KR101185903B1 - Anti-inflammatory agent containing eupatorium japonicum extract - Google Patents

Abstract

The present invention relates to an anti-inflammatory composition comprising a spinach herb extract as an active ingredient. The spinus herb extract is not only cytotoxic, but also expression of each level of protein related to inflammation, specifically NO secretion, iNOS and COX-2 expression, iNOS and COX-2 mRNA transcription and inflammation As a result of confirming the transcription of various cytokine mRNAs, it was confirmed that inflammation can be effectively inhibited. Thus, the anti-inflammatory composition comprising the same as an active ingredient has anti-inflammatory and anti-inflammatory effects that inhibit inflammation in diseases related to inflammation. It can be applied to such a cosmetic composition.

Description

Anti-inflammatory agent, including spinach herb extract {ANTI-INFLAMMATORY AGENT CONTAINING EUPATORIUM JAPONICUM EXTRACT}

The present invention relates to an anti-inflammatory composition comprising a plant extract having an anti-inflammatory effect as an active ingredient.

Inflammation is a localized immune response that minimizes damage and restores damaged areas when cells or tissues are damaged or destroyed by various factors such as harmful substances or organisms from outside. And a defense mechanism useful for removing products produced by tissue damage. As a result of this defense mechanism, pain, edema, redness or fever may occur, resulting in dysfunction. Various factors that cause inflammation include physical factors caused by trauma, burns, frostbite, radioactivity, chemical factors such as acids, and immunological factors caused by antibody reactions. It is also caused by.

In normal cases, the inflammation acts to neutralize or remove the onset factors through the inflammatory response in vivo and to restore the normal structure and function by regenerating the upper tissue, but the degree of inflammation becomes more than a certain level or becomes chronic. This is a problem if you progress to such a disease state. In addition to being able to observe the inflammatory response in almost all diseases, it is known that enzymes related to the inflammatory response play an important role in carcinogenesis.

Recently, it is known that the progression of the inflammatory response in the body is related to the enzyme activity of cyclooxygenase (COX). The COX enzyme is a major enzyme involved in the biosynthesis of prostaglandin present in vivo (Smith et al., J. Biol. Chem., 271, 33157 (1996)), and two kinds of isozymes, COX-1 and COX -2 is known to exist. The COX-1 is constantly present in tissues such as the stomach and kidneys, and is involved in maintaining normal homeostasis, whereas the COX-2 is involved in mitogen or cytokines during inflammation or other immune responses. Is an enzyme that is transiently and rapidly expressed in cells. Therefore, for an anti-inflammatory effect without side effects related to COX-1 inhibition, which is mainly associated with irreversible reactions, substances capable of selectively inhibiting COX-2 have been reported as effective methods of inhibiting inflammation.

Another powerful inflammatory mediator, nitric oxide (NO), is produced from L-arginine by NO synthetase (NOS), and can be produced by many types of substances, such as external stresses such as UV, or substances such as endotoxins or cytokines. Produced in cells. Such inflammatory stimuli can increase the expression of inducible NOS (iNOS) in the cell, thereby inducing NO production in the cell, thereby inducing an inflammatory response by activating macrophages.

Therefore, in order to effectively alleviate inflammation, studies on substances capable of inhibiting COX-2 and iNOS have been conducted. However, some side effects are problematic for anti-inflammatory substances developed by these studies. For example, nonsteroidal anti-inflammatory drugs used for the treatment of chronic inflammatory diseases such as acute or rheumatoid arthritis are known to exhibit side effects such as gastrointestinal disorders by inhibiting COX-2 enzyme as well as COX-1 enzyme. have.

On the other hand, cosmetics used in everyday life is a product used for protecting skin and beautifying cleanliness, but when looking at the cosmetic composition, components different from the purpose of skin protection are used as essential to the formation of the product. Examples include surfactants, preservatives, fragrances, sunscreens, pigments, and various other ingredients used to impart other benefits or effects. Essential ingredients used in the manufacture of cosmetics are generally known to cause various side effects such as inflammation, rash or edema on the skin.

In addition, if fatty acids, higher alcohols, proteins, etc. in sebum, sweat, and cosmetic components discharged from the body are decomposed into toxic substances by skin floras present on the skin, skin inflammation may be caused by them. It is well known that skin irritation is caused by UV rays from the sun.

As such, the cause of skin side effects in cosmetics is always latent, and various studies have been conducted to solve them. To date, non-steroidal substances such as flufenamic acid, ibuprofen, benzydamine, and indomethacin are used as nonsteroidal substances to stimulate irritation and inflammation, such as erythema and edema. The steroids include prednisolone and dexamethasone, and allantoin, azulene, ε-aminokiproic acid, hydrocortisone, licoriceic acid and derivatives thereof (β-glycilechinic acid and glycylacenic acid derivatives) It is known to be effective in anti-inflammatory.

However, indomethacin, which is generally used as an anti-inflammatory agent, is a substance that cannot be used in cosmetics, and the amount of hydrocortisone is limited, and licorice acid and its derivatives are difficult to stabilize or have poor solubility. Due to the fact that it is difficult to obtain a practical effect, anti-inflammatory agents known to date have most problems in terms of skin safety and stability in the formulation of cosmetics, so their use is limited.

Therefore, it is possible to effectively suppress COX-2 and iNOS without any side effects or cytotoxicity with natural substance-derived material, and it has excellent anti-inflammatory effect, not only can inhibit inflammation without side effects, There is a need for development of materials that can be used in cosmetics without limitation.

In particular, in recent years, in order to meet the needs of consumers, research and development on cosmetics or cosmetic compositions using natural raw materials are actively progressing.

In order to meet the above demands, an object of the present invention is to provide an anti-inflammatory composition comprising as an active ingredient a plant extract less likely to cause problems associated with side effects.

In addition, unlike the existing anti-inflammatory substances, the side effects such as natural plants that can be used for food is not a problem, as well as excellent safety, plant extracts that can inhibit COX-2 and iNOS associated with inflammation as an active ingredient. It is an object to provide an anti-inflammatory or cosmetic composition comprising.

In order to achieve the above object, the present invention provides an anti-inflammatory composition comprising a spinach sprout extract as an active ingredient.

The spinus herb extract can inhibit NO secretion, inhibit the expression of iNOS and COX-2, control the amount of transcription of mRNA of iNOS and COX-2, and control various cytokines related to inflammation. In addition to controlling the amount of transcription of mRNA, it is derived from natural products, and is unlikely to cause side effects, and MTT analysis showed no cytotoxicity.

Therefore, the anti-inflammatory composition of the present invention can be provided as an active ingredient of the anti-inflammatory agent or an active ingredient of the cosmetic composition for the purpose of inhibiting inflammation.

The present inventors can inhibit the secretion of NO that the spinel herb extract can directly induce inflammation, inhibit the expression of iNOS and COX-2 associated with the production of prostaglandins that cause the secretion and inflammation of NO, In addition to controlling the mRNA transcription of the iNOS mRNA and COX-2, as well as the result of inhibiting the mRNA transcription of cytokines associated with inflammation, it was confirmed that the spinel herb extract has an excellent anti-inflammatory effect. Was completed.

Hereinafter, the present invention will be described in more detail.

The present invention relates to an anti-inflammatory composition comprising a spinach herb extract as an active ingredient.

The spiny sprout ( Eupatorium japonicum ) is a perennial herb belonging to the Asteraceae, and is distributed in Korea, China, and Japan. The hair is thin in whole and the stem stands straight and the height is about 70cm. The leaves from the base are small and disappear by the time of flowering, with large leaves facing in the center and short petioles, and the leaves in the center are ovate or long oval with serrate at the edge. Flowers of the spinal buds form a head-shaped inflorescence in white purple and bloom in July to October. The fruit ripens in November with a fruit. It has been used for food since ancient times, and in particular, young shoots of spinal sprouts are slightly boiled, seasoned, and used as mukmulmul, dried flowers in the shade, and tea.

The spinel herb extract may be prepared according to a conventional method of preparing a plant extract, and for example, the flower, leaf, branch, root, fruit or bark of the spinel bud, or its pulverized product, preferably is extracted from the flower of the spinel bud The extract may be prepared by adding a solvent or may be prepared by adding a fractional solvent to the crude extract prepared by extracting with an extraction solvent.

The extraction solvent may be at least one selected from the group consisting of water and an organic solvent. The organic solvent may be a polar solvent such as an alcohol having 1 to 5 carbon atoms, the alcohol dilution ethyl acetate or acetone and a nonpolar solvent of ether, chloroform, benzene, hexane or dichloromethane, or a mixed solvent thereof. The alcohol having 1 to 5 carbon atoms may be methanol, ethanol, propanol, butanol, isopropanol, and the like, but is not limited thereto. In addition, the alcohol dilution water may be one obtained by diluting the alcohol to 50 to 99.9% (v / v).

The extraction solvent of the spinach sprout extract of the present invention is preferably at least one selected from the group consisting of water, alcohol having 1 to 5 carbon atoms, alcohol dilution water and mixtures thereof, more preferably water, 1 to 4 carbon atoms It may be any one selected from the group consisting of alcohols and mixtures thereof, and more preferably 75 to 99% aqueous ethanol solution. For example, the extraction process may be performed at 4 ° C. to 120 ° C., or 50 ° C. to 90 ° C., or 60 ° C. to 80 ° C., but is not limited thereto. In addition, the extraction time is not particularly limited, but may be 10 minutes to 12 hours.

The spinach herb extract of the present invention may be prepared according to a conventional method of preparing plant extracts, and specifically, may be cold extraction, hot extraction, thermal extraction, ultrasonic extraction, or the like. Can be used.

In addition, the extract extracted with the solvent is then any one solvent selected from the group consisting of hexane, methylene chloride, acetone, ethyl acetate, ethyl ether, chloroform, water and mixtures thereof, preferably hexane and methylene chloride group The fractionation process may be further carried out with one or more solvents selected from. Two or more solvents may be used in the fractionation, and each solvent extract may be prepared using sequentially or mixed according to the polarity of the solvent. In addition, the fractionation process may be performed at 4 ° C. to 120 ° C., or 50 ° C. to 90 ° C., or 60 ° C. to 80 ° C., but is not limited thereto.

The prepared extract or the fraction obtained by performing the fractionation process can be filtered or concentrated or dried to remove the solvent, it can be carried out both filtration, concentration and drying. Specifically, the filtration may be performed using a filter paper or a reduced pressure filter, the concentration may be concentrated under reduced pressure using a reduced pressure concentrator, for example, a rotary evaporator, and the drying may be performed by, for example, a lyophilization method.

When 5 ㎍ / ㎖ of spinach sprout flower ethanol extract of the present invention can suppress the production of LPS-induced NO in the intracellular experiment to the state before inflammation induction, when 10 ㎍ / ㎖ treated NO production In addition to controlling the expression of iNOS related to the level of control where no inflammation occurred, it can also control the mRNA transcription of mRNA and COX-2 of iNOS, and the mRNA of IL-6, an inflammation-inducing cytokine. It was confirmed that the mRNA transcription of IL-1β can also be inhibited. In addition, the ethanol extract of spinel buds showed NO inhibitory effect of about 800% compared to the root extract and about 600% compared to the stem extract, and the NO secretion was almost similar to that of the control group which was not induced to inflammation. The anti-inflammatory effect was found to be very good. In addition, as a result of experiments on the fraction of the ethanol extract of spinel buds, when the experiment was performed with water or butanol as a fraction solvent, the NO content was increased rather than the extract, but in the case of hexane and methylene chloride Compared with the control group not treated with LPS, that is, the NO content was remarkably reduced, that is, almost NO was not measured, and thus, it was confirmed to have a remarkably superior effect compared to other fractional solvents. On the other hand, the ethanol extract of spinel buds was found to be cytotoxic even when treated with a concentration of 10 ㎍ / ㎖ MTT analysis.

Thus, the anti-inflammatory composition may be used to suppress inflammation or to treat or prevent inflammation. The inflammation is a concept including a general inflammatory disease, for example, the inflammatory disease may be at least one selected from the group consisting of various dermatitis, allergies, systemic lupus erythematosus, retinitis, gastritis, hepatitis, enteritis, pancreatitis and nephritis, The allergy may include anaphylaxis, allergic rhinitis, asthma, allergic conjunctivitis, allergic dermatitis, atopic dermatitis, contact dermatitis, urticaria, insect allergy, food Allergy and drug allergies. Therefore, the anti-inflammatory composition of the present invention may be applied as a composition for the treatment or prevention of inflammatory diseases, or may be applied as a food composition for the prevention or improvement of the inflammatory diseases. The food composition may be, for example, a health functional food composition for preventing or improving the inflammatory disease.

The health functional food is a physical, biochemical, biotechnological method, such as using the physical, biochemical, biotechnological techniques, such as food groups or food composition that has added value to give a function and expression of the function of the food for a specific purpose, disease prevention and recovery, etc. It refers to a food that is designed and processed to fully express the gymnastics function related to the living body. The dietary supplement may include food acceptable food additives, and may further include appropriate carriers, excipients and diluents commonly used in the manufacture of dietary supplements.

Health functional food composition for the prevention or improvement of inflammatory diseases of the present invention may contain 0.001 to 15% by weight of the total weight of the spinach sprout extract.

The anti-inflammatory composition comprising the spinach herb extract as an active ingredient can be directly applied to animals including humans. The animal is a biological group corresponding to a plant, and the organic material is mainly consumed as nutrients, and the digestive organ, the excretory organ, and the respiratory organ are differentiated. Preferably, the animal may be a mammal, more preferably a human.

The spinel herb extract may be used alone in the anti-inflammatory composition, and may further include other pharmacologically acceptable carriers, excipients, diluents or subcomponents. More specifically, when the composition comprising the spinach sprout extract is used as a medicament or for medicinal or pharmaceutical use, the spinach sprout extract may be mixed with a pharmaceutically acceptable carrier or excipient according to a conventional method. It can be used diluted with a diluent.

In this case, the content of the spinel bud extract in the composition may be 0.001% by weight to 99.9% by weight, 0.1% by weight to 99% by weight or 1% by weight to 50% by weight, but is not limited thereto. Depending on the method, the content of the compound can be used by appropriately adjusting to the desired content.

Examples of the pharmaceutically acceptable carrier, excipient or diluent include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, Cellulose, methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil, propylhydroxybenzoate, talc, magnesium stearate and mineral oil , Dextrin, calcium carbonate, propylene glycol, liquid paraffin, and physiological saline. However, the present invention is not limited thereto, and any conventional carrier, excipient or diluent may be used. In addition, the pharmaceutical composition may further comprise at least one selected from the group consisting of conventional fillers, extenders, binders, disintegrants, anticoagulants, lubricants, humectants, pH adjusters, nutrients, vitamins, electrolytes, alginic acid and its salts, pectic acid and its salts, , Fragrances, emulsifiers, preservatives, and the like. The components may be added independently or in combination to the spinach sprout extract, which is the active ingredient.

In addition, the composition of the present invention may further include a substance used as a known anti-inflammatory effect, for example, COX-2 inhibitors, NO inhibitors or anti-inflammatory agents in addition to the active ingredient.

When the composition is used as a medicine, it can be administered orally or parenterally. In one example, it can be administered through various routes including oral, transdermal, subcutaneous, intravenous or muscular.

In addition, the formulations of the compositions may vary depending on the method of use and may be formulated using methods well known in the art to provide rapid, sustained or delayed release of the active ingredient after administration to the mammal . In general, solid dosage forms for oral administration include tablets, pills, soft or hard capsules, pills, powders and granules, which may contain one or more Excipients such as starch, calcium carbonate, sucrose or lactose, gelatin, and the like. In addition to simple excipients, lubricants such as magnesium stearate and talc may also be used. Oral liquid preparations include suspending agents (SUSTESIONS), liquid solutions, emulsions (EMULSIONS) and syrups (SYRUPS) .Such as simple diluents such as water and liquid paraffin, various excipients such as wetting agents, Sweeteners, fragrances, preservatives and the like can be included.

Forms for parenteral administration are CREAM, LOTIONS, ONITMENTS, PLASTERS, LIQUIDS AND SOULTIONS, AEROSOLS, FRUIDEXTRACTS, Elixir (ELIXIR), INFUSIONS, SACHET, PATCH or INJECTIONS.

Furthermore, the compositions of the present invention may be formulated using suitable methods known in the art or using methods disclosed in Remington's Pharmaceutical Science (Recent Edition, Mack Publishing Company, Easton PA). Can be.

The dosage of the composition may be determined in consideration of the method of administration, age, sex, severity, condition of the patient, absorption of the active ingredient in the body, inactivation rate and the drug used in combination, for example, based on the daily effective ingredient 0.1 mg / kg (body weight) to 500 mg / kg (body weight), 0.1 mg / kg (body weight) to 400 mg / kg body weight or 1 mg / kg body weight to 300 mg / kg body weight It can be administered, and can be administered once or divided into several times. The dose is not intended to limit the scope of the invention in any way.

The present invention also provides an anti-inflammatory agent comprising an anti-inflammatory composition comprising the spinach sprout extract as an active ingredient.

The spinach sprout extract may be a fraction fractionated with at least one solvent selected from the group consisting of hexane and methylene chloride of the spinach sprout flower ethanol extract, more preferably the spinach sprout flower ethanol extract.

The anti-inflammatory agent may include the active ingredient alone, and may further include a pharmaceutically acceptable carrier or excipient according to the formulation, method of use, and purpose of use. When provided in a mixture, the active ingredient may be included in an amount of 0.1 to 99.9% by weight based on the total anti-inflammatory agent, but is generally included in an amount of 0.001 to 50% by weight.

The anti-inflammatory agent is used for the purpose of preventing and treating various chronic inflammatory diseases such as rheumatoid arthritis, lupus, multiple sclerosis, various acute inflammatory diseases such as sepsis, shock, organ transplant rejection, ophthalmic disease, bronchitis, or inflammatory bowel disease. It is possible.

Examples of the carrier or excipient include water, dextrin, calcium carbonate, lactose, propylene glycol, liquid paraffin, saline, dextrose, sucrose, sorbitol, mannitol, ziitol, erythritol, maltitol, starch, gelatin, calcium phosphate, Calcium silicate, cellulose, methyl cellulose, polyvinylpyrrolidone, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. Two or more carriers or excipients may be used.

In addition, when the anti-inflammatory agent is formulated, conventional fillers, extenders, binders, disintegrants, surfactants, anti-coagulants, lubricants, wetting agents, fragrances, emulsifiers or preservatives may be further included.

In addition, the anti-inflammatory agent of the present invention may further include a compound or plant extract having a known anti-inflammatory activity in addition to spinach sprout extract, it may be included in 5 to 20 parts by weight based on 100 parts by weight of spinach sprout extract.

The formulation of the anti-inflammatory agent may be in a preferred form depending on the method of use, and may be formulated by employing methods known in the art, in particular to provide rapid, sustained or delayed release of the active ingredient after administration to a mammal. Examples of specific formulations include warnings, granules, lotions, linings, limonades, powders, syrups, ointments, liquids, aerosols, EXTRACTS, elixirs, ointments, liquid extracts, emulsions, Suspensions, premises, acupuncture, eye drops, tablets, suppositories, injections, spirits, capsules, creams, pills, soft or hard gelatin capsules.

Anti-inflammatory agents according to the present invention can be used orally or parenterally, for example, can be used through the dermis, intramuscular, intraperitoneal, intravenous, subcutaneous, nasal, epidural and oral route, the dosage thereof, the method of administration , The age, sex and weight of the recipient, and the severity of the disease, it is good to determine. In one embodiment, the anti-inflammatory agent of the present invention can be administered one or more times 0.1 to 100 mg / kg (body weight) per day based on the active ingredient. However, the above dosage is only one example to illustrate and is not limited to the above range.

The present invention also provides a cosmetic composition comprising an anti-inflammatory composition comprising the spinel herb extract as an active ingredient.

Since the spinal herb extract is derived from a natural substance used for edible, no side effects are not a problem, and there is no cytotoxicity, and the anti-inflammatory and anti-stimulatory activity is excellent because of its excellent anti-inflammatory effect. Since the induced inflammation and inflammation induced by the external environment can be effectively controlled, the anti-inflammatory composition comprising the spinach sprout extract as an active ingredient may be used as an active ingredient of a cosmetic composition having an effect of improving inflammation and alleviating inflammation.

The spinus herb extract is a ethanol extract of the spiny bud flower ethanol extract, preferably a fraction fractionated with one or more solvents selected from the group consisting of hexane and methylene chloride of the spiny bud flower ethanol extract, more preferably the hexane fraction of the liana flower ethanol extract Can be.

The cosmetic composition may be provided for use in basic cosmetics, makeup cosmetics, body cosmetics, hair cosmetics, scalp cosmetics, shaving cosmetics or oral cosmetics.

Examples of the basic cosmetics include creams, lotions, packs, massage creams, latexes, etc. Examples of the makeup cosmetics include foundations, makeup bases, lipsticks, eye shadows, eyeliners, mascaras, eyebrow pencils, and the like. Examples of cosmetics include soaps, liquid detergents, baths, sunscreen creams, sun oils, and the like. Examples of the hair cosmetics include shampoo, conditioner, hair treatment, hair mousse, hair liquid, pomade, hair colorant, and hair bleach. Agent or color rinse. Examples of the scalp cosmetics include hair tonic or scalp treatment, and examples of the shaving cosmetics include aftershave or shaving cream, and examples of the oral cosmetics include Toothpaste or mouse washer.

In addition to the active ingredient, the cosmetic composition is a component that is usually formulated in the cosmetic composition according to the purpose of use and the nature of the cosmetic composition, for example, moisturizers, ultraviolet absorbers, vitamins, animal and plant extracts, digestive agents, whitening agents, vasodilators, astringents, refreshing agents, Hormonal agents and the like can be further formulated. In addition, the cosmetic composition may further include a base necessary to penetrate or transfer the drug or active ingredient into the skin tissue.

The formulation of the cosmetic composition may take an appropriate form depending on the purpose of use and the nature of the cosmetic composition, for example, an aqueous solution, solubilizing, emulsifying, emulsion, gel, paste, ointment, aerosol, water-oil It may be a two-layered or water-oil-powder three-layered, examples of the formulations are merely illustrative, and the formulations and forms of the cosmetic composition of the present invention are not limited by the above examples.

The active ingredient may be included in an amount of 0.001 to 50% by weight based on the total weight of the cosmetic composition, preferably 0.01 to 20% by weight, but the content is the content of ingredients other than the active ingredient contained in the formulation or cosmetic composition. According to the present invention, the amount of the active ingredient included in the present invention is not limited.

The spinach herb extract of the present invention is a plant-derived extract used for food, which has no side effects or safety problems, is not cytotoxic, and specifically expresses levels of proteins related to inflammation, NO secretion amount, iNOS and COX- The expression of 2, iNOS and COX-2 mRNA and whether the transcription of various cytokine (cytokine) mRNA associated with inflammation was confirmed through the effects on the results, it was confirmed that it can effectively inhibit inflammation. Therefore, the anti-inflammatory composition comprising the spinal herb extract as an active ingredient is an anti-inflammatory agent for inhibiting inflammation and treating or preventing diseases related to inflammation, and skins due to ingredients or external environment which are essential for the manufacture of cosmetics. It can be applied to a cosmetic composition having a feature that can effectively suppress the inflammation of. Therefore, the present invention can be widely used in the medical industry related to the treatment of diseases related to inflammation and in the cosmetic industry related to the control of dermatitis.

1 is a graph showing the results of measuring the cytotoxicity of the spinal sprout extract by MTT assay using RAW264.7 cell line according to an embodiment of the present invention, in which CON is not administered any sample The control group, the horizontal axis value represents the dose (μg / mL) of the spinal sprout extract, the experimental group indicated by the arrow on the horizontal axis means that the LPS (1 μg / mL) was treated together.
Figure 2 is a graph showing the result of measuring the amount of NO secretion, in order to confirm the anti-inflammatory effect of the spinel sprout extract using RAW264.7 cell line, according to an embodiment of the present invention, in Figure 2a + is LPS (1 Μg / mL) was treated together,-means not treated with LPS, the horizontal axis indicates the kind (by site) and administration of the spinel sprout extract, the vertical axis indicates the amount of NO secretion, In 2b, CON represents a control group that did not receive any sample, and the horizontal axis value represents the dose (㎍ / mL) of the spinach sprout extract, and the horizontal arrow marks the LPS (1 μg / mL) together. It means.
Figure 3 using the RAW264.7 cell line, in accordance with an embodiment of the present invention, in order to confirm the anti-inflammatory effect of the spinel bud extract, iNOS protein expression and COX-2 protein expression by the result confirmed by Western blot analysis In the above picture, CON indicates the control group not administered any sample, the value on the left vertical axis indicates the size of the protein (kDa), the right vertical axis indicates the type of the protein, and the horizontal axis indicates the spine. It is a numerical value which shows the dose (microgram / mL) amount of the herb extract, and the arrow mark of a horizontal axis means that LPS (1 microgram / mL) was processed together.
Figure 4 using the RAW264.7 cell line, in accordance with an embodiment of the present invention, in order to confirm the anti-inflammatory effect of the spinel sprout extract, iNOS mRNA and COX-2 mRNA transcription amount was confirmed through the RT-PCR method In the graph shown, CON represents a control group not administered any sample, the value on the vertical axis represents the value, the value on the horizontal axis represents the dose (㎍ / mL) amount of the spinel sprout extract, the arrow on the horizontal axis Indication means that LPS (1 μg / mL) was treated together. Figure 4a is a graph showing the result of measuring the amount of iNOS mRNA transcription, Figure 4b is a graph showing the result of measuring the amount of COX-2 mRNA transcription.
Figure 5 using the RAW264.7 cell line, in accordance with an embodiment of the present invention, in order to confirm the anti-inflammatory effect of the spinel sprout extract, the mRNA transcription amount of cytokines associated with inflammation was confirmed by RT-PCR method In the graph shown, CON indicates the control group was not administered any sample, the value of the vertical axis represents the fold increased mRNA content relative to the GADPH compared to the control, the value of the horizontal axis represents the dosage of the spinel sprout extract (㎍ / mL) It is a numerical value showing the quantity, and the arrow mark on a horizontal axis means that LPS (1 microgram / mL) was processed together. Figure 5a is a graph showing the result of measuring the amount of IL-6 mRNA transcription, Figure 5b is a graph showing the result of measuring the amount of IL-1β mRNA transcription, Figure 5c is a result of measuring the amount of TNF-α mRNA transcription The graph shown.
6 is a graph showing the result of measuring the amount of NO secretion, in order to confirm the anti-inflammatory effect of the fraction of the spinel bud flower ethanol extract according to the type of fraction solvent, using a RAW264.7 cell line according to an embodiment of the present invention As shown in FIG. 6, the underlined portion means that LPS (1 μg / mL) was treated together, CON means no LPS treatment, and 0 means that LPS was not treated, and then no sample was administered. Mean spine, spinach sprout means that the spinal sprout ethanol extract was administered, the horizontal axis represents the type of fraction of the spinach sprout extract (by fractional solvent), the vertical axis represents the NO secretion amount.

Hereinafter, the present invention will be described in detail with reference to Examples. However, the following examples are merely illustrative of the present invention and can be modified in many different forms, which are intended to illustrate the present invention, but the scope of the present invention is not limited by the following examples.

Example 1 Preparation of Spinach Sprout Extract and Fraction

Spine sprouts ( Eupatorium) japonicum ) flowers, stems and roots of 100g each was immersed in 10L of ethanol, and then extracted by hot needle extraction method.

More specifically, 50L of ethanol was added to 500g of the spinach bud flowers, stems and roots, and the spinach bud flowers, stems and roots were completely immersed in an extraction solvent, and then extracted while refluxing at 70 ° C. The extracts of the spinach sprouts prepared by the extraction were concentrated under reduced pressure using a vacuum concentrator, respectively, and lyophilized at -20 ° C. Through the lyophilization, 50g of extract was obtained (yield 5%).

A fraction of the ethanol extract of spinel buds is prepared by replacing 30 g of the crude extract with 10-fold distilled water, that is, 300 g of distilled water, and then adding hexane and fractionating to separate only the hexane layer. The methylene chloride fraction was prepared by adding the same amount of methylene chloride to the remaining solution (water layer), separating the layers, and separating only the methylene chloride layer. The methylene chloride layer was separated and the remaining solution (water layer) Ethyl acetate fraction was prepared by adding the same amount of ethyl acetate and fractionating to separate only the ethyl acetate layer, separating the ethyl acetate layer and adding the same amount of butanol to the remaining solution (water layer) By fractionating only butanol layer to prepare a butanol fraction, The remaining solution was used as the water fraction. The spinach sprout fraction solution for each solvent prepared through the fraction was concentrated under reduced pressure using a vacuum concentrator, and then freeze-dried at -20 ° C to prepare a fraction.

The extracts and fractions obtained were cryopreserved until use in experiments.

Example 2 Cytotoxicity Experiment

In order to measure the cytotoxicity of the spinel bud flower extract prepared in Example 1, RAW264.7 cells, which are mouse macrophages, were purchased from ATCC and used.

DMEM / F12 (Dulbecco's modified Eagle's medium / Nutrient Mixture Ham's F12), FBS (fetal bovine serum), L-glutamine, penicillin-streptomycin and Insulin used in the cell culture were Gibco / BRL. (USA).

The RAW264.7 cells were cultured using a medium containing 10% FBS, 1% penicillin streptomycin 1% L-glutamine and 20 μg / ml insulin in DMEM / F12 medium, and a 37 ° C. CO 2 incubator (5% CO 2/95% air). After about 80% of the cells were incubated, the cells were washed with a layer of PBS (pH 7.4), washed, and subcultured with 0.25% trypsin and 2.56 mmol / L EDTA. Medium was changed every two days.

The cultured cells were aliquoted into 24 well-plates at a density of 50,000 cells / well and incubated for 24 hours. After 24 hours of incubation, serum deprivation was performed with serum-deprivation medium (SDM) containing 1% charcoal stripped FBS for 24 hours. After 24 hours, MTT assay (MTT assay) at 0 hours, 4 hours and 24 hours after exchanging with SDM containing LPS and spinel bud extract of Example 1 of various concentrations together with no treatment. The number of living cells was measured by the method.

More specifically, the MTT assay is a test method that utilizes the ability of intracellular mitochondria to reduce MTT tetrazolium, a yellow water-soluble substrate, to a water-soluble MTT formazan crystal with a blue violet color by dehydrogenase action. As a solvent for dissolving the spinach sprout extract of Example 1, DMSO was found to have little effect on cell survival. For the MTT assay, the cell culture medium was removed at each time period, and then treated with 1 ml / well of DMEM / F12 medium containing MTT at 1 mg / ml, and further incubated in a 37 ° C. wet CO 2 incubator for 3 hours. Thereafter, after removing the medium, formazan crystal was dissolved by adding 0.5 ml isopropanol, and the cell viability was confirmed by measuring the absorbance at 570 nm at a micro plate reader (BIO-RAD). The results of treatment with spinach sprout extract for 24 hours are shown in FIG. 1.

As shown in FIG. 1, even when treated for 24 hours, when the spinach sprout extract prepared in Example 1 was treated at various concentrations together with the control sample and the LPS, which were not treated with any sample, the growth of the cells was increased. No significant effect was found. Therefore, it was confirmed from the above results that the spinach sprout extract has no cytotoxicity up to 10 μg / ml.

Example 3 Anti-inflammatory Effect Measurement 1-NO Content Measurement

In order to confirm the anti-inflammatory effect of the extract of each spinel bud prepared in Example 1, RAW264.7 cells cultured in Example 2 was used.

After adding together the extract of each spinel bud prepared in Example 1 and LPS, and incubated for 24 hours by the method of Example 2, the culture solution after the 24-hour incubation was collected, and the amount of NO secretion Griess reagent It was measured using the system (Promega, USA), the results are shown in Figures 2a and 2b. More specifically, the measurement method using the Griess reagent system was based on an experimental method provided by Promega, a manufacturer of the system, a Sulfanilamide solution was added to the collected cell culture solution, and then a NED solution was added thereto. It was carried out by measuring at 540nm using.

As shown in FIG. 2A, in the case of the control group not treated with LPS, low NO secretion was confirmed. On the other hand, in the experimental group to which LPS was added, it was confirmed that the content of NO was significantly increased by causing inflammation due to LPS. In addition, despite the LPS treatment, when the 10 ㎍ / ㎖ treatment of the extract per each spinel sprout prepared in Example 1 concentration of NO secretion was reduced, in particular, about 20% of the NO content of the spinel sprout root extract In the case of spinach sprout stem extract, the NO content was reduced by about 40%, while the spinach sprout flower extract showed the NOx reduction effect of 90% or more compared to the experimental group added with almost LPS. The control group without LPS was measured to have almost similar NO content. From the above results, it is expected that the spinel bud flower extract has a significantly superior NO secretion inhibitory effect, that is, an anti-inflammatory effect, compared to the extracts of other sites. Since then, the experiment for confirming the anti-inflammatory effect of the spinel bud extract is performed on the spinel bud flower extract. It was performed using.

In addition, as shown in FIG. 2b, the anti-inflammatory effect, that is, the concentration of the spinel bud flower extract prepared in Example 1 as a result of treating the spinel bud flower extract, whose NO secretion inhibitory effect was confirmed, in different contents Dependently, the NO secretion was reduced, and when the 5 ㎍ / ㎖ treated with the control almost the same NO content, when the 10 ㎍ / ㎖ treated with a lower NO content than the control, the spinal sprout of the present invention The flower extract is not only cytotoxic and safe, but also has an anti-inflammatory effect.

Example 4 Anti-inflammatory Effect Measurement 2-Measurement of iNOS and COX-2 Expression

In order to confirm the anti-inflammatory effect confirmed the NO secretion in Example 3, the expression levels of the iNOS and COX-2 proteins related to the inflammatory response were measured by Western blot analysis.

More specifically, first, total cell lyaste was obtained. First, total cell lyaste was divided into RAW264.7 cells of Example 2 in a 100 mm dish at a density of 1 × 10 ⁶ cells / dish and incubated for 24 hours, followed by incubation for 24 hours with serum starvation medium. After Serum starvation, the spine sprout flower extract prepared in Example 1 of various concentrations and LPS were added together, followed by incubation for 24 hours by the method of Example 2, and after the 24 hours, each of the cultured cells Was rinsed with cold PBX containing 1 mmol / L iodoacetic acid and 1 mmol / L phenylmethylsulfonylfluoride (PMSF), and the cells were collected with a scraper and centrifuged at 2,000 rpm and 4 ° C. for 2 minutes. Pellets obtained through the centrifugation were lysis buffer (20 mmol / L Hepes, pH 7.5, 1% Triton X-100, 150 mmol / L NaCl, 1 mmol / L EDTA, 1 mmol / L EGTA, 100 mmol). / L NaF, 10 mmol.L iodoacetic acid, 0.2 mmol / L PMSF, 20 mg / L aprotinin, 10 mg / L antipain, 10 mg / L lepeptin, 80 mg / L benzamidine HCl) for 40 minutes at 4˚C After the cell was lysed by lysis, the total cell lysate was prepared by centrifugation and supernatant, which was stored at -70 ° C.

Western blot analysis to confirm the expression level of iNOS and COX-2 protein using the total cell lyaste was carried out in the following manner.

The total cell lyaste (50 μg protein) was separated by 4-20% gradient sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to a polyvinylodene fluoride (PVDF) membrane. The PVDF membrane to which the protein was transferred was blocked in 5% non-fat milk-TBST (20 mmol / L Tris? HCL, pH 7.6, 150 mmol / L NaCl, 0.1% Tween 20) for 1 hour and then TBST for 10 minutes. Wash three times. COX-2 and iNOS antibodies were added to the membrane washed with TBST, incubated at 4 ° C. for 24 hours, and then washed three times for 10 minutes using TBST. Thereafter, the membrane washed with TBST was incubated with horseradish peroxidase (HRP) -linked anti-rabbit or mouse IgG for 1 hour and then washed three times with TBST for 10 minutes. Signals of proteins bound to the antibodies were visualized using Immobilon Western Chemiluminescent HRP Substrate, and the results are shown in FIG. 3.

As shown in FIG. 3, in the case of β-actin not related to inflammation, similar bands were identified in all experimental groups, and thus, the addition of LPS and spinel bud flower extract from the band was not related to cell survival. It was found that it did not affect the expression of most unrelated proteins.

As a result of confirming the expression of iNOS and COX-2 proteins related to the inflammation, the proteins were not found in the control group without adding LPS, but the expression of iNOS and COX-2 proteins increased rapidly when LPS was added. Confirmed. In addition, when the spinach sprout flower extract of the present invention was added, it was confirmed that the expression levels of iNOS and COX-2 proteins were decreased, and in particular, iNOS was significantly reduced in the expression levels of 5 μg / ml. It was confirmed that the 10 ㎍ / ㎖ treatment was the same as the control without the addition of LPS.

From the above results, it was confirmed that the spinel bud flower extract has an anti-inflammatory effect by inhibiting the expression of inflammation-related proteins, in particular, iNOS, not only inhibiting inflammation, but also inhibiting the expression of COX-2.

< Example   5> anti-inflammatory effect Measurement 3  - iNOS Wow COX -2 mRNA  Level measurement and inflammation-related cytokines mRNA  Level measurement

In order to confirm the anti-inflammatory effect confirmed the NO secretion in Example 3, the degree of mRNA transcription and cytokines associated with inflammation of each protein affecting the expression of iNOS and COX-2 proteins, which are proteins related to the inflammatory response The change of mRNA content of) was confirmed.

The RAW264.7 cells of Example 2 were incubated with serum starvation medium for 24 hours by the method described in Example 4. After Serum starvation, the spine sprout flower extract prepared in Example 1 of various concentrations and LPS were added together, followed by incubation for 24 hours by the method of Example 2, and after the 24 hours, each of the cultured cells RNA was isolated using a Qiagen RNase mini kit (Qiagen, Germany). The RNA isolation was performed by the protocol provided in the kit. Superscript II reverse transcriptase (Invitrogen, USA) was added to 3 μg of RNA isolated by the above method, incubated at 42 ° C. for 1 hour and 45 minutes, and then incubated at 70 ° C. for 15 minutes to obtain cDNA. The obtained cDNA was quantified by real-time PCR. Sequence and experimental conditions of the primer for performing the real-time PCR are described in Table 1 below.

Target mRNA Primer sequence Annealing Tm (℃) GADPH sense CATCAGCAATGCCTCCTGCA 54 anti-sense CTGTGGTCATGAGTCCTTCC COX-2 sense GAAGTCTTTGGTCTGGTGCCTG 56 anti-sense GTCTGCTGGTTTGGAATAGTTGC iNOS sense GGAGCGAGTTGTGGATTGTC 56 anti-sense GTGAGGGCTTGGCTGAGTGAG TNF-a sense TCCAGGCGGTGCCTATGT 56 anti-sense CGATCACCCCGAAGTTCAGT IL-6 sense GATGCTAACAAACTGGATATAATC 56 anti-sense GGTCCTTAGCCACTCCTTCTGTG I-1β sense GATGCTAACAAACTGGATATAATC 56 anti-sense GGTCCTTAGCCACTCCTTCTGTG

The real-time PCR results were converted into mRNA amounts compared to GAPDH using ROTOR-GENE 6000 Series software 1.7, and then displayed as contents compared to the control, and are shown in FIGS. 4 to 5.

As shown in FIG. 4, in the control group not treated with LPS, mRNAs of iNOS and COX-2 proteins were not confirmed at all, whereas mRNAs of iNOS and COX-2 proteins were remarkably high when only LPS was treated. In addition, despite the LPS treatment, it was confirmed that the mRNA content of iNOS and COX-2 protein was significantly reduced when the spinach sprout flower extract prepared in Example 1 was treated, in particular, the iNOS mRNA content was more remarkable. It was confirmed that the reduction.

In addition, as shown in FIG. 5, the control group not treated with LPS was not identified with mRNA of IL-6, an IL-1β mRNA, and TNF-α mRNA, which is a cytokine (cytokine) associated with inflammation. Only high levels of cytokine mRNA were observed. In addition, despite the LPS treatment, when the spinel bud flower extract prepared in Example 1 is treated, the concentration of the mRNA of IL-6, the mRNA of IL-1β and the TNF-α mRNA are significantly reduced. In particular, it was confirmed that the mRNA content of IL-6 and the mRNA content of IL-1β were reduced to a level not causing inflammation by adding LPS.

< Example   6> anti-inflammatory effect Measurement 4  - Fraction NO  Content measurement

In order to confirm the anti-inflammatory effect of each fraction of the fraction of the ethanol extract of spinel bud flower prepared in Example 1, using the RAW264.7 cells cultured in Example 2, the fraction is NO by the method of Example 3 The effect on production was measured.

More specifically, after adding 10 μg / ml of the fraction of the spinus ethanol extract prepared in Example 1 and LPS together, incubated by the method of Example 2 for 24 hours, the culture solution after the culture for 24 hours Collected, the amount of NO secretion was measured using a Griess reagent system (Promega, USA) as in Example 3, the results are shown in FIG.

As shown in FIG. 6, the control group (CON of FIG. 6) not treated with LPS was found to have almost no NO secretion. On the other hand, in the experimental group to which LPS was added (0 of FIG. 6), inflammation was induced due to LPS, and the content of NO was markedly increased, and it was confirmed that it was about 20 μM. In addition, despite the LPS treatment, the spinach sprout flower extract prepared in Example 1 showed an effect of reducing the NO content of about 75% compared to the experimental group to which almost LPS was added. On the other hand, the water fraction of the ethanol extract (water of Figure 6) was found to have almost no NO secretion inhibitory effect, but the butanol fraction (butanol of Figure 6) also shows a NO content corresponding to 300% of the ethanol extract NO secretion inhibitory effect was found to be very low. In addition, the ethyl acetate fraction also showed more than 50% of the NO content of the ethanol extract, it was confirmed that the increase of the NO secretion inhibitory effect is lower than the ethanol extract. However, the hexane fraction and the methylene chloride fraction showed a NO content almost similar to that of the LPS-treated control group (CON of FIG. 6), and it was confirmed that there was a markedly improved NO secretion inhibitory effect. Since the production of NO is related to the UPSTREAM in relation to the inflammatory response, the inhibition of the NO production in this UPSTREAM step may have a significant effect in relation to the final inflammatory response, so the hexane fraction and the methylene chloride fraction are more prominent than the other fractions. It was expected to have an anti-inflammatory effect.

According to the experimental results, the extract of spinal herbs used for food was confirmed that there is no cytotoxicity in the MTT analysis as expected, and when examined various mechanisms that cause inflammation in relation to the anti-inflammatory effect is induced by NO Inflammation-related results (NO secretion levels, iNOS expression levels and iNOS mRNA transcription levels), and COX-2-induced inflammation-related results (COX-2 expression levels and COX-2 mRNA transcription levels) Amount) and various cytokine-induced mRNA transcription levels, it was confirmed that the inflammation can be effectively inhibited. In particular, the hexane and methylene chloride fractions of the ethanol extract of spinel buds have anti-inflammatory effects. Since it was confirmed to be very excellent, the spinach sprout extract of the present invention, in particular, the spinach sprout flower ethanol extract and its hexane fraction and methylene Low-grade fraction can not only replace existing inflammatory agent, an inflammation caused by the components used in conventional cosmetics may be suitably controlled here is expected to be used as an active ingredient of the cosmetic composition.

Claims (5)

delete An anti-inflammatory composition comprising an extract from the spinach sprouts with water, at least one selected from the group consisting of alcohols having 1 to 5 carbon atoms and mixtures thereof as an extractant. The method of claim 2,
The spinus herb extract is an anti-salt composition comprising fractions of at least one selected from the group consisting of hexane and methylene chloride in the spinel bud flower ethanol extract. An anti-inflammatory agent comprising the anti-inflammatory composition of claim 2 as an active ingredient. Cosmetic composition having an inflammation and alleviation effect comprising the anti-inflammatory composition of claim 2 as an active ingredient.

Images