice seed having a huge pear.

1) Rice varieties Cultivated hybrid plants (YR23517) artificially cross-cultured using Hwachung rice as a model and Sangjuchal rice as a copy.

2) After collecting ear which shows pollen development status in the early and middle stage of the first nuclear stage, the medicine is cultured according to the usual method.

3) The collected ear is soaked in N6-Y2 medium containing 2ppm NAA, 0.2ppm cinetin, etc., and then low-temperature treated for 15 days, followed by incubation at 25 ° C for 30-40 days to induce callus.

4) The transferred callus is transferred to N6-Y2 medium containing 0.2 ppm IAA, 2 ppm cinetin, etc., and cultured for about 30 days to regenerate the plant.

5) Plants are transplanted into culture bottles to induce root development and transfer to the soil to harvest seeds of each plant.

6) The harvested seeds are transferred back to the soil, and the grain characteristics of each plant are analyzed to select a large pear seedling plant with a large pear (seed).

Giant pear waxy rice 'YR23517Acp79' plant used in the present invention has several tillers in one abandonment, and can be asexually propagated by artificially separating and replanting the bulk of the giant pear ricey plant, Seed propagation is also possible without changing its properties. The YR23517Acp79 has been deposited with the accession number KACC98006P dated February 12, 2009 at the National Institute of Agricultural Science, National Agricultural Science Institute, Seodun-dong, Gwonseon-gu, Suwon-si, Gyeonggi-do, and can be easily obtained through the institution.

Mo I 'YR23517Acp79' is not the characteristics of the endosperm chalseong is not anthocyanins accumulated in gokrip surface brown color has a yellow-white characteristics, look for characteristics of the giant embryonic endosperm is larger by the action of an allele ge ^t ripening is very poor As a result, natural grains have lower disadvantages than ordinary rice varieties.

Therefore, the present invention aims to improve the disadvantage of 'YR23517Acp79' and at the same time to develop a new rice plant that accumulates anthocyanin in brown rice. In order to achieve this purpose, after ripening of 'Jongsaeng Blackchalk', a rice variety of brown rice color with 'YR23517Acp79', after ripening is good at normal rice varieties and accumulated anthocyanin in brown rice, Milyang 263 was raised.

'Chosaeng Blackchal', which is used as a supplement in the present invention, is a new breed bred by the Rural Development Administration and is currently widely used in Korea. The yield is 461kg / 10a on average.

The method for breeding the 'black sheep giant pear rice plant chain' Miyang No. 263 'of the present invention is as follows.

First, the hybrid species (F1) is nurtured by artificially breeding YR23517Acp79 as a model and artificially breeding black crude rice varieties 'Josaeng Blackchal' as a copy. The genes of rice, which govern the macroscopic traits of giant, friable, and anthocyanin biosynthesis, which are the targets for selection in this hybrid, are inherited independently from each other due to their different positions on chromosomes. The probability of selecting is 1/64 in F2, but the hybrid has the wx gene that is both abundant in both the parent and the minor, so all hybrid progeny appear to be ablative, so there is no need to select for the wx gene. Since only a large number of traits and anthocyanin accumulation lines were selected, the theoretical selection probability was greatly increased to 1/16. The seed generation (F2) from the ear of the hybrid of the hybrid (F1) plants was unselected to the third generation (F3) by the general group breeding method, and the hybrid fourth generation (F4 Seed) was harvested by the plants. Harvested fourth generation seeds were published on the pavement by lineage by the general lineage breeding method. When the 4th generation of hybrid plants began to grow and reached ripening stages, some of the seeds deleted in the plants of each strain were removed, and the seeds of the brown rice were observed after removing the seedlings. Plants were identified, and all the seeds deleted from the plants in the system were selected from the fixed strains showing the characteristics of giant pears, and the following year, the productivity test was published.

As a result, YR25277-B-B-314-2, which is a black rice, has a feature of having a large and large pear, and has improved ripeness of seeds, was selected from the fifth generation (F5) of hybridization and named as 'Miyang No. 263'.

Milyang 263 of the present invention was deposited with the accession number KACC98009P dated June 30, 2010 at the National Institute of Agricultural Science, Seodun-dong, Gwonseon-gu, Suwon-si, Gyeonggi-do.

The black rice giant pear rice 'Miyang No. 263' plant used in the present invention has several powders in a single bar, which can be asexually reproduced by artificially separating and replanting the grains of the plants. Reproduction is also possible without changing its properties. In the present invention, the heukchal giant pear rice 'milyang 263' plant is also possible to manufacture by transforming the plant using genetic recombination. Methods that can be adopted for the transformation of rice do not require special limitation, for example, can be used in vitro culture or microprojection impact injection of suspension cells and direct gene uptake or electroporation of protoplasts.

'Black Yang No. 263', a black-hulled giant pear rice plant of the present invention has the amino acid sequence of SEQ ID NO: 3, which is involved in the development of a giant embryo in which the 395th amino acid of cytochrome P450 of rice is modified from tryptophan (W) to leucine (L). (FIG. 2).

SEQ ID NO: 3 is the amino acid sequence of the ge ^t gene, which is an allele involved in the development of a giant embryo of the black rice giant pear rice plant 'Miyang No. 263' included in the present invention. SEQ ID NO: 3 is composed of 520 amino acids, characterized in that the 395th amino acid of the sheet chromium P450 is modified from tryptophan (W) to leucine (L), the rice with the gene is a large pear with an enlarged pear size . The amino acid sequence of SEQ ID NO: 3 can be obtained by using RT-PCR and a cloning method from RNA extracted from the embryo in the seed stage of the black rice giant pear rice plant 'Miyang No. 263' included in the present invention.

The ge ^t gene according to the present invention as described above can be used as a practical selection marker for the breeding of rice plants in the future Black rice giant pear plant, the black rice giant pear rice plant material of the production of products using pear and pear-containing components of rice as well as grain Can also be used.

The brown rice of the existing YR23517Acp79 cultivar has a large pear weight that is three times larger than the normal rice cultivar, but it is poorly agriculturally ripened, and there is no anthocyanin in the grain, and the surface is uneven, so it is easily harvested at harvest. There was a problem that it is difficult to do. On the other hand, the rice cultivar 'Josaeng Blackchalk', which is currently being distributed to domestic farms, contains anthocyanins in the grains, but the size of the pear is in the range of the common rice cultivars, and it is specifically present in the pear. There was a problem that the content of excellent nutrients such as GABA is not high. Milyang 263 of the present invention is significantly improved compared to the YR23517Acp79 varieties, contains an anthocyanin component in the grain more than 120 mg / 100g, the surface is smooth and has the advantage that the harvest is much more advantageous to the problem of the two varieties It is characterized by all solved.

In other words, the Milyang 263 of the present invention can provide new varieties superior to the conventional rice varieties, while maintaining the characteristics of YR23517Acp79 varieties of giant pear rice, while improving the ripening and containing anthocyanin in the grain There is an advantage.

After all, the present invention is characterized by a composition for preventing or treating alcoholism, including various rice, rice pear or extract thereof, including Miryang 263.

The rice is not limited in its type so that the general rice, general rice pears, colored rice, colored rice pears, giant embryos, giant embryos pears, waxy giants, waxy giants pears, etc. can be used, the black rice giant embryos described above 'mil sheep 263 '.

Miryang 263 contains vitamins such as tocopherol, lysine, riboflavin, thiamin, phytosterol, palmyric acid and oleic acid, and particularly high content of antioxidant anthocyanin, gamma-aminobutyric acid (GABA) compared to normal rice. It is included in the content and is effective in the treatment and prevention of alcoholism.

In addition, when the rice is germinated, functional ingredients may be increased to further increase the treatment and prevention effect of alcoholism.

The rice or pear extract of rice can be extracted by a conventional method using a common extraction solvent well known in the art, the extraction solvent is water, C ₁ ~ C ₄ alcohol, ethyl acetate, acetone or a mixture thereof It is preferable to use a solvent selected from a solvent, preferably water, C ₁ to C ₄ lower alcohols, ethyl acetate or a mixed solvent thereof, but is not limited thereto. The amount of the extraction solvent is preferably 1 to 50 times the weight of the rice, more preferably 5 to 30 times, but is not limited thereto. The extraction method may be an extraction method such as hot water extraction, immersion extraction, reflux cooling extraction and ultrasonic extraction.

The alcoholism prevention or treatment composition may include a pharmaceutically acceptable carrier, excipient or diluent in addition to rice as an active ingredient. In addition, as a parenteral preparation, it can be formulated into a skin external preparation such as a dressing agent, a patch, a band, an ointment, or an injection. The dosage of the composition of the present invention varies depending on the weight, age, sex, health status, diet, time of administration, administration method, excretion rate and severity of the disease of the patient, and is a dietary method, so that the conventional treatment It can also be used in combination with drugs.

In particular, the composition of the present invention can be ingested in the form of processed products, and rice using brown rice powder and extract, the extract can be added as it is or used as a health food with other food or food ingredients, according to a conventional method Can be used as appropriate. The blending amount of the active ingredient may be suitably determined according to the purpose of use (prevention, health or treatment).

Hereinafter, the present invention will be described in detail with reference to Examples, but the present invention is not limited thereto.

Example 1 Selection of Giant Rice YR23517Acp79 by Medicine Culture

The hybrid plants (YR23517), which were artificially crossed, were grown using Hwachung rice as a model and Sangjuchal rice as a copy. Ears showing pollen development in the early and middle stages of 1-nucleus were collected and then cultured according to a conventional method. The collected ear was soaked in N6-Y2 medium containing 2ppm NAA, 0.2ppm cinetin and the like, and then low-temperature treated for 15 days, followed by incubation at 25 ° C for 30 days to induce callus.

The callus was transferred to N6-Y2 medium containing 0.2ppm IAA, 2ppm cinetin and the like, and cultured for about 30 days to re-differentiate the plant. Plants were transplanted into culture bottles to induce root development, seeded in soil and harvested seeds of each plant. Harvested seeds were transferred back to the soil, and the grain characteristics of each plant were analyzed, and a large pear rice plant YR23517Acp79 was selected.

<Example 2> Breeding method of the rice black giant pear plant 'Miyang No. 263'

As a new breed breeding material of the present invention, the YR23517Acp79 cultivar was used as a model and the crude black chalcedony was used as a copy.

First, hybridization (F1) was made by artificially crossing the YR23517Acp79 as a model and artificially breeding the black-rice rice varieties 'Chosaeng Blackchal'. The isolated generation (F2) seeds generated from the ear of hybrids (F1) plants were unselected to hybrid third generation (F3) by the general group breeding method, and the hybrid fourth generation seeds (F4 Seed) were harvested by plants. In addition, the harvested 4th generation seed 427 strains were published on the package of about 23 individuals per line by the general lineage breeding method. When the fourth generation of hybrid plants began to grow and reached maturity, some of the seeds deleted in the plants of each strain were removed, and the pears of brown rice were observed after removing the seedlings. Plants were identified and the seedlings deleted from the plants in the system were selected from the fixed 34 strains showing the characteristics of the giant pear and published in the productivity test the following year.

As a result of the productivity test, YR25277-BB-314-2, which is black rice, has a feature of having a large and large pear, and improved ripeness of seeds, was selected and named as 'Miyang No. 263'. Milyang 263 of the present invention was deposited with the accession number KACC98009P dated June 30, 2010 at the National Institute of Agricultural Science, Seodun-dong, Gwonseon-gu, Suwon-si, Gyeonggi-do.

Example 3 ge ^t  Cloning and Sequencing Genes

The genome gene Cytochrome P450, a gene related to pear size, was isolated from rice varieties YR23517Acp79 and Miryang 263, a hybrid plant of crude black sack.

Using DNA cytochrome P450 genome sequence obtained through NCBI database (http://www.ncbi.nlm.nih.gov/) for gene isolation by PCR, each DNA was divided into two DNA fragments around introns. Primers were synthesized appropriately according to the nucleotide sequence of the fragment, and the conventional PCR method was performed under the condition that 5 μl of betaine (5 μg, Sigma, USA) was added. PCR reaction conditions were 50 μl of a mixture containing 20 ng of DNA, 500 mM betaine, lX Ex Taq buffer, 0.2 mM dNTP, 0.5 unit Ex Taq polymerase (Takara, Japan), and primer luM. Amplified times. Primers used in the PCR are as follows.

SEQ ID NO: P450Fl 5′-TAGCTTCTCTCCACGTCTT-3 ′ (forward primer)

SEQ ID NO: P450Rl 5′-GCCATGGACGTTTCCTTCTC-3 ′ (reverse primer)

SEQ ID NO: P450F2 5'-TCTCCTCGTCGTCGTCTTC-3 '(forward primer)

SEQ ID NO: P450R2 5′-TGATGTTTCACAACTAATGCCTCG-3 ′ (reverse primer)

Two genomic DNAs amplified with the four primers were conjugated to the pGEM-T Easy Vector (Promega Co, USA) and then transformed into recombinant E. coli JMI09 cells. The recombinant E. coli inserted with the recombinant vector was first selected through a color selection (blue) using an antibiotic resistance marker (Epicillin) and a beta galactosidase enzyme, and the selected E. coli was inserted through DNA miniprepping. The vector was extracted and confirmed secondary. Through such a series of processes, a transgenic E. coli with the genomic sequence of each cytochrome P450 gene was inserted.

The nucleotide sequence of the cytochrome P450 gene inserted into the vector was cytochrome P450 genomic DNA using T7 and (5'-TAATACGACTCACTATAGGG-3 ') and SP6 (5'-ATTTAGGTGACACTATAG-3'). The base sequence of was analyzed. The sequencing work was confirmed to be a very accurate result obtained by performing two sequencing of each of the 10 recombinant DNAs obtained independently to eliminate sequencing errors.

The intron portion of the genomic DNA obtained through the sequencing analysis was removed, and the sintered rice, Sangju rice, Nipponbare and Dongjin rice for the exon-only gene (cDNA) and amino acid sequences. Homology with cytochrome P450 found in

The results of the sequencing analysis (Table 1) shows that the 395th amino acid is changed as the 1195th base is changed from G (guanine) to T (thymine) in cytochrome P450 genome DNA of rice having a normal size. It was confirmed that the tryptophan (W) is transformed into leucine (L). Therefore, this gene (cDNA) was named ge ^t , a new allele of the cytochrome P450 gene (cDNA). The rice having the ge ^t gene is a huge embryo whose size is larger.

kind order ge ^t AAGGAGACGCTGCGCATGCACCCGCCGGGCCCGCTCCTGTCGT T GGCGCGCCTCGCCGTG
W → L Sangju Rice AAGGAGACGCTGCGCATGCACCCGCCGGGCCCGCTCCTGTCGTGGGCGCGCCTCGCCGTG Hwacheng AAGGAGACGCTGCGCATGCACCCGCCGGGCCCGCTCCTGTCGTGGGCGCGCCTCGCCGTG Nippon Hope AAGGAGACGCTGCGCATGCACCCGCCGGGCCCGCTCCTGTCGTGGGCGCGCCTCGCCGTG

Experimental Example 1 Comparative Evaluation of Major Agricultural Characteristics of Miryang 263

In order to evaluate the main agricultural characteristics of Miryang No. 263 of the present invention, a comparative analysis with YR23517Acp79, big eyes, crude blacksack and Ilmi rice variety was performed, and the results are shown in Table 2 below.

Among the following varieties, Milyang 263, YR23517Acp79, crude black sesame and Ilmi rice were varieties grown by the National Institute of Food Science and Technology. The seeds harvested at the Institute were used in 2008. Was used. Seeds of each cultivar were seeded in seedling boxes, and after 30 days of seedling period, they were transplanted on June 1st. The planting distance of Yiang City was 30cm (hot distance) ㅧ 15cm (weekly distance) and three copies per week. The average temperature of the entire rice growing period (seedling to harvesting, May 1 ~ October 10) was 23.2 ℃, average maximum temperature 29.4 ℃, average minimum temperature 18.0 ℃, total sunshine time 874.8 hours, total precipitation 939mm.

The investigation of each trait was based on the RDA standard survey criteria. Leaf anthocyanin was evaluated based on the expression of red pigment in the leaves before maturation before aging, and the extraction period was based on 40% of the total hard water. Soy sauce measured the length from the surface to the ear of the longest ear, and head length measured the length from the ear of the ear to the tip of the ear, and the number of heads per week was measured based on the number of ears of rice plants. The yield of brown rice was converted to 10a (1000㎡) after harvesting 100 strains (approximately area: 4.5㎡) of each variety.

Major Agricultural Characteristics of Miryang 263 division Leaf color Lobe
Anthocyanins Water dispenser
(Mon./Sun) Soy sauce
(cm) stripe
(cm) Shares per week
(recast) Brown rice
(kg / 10a) Miryang 263 green none 8.08 65 21.4 10 449 YR23517Acp79 green none 8.10 69 19.7 10 428 Big eyes green none 8.13 69 23.5 10 598 Black and white green has exist 8.11 61 21.4 11 461 Japan green none 8.19 72 20.7 12 566

As shown in Table 2, Miryang No. 263 of the present invention, the extraction period is August 8, belongs to a crude species, the green color is green, there is no accumulation of anthocyanin pigment in the leaves. Milyang 263's sorghum was 1 less than crude black sesame and brown rice yield was about 2.5% less than that of crude black sesame. However, the ripening of seeds improved, resulting in about 5% increase compared to YR23517Acp79. In addition, the Miryang 263 is not bad for general cultivation because the cultivation characteristics are not bad compared to ordinary rice.

Experimental Example 2 Comparative Evaluation of Brown Rice Characteristics of Milyang 263

In order to evaluate the brown rice characteristics of the wheat plant No. 263, a new varieties of rice plants of the present invention, a comparative evaluation with other varieties was performed, and the results are shown in Table 3 below.

Brown Rice Characteristics of Miryang 263 division Brown rice natural grain
(g) Weight
(mg / 1000 grains) Oil weight
(mg / 1000 grains) Brown rice
Times ratio (%) Main characteristic Miryang 263 19.4 1.464 17.96 7.5 Black rice YR23517Acp79 14.3 1.964 12.33 13.7 Giant rice paddy Big eyes 20.9 1.492 19.45 7.1 Giant belly rice Black and white 19.8 0.515 19.29 2.6 Black rice Japan 22.8 0.616 22.18 2.7 Plain rice

As shown in Table 3, the grains of the black rice giant pear rice plant Miryang No. 263 showed a significantly larger pear than the ordinary rice ((A) of FIG. 1), as shown in FIG. g showed a significant improvement over 14.3 g of YR23517Acp79 which is the original system. The ratio of pears in brown rice was 7.5%, which was similar to that of the large-eyed rice varieties developed previously (big pears, rice, no brown anthocyanin). Therefore, Milyang 263 is Korea's first large black rice germ rice plant, and there are no disadvantages in terms of ripening characteristics, so farming and harvesting is possible.

Experimental Example 3 Comparative Evaluation of Brown Rice Nutritional Components in Milyang 263

Nutritional analysis of the brown rice, including the new varieties of rice plants milyang 263 of the present invention and nutritional comparison with other varieties were carried out, the results are shown in Tables 4 and 5.

GABA content (mg / g) Kinds Brown rice ship Oil Germinated brown rice (2 days) Miryang 263 0.34 1.90 0.08 0.88 Giant embryo (big eyes) 0.22 1.46 0.04 0.87 Black and white 0.05 0.70 0.04 0.55 Japan 0.04 0.65 0.04 0.44

As shown in Table 4, Milyang 263 acts as a competitive inhibitor of GABA receptors in the human body, and shows gamma-aminobutyric acid (GABA; Agric. Chem. 49 (3), 95-100) (0.34 mg / g) was contained about 9 times compared to Japan and crude black chalk, and was confirmed to be included in a high content compared to giant embryo (0.22 mg / g). In particular, the germination of seeds increased the GABA content in Japan to 0.44 mg / g, significantly higher than before germination, and the GABA content of Miryang 263 was 0.88 mg / g, more than two times higher than before germination.

Kinds Anthocyanins
(mg / 100g) Amylopectin
(%) gamma
Oryzanol
(mg / g) protein(%) Fat(%) Inorganic Ingredients (mg / kg) Ca Mg Fe Miryang263 129.4 94.5 0.32 8.98 2.57 338.1 1366.0 45.7 Giant embryo
(Big eyes) - 85.3 0.32 8.09 3.31 167.1 1294.0 29.6 Black and white 117.5 95.5 0.29 7.81 3.11 234.6 1193.3 20.7 Japan - 83.5 0.23 7.45 2.25 164.0 875.0 30.3

As shown in Table 5, the brown rice of Miryang No. 263 contains an anthocyanin content of 129 mg / 100 g which is not present in the giant pear rice, YR23517Acp79. Anthocyanins are well known as functional substances that exhibit strong antioxidant and anti-inflammatory effects by chemical structure (J. Agric. Food Chem, 2003, 51, 628-633). In addition, gamma-orizanol content with antihypertensive and antidiabetic effects was also superior to other varieties, and the general inorganic content of calcium (33.8 mg / 100g) and iron (4.5 mg / 100 g) was 1.2 compared to other varieties. It confirmed that it contained 2 times more. Therefore, Miryang 263, a new kind of rice plant according to the present invention, was confirmed to be a variety having a superior functional substance and nutrient content than other varieties.

In addition, the amino acid component ratio of Miryang No. 263 brown rice compared to other rice brown rice is shown in Table 6 below.

Amino acid (mg / g) Miryang 263 Big eyes Black and white Japan Asp 20.24 18.21 15.99 16.52 Thre 17.78 16.56 14.14 14.16 Ser 14.28 13.40 11.62 11.92 Glu 20.03 18.89 15.54 17.41 Pro 16.66 16.34 14.72 17.27 Gly 11.30 10.45 9.11 9.03 Ala 12.84 12.17 10.22 10.83 Cys 18.16 15.70 16.65 33.72 Val 16.53 15.32 13.28 13.79 Met 23.79 14.69 30.88 28.91 Ile 18.22 16.54 14.52 15.53 Leu 18.20 16.88 14.72 15.66 Tyr 32.26 29.19 21.18 19.15 Phe 23.75 21.55 18.24 19.16 His 26.00 22.69 20.10 19.14 Lys 23.78 21.60 18.33 17.62 Arg 26.79 24.97 19.75 19.80 Total 340.61 305.15 278.99 299.62

Preparation Example 1 Preparation of Milyang 263 Brown Rice Extract

After removing chaff skin of Milyang No. 263 and pulverizing, ethyl acetate, 70% ethanol or 70% methanol was added 20 times of the grain weight as a solvent to the ground sample, and ultrasonic extraction was performed for 24 hours to obtain brown rice extract. In addition, the extract was obtained in the same manner as in the case of giant embryonic rice (big eyes) and ordinary Japanese rice.

Preparation Example 2 Preparation of Germinated Extract of Milyang No. 263

Milyang No. 263 was immersed in water at 30 ° C. for 24 hours, then germinated at 27 ° C. for 2 days to remove shells, dried and ground, and then ethyl acetate, 70% ethanol or 70% methanol was granulated as a solvent. 20 times the weight and ultrasonic extraction was performed for 24 hours to obtain a germination extract. In addition, the extract was obtained in the same manner as in the case of giant embryonic rice (big eyes) and ordinary Japanese rice.

Experimental Example 4 Evaluation of Antioxidant Activity of Extracts

0.05 ml of the germination extract obtained in Example 5 and 0.2 ml of final concentration 100 uM DPPH (2,2-di- (4-tert-oxyphenyl-1-picrylhydrazyl)) were mixed and reacted for 30 minutes, followed by absorbance at 517 nm. To compare the antioxidant activity was evaluated and the results are shown in Table 7.

extract DPPH Antioxidant Activity by Extraction Solvent (%) EtOAC 70% EtOH 70% MeOH Miryang 263 43.1 23.7 37.2 Giant embryo (big eyes) 31.9 12.9 10.4 Japan 22.3 14.8 5.2

As shown in Table 7, the ethyl acetate, ethanol and methanol extracts all showed high antioxidant activity, and especially the ethyl acetate extract of Milyang 263 showed very good antioxidant activity.

In addition, the reaction with the germination extract of Example 5 using ABTs (2,2-azino-bis- (3-ethylbenzthizaoline-6-sulfonic acid)) was observed at 734 nm to compare the radical scavenging ability of ABTs with antioxidant activity. Was assayed and the results are shown in Table 8 below.

extract ABTS Antioxidant Activity by Extraction Solvent (%) EtOAC 70% EtOH 70% MeOH Miryang No. 263 29.5 73.8 71.4 Giant embryo (big eyes) 24.5 38.2 31.2 Japan 16.8 32.2 38.5

As shown in Table 8, it was confirmed that the extract of Milyang 263, giant embryonic rice and Ilmi also showed excellent antioxidant activity through ABTs experiment.

Experimental Example 5 Comparison of Alcohol Intake Effect Using Alcoholic Rats

In order to confirm the effect of alcohol treatment of rice, animal experiments were conducted in C57BL / 6 mice, which are alcohol dependent animal models. The C57BL / 6 mice have high bioactivity and are widely used for genetic studies of alcohol addiction and drug efficacy due to their high preference for morphine, high alcohol intake and preference.

Four week old C57BL / 6 mice were adapted to the experimental environment for one week. At this time, water and mouse feed were freely consumed for 24 hours. Then, using the finite approach for behavioral alcohol dependence of the subject mice, alcohol intake was forced by providing only 10% ethanol for 24 hours with feed instead of water for 14 days. For 16 days thereafter, only 2 hours of daily ethanol was provided without water, and the remaining 22 hours without ethanol was provided with water. Next, US, Giant Embryo and Milyang 263 brown rice were provided for 20 days, respectively, and the 12-hour dark condition was from 1 pm to 1 am. As a control group, only the feed group was used.

After 4 days of stabilization, the intake of ethanol was examined once every two days, compared to the average alcohol intake after 10 days is shown in Table 9 below, a graph comparing the alcohol intake over time Figure 3 Shown in

process basic
Alcohol intake
(g / kg) Average alcohol intake after 10 days
(g / kg) Alcohol intake changes
(g / kg) Change
(%) Feed (control) 7.8 11.0 + 3.2 + 41 Japan 7.6 7.3 -0.3 - 4 Giant embryo 7.9 4.9 - 3.0 -38 Miryang 263 7.5 3.8 -3.7 -50

As shown in Table 9, the feed-only group showed an alcohol intake of 11.0 g / kg compared to the basic alcohol intake of 7.8 g / kg, indicating that the alcohol intake increased by 41%. It was similar to the response of rats. In the group provided with Japan, the alcohol consumption of 7.3 g / kg was decreased by 4% compared to the basic alcohol intake of 7.6 g / kg, and in the group provided with giant embryos, 4.9 compared with the basic alcohol intake of 7.9 g / kg. The alcohol intake of g / kg was shown, indicating a reduction of 38%. In particular, the group provided with Miryang No. 263 showed an alcohol intake of 3.8 g / kg, which was found to be significantly reduced by 50% compared to the basic alcohol intake. This decrease in alcohol consumption tends to be similar to the pre-clinical test of reduced animal intake of naltrexone and acamprosate, which is used as a conventional medicinal product, resulting in various functional and antioxidant components, including gamma-aminobutyric acid in rice. It is thought to affect the reduction of alcohol consumption.

In addition, in order to confirm the effect of reduced alcohol intake of germinated brown rice, after grinding the brown rice of the Japanese rice, crude black cheese, giant embryonic rice and Miryang No. 263 germinated under the conditions shown in Example 5, the germinated brown rice pulverized product and the feed to the weight ratio 7 The sample was prepared by mixing to 3 :. The average alcohol intake was provided to the alcohol-addicted rats so that the average daily feed of 7 g was ingested. The results are shown in Table 10 below, and a graph comparing alcohol intake over time was shown in FIG. 4. Indicated.

process basic
Alcohol intake
(g / kg) After 10 days
Average alcohol
Intake (g / kg) Alcohol consumption
Reduction amount (g / kg) Reduction rate
(%) Germination 7.0 4.5 2.5 36 Germinated crude black 6.7 4.7 2.0 30 germination
Giant embryo 6.9 2.7 4.2 61 germination
Miryang 263 6.8 2.4 4.4 65

※ Average feed intake: 7g / 1day / 30g mice

As shown in Table 10, when crushed germinated brown rice and fed with feed, it showed a better alcohol addiction treatment effect as compared to the use of brown rice, specifically, germinated ilmi to the basic alcohol intake 7.0 g / kg Compared with 36%, germinated crude black sack, 30%, germinated giant embryo, 61%, and germinated Miryang 263 showed 65% reduction in alcohol consumption. When the results are compared with the GABA content of Table 4, the GABA content is 0.88 mg / g and 0.87 mg / g, respectively, when Miryang 263 and giant embryo are germinated, and the alcohol intake reduction rate is 65% and Similar to 61%, GABA contents were 0.55 mg / g and 0.44 mg / g in the germinated crude black and germinated Japan, respectively, and alcohol intake decreased as the GABA content increased to 30% and 36%, respectively. It was found that the GABA content significantly reduced alcohol intake, as it was found to be significantly decreased.

Agricultural Biotechnology Research Institute KACC98009 20100630

<110> REPUBLIC OF KOREA (MANAGEMENT: RURAL DEVELOPMENT ADMINISTRATION) <120> Composition for the treatment of alcoholism comprising a rice or          its extracts <160> 7 <170> Kopatentin 1.71 <210> 1 <211> 2301 <212> DNA <213> Oryza sativa <220> <221> gene (222) (1) .. (2301) <223> genomic DNA of cytochrome P450 <400> 1 gccattatta tgtagtccta tatttaagga agaaactaat gatatatacg cagatattgt 60 taataatgac cctttgatta cgctatcatt actgacaatg acatgtgggg ctagagtgtc 120 agataattgg aggtccaaat ttttggagtg gcaaaatggt ctatttaaag caccaggtgt 180 ttattagctt ctctccacgt cttcttcctc ccaagaaaac tcctctcact tcgcgaacgc 240 ttcccatggc gctctcctcc atggccgcgg cgcaagagag ctccctcctc ctcttcctcc 300 tcccgacgtc ggccgcctcc gtgttcccgc cgctcatctc cgtggtcgtc ctcgccgcgc 360 tcctcctgtg gctctcgccg ggtggccccg cgtgggcgct gtcccgttgc cgtggcacgc 420 cgccgccgcc gggcgtggcg gggggcgcgg ccagcgcgct gtccggccct gccgcgcacc 480 gcgtgctcgc cgggatttcg cgcgccgtcg agggcggcgc ggcggtgatg tcgctctccg 540 tcggcctcac ccgcctcgtc gtggcgagcc ggccggagac ggcgagggag atcctcgtca 600 gcccggcgtt cggcgaccgc cccgtgaagg acgcggcgag gcagctgctg ttccaccgcg 660 ccatggggtt cgccccgtcg ggcgacgcgc actggcgcgg gctccgccgc gcctccgcgg 720 cgcacctctt cggcccgcgc cgcgtggccg ggtccgcgcc cgagcgcgag gccatcggcg 780 cccgcatagt cggcgacgtc gcctccctca tgtcccgccg cggcgaggtc cccctccgcc 840 gcgtccttca cgccgcgtcg ctcggccacg tcatggcgac cgtcttcggc aagcggcacg 900 gcgacatctc gatccaggac ggcgagctcc tggaggagat ggtcaccgaa gggtacgacc 960 tcctcggcaa gttcaactgg gccgaccacc tgccattgct caggtggctc gacctccagg 1020 gcatccgccg ccggtgcaac aggctagtcc agaaggtgga ggtgttcgtc ggaaagatca 1080 tacaggagca caaggcgaag cgagctgccg gaggcgtcgc cgtcgccgac ggcgtcttgg 1140 gcgacttcgt cgacgtcctc ctcgacctcc agggagagga gaagatgtca gactccgaca 1200 tgatcgctgt tctttgggta agtctcctcg tcgtcgtctt cgtcgtaaag cttgagaagg 1260 aaacgtccat ggcgttttca tggattggtt tcttgttttt ttcttcagga gatgatcttt 1320 agagggacgg acacggtggc gatcttgatg gagtgggtga tggcgaggat ggtgatgcac 1380 ccggagatcc aggcgaaggc gcaggcggag gtggacgccg ccgtgggggg acgccgcggc 1440 cgcgtcgccg acggcgacgt ggcgagcctc ccctacatcc agtccatcgt gaaggagacg 1500 ctgcgcatgc acccgccggg cccgctcctg tcgtgggcgc gcctcgccgt gcacgacgcg 1560 cgcgtcggtg gccacgccgt ccccgccggg acgacggcga tggtgaacat gtgggcgatc 1620 gcccacgacg ccgccgtctg gccggagccg gatgcgttcc gcccggagcg cttctcggag 1680 ggggaggacg tcggcgtgct cggcggcgac ctccgcctcg cgccgttcgg cgccggccgc 1740 cgcgtctgcc ctggcaggat gctggcgctc gccaccgccc acctctggct cgcccagctg 1800 ctgcacgcct tcgactggtc ccccaccgcc gccggcgtcg acctgtccga gcgcctcggc 1860 atgtcgctgg agatggcggc gccgctcgtg tgcaaggccg tggctagggc ctgagcccta 1920 gccgccgccg ccgccattat tgccattgat gtggctagcg acgttgtcgt gctcgcatcc 1980 atactcctcc ataggcaact cgtctagcca atgaagaaag ctactatcta tctatctatc 2040 aagctagctg ctactatcac aaaccgcatt tcggcatcat cttaaattag ctcttagggg 2100 tgtaggcgat tttggtttcc cccaaaaatt tgctttgcca gtcttttggt ttaaatcgag 2160 gcattagttg tgaaacatca tgagaagtta tttaaatctg aggaattttg tttgaacctt 2220 ttctggtgtg ctaaatggat cgtgctttga gtatcttatt attctgaatg tgttatgtag 2280 ctacactctc ctgaatcatg t 2301 <210> 2 <211> 1563 <212> DNA <213> Oryza sativa <220> <221> gene (222) (1) .. (1563) <223> cDNA of cytochrome P450 <400> 2 atggccgcgg cgcaagagag ctccctcctc ctcttcctcc tcccgacgtc ggccgcctcc 60 gtgttcccgc cgctcatctc cgtggtcgtc ctcgccgcgc tcctcctgtg gctctcgccg 120 ggtggccccg cgtgggcgct gtcccgttgc cgtggcacgc cgccgccgcc gggcgtggcg 180 gggggcgcgg ccagcgcgct gtccggccct gccgcgcacc gcgtgctcgc cgggatttcg 240 cgcgccgtcg agggcggcgc ggcggtgatg tcgctctccg tcggcctcac ccgcctcgtc 300 gtggcgagcc ggccggagac ggcgagggag atcctcgtca gcccggcgtt cggcgaccgc 360 cccgtgaagg acgcggcgag gcagctgctg ttccaccgcg ccatggggtt cgccccgtcg 420 ggcgacgcgc actggcgcgg gctccgccgc gcctccgcgg cgcacctctt cggcccgcgc 480 cgcgtggccg ggtccgcgcc cgagcgcgag gccatcggcg cccgcatagt cggcgacgtc 540 gcctccctca tgtcccgccg cggcgaggtc cccctccgcc gcgtccttca cgccgcgtcg 600 ctcggccacg tcatggcgac cgtcttcggc aagcggcacg gcgacatctc gatccaggac 660 ggcgagctcc tggaggagat ggtcaccgaa gggtacgacc tcctcggcaa gttcaactgg 720 gccgaccacc tgccattgct caggtggctc gacctccagg gcatccgccg ccggtgcaac 780 aggctagtcc agaaggtgga ggtgttcgtc ggaaagatca tacaggagca caaggcgaag 840 cgagctgccg gaggcgtcgc cgtcgccgac ggcgtcttgg gcgacttcgt cgacgtcctc 900 ctcgacctcc agggagagga gaagatgtca gactccgaca tgatcgctgt tctttgggag 960 atgatcttta gagggacgga cacggtggcg atcttgatgg agtgggtgat ggcgaggatg 1020 gtgatgcacc cggagatcca ggcgaaggcg caggcggagg tggacgccgc cgtgggggga 1080 cgccgcggcc gcgtcgccga cggcgacgtg gcgagcctcc cctacatcca gtccatcgtg 1140 aaggagacgc tgcgcatgca cccgccgggc ccgctcctgt cgttggcgcg cctcgccgtg 1200 cacgacgcgc gcgtcggtgg ccacgccgtc cccgccggga cgacggcgat ggtgaacatg 1260 tgggcgatcg cccacgacgc cgccgtctgg ccggagccgg atgcgttccg cccggagcgc 1320 ttctcggagg gggaggacgt cggcgtgctc ggcggcgacc tccgcctcgc gccgttcggc 1380 gccggccgcc gcgtctgccc tggcaggatg ctggcgctcg ccaccgccca cctctggctc 1440 gcccagctgc tgcacgcctt cgactggtcc cccaccgccg ccggcgtcga cctgtccgag 1500 cgcctcggca tgtcgctgga gatggcggcg ccgctcgtgt gcaaggccgt ggctagggcc 1560 tga 1563 <210> 3 <211> 520 <212> PRT <213> Oryza sativa <220> <221> PEPTIDE (222) (1) .. (520) <223> Cytochrome P450 <400> 3 Met Ala Ala Ala Gln Glu Ser Ser Leu Leu Leu Phe Leu Leu Pro Thr   1 5 10 15 Ser Ala Ala Ser Val Phe Pro Pro Leu Ile Ser Val Val Val Leu Ala              20 25 30 Ala Leu Leu Leu Trp Leu Ser Pro Gly Gly Pro Ala Trp Ala Leu Ser          35 40 45 Arg Cys Arg Gly Thr Pro Pro Pro Pro Gly Val Ala Gly Gly Ala Ala      50 55 60 Ser Ala Leu Ser Gly Pro Ala Ala His Arg Val Leu Ala Gly Ile Ser  65 70 75 80 Arg Ala Val Glu Gly Gly Ala Ala Val Met Ser Leu Ser Val Gly Leu                  85 90 95 Thr Arg Leu Val Val Ala Ser Arg Pro Glu Thr Ala Arg Glu Ile Leu             100 105 110 Val Ser Pro Ala Phe Gly Asp Arg Pro Val Lys Asp Ala Ala Arg Gln         115 120 125 Leu Leu Phe His Arg Ala Met Gly Phe Ala Pro Ser Gly Asp Ala His     130 135 140 Trp Arg Gly Leu Arg Arg Ala Ser Ala Ala His Leu Phe Gly Pro Arg 145 150 155 160 Arg Val Ala Gly Ser Ala Pro Glu Arg Glu Ala Ile Gly Ala Arg Ile                 165 170 175 Val Gly Asp Val Ala Ser Leu Met Ser Arg Arg Gly Glu Val Pro Leu             180 185 190 Arg Arg Val Leu His Ala Ala Ser Leu Gly His Val Met Ala Thr Val         195 200 205 Phe Gly Lys Arg His Gly Asp Ile Ser Ile Gln Asp Gly Glu Leu Leu     210 215 220 Glu Glu Met Val Thr Glu Gly Tyr Asp Leu Leu Gly Lys Phe Asn Trp 225 230 235 240 Ala Asp His Leu Pro Leu Leu Arg Trp Leu Asp Leu Gln Gly Ile Arg                 245 250 255 Arg Arg Cys Asn Arg Leu Val Gln Lys Val Glu Val Phe Val Gly Lys             260 265 270 Ile Ile Gln Glu His Lys Ala Lys Arg Ala Ala Gly Val Ala Val         275 280 285 Ala Asp Gly Val Leu Gly Asp Phe Val Asp Val Leu Leu Asp Leu Gln     290 295 300 Gly Glu Glu Lys Met Ser Asp Ser Asp Met Ile Ala Val Leu Trp Glu 305 310 315 320 Met Ile Phe Arg Gly Thr Asp Thr Val Ala Ile Leu Met Glu Trp Val                 325 330 335 Met Ala Arg Met Val Met His Pro Glu Ile Gln Ala Lys Ala Gln Ala             340 345 350 Glu Val Asp Ala Ala Val Gly Gly Arg Arg Gly Arg Val Ala Asp Gly         355 360 365 Asp Val Ala Ser Leu Pro Tyr Ile Gln Ser Ile Val Lys Glu Thr Leu     370 375 380 Arg Met His Pro Pro Gly Pro Leu Leu Ser Leu Ala Arg Leu Ala Val 385 390 395 400 His Asp Ala Arg Val Gly Gly His Ala Val Pro Ala Gly Thr Thr Ala                 405 410 415 Met Val Asn Met Trp Ala Ile Ala His Asp Ala Ala Val Trp Pro Glu             420 425 430 Pro Asp Ala Phe Arg Pro Glu Arg Phe Ser Glu Gly Glu Asp Val Gly         435 440 445 Val Leu Gly Gly Asp Leu Arg Leu Ala Pro Phe Gly Ala Gly Arg Arg     450 455 460 Val Cys Pro Gly Arg Met Leu Ala Leu Ala Thr Ala His Leu Trp Leu 465 470 475 480 Ala Gln Leu Leu His Ala Phe Asp Trp Ser Pro Thr Ala Ala Gly Val                 485 490 495 Asp Leu Ser Glu Arg Leu Gly Met Ser Leu Glu Met Ala Ala Pro Leu             500 505 510 Val Cys Lys Ala Val Ala Arg Ala         515 520 <210> 4 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> forward primer P450F1 <400> 4 tagcttctct ccacgtctt 19 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer of P450R1 <400> 5 gccatggacg tttccttctc 20 <210> 6 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> forward primer of P450F2 <400> 6 tctcctcgtc gtcgtcttc 19 <210> 7 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> reverse primer of P450R2 <400> 7 tgatgtttca caactaatgc ctcg 24

Claims (10)

Germinated rice, germinated rice pear or extracts thereof comprising a composition for preventing or treating alcoholism.
delete [Claim 2] The composition for preventing or treating alcoholism according to claim 1, wherein the rice is plain rice, colored rice or giant embryonic rice.
The method of claim 1, wherein the rice is a composition for preventing or treating alcoholism, characterized in that the grains of the black rice giant pear rice plant Miryang No. 263 containing the nucleotide sequence of SEQ ID NO: 1.
5. The composition of claim 4, wherein the base sequence of SEQ ID NO: 1 is a base sequence encoding leucine as the 395th amino acid after translation.
5. The composition for preventing or treating alcoholism according to claim 4, wherein Milyang 263 is selected from hybridized generations based on the YR23517Acp79 variety and the crude black pigment varieties.
The composition for preventing or treating alcoholism according to claim 1, wherein the extract is extracted with one or two or more mixed solvents selected from water, C ₁ to C ₄ alcohols, and ethyl acetate.
Germinated rice, pear or germinated extract of germinated rice, alcoholism prevention or improvement health food comprising a.
delete The method of claim 8, wherein the extract is water, C ₁ ~ C ₄ alcohol and ethyl acetate, one or two or more mixed solvents selected from the mixture of alcohol, characterized in that the alcohol food prevention or improvement health foods.

Images