KR100538465B1

KR100538465B1 - Composition comprising kringle domain 1-2 peptide having anti-angiogenic activity and cancer growth inhibitory activity and its use thereof

Info

Publication number: KR100538465B1
Application number: KR10-2003-0008100A
Authority: KR
Inventors: 조영애; 이수영
Original assignee: 가톨릭대학교 산학협력단
Priority date: 2003-02-10
Filing date: 2003-02-10
Publication date: 2005-12-22
Also published as: KR20040072141A

Abstract

인간 티슈타입 플라스미노겐 활성자(tissue type plasminogen activator, t-PA)에서 유래하는 혈관신생과 암의 성장을 억제하는 크링글 도메인 단백질 TK1-2, 이를 발현하는 벡터 및 균주, 그리고 상기 단백질을 함유하는 약학조성물에 관한 것이다. RT-PCR에 의해 cDNA 확보, 대장균 발현 플라스미드, 효모 피키아(pichia) 발현 플라스미드의 제작, 단백질 발현 및 분리 정제 후, 내피세포의 성장 억제, CAM 분석상에서의 혈관신생 억제기능이 확인되었고, 폐암의 실험동물 모델에서 암의 성장을 억제하는 것을 확인하였다. 본 발명은 암 뿐만 아니라 류마티스 관절염, 망막병증, 건선 등의 질환에 유용하게 사용될 수 있다.Kringle domain protein TK1-2 which inhibits angiogenesis and cancer growth derived from human tissue type plasminogen activator (t-PA), vectors and strains expressing the same, and the protein It relates to a pharmaceutical composition. RT-PCR confirmed cDNA, E. coli expression plasmid, yeast pichia expression plasmid, protein expression and isolation and purification. It was confirmed that the growth of cancer in the experimental animal model. The present invention can be usefully used for diseases such as rheumatoid arthritis, retinopathy, psoriasis as well as cancer.

Description

Composition comprising kringle domain 1-2 peptide having anti-angiogenic activity and cancer growth inhibitory activity and its use approximately}

본 발명은 혈관신생 억제활성 및 암의 성장 억제 활성을 갖는 단백질에 관한 것이다. 더욱 상세하게는 인간 티슈조직 플라스미노겐 활성자(t-PA)의 크링글 도메인 1 및 2를 포함하는 재조합 단백질 TK1-2, 이의 제조방법 및 이를 함유하는 약학조성물에 관한 것이다. The present invention relates to a protein having angiogenesis inhibitory activity and cancer growth inhibitory activity. More specifically, the present invention relates to a recombinant protein TK1-2 comprising Kringle domains 1 and 2 of human tissue tissue plasminogen activator (t-PA), a preparation method thereof, and a pharmaceutical composition containing the same.

종양의 성장과 전이에 있어서 혈관형성 과정은 필수적으로 요구된다 (Folkman, J., J. Natl. Cancer Inst., 82, pp 4-6, 1990; Millauer, B. et al., Nature, 367, pp 576-579, 1994). 이미 많은 연구자들이 혈관형성 과정을 억제하여 종양을 치료하려는 연구를 하였으며, 그 결과 안지오스태틴(angiostatin), 엔도스태틴(endostatin), PK 5, 프로트롬빈 크링글 2 (prothrombin kringle 2) 등 여러 혈관형성 억제인자들이 보고되었다 (O'Reilly, M.S. et al, Cell, 79, pp 315-328 1994; O'Reilly, M.S. et al., Cell, 88, pp 277-285, 1997; Cao, Y., J. Biol. Chem., 272, pp 22924-22928, 1997; Lee T.H., J. Biol. Chem., 273, pp 28805-28812, 1998). 이 중에서 안지오스태틴을 포함한 일부 억제인자들은 크링글 구조를 공통적으로 가지고 있다는 특징을 보여준다. 이러한 혈관신생억제제의 특징은 약물 내성이 없고, 독성이 없는 점, 위장관 증세와 골수 억제(bone marrow suppression) 및 머리카락의 손실이 없는 점, 방사선 치료의 효과를 높일 수 있는 점, 혈액뇌관문(blood brain barrier, BBB)이 없는 점 등의 장점이 있어 화학요법제의 단점을 보완할 수 있다.Angiogenesis processes are essential for tumor growth and metastasis (Folkman, J., J. Natl. Cancer Inst. , 82 , pp 4-6, 1990; Millauer, B. et al. , Nature , 367 , pp 576-579, 1994). Many researchers have already tried to treat tumors by inhibiting the angiogenesis process, and as a result, various angiogenesis including angiostatin, endostatin, PK 5, prothrombin kringle 2, etc. Inhibitors have been reported (O'Reilly, MS et al , Cell , 79 , pp 315-328 1994; O'Reilly, MS et al. , Cell , 88 , pp 277-285, 1997; Cao, Y., J Biol. Chem. , 272 , pp 22924-22928, 1997; Lee TH, J. Biol. Chem ., 273 , pp 28805-28812, 1998). Some of these inhibitors, including angiostatin, are characterized by a common kringle structure. These anti-angiogenic agents are characterized by inadequate drug resistance, no toxicity, gastrointestinal symptoms and bone marrow suppression and no hair loss, which can increase the effectiveness of radiation therapy, and blood There is no brain barrier (BBB), which can compensate for the disadvantages of chemotherapeutic agents.

또한 혈관신생 억제제들은 암의 성장과 전이의 억제에 사용될 수 있을 뿐아니라 망막병증, 류마티스성 관절염, 건선 등의 치료에도 이용될 수 있다 (Folkman, J., Nature Med., 1, pp27-31, 1995).Angiogenesis inhibitors can also be used to inhibit cancer growth and metastasis, as well as to treat retinopathy, rheumatoid arthritis, psoriasis, etc. (Folkman, J., Nature Med. , 1 , pp27-31, 1995).

티슈타입 플라스미노겐 활성자 (tissue type plasminogen activator, t-PA)는 multi-domain serine protease이며, 섬유소용해 (fibrinolysis)와 종양의 전이에 관여한다 (Rijken, D.C., J. Biol. Chem., 257, pp2920-2925, 1982; Mignatti, P., Cell, 47, pp487-498, 1986). t-PA는 크게 N 말단 측으로부터 핑거 도메인(F), 상피세포증식인자 도메인(G), 2개의 크링글 도메인(kringle Ⅰ domain, kringle Ⅱ domain), 세린 프로테아제(serine protease, P)의 5개의 도메인으로 구성되어 있다. 약 70~80개의 아미노산들로 이루어진 크링글 도메인은 3중의 이황화결합 (disulfide bond)으로 연결된 루프(loop) 구조가 특징적이고 이 3중의 이황화결합도 크링글 구조들 사이에 엄격히 보존되어 있다. t-PA 크링글들은 플라스미노겐 크링글들과의 아미노산 서열 동일성이 26-39%로 비교적 낮은 편이다.Tissue type plasminogen activator (t-PA) is a multi-domain serine protease and is involved in fibrinolysis and tumor metastasis (Rijken, DC, J. Biol. Chem ., 257 , pp 2920-2925, 1982; Mignatti, P., Cell , 47 , pp 487-498, 1986). t-PA is largely divided into five groups: finger domain (F), epithelial cell growth factor domain (G), two kringle domain (kringle II domain) and serine protease (P) from the N-terminal side. It consists of domains. The Kringle domain of about 70 to 80 amino acids is characterized by a loop structure linked by triple disulfide bonds, and the triple disulfide bonds are strictly preserved between the Kringle structures. t-PA kringles have relatively low amino acid sequence identity with plasminogen kringles (26-39%).

종래기술로는 조직형 플라스미노겐 활성인자(t-PA)가 응혈 용해 활성을 갖는 피브린 용해제(대한민국 특허공보 특1997-5251)로 개시되어 있으며, 대한민국 특허 1997-1237 에는 신규한 플라스미노겐 활성인자가 심근경색증, 발작, 심장마비, 폐동맥 색전증, 심정맥 혈전증, 말초동맥 교합 등의 혈관질병의 치료용 혈전용해제로서 개시되어 있다. 피브린을 용해하여 혈액의 응고를 억제하는 혈전분해제로서 많은 종래 기술이 존재하나, 일부 서열이 내피세포 성장 억제, 혈관신생 억제 및 암의 성장 억제 기능이 있는지는 현재까지 밝혀진 바 없다.In the prior art, tissue-type plasminogen activator (t-PA) is disclosed as a fibrin soluble agent having coagulation lytic activity (Korean Patent Publication No. 1997-5251), and Korean Patent 1997-1237 discloses a novel plasminogen activity. Factors are disclosed as thrombolytics for the treatment of vascular diseases such as myocardial infarction, seizures, heart attacks, pulmonary embolism, deep vein thrombosis, peripheral artery occlusion and the like. There are many prior arts as thrombolytic agents that dissolve fibrin and inhibit blood coagulation, but it is not known until now whether some sequences have endothelial growth inhibition, angiogenesis inhibition, and cancer growth inhibition.

따라서 본 발명자들은 약물 내성이 없는 새로운 항암 치료제의 개발을 위해, 티슈타입 플라스미노겐 활성자(tissue type plasminogen activator,t-PA)의 크링글 도메인에 대하여 시험관내 시험(in vitro) 및 생체내 시험(in vivo)에서 혈관 신생 억제 효과가 있는지 조사하고자 하였고, 실험동물 모델에서 항암효과를 조사하여 새로운 항암 치료제의 가능성을 찾아보고자 하였다. t-PA에서 두 개의 크링글을 포함하는 도메인만을 재조합 단백질로서 대장균과 효모에서 발현, 리폴딩 (refolding), 정제하는 기술을 확립하여 재조합 단백질을 효율적으로 생산하는 방법을 확립하였고, 활성있는 재조합 단백질을 대량으로 생산, 정제하여 시료를 충분히 확보한 다음 내피세포들에 대한 증식 억제 효과와 CAM 어세이를 통해 생체내 실험(in vivo)에서 혈관신생에 대한 효과를 확인하였고, 최종적으로 인간 폐암세포 (Human lung cancer cell)를 이식시킨 실험동물 모델에서 항암효과를 조사하고, 조직 염색을 통해 암의 성장과 혈관신생에 미치는 영향을 확인하여 본 발명을 완성하였다.Therefore, the present inventors have conducted in vitro and in vivo tests on the Kringle domain of tissue type plasminogen activator (t-PA) for the development of a new anti-cancer drug with no drug resistance. The purpose of this study was to investigate whether angiogenesis inhibitory effect was observed in vivo and to investigate the anticancer effect in experimental animal models to find the possibility of new anticancer drugs. Established a method for efficiently producing recombinant proteins by establishing technologies for expression, refolding, and purification in E. coli and yeast as recombinant proteins with only two Kringle domains in t-PA. Production and purification in large quantities to secure a sufficient sample, and then confirmed the effect on the angiogenesis in vivo through the proliferation inhibitory effect on endothelial cells and CAM assay, and finally human lung cancer cells ( The present invention was completed by investigating the anticancer effect in an experimental animal model implanted with human lung cancer cells, and confirming the effect on cancer growth and angiogenesis through tissue staining.

본 발명의 목적은 플라스미노겐의 크링글 부분을 재조합 단백질로 발현, 정제하여, 본 발명의 재조합 단백질이 혈관 내피 세포 증식 억제 효과, 혈관신생 억제 효과 및 암의 성장억제 효과를 밝혀 혈관신생억제제 및 암의 성장 억제제로서의 신규한 용도를 제공하는 것이다. An object of the present invention is to express and purify the Kringle portion of the plasminogen as a recombinant protein, thereby revealing an angiogenesis inhibitor by the recombinant protein of the present invention revealing vascular endothelial cell proliferation inhibitory effect, angiogenesis inhibitory effect and cancer growth inhibitory effect. It is to provide a novel use as a growth inhibitor of cancer.

상기 목적을 달성하기 위하여, 본 발명은 인간 티슈 타입 플라스미노겐 활성자(t-PA)에서 유래하는, 혈관신생 및 암의 성장을 억제활성을 갖는 서열번호 1에 기재된 아미노산 서열을 갖는 재조합 단백질 TK1-2를 제공한다.In order to achieve the above object, the present invention provides a recombinant protein TK1 having an amino acid sequence as set forth in SEQ ID NO: 1, which is derived from human tissue type plasminogen activator (t-PA) and has an inhibitory activity on angiogenesis and cancer. Gives -2.

본 발명은 상기 단백질을 발현하는 재조합 플라스미드로서, 재조합 대장균 발현 플라스미드인 TK1-2(삽입유전자)/pET-15b(벡터)를 제공한다.The present invention provides a recombinant plasmid expressing the protein, TK1-2 (inserted gene) / pET-15b (vector), which is a recombinant E. coli expression plasmid.

또한, 본 발명은 상기 단백질을 발현하는 재조합 플라스미드로서, 재조합 효모 발현 플라스미드인 His-TK1-2(삽입유전자)/pPICZα-C(벡터) 및 N-TK1-2(삽입유전자)/pPICZα-C(벡터)를 제공한다.In addition, the present invention is a recombinant plasmid expressing the protein, His-TK1-2 (insert gene) / pPICZα-C (vector) and N-TK1-2 (insert gene) / pPICZα-C (recombinant yeast expression plasmid) Vector).

또한, 본 발명은 상기 크링글 도메인 TK1-2 단백질을 함유하는 내피세포성장 억제용 약학조성물을 제공한다.The present invention also provides a pharmaceutical composition for inhibiting endothelial cell growth containing the Kringle domain TK1-2 protein.

또한, 본 발명은 상기 크링글 도메인 TK1-2 단백질을 함유하는 혈관신생 억제용 약학조성물을 제공한다.The present invention also provides a pharmaceutical composition for inhibiting angiogenesis containing the Kringle domain TK1-2 protein.

또한, 본 발명은 상기 크링글 도메인 TK1-2 단백질을 함유하는 암의 성장 억제용 약학조성물을 제공한다.The present invention also provides a pharmaceutical composition for inhibiting growth of cancer containing the Kringle domain TK1-2 protein.

이하, 본 발명을 상세히 설명한다.Hereinafter, the present invention will be described in detail.

본 발명은 인간의 티슈 타입 플라스미노겐 활성자에서 유래하는 서열번호 1에 기재된 아미노산 서열을 갖는 단백질 조성물을 제공한다. The present invention provides a protein composition having the amino acid sequence set forth in SEQ ID NO: 1 derived from human tissue type plasminogen activator.

상기 TK1-2 단백질은 플라스미노겐의 크링글(kringle) 도메인의 1 및 2에 해당하는 부분이고, 인간 플라스미노겐 단백질의 90번째 아미노산 서열 세린부터 263번째 트레오닌까지의 아미노산서열(서열번호 1)을 포함하며, 이는 서열번호 2로 표시되는 염기서열에 의해 암호화될 수 있다.The TK1-2 protein is a part corresponding to 1 and 2 of the kringle domain of plasminogen, and the amino acid sequence from the 90th amino acid sequence serine to the 263th threonine of human plasminogen protein (SEQ ID NO: 1). It includes, it may be encoded by the nucleotide sequence represented by SEQ ID NO: 2.

본 발명은 상기 단백질의 발현을 위하여 대장균 및 효모에서 단백질을 발현시키기 위하여, 대장균 또는 효모 발현벡터와 상기 단백질을 암호화하는 염기서열 및 변형염기서열로 이루어진 플라스미드를 제공한다.The present invention provides a plasmid consisting of E. coli or yeast expression vector and a base sequence and a modified base sequence encoding the protein in order to express the protein in E. coli and yeast for the expression of the protein.

상기 변형염기서열은 5개 내지 10개의 히스티딘 아미노산을 암호화하는 염기서열, 트롬빈에 의해 잘려지는 아미노산 암호화 염기서열, c-myc 에피토프 (epitope) 염기서열 중 하나 이상을 선택하여 사용할 수 있다.The modified base sequence may be used by selecting one or more of a base sequence encoding 5 to 10 histidine amino acids, an amino acid coding sequence cut by thrombin, and a c-myc epitope base sequence.

사람의 혈액, 조직 또는 세포에서 추출한 전체 RNA를 가지고 RT-PCR을 수행하여 cDNA를 제작하고, 서열번호 3 및 4 또는 서열번호 5 및 6의 프라이머를 사용하여 PCR을 수행하여 서열번호 2를 포함하는 cDNA를 증폭할 수 있다. 상기 PCR 산물에 제한효소를 처리하여, 대장균 발현 벡터 또는 효모 발현벡터에 클로닝하여 단백질 발현을 위한 플라스미드를 제작할 수 있다.RT-PCR was performed on the whole RNA extracted from human blood, tissue, or cells to prepare cDNA, and PCR was performed using primers SEQ ID NO: 3 and 4 or SEQ ID NO: 5 and 6 to include SEQ ID NO: 2. cDNA can be amplified. By treating the PCR product with restriction enzymes, the plasmid for protein expression can be prepared by cloning the E. coli expression vector or yeast expression vector.

본 발명은 상기 단백질을 발현하는 재조합 플라스미드로 서열번호 2의 염기서열을 포함하는 재조합 대장균 발현 플라스미드인 TK1-2/pET-15b를 제공하며, TK1-2/pET-15b로 형질전환된 재조합 대장균, 바람직하게는 BL21(DE3)/TK1-2/pET-15b 균주를 제공한다.The present invention provides a recombinant E. coli expression plasmid TK1-2 / pET-15b comprising the nucleotide sequence of SEQ ID NO: 2 as a recombinant plasmid expressing the protein, recombinant E. coli transformed with TK1-2 / pET-15b, Preferably, BL21 (DE3) / TK1-2 / pET-15b strain is provided.

또한, 본 발명은 상기 단백질을 발현하는 재조합 플라스미드로 서열번호 2의 염기서열을 포함하는 재조합 효모 발현 플라스미드인 His-TK1-2/pPICZα-C및 N-TK1-2/pPICZα-C를 제공하고, 이 His-TK1-2/pPICZα-C로 형질전환된 효모 균주 또는 N-TK1-2/pPICZα-C로 형질전환된 효모 균주를 제공한다.The present invention also provides His-TK1-2 / pPICZα-C and N-TK1-2 / pPICZα-C, which are recombinant yeast expression plasmids comprising the nucleotide sequence of SEQ ID NO: 2 as a recombinant plasmid expressing the protein, This provides a yeast strain transformed with His-TK1-2 / pPICZα-C or a yeast strain transformed with N-TK1-2 / pPICZα-C.

상기 효모 균주는 피키아 파스토리스 (Pichia pastoris) 이며, 바람직하게는 X-33 또는 GS115를 사용할 수 있다.The yeast strain is Pichia pastoris , preferably X-33 or GS115 can be used.

본 발명의 TK1-2 단백질을 생산하는 세포주 X-33/N-TK1-2/pPICZα-C는 2003년 1월 27일자로 KRIBB에 기탁번호 제 KCTC 10415BP호로서 기탁하였다.The cell line X-33 / N-TK1-2 / pPICZα-C, which produces the TK1-2 protein of the present invention, was deposited with KRIBB as Accession No. KCTC 10415BP on January 27, 2003.

또한, 본 발명은 다음의 단계를 포함하는, 대장균에서 발현시킨 TK1-2 단백질을 정제하여 제조하는 방법을 제공한다.In addition, the present invention provides a method for purifying TK1-2 protein expressed in E. coli, comprising the following steps.

1) 서열번호 2를 포함하는 대장균 발현 플라스미드인 TK1-2/pET-15b로 형질전환된 대장균을 제작하는 단계;1) preparing E. coli transformed with TK1-2 / pET-15b, an E. coli expression plasmid comprising SEQ ID NO: 2;

2) 대장균에서 단백질 발현을 유도하여 배양하는 단계; 2) inducing and expressing protein expression in E. coli;

3) 상기 배양된 대장균을 수집하고 파쇄하는 단계;3) collecting and crushing the cultured Escherichia coli;

4) 가용성부분 및 비가용성 부분을 분리하는 단계; 4) separating the soluble portion and the non-soluble portion;

5) 봉입체를 세척하는 단계5) washing the enclosure

6) 비가용성부분을 히스-택 친화 컬럼크로마토그래피에 통과시키는 단계; 6) passing the non-soluble portion through heat-tack affinity column chromatography;

7) 리폴딩(refolding)시키는 단계; 및7) refolding; And

8) 재조합 단백질 TK1-2를 수득하는 단계;를 포함하는 재조합 TK1-2 단백질 제조방법을 제공한다.8) obtaining a recombinant protein TK1-2; provides a method for producing a recombinant TK1-2 protein comprising a.

본 발명의 바람직한 실시예로, 히스-택 서열을 포함하는 TK1-2/pET-15b 발현 플라스미드를 대장균 BL21(DE3)에 형질전환시키고, 형질전환체는 항생제를 함유한 LB 배지를 사용하여 37℃에서 흡광도(A₆₀₀)가 0.6에 이를 때까지 배양한다. 재조합 단백질 생산을 유도하기 위하여 IPTG(isopropyl thio-β-galactopyranoside)를 최종농도가 1.0mM이 되도록 배지에 첨가한 후, 37℃에서 다시 3시간 내지 4시간 정도 배양하며, 그 다음 8,000×g에서 15분간 원심분리하여 대장균을 수집한다. 다음 단계는 TK1-2 단백질의 리폴딩(refolding) 및 정제를 위한 단계로, 대장균 펠렛을 용해완충액(lysis buffer, 20mM Tris-Cl, pH 7.9, 50mM NaCl, 1mM MgCl₂, 0.1mM CaCl₂, 20㎍/㎖ RNase A, 50㎍/㎖ DNase I)에 현탁시킨 후, 15 내지 30분 동안 초음파분해(sonication)하여 대장균을 파괴시키고, 1,000×g에서 20분 동안 원심분리하여 세포 잔여물과 봉입체 층을 분리한 뒤 4℃, 20,000×g에서 30분 동안 원심분리하여 봉입체만 펠렛으로 수집한다. 수확된 봉입체에 IB 세척 완충액 (IB wash buffer, 20 mM Tris-Cl, pH 7.9, 0.5 M NaCl, 2 M urea)을 가해 초음파분해로 현탁시키고 20,000×g에서 30분 동안 원심분리하여 봉입체를 얻는다. 봉입체를 IB 가용성 완충액(IB soluble buffer, 20 mM Tris-HCl, pH 7.9, 0.5 M NaCl, 5 mM imidazole, 8 M Urea)에 현탁시켜 4℃에서 밤새도록 12시간 정도 반응시켜 녹이고, IB 희석완충액(IB dilution buffer, 20 mM Tris-HCl, pH 7.9, 0.5 M NaCl, 5 mM imidazole, 2 M Urea)으로 우레아(urea)농도가 6 M이 되게 희석시킨다. 4℃, 18,000×g에서 30 분 동안 원심분리한 후 His-tag 친화 크로마토그래피를 수행하여 단백질을 정제한다.In a preferred embodiment of the present invention, a TK1-2 / pET-15b expression plasmid comprising a heat-tack sequence is transformed into Escherichia coli BL21 (DE3), and the transformant is 37 ° C using LB medium containing antibiotics. Incubate at until the absorbance (A ₆₀₀ ) reaches 0.6. In order to induce recombinant protein production, isopropyl thio-β-galactopyranoside (IPTG) was added to the medium to a final concentration of 1.0 mM, and then incubated again at 37 ° C. for 3 to 4 hours, and then 15 at 8,000 × g. Collect E. coli by centrifugation for a minute. The next step is to refold and purify the TK1-2 protein. The E. coli pellets were dissolved in lysis buffer (20 mM Tris-Cl, pH 7.9, 50 mM NaCl, 1 mM MgCl ₂ , 0.1 mM CaCl ₂ , 20). Suspension in μg / ml RNase A, 50 μg / ml DNase I), followed by sonication for 15-30 minutes to destroy E. coli, and centrifugation at 1,000 × g for 20 minutes for cell residue and inclusion body layer. After the separation was centrifuged at 4 ℃, 20,000 × g for 30 minutes to collect only the inclusion body pellet. IB wash buffer (IB wash buffer, 20 mM Tris-Cl, pH 7.9, 0.5 M NaCl, 2 M urea) was added to the harvested inclusion bodies, suspended by sonication and centrifuged at 20,000 × g for 30 minutes to obtain inclusion bodies. The inclusion body was suspended in IB soluble buffer (IB soluble buffer, 20 mM Tris-HCl, pH 7.9, 0.5 M NaCl, 5 mM imidazole, 8 M Urea), reacted overnight at 4 ° C. for 12 hours, and dissolved in IB dilution buffer ( Dilute urea to 6 M with IB dilution buffer, 20 mM Tris-HCl, pH 7.9, 0.5 M NaCl, 5 mM imidazole, 2 M Urea). The protein is purified by centrifugation at 18,000 × g for 30 minutes at 4 ° C. followed by His-tag affinity chromatography.

10 ㎖의 프로밴드^TM 레진(ProBond^TMresin)을 글래스 컬럼에 충진(packing)한다. 레진 부피의 3 배가 되는 1차 증류수로 세척하고 5 배가 되는 전하 완충액(charge buffer, 결합 완충액(binding buffer)에 NiSO₄를 0.1 M이 되게 넣어 준 것)을 흘려준 후, 3 배 부피의 결합완충액 (0.5 M NaCl, 20 mM Tris-HCl, pH 7.9, 5 mM Imidazole)과 3 배 부피의 우레아 결합 완충액(urea binding buffer, 0.5 M NaCl, 20 mM Tris-HCl, pH 7.9, 5 mM Imidazole, 6 M Urea)을 흘려주어 평준화시킨다. 시료를 통과시킨 후, 레진의 10 배 부피의 우레아 결합 완충액으로 세척해 주고, 2 배 부피의 수세 완충액(wash buffer, 0.5 M NaCl, 20 mM Tris-HCl, pH 7.9, 20 mM imidazole, 6 M urea)으로 다시 세척한다. 용출 완충액(elution buffer, 0.5 M NaCl, 20 mM Tris-HCl, pH 7.9, 1 M Imidazole, 6 M Urea)으로 10 ㎖ 씩 용출된 것을 분획한다.The band 10 ㎖ Pro ^TM resin (ProBond ^TM resin) is filled (packing) to the glass column. After washing with primary distilled water, which is three times the volume of resin, and doubling the charge buffer (putting 0.1 M of NiSO ₄ into the binding buffer), the volume of binding buffer is three times. (0.5 M NaCl, 20 mM Tris-HCl, pH 7.9, 5 mM Imidazole) and 3 volumes of urea binding buffer (0.5 M NaCl, 20 mM Tris-HCl, pH 7.9, 5 mM Imidazole, 6 M) Urea) to level out. After passing the sample, it was washed with 10 times volume of urea binding buffer of resin, and 2 times volume of wash buffer (wash buffer, 0.5 M NaCl, 20 mM Tris-HCl, pH 7.9, 20 mM imidazole, 6 M urea). Wash again with). Elution buffer (0.5 M NaCl, 20 mM Tris-HCl, pH 7.9, 1 M Imidazole, 6 M Urea) was fractionated by 10 ml.

1.5 ℓ의 3 M 우레아 리폴딩 완충액 (0.1 M Tris-HCl, pH 8.0, 0.15 M NaCl, 3 M Urea)을 넣고 최종농도가 1 mM이 되게 환원형 글루타치온(glutathione, GSH)을 첨가한다. 리폴딩 희석완충액 (0.1 M Tris-HCl, pH 8.0, 0.15 M NaCl)으로 우레아 농도가 2 M이 되게 희석하고 최종농도가 1 mM을 유지하도록 GSH를 넣어 주어 상온에서 24 시간 동안 천천히 흔든다. 그런 다음 산화형 글루타치온 (GSSG)을 0.1 mM이 되도록 넣고 상온에서 4 내지 6 시간 동안 천천히 흔들어 준 후 4 M 아세트산으로 pH가 5.5가 되도록 조절한다. 밀리포어 랩스케일 TFF 시스템(Millipore Labscale TFF system)을 이용하여 20 ㎖까지 농축하고 100배 부피의 20 mM 트리스-아세테이트(pH 5.5) 용액과 3 차 증류수로 각각 3 번씩 투석하여 정제된 재조합 TK1-2 단백질을 수득할 수 있다.Add 1.5 L of 3 M urea refolding buffer (0.1 M Tris-HCl, pH 8.0, 0.15 M NaCl, 3 M Urea) and add reduced glutathione (GSH) to a final concentration of 1 mM. Dilute urea concentration to 2 M with refolding dilution buffer (0.1 M Tris-HCl, pH 8.0, 0.15 M NaCl) and shake slowly for 24 hours at room temperature with GSH added to maintain final concentration of 1 mM. Then, add oxidized glutathione (GSSG) to 0.1 mM, shake slowly at room temperature for 4 to 6 hours, and adjust the pH to 5.5 with 4 M acetic acid. Recombinant TK1-2 purified by concentrating to 20 ml using a Millipore Labscale TFF system and dialyzed three times with 100-fold volume of 20 mM tris-acetate (pH 5.5) solution and third distilled water, respectively. Proteins can be obtained.

상기의 단백질 정제과정에 약간의 변형을 가하여, His-TK1-2/pPICZα-C 또는 N-TK1-2/pPICZα-C로 형질전환된 세포주에서, 단백질을 발현시켜 본 발명의 TK1-2 단백질을 수득할 수 있다.With some modification to the protein purification process, the TK1-2 protein of the present invention was expressed by expressing the protein in a cell line transformed with His-TK1-2 / pPICZα-C or N-TK1-2 / pPICZα-C. Can be obtained.

상기 정제된 본 발명의 TK1-2 단백질은 내피세포의 성장분석 실험에서 뛰어난 억제효과를 보였고, CAM 분석상에서의 혈관신생 억제기능이 확인되었고, 폐암의 실험동물 모델에서 암의 성장을 억제하는 것을 확인하였다.The purified TK1-2 protein of the present invention showed an excellent inhibitory effect in the endothelial cell growth assay, CAM analysis was confirmed an angiogenesis inhibitory function, inhibited the growth of cancer in the experimental animal model of lung cancer It was.

또한, 본 발명은 상기 재조합 단백질 TK1-2를 함유하는 내피세포성장 억제활성을 갖는 조성물을 제공한다.The present invention also provides a composition having an endothelial cell growth inhibitory activity containing the recombinant protein TK1-2.

또한, 본 발명은 상기 재조합 단백질 TK1-2를 함유하는 혈관신생 억제활성을 갖는 조성물을 제공한다.The present invention also provides a composition having angiogenesis inhibitory activity containing the recombinant protein TK1-2.

또한, 본 발명은 상기 재조합 단백질 TK1-2를 함유하는 암의 성장 억제활성을 갖는 조성물을 제공한다.The present invention also provides a composition having growth inhibitory activity of cancer containing the recombinant protein TK1-2.

또한, 본 발명은 상기 재조합 단백질 TK1-2를 함유하는 내피세포성장으로 인한 질환의 예방 및 치료용 약학조성물을 제공한다.The present invention also provides a pharmaceutical composition for the prevention and treatment of diseases caused by endothelial cell growth containing the recombinant protein TK1-2.

또한, 본 발명은 상기 재조합 단백질 TK1-2를 함유하는 혈관신생으로 인한 질환의 예방 및 치료용 약학조성물을 제공한다.The present invention also provides a pharmaceutical composition for the prevention and treatment of diseases caused by angiogenesis containing the recombinant protein TK1-2.

또한, 본 발명은 상기 재조합 단백질 TK1-2를 함유하는 암질환의 예방 및 치료용 약학조성물을 제공한다.The present invention also provides a pharmaceutical composition for the prevention and treatment of cancer diseases containing the recombinant protein TK1-2.

상기 혈관신생으로 인한 질환으로는 류마티스성 관절염, 골관절염, 패혈증성 관절염, 건선, 각막궤양, 노화와 관련된 황반 변성, 당뇨성 망막병증, 증식성 유리체 망막병증, 미성숙 망막병증, 안과 염증, 원추 각막, 쇼그렌 증후군, 근시 안과종양, 각막이식 거부,이상 창상 유합, 골질환, 단백뇨증, 복대동맥류 질환, 외상성 관절 손상에 따른 퇴행성 연골손실, 신경계의 수초탈락 질환, 간경변, 신사구체 질환, 배태막의 미성숙 파열, 염증성 장질환, 치근막 질환, 동맥경화증, 재협착증, 중추신경계의 염증질환, 알츠하이머 질환, 피부노화, 암의 침윤과 전이가 있으며, 본 발명의 약학조성물은 혈관신생에 의한 질환의 치료에 사용할 수 있다Diseases caused by angiogenesis include rheumatoid arthritis, osteoarthritis, sepsis arthritis, psoriasis, corneal ulcer, age-related macular degeneration, diabetic retinopathy, proliferative vitreoretinopathy, immature retinopathy, ophthalmic inflammation, cone cornea, Sjogren's syndrome, myopia ophthalmic tumor, corneal graft rejection, aberrant wound union, bone disease, proteinuria, abdominal aortic aneurysm, degenerative cartilage loss due to traumatic joint injury, demyelination of the nervous system, cirrhosis, renal glomeruli, immature tear , Inflammatory bowel disease, periodontal disease, arteriosclerosis, restenosis, inflammatory diseases of the central nervous system, Alzheimer's disease, skin aging, cancer infiltration and metastasis, the pharmaceutical composition of the present invention can be used for the treatment of diseases caused by angiogenesis have

상기 암질환은 폐암, 비소세포성폐암, 결장암, 골암, 췌장암, 피부암, 두부 또는 경부 암, 피부 또는 안구내 흑색종, 자궁암, 난소암, 직장암, 위암, 항문부근암, 결장암, 유방암, 나팔관암종, 자궁내막암종, 자궁경부암종, 질암종, 음문암종, 호지킨병(Hodgkin's disease), 식도암, 소장암, 내분비선암, 갑상선암, 부갑상선암, 부신암, 연조직 육종, 요도암, 음경암, 전립선암, 만성 또는 급성 백혈병, 림프구 림프종, 방광암, 신장 또는 수뇨관 암, 신장세포 암종, 신장골반 암종, 중추신경계(CNS; central nervous system) 종양, 1차 CNS 림프종, 척수 종양, 뇌간 신경교종, 뇌하수체 선종이 있으며, 본 발명의 약학조성물을 암의 치료에 사용할 수 있다.The cancer diseases include lung cancer, non-small cell lung cancer, colon cancer, bone cancer, pancreatic cancer, skin cancer, head or neck cancer, skin or intraocular melanoma, uterine cancer, ovarian cancer, rectal cancer, gastric cancer, anal muscle cancer, colon cancer, breast cancer, and fallopian tube carcinoma , Endometrial carcinoma, cervical carcinoma, vaginal carcinoma, vulvar carcinoma, Hodgkin's disease, esophageal cancer, small intestine cancer, endocrine adenocarcinoma, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penis cancer, prostate cancer , Chronic or acute leukemia, lymphocytic lymphoma, bladder cancer, kidney or ureter cancer, renal cell carcinoma, renal pelvic carcinoma, central nervous system (CNS) tumor, primary CNS lymphoma, spinal cord tumor, brain stem glioma, pituitary adenoma The pharmaceutical composition of the present invention can be used for the treatment of cancer.

본 발명의 TK1-2 단백질을 유효성분으로 포함하는 조성물은 단일제로 사용하거나 약효를 증강시킬 수 있는 다른 유효성분과 함께 복합제로 사용할 수 있다.The composition containing the TK1-2 protein of the present invention as an active ingredient can be used as a single agent or in combination with other active ingredients that can enhance the efficacy.

이때 약제학적으로 허용 가능한 희석제를 포함하여 사용할 수 있으며, 희석제로는 식염수, 완충 식염수, 덱스트로스, 말토덱스트린, 물, 글리세롤, 에탄올 및 이의 복합물을 포함하지만, 이에 국한되는 것은 아니다.In this case, a pharmaceutically acceptable diluent may be used, and the diluent includes, but is not limited to, saline solution, buffered saline solution, dextrose, maltodextrin, water, glycerol, ethanol and combinations thereof.

본 발명의 TK1-2 단백질 조성물은 1종 이상의 약제학적으로 허용 가능한 부형제와 함께 약학 조성물로 투여될 수 있다.The TK1-2 protein composition of the present invention may be administered in a pharmaceutical composition with one or more pharmaceutically acceptable excipients.

특정 환자에 대한 구체적인 치료적 유효량 정도는 달성하고자 하는 반응의 종류와 정도, 경우에 따라 다른 제제가 사용되는지의 여부를 비롯한 구체적 조성물, 환자의 연령, 체중, 일반 건강 상태, 성별 및 식이, 투여 시간, 투여 경로 및 조성물의 분비율, 치료 기간, 구체적 조성물과 함께 사용되거나 동시 사용되는 약물(예, 화학요법제)을 비롯한 다양한 인자와 의약 분야에 잘 알려진 유사 인자에 따라 다르게 적용하는 것이 바람직하다.The specific therapeutically effective amount for a particular patient is determined by the specific composition, including the type and extent of the reaction to be achieved and whether other agents are used in some cases, the age, weight, general health, sex and diet of the patient, and the time of administration. It is desirable to apply differently depending on various factors and similar factors well known in the medical field, including the route of administration and the rate of release of the composition, the duration of treatment, and the drug (eg, chemotherapeutic agent) used or co-used with the specific composition.

본 발명의 TK1-2 단백질 조성물의 단위 투여량은 5㎎ 내지 2g이 바람직하며, 10㎎ 내지 1g이 가장 바람직하다.The unit dosage of the TK1-2 protein composition of the present invention is preferably 5 mg to 2 g, most preferably 10 mg to 1 g.

또한 환자의 나이와 체중뿐만 아니라 혈관신생에 의한 질환의 종류 및 질환의 정도에 따라 용량 및 투여방법이 달라지기는 하나 일반적으로 0.05 내지 200㎎/㎏체중으로 투여할 수 있으며 1일 1 내지 3회 투여하는 것이 바람직하다.In addition, depending on the age and weight of the patient as well as the type of disease and the extent of the disease caused by angiogenesis, the dosage and the method of administration vary, but can generally be administered at 0.05 to 200mg / ㎏ body weight 1 to 3 times a day It is preferable to administer.

본 발명의 약학조성물은 경구, 직장, 국소, 정맥내, 복강내, 근육내, 동맥내, 경피, 비측내, 흡입, 안구내 또는 피내 경로를 통해 통상적인 방식으로 투여할 수 있다.The pharmaceutical compositions of the present invention may be administered in a conventional manner via the oral, rectal, topical, intravenous, intraperitoneal, intramuscular, intraarterial, transdermal, nasal, inhalation, intraocular or intradermal routes.

비경구 투여는 정맥내, 근육내, 복강내, 흉골내, 경피 및 동맥내 주사 및 주입을 포함하는 투여 방식을 의미한다. 본 발명의 약학조성물의 비경구 투여는 바람직한 순도하에 약제학적으로 허용가능한 담체, 즉 사용되는 농도와 투여량에서 수용체에게 비독성이고 다른 제제 성분과 화합할 수 있는 것을 혼합하여 단위 투여량의 제형으로 조제하는 것이 바람직하다.Parenteral administration means administration modes including intravenous, intramuscular, intraperitoneal, intrasternal, transdermal and intraarterial injection and infusion. Parenteral administration of the pharmaceutical compositions of the present invention may be carried out in unit dosage form in combination with a pharmaceutically acceptable carrier, i.e., nontoxic to the receptor and compatible with other agent components at the concentrations and dosages employed, under the desired purity. It is preferable to prepare.

또한 본 발명의 약학조성물의 제형은 어떠한 제형으로도 적용가능하며, 제조한 제형은 경구용, 주사용, 도포용으로 사용할 수 있다. 상기 제형은 주사용 형태(용액, 현탁액 또는 유탁액)로 조제할 수 있고, 정제, 캅셀제, 연질캅셀제, 수액제, 과립제, 환제 등 경구용으로 조제할 수 있다.In addition, the formulation of the pharmaceutical composition of the present invention can be applied to any formulation, and the prepared formulation can be used for oral, injection, and application. The formulation may be prepared in an injectable form (solution, suspension or emulsion), and may be prepared orally for tablets, capsules, soft capsules, infusions, granules, pills and the like.

상기 조성물은 TK1-2 단백질을 캅셀에 부형제 없이 충전하거나 미립된 고체 담체 또는 액체 담체 또는 그 양자와 균일하게 충분히 접촉시켜 제조한다. 그 다음, 필요한 경우 생성물을 바람직한 제제로 성형한다.The composition is prepared by filling the capsule with TK1-2 protein without excipients or by uniformly sufficient contact with the particulate solid or liquid carrier or both. The product is then shaped into the desired formulation if necessary.

이러한 담체 부형제의 예로서 전분, 물, 식염수, 링거액 및 덱스트로스 용액이 있다. 당해 기술 분야에 알려진 적합한 제제는 문헌(Remington's Pharmaceutical Science(최근판), Mack Publishing Company, Easton PA)에 개시되어 있는 것을 사용하는 것이 바람직하다. Examples of such carrier excipients include starch, water, saline, Ringer's solution and dextrose solution. Suitable formulations known in the art are preferably used as disclosed in Remington's Pharmaceutical Science (Recent Edition), Mack Publishing Company, Easton PA.

이하, 본 발명의 이해를 돕기 위하여 바람직한 실시예를 제시한다. 그러나 하기의 실시예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐, 실시예에 의해 본 발명의 내용이 한정되는 것은 아니다.Hereinafter, preferred examples are provided to aid in understanding the present invention. However, the following examples are merely provided to more easily understand the present invention, and the contents of the present invention are not limited by the examples.

실시예 1 : 대장균에서의 TK1-2 단백질 발현, 정제 및 효능 검색Example 1 TK1-2 Protein Expression, Purification and Efficacy Screening in Escherichia Coli

1-1. TK1-2/pET-15b 플라스미드 제작1-1. TK1-2 / pET-15b Plasmid Construction

제대정맥 내피세포 (HUVEC, 1-6-2 참조)의 전체 RNA를 퀴아젠 RNA 분리키트를 사용하여 수득한 후, cDNA는 올리고-d(T) 프라이머와 cDNA 합성 키트(First strand cDNA synthesis kit, Roche Molecular Biochemicals사)를 사용하여 cDNA를 제작하였다. 그 다음, 인간 t-PA의 90번째 아미노산 알라닌(alanine)부터 263번째 트레오닌(Threonine)까지의 아미노산을 암호화하는 cDNA를 Pfu 복제효소 (Stratagene사)을 사용한 PCR을 수행하여 제작하였다. 이 때 프라이머는 서열번호 3에 기재된 프라이머 1 (5'- ATCGGATCCCATGGCCACGTGCTACGAGGACCAG -3') 및 서열번호 4에 기재된 프라이머 2 (5'-ATCGGATCCTCAGGTGGAGCAGGAGGGCACATC -3')를 사용하였다. 증폭된 cDNA를 BamHI 으로 처리하였으며, BamHI으로 잘려지고 탈인산화된 pET-15b (Novagen사)에 라이게이션되어 재조합 플라스미드인 TK1-2/pET-15b가 제작되었으며, 도 1에 플라스미드 구조가 나타나 있다. 이 재조합 플라스미드는 아미노 말단(N-terminal)에 히스-택 서열(His-tag sequence) 및 트롬빈 분할 부위 (thrombin cleavage site)를 포함하는 26개의 부가적인 아미노산을 보유하게 된다. 이 제작된 플라스미드는 DNA 시퀀싱 키트(T7 sequencing version 2.0 DNA sequencing kit, Amersham Pharmacia Biotech사)를 사용하여 염기서열이 확인되었다. 단백질 발현을 위하여 TK1-2/pET-15b는 BL21(DE3) 대장균에 당업계의 통상적인 방법으로 형질전환시켰다. After obtaining total RNA of umbilical vein endothelial cells (see HUVEC, 1-6-2) using a Qiagen RNA isolation kit, cDNA was prepared using oligo-d (T) primer and cDNA synthesis kit (First strand cDNA synthesis kit, CDNA was prepared using Roche Molecular Biochemicals. Subsequently, cDNA encoding amino acids from the 90th amino acid alanine of human t-PA to 263 threonine was produced by PCR using Pfu transcriptase (Stratagene). At this time, primer 1 (5'-ATCGGATCCCATGGCCACGTGCTACGAGGACCAG-3 ') and primer 2 (5'-ATCGGATCCTCAGGTGGAGCAGGAGGGCACATC-3') described in SEQ ID NO: 3 were used. The amplified cDNA was treated with BamHI, ligated to dephosphorylated pET-15b (Novagen) to produce a recombinant plasmid TK1-2 / pET-15b, and the plasmid structure is shown in FIG. 1. The recombinant plasmid has 26 additional amino acids at its N-terminal, including a his-tag sequence and a thrombin cleavage site. The prepared plasmid was identified using a DNA sequencing version (T7 sequencing version 2.0 DNA sequencing kit, Amersham Pharmacia Biotech). For protein expression, TK1-2 / pET-15b was transformed into BL21 (DE3) Escherichia coli by conventional methods in the art.

1-2. TK1-2 단백질 발현과 정제1-2. TK1-2 Protein Expression and Purification

대장균 형질전환체는 3 리터 LB 배지(100㎍/㎖ 암피실린 함유)를 사용하여 37℃에서 배양되었으며, 흡광도(A₆₀₀)가 0.6에 이를 때까지 배양하였다. 재조합 단백질 생산을 유도하기 위하여 IPTG(isopropyl thio-β-galactopyranoside, Amresco사)를 최종농도가 1.0mM이 되도록 배지에 첨가한 후, 37℃에서 다시 3시간 정도 배양하였으며, 그 다음 8,000×g에서 20 분간 원심분리하여 세포를 수집하였다.E. coli transformants were incubated at 37 ° C. using 3 liter LB medium (containing 100 μg / ml ampicillin) and incubated until absorbance (A ₆₀₀ ) reached 0.6. In order to induce recombinant protein production, IPTG (isopropyl thio-β-galactopyranoside, Amresco) was added to the medium to a final concentration of 1.0 mM, and then incubated at 37 ° C. for about 3 hours, and then 20 at 8,000 × g. Cells were collected by centrifugation for a minute.

다음 단계로 TK1-2 단백질의 리폴딩(refolding) 및 정제를 위한 단계를 수행하였다. 세포 펠렛을 용해완충액(lysis buffer, 20mM Tris-Cl, pH 7.9, 50mM NaCl, 1mM MgCl₂, 0.1mM CaCl₂, 20㎍/㎖ RNase A, 50㎍/㎖ DNase I) 40 ㎖에 현탁시킨 후, 15-30 분 동안 초음파분해(sonication)하였다. 1,000×g에서 20분 동안 원심분리 하여 세포 잔여물과 봉입체 층을 분리한 뒤 4℃, 20,000×g에서 30 분 동안 원심분리하여 봉입체만 펠렛으로 얻었다.The next step was to refold and purify the TK1-2 protein. The cell pellet is suspended in 40 ml of lysis buffer (lysis buffer, 20 mM Tris-Cl, pH 7.9, 50 mM NaCl, 1 mM MgCl ₂ , 0.1 mM CaCl ₂ , 20 µg / ml RNase A, 50 µg / ml DNase I). Sonication was performed for 15-30 minutes. After centrifugation at 1,000 x g for 20 minutes to separate the cell residue and the inclusion body layer was centrifuged at 4 ℃, 20,000 × g for 30 minutes to obtain only the inclusion body pellets.

TK1-2를 발현하는 대장균(TK1-2/pET-15b)의 재조합 단백질 발현을 유도하였을때 거의 대부분의 단백질이 봉입체(inclusion body, IB)형태로 나타났다(도 2 참조). 봉입체 펠렛을 IB 세척 완충액 (IB wash buffer, 20 mM Tris-Cl, pH 7.9, 0.5 M NaCl, 2 M urea) 40 ㎖을 가해 초음파분해로 현탁시키고 20,000×g에서 30 분 동안 원심분리하여 봉입체를 세척하였다. 세척된 봉입체를 18 ㎖의 IB 가용성 완충액(IB soluble buffer, 20 mM Tris-HCl, pH 7.9, 0.5 M NaCl, 5 mM imidazole, 8 M Urea)에 현탁시켜 4℃에서 밤새도록 12 시간 정도 반응시켜 녹였고, 희석완충액(IB dilution buffer, 20 mM Tris-HCl, pH 7.9, 0.5 M NaCl, 5 mM imidazole, 2 M Urea)으로 우레아(urea)농도가 6 M이 되게 희석시켰다. 4℃, 18,000×g에서 30 분 동안 원심분리한 후 His-tag 친화 크로마토그래피 (하기 실시예 1-3 참조)를 수행하여 단백질을 정제하였다. 1.5ℓ의 3 M 우레아 리폴딩 완충액 (0.1 M Tris-HCl, pH 8.0, 0.15 M NaCl, 3 M Urea)를 넣고 최종농도가 1 mM이 되게 환원형 글루타치온(glutathione, GSH, Amresco사)을 첨가하였다. 리폴딩 희석완충액 (0.1 M Tris-HCl, pH 8.0, 0.15 M NaCl)으로 우레아 농도가 2 M이 되게 희석하고 최종농도가 1 mM을 유지하도록 GSH를 넣어 주어 상온에서 24 시간 동안 천천히 흔들어 주었다. 그런 다음 산화형 글루타치온 (GSSG, Sigma사)을 0.1 mM이 되도록 넣고 상온에서 4-6 시간 동안 천천히 흔들어 준 후 4 M 아세트산으로 pH가 5.5가 되도록 조절하였다. 밀리포어 랩스케일 TFF 시스템(Millipore Labscale TFF system, Millipore사)을 이용하여 20 ㎖까지 농축하고 100배 부피의 20 mM 트리스-아세테이트(pH 5.5) 용액과 3 차 증류수로 각각 3 번씩 투석하였다. 단백질들은 SDS-PAGE 로 확인하였다(도 2 및 도 3 참조).When the recombinant protein expression of E. coli (TK1-2 / pET-15b) expressing TK1-2 was induced, almost all proteins appeared in the form of inclusion bodies (IB) (see FIG. 2). The inclusion body pellet was added to 40 ml of IB wash buffer (IB wash buffer, 20 mM Tris-Cl, pH 7.9, 0.5 M NaCl, 2 M urea), suspended by sonication and centrifuged at 20,000 × g for 30 minutes to wash the inclusion body. It was. The washed inclusion body was suspended in 18 ml of IB soluble buffer (IB soluble buffer, 20 mM Tris-HCl, pH 7.9, 0.5 M NaCl, 5 mM imidazole, 8 M Urea) and reacted overnight at 4 ° C. for 12 hours. The urea concentration was diluted to 6 M with dilution buffer (IB dilution buffer, 20 mM Tris-HCl, pH 7.9, 0.5 M NaCl, 5 mM imidazole, 2 M Urea). The proteins were purified by centrifugation at 18,000 × g for 30 minutes at 4 ° C. followed by His-tag affinity chromatography (see Examples 1-3 below). 1.5 L of 3 M urea refolding buffer (0.1 M Tris-HCl, pH 8.0, 0.15 M NaCl, 3 M Urea) was added and reduced glutathione (glutathione, GSH, Amresco) was added to a final concentration of 1 mM. . The dilution buffer solution (0.1 M Tris-HCl, pH 8.0, 0.15 M NaCl) was diluted to 2 M urea and the GSH was added to maintain a final concentration of 1 mM and shaken slowly at room temperature for 24 hours. Then, oxidized glutathione (GSSG, Sigma) was added to 0.1 mM, shaken slowly at room temperature for 4-6 hours, and adjusted to pH 5.5 with 4 M acetic acid. The solution was concentrated to 20 ml using a Millipore Labscale TFF system (Milliipore) and dialyzed three times with 100-fold volume of 20 mM tris-acetate (pH 5.5) solution and tertiary distilled water, respectively. Proteins were identified by SDS-PAGE (see Figures 2 and 3).

1-3 : His-tag 친화 컬럼을 이용한 크로마토그래피1-3: Chromatography Using His-tag Affinity Column

10 ㎖의 프로밴드^TM 레진(ProBond^TMresin, Invitrogen사, Carlsbad, CA)을 글래스 컬럼에 충진(packing)하였다. 레진 부피의 3 배가 되는 1차 증류수로 세척하고 5 배가 되는 전하 완충액(charge buffer, 결합 완충액(binding buffer)에 NiSO₄를 0.1 M이 되게 넣어 준 것)을 흘려준 후, 3 배 부피의 결합완충액 (0.5 M NaCl, 20 mM Tris-HCl, pH 7.9, 5 mM Imidazole)과 3 배 부피의 우레아 결합 완충액(urea binding buffer, 0.5 M NaCl, 20 mM Tris-HCl, pH 7.9, 5 mM Imidazole, 6 M Urea)을 흘려주어 평준화 시켰다. 시료를 통과시킨 후, 레진의 10 배 부피의 우레아 결합 완충액으로 세척해 주고, 2 배 부피의 수세 완충액(wash buffer, 0.5 M NaCl, 20 mM Tris-HCl, pH 7.9, 20 mM imidazole, 6 M urea)으로 다시 세척해 주었다. 용출 완충액(elution buffer, 0.5 M NaCl, 20 mM Tris-HCl, pH 7.9, 1 M Imidazole, 6 M Urea)으로 10 ㎖ 씩 용출, 분획하였다.A 10 ㎖ pro band ^TM resin (ProBond ^TM resin, Invitrogen Corporation, Carlsbad, CA) was packed (packing) to the glass column. After washing with primary distilled water, which is three times the volume of resin, and doubling the charge buffer (putting 0.1 M of NiSO ₄ into the binding buffer), the volume of binding buffer is three times. (0.5 M NaCl, 20 mM Tris-HCl, pH 7.9, 5 mM Imidazole) and 3 volumes of urea binding buffer (0.5 M NaCl, 20 mM Tris-HCl, pH 7.9, 5 mM Imidazole, 6 M) Urea) was flushed and leveled. After passing the sample, it was washed with 10 times volume of urea binding buffer of resin, and 2 times volume of wash buffer (wash buffer, 0.5 M NaCl, 20 mM Tris-HCl, pH 7.9, 20 mM imidazole, 6 M urea). ) And washed again. Elution buffer (elution buffer, 0.5 M NaCl, 20 mM Tris-HCl, pH 7.9, 1 M Imidazole, 6 M Urea) was eluted and fractionated 10 ml.

대략적으로 5 ℓ 플라스크 배양시 세포 펠렛을 약 15g 정도 얻었으며, 이로부터 봉입체를 3-4g 얻을 수 있었고, His-tag 친화 컬럼을 통한 정제와 리폴딩(refolding) 과정을 거쳐 최종적으로 7-12 mg/ℓ의 TK1-2 단백질을 얻을 수 있었다. Approximately 5 g of the cell pellet was obtained from the culture of the 5 L flask, and 3 to 4 g of the inclusion body were obtained from the cell pellet. After purification and refolding through a His-tag affinity column, the final 7-12 mg was obtained. / l TK1-2 protein was obtained.

상기 발현시켜 정제, 수득된 단백질 시료들은 SDS-PAGE와 실시예 1-4의 아미노산 서열 분석 및 단백질 질량분석을 수행하였다.The expressed and purified protein samples were subjected to SDS-PAGE and amino acid sequence analysis and protein mass spectrometry of Examples 1-4.

도 2는 상기의 단백질 정제 단계마다 수득된 시료들을 14% SDS-폴리아크릴아마이드 젤에 환원 조건하에서 전기영동(트리스-글라이신 완충액 사용)한 것을 코마시블루 염색한 사진이다. 레인 1은 MW 표준 단백질 Mark12(Invitrogen사)이고, 레인 2은 대장균 전체 단백질이며, 레인 3는 대장균 단백질의 가용성 분획이고, 레인 4은 대장균 단백질 중 비가용성 분획이며, 레인 5는 6M 우레아 용액에 용해되어있는 비가용성 분획이며, 레인 6은 레인5의 시료를 His-tag Ni+ 친화 컬럼을 통과시킨 분획이며, 레인 7은 20mM 이미다졸 용액으로 용출한 분획이며, 레인 8은 His-tag 친화 컬럼으로부터 1M 이미다졸 용액으로 용출된 시료이고 레인 9는 투석후 최종적으로 얻은 시료이다. 정제된 TK1-2는 환원조건하의 SDS-PAGE상에서 단일밴드로 나타나며, 크기는 22 내지 23 킬로달톤 이었다. FIG. 2 is a photograph of Coomassie blue staining of the samples obtained for each step of protein purification on 14% SDS-polyacrylamide gel under electrophoresis (using tris-glycine buffer solution) under reducing conditions. Lane 1 is the MW standard protein Mark12 (Invitrogen), lane 2 is the E. coli protein, lane 3 is the soluble fraction of E. coli protein, lane 4 is the non-soluble fraction of E. coli protein, and lane 5 is dissolved in 6M urea solution. Lane 6 is a fraction obtained by passing a sample of lane 5 through a His-tag Ni + affinity column, lane 7 is a fraction eluted with a 20 mM imidazole solution, and lane 8 is 1M from a His-tag affinity column. Sample eluted with imidazole solution and lane 9 is the final sample obtained after dialysis. Purified TK1-2 appeared as a single band on SDS-PAGE under reducing conditions, and the size was 22 to 23 kilodaltons.

도 3의 레인 1은 정제된 TK1-2가 비환원조건에서 전기영동한 것이고, 레인 2는 환원조건에서 전기영동한 것이다. 수득된 단백질은 예상분자량이 22,075달톤인 것에 비하여, 비환원조건하의 SDS-PAGE상에서 좀더 빨리 이동하는 양상을 보였다. β-머캅토에탄올이 존재하는 환원조건에서는 전기영동시 분자의 이동성이 감소함을 확인할 수 있었다.Lane 1 of FIG. 3 is electrophoresed in purified TK1-2 under non-reducing conditions, and lane 2 is electrophoresized under reducing conditions. The obtained protein showed faster migration on SDS-PAGE under non-reducing conditions, compared to the expected molecular weight of 22,075 Daltons. In the reducing condition in which β-mercaptoethanol is present, it was confirmed that the mobility of the molecule was reduced during electrophoresis.

1-4 : 단백질 분석1-4: Protein Analysis

아미노산서열은 한국기초과학연구소(서울, 한국)의 단백질서열분석시스템 (Procise 491 protein sequencing system, Applied Biosystems사)을 이용하여 분석되었다. MALDI 질량분석(Matrix-assisted laser desorption ionization mass spectrometry)도 한국기초과학연구소의 보이저 바이오스펙트로메트리 워크스테이션 (Voyager Biospectrometry workstation, PerSeptive Biosystems, Framinghum, MA, USA)으로 행하였다.The amino acid sequences were analyzed using the Procise 491 protein sequencing system (Applied Biosystems) of the Korea Basic Science Institute (Seoul, Korea). MALDI mass spectrometry (Matrix-assisted laser desorption ionization mass spectrometry) was also performed by the Voyager Biospectrometry workstation (PerSeptive Biosystems, Framinghum, MA, USA).

아미노산 분석 결과, N-말단의 메티오닌(methionine)이 소실된 상태였고, 이는 MALDI 질량 분석(도 4 참조)을 하였을 때 21,947 Da으로, 메티오닌이 소실된 계산된 분자량 21,944 Da과 일치하였다. 엔도톡신(Endotoxin) 수준이 0.3 EU/mg 이하가 되게 시료를 준비하여 동물실험에 적합하게 제조하였다.As a result of the amino acid analysis, N-terminal methionine was lost, which was 21,947 Da when MALDI mass spectrometry (see FIG. 4) was consistent with the calculated molecular weight of 21,944 Da where methionine was lost. Samples were prepared to have an endotoxin level of 0.3 EU / mg or less, and were prepared for animal testing.

1-5 : 재조합 단백질 TK1-2의 라이신 세파로스에 대한 친화도 조사1-5: Investigation of affinity of lysine sepharose of recombinant protein TK1-2

인간 티슈타입 플라스미노겐(t-PA)의 크링글 도메인은 라이신(lysine) 잔기에 친화력을 가진 것으로 알려져 있으며, 이러한 것을 참조로 본 발명의 발현, 정제한 재조합 단백질 TK1-2가 정제과정 중 제대로 리폴딩(refolding)이 일어났는지 확인하기 위하여 라이신 세파로스(lysine sepharose)에 대한 결합능력의 여부를 조사하였다. 라이신 세파로스를 10 g을 이차증류수에 실온에서 1시간동안 스웰링 (swelling) 시킨 다음, 컬럼에 충진(packing)하고 레진 부피의 3배가 되는 완충액 A (50 mM phosphate: pH 7.5)로 평형을 시킨 후, 준비한 시료를 통과시켰다. 완충액 A를 3번 통과시켜 세척한 후, 완충액 B (50 mM phosphate: pH 7.5, 0.5 M NaCl)로 3번 세척하고, 용출 완충액 (0.2 M ε-aminocaproic acid (ε-ACA) in distilled water)으로 5 ㎖ 씩 용출, 분획한 후, 이것을 14% SDS-폴리아크릴아미드 젤 상에서 트리스-글라이신 완충액을 사용한 환원조건하에서 전기영동하였다. The Kringle domain of human tissue type plasminogen (t-PA) is known to have an affinity for lysine residues, and the recombinant protein TK1-2 expressed and purified according to the present invention is properly treated during purification. To determine if refolding occurred, we examined the ability of binding to lysine sepharose. 10 g of lysine sepharose was swelled in secondary distilled water for 1 hour at room temperature, then packed into a column and equilibrated with buffer A (50 mM phosphate: pH 7.5), which is three times the resin volume. Then, the prepared sample was passed. Buffer A was washed three times and then washed three times with Buffer B (50 mM phosphate: pH 7.5, 0.5 M NaCl) and with elution buffer (0.2 M ε-aminocaproic acid (ε-ACA) in distilled water). After elution and fractionation of 5 ml each, it was electrophoresed under reducing conditions using tris-glycine buffer on 14% SDS-polyacrylamide gel.

도 5 및 6은 라이신-세파로스 컬럼 통과 후 수득된 단백질 시료를 전기영동하여 코마시블루 염색한 것으로, 도 5의 레인 1은 리폴딩 과정을 거친 TK1-2 단백질이며, 레인 2는 50mM 트리스-Cl 용액으로 컬럼을 씻어내고 수득한 분획이고, 레인 3, 4 및 5는 0.5M 염화나트륨용액으로 컬럼을 씻어낸 후 수득한 분획들이고, 레인 6,7 및 8은 용출분획이다. 도 6의 레인 A는 라이신-세파로스 컬럼 통과후 정제된 TK1-2 이고, 레인 B는 히스-택 친화 컬럼 통과 후 정제된 분획이다.5 and 6 are coomassie blue staining by electrophoresis of the protein sample obtained after passing through the lysine-sepharose column, lane 1 of Figure 5 is a refolded TK1-2 protein, lane 2 is 50mM Tris- Fractions obtained by washing the column with Cl solution, lanes 3, 4 and 5 are the fractions obtained after washing the column with 0.5 M sodium chloride solution, lanes 6, 7 and 8 are the elution fractions. Lane A in FIG. 6 is purified TK1-2 after passing through a lysine-sepharose column and lane B is purified fraction after passing through a heat-tack affinity column.

도 5 및 6에서 보여준 바와 같이 라이신-세파로스에 결합하여 0.2M ε-ACA의 용액으로 용출되는 약 22 KDa의 단백질 분획을 확인할 수 있었다. 따라서 정제과정을 거친 본 발명의 단백질의 크링글 구조가 제대로 리폴딩(refolding)되어 라이신-결합 포켓(lysine-binding pocket)을 형성하였다고 판단하였다. As shown in FIGS. 5 and 6, a protein fraction of about 22 KDa bound to lysine-sepharose and eluted with a solution of 0.2 M ε-ACA was identified. Therefore, it was determined that the Kringle structure of the protein of the present invention, which had been purified, was properly refolded to form a lysine-binding pocket.

1-6 : TK1-2의 내피세포들에 대한 증식 억제효과1-6: Inhibitory Effects of TK1-2 on Endothelial Cells

(1-6-1)TK1-2의 소의 모세혈관 내피(Bovine capillary endothelial)세포 증식 억제효과(1-6-1) TK1-2 Inhibitory Effect on Bovine Capillary Endothelial Cell Proliferation

bFGF(basic fibroblast growth factor)에 의해 자극된 소의 모세혈관 내피(Bovine capillary endothelial, BCE) 세포 성장에 대하여, 상기 본 발명의 정제된 TK1-2 단백질에 의한 억제효과를 관찰하였다. BCE 세포 증식 분석은 오레일리의 방법(O'Reilly, M.S. et al.; Cell, 79, pp315-328, 1994; Lee, H.S. et al.; Arch. Biochem. Biophys., 375, pp359-363, 2000)에 따라 수행되어 졌다.On bovine capillary endothelial (BCE) cell growth stimulated by bFGF (basic fibroblast growth factor), the inhibitory effect of the purified TK1-2 protein of the present invention was observed. BCE cell proliferation assays were performed by O'Reilly, MS et al .; Cell , 79 , pp315-328, 1994; Lee, HS et al . ; Arch. Biochem. Biophys. , 375 , pp359-363, 2000 Was performed according to

젤라틴 코팅된 24 웰 배양 플레이트에 웰당 12,500 개 BCE 세포를 깔고, DMEM 배지(10% FBS, 1% 항생제 포함)에서 24시간동안 배양하였다. 그 다음 기존 배지를 0.25㎖ DMEM 배지(5% FBS, 1% 항생제 포함) 및 0 nM 내지 320nM의 농도의 TK1-2 단백질 시료 또는 안지오스태틴과 교체하였다. 30분 배양 후에 0.25㎖ DMEM(5% FBS, 1% 항생제) 및 2ng/㎖ bFGF(R&D system사)을 각 웰에 첨가하였다. 72시간 후, 세포들을 트립신 처리하여 퍼뜨린 후 트립판블루 방법(trypan blue exclusion method)으로 세포의 수를 계산하였다.12,500 BCE cells per well were placed on gelatin coated 24-well culture plates and incubated for 24 hours in DMEM medium (10% FBS, with 1% antibiotics). Existing medium was then replaced with 0.25 ml DMEM medium (5% FBS, with 1% antibiotic) and TK1-2 protein samples or angiostatin at concentrations from 0 nM to 320 nM. After 30 min incubation, 0.25 ml DMEM (5% FBS, 1% antibiotic) and 2 ng / ml bFGF (R & D system) were added to each well. After 72 hours, the cells were spread out by trypsinization and the number of cells was counted by trypan blue exclusion method.

도 7에서와 같이, 단백질 TK1-2는 bFGF에 의해 자극된 BCE세포에 대한 성장억제효과를 나타냈으며, 단백질 양에 의존적인 양상을 보였다. 50% 억제효과(ED₅₀)를 보이는 TK1-2의 농도는 약 40nM이었다. 안지오스태틴의 경우 50% 억제효과를 보이는 농도가 약 80nM 것에 비해, TK1-2가 현저한 억제효과를 나타내었다.As shown in Figure 7, protein TK1-2 showed a growth inhibitory effect on bFGF-stimulated BCE cells, and showed a protein-dependent pattern. The concentration of TK1-2 showing a 50% inhibitory effect (ED ₅₀ ) was about 40 nM. In the case of angiostatin, the concentration showing 50% inhibitory effect was about 80nM, whereas TK1-2 showed a significant inhibitory effect.

(1-6-2) TK1-2의 제대정맥 내피세포의 증식 억제 효과(1-6-2) Inhibitory Effect of TK1-2 on Proliferation of Umbilical Vein Endothelial Cells

인간 제대정맥 혈관내피세포(Human Umbilical Vein Endotherial Cell: HUVEC)는 제왕절개수술로 얻은 사람의 탯줄에서 공지의 방법(Jaffe et al.;J. Clin. Invest., 52, pp2745-2756, 1973)을 적용시켜 분리하였고, M199 배지 (20% FBS, 30㎍/㎖ 내피세포성장 보충물(Sigma사), 90㎍/㎖ 헤파린, 25mM 헤피스(Hepes), 2.2g/ℓ 소듐 바이카보네이트, 2mM L-글루타민 및 1% 항생제 포함)에서 유지시켰다. 세포를 계대배양하여 3, 4 및 5 세대의 세포를 실험에 사용하였다. 배양된 내피세포를 이용하여 [³H]-티미딘 인코포레이션 분석(thymidine incorportion assay)을 다음과 같이 수행하였다.Human Umbilical Vein Endotherial Cells (HUVECs) are known from the umbilical cord of humans obtained by caesarean section (Jaffe et al . ; J. Clin. Invest. , 52 , pp 2745-2756, 1973). Isolated by application, M199 medium (20% FBS, 30 μg / ml endothelial cell growth supplement (Sigma), 90 μg / ml heparin, 25 mM Hepes, 2.2 g / L sodium bicarbonate, 2 mM L- Glutamine and 1% antibiotic). Cells were passaged to use cells of the 3, 4 and 5 generations for the experiment. Using cultured endothelial cells, a [ ³ H] -thymidine incorportion assay was performed as follows.

젤라틴 코팅된 24 웰 배양 플레이트에 웰당 20,000 개의 제대혈관내피세포를 깔고, M199 배지(10% FBS, 90㎍/㎖ 헤파린, 1% 항생제 포함)에서 24시간동안 배양하였다. 그 다음 기존 배지를 0.25㎖ M199 배지(5% FBS, 90㎍/㎖ 헤파린, 1% 항생제 포함) 및 0 nM 내지 320nM의 농도의 His-TK1-2 단백질 시료를 가하였다. 30분 배양 후에 0.25㎖ M199(5% FBS, 90㎍/㎖ 헤파린, 1% 항생제) 및 6 ng/㎖ bFGF(R&D system사)를 각 웰에 첨가하였다. 18 시간 후, [³H]-티미딘을 1 μCi (0.037 MBq)를 가해 6 시간 동안 좀더 배양하였다. 배양 후 세포들을 메탄올로 고정시키고, 냉 10% TCA로 3번 세척하였고, 0.25 N NaOH, 1% SDS에 녹인 후, 방사능을 액체섬광계수기(liquid scintillation counter)를 사용하여 계측하였다.20,000 umbilical cord endothelial cells per well were placed in gelatin coated 24-well culture plates and incubated for 24 hours in M199 medium (10% FBS, 90 μg / ml heparin, with 1% antibiotics). Existing medium was then added 0.25 mL M199 medium (5% FBS, 90 μg / mL heparin, with 1% antibiotic) and His-TK1-2 protein samples at concentrations from 0 nM to 320 nM. After 30 min incubation, 0.25 ml M199 (5% FBS, 90 μg / ml heparin, 1% antibiotic) and 6 ng / ml bFGF (R & D system) were added to each well. After 18 hours, [ ³ H] -thymidine was added to 1 μCi (0.037 MBq) and further incubated for 6 hours. After incubation, the cells were fixed with methanol, washed three times with cold 10% TCA, dissolved in 0.25 N NaOH, 1% SDS, and radioactivity was measured using a liquid scintillation counter.

도 8에서와 같이, 단백질 TK1-2는 bFGF에 의해 자극된 HUVE 세포에 대한 성장억제효과를 나타냈으며, 단백질 양에 의존적인 양상을 보였다. As shown in Figure 8, protein TK1-2 showed a growth inhibitory effect on bFGF-stimulated HUVE cells, and showed a protein-dependent pattern.

1-7 : CAM 분석(CAM assay)을 통한 생체내에서의 TK1-2의 혈관신생억제효과관찰1-7: Observation of angiogenesis inhibitory effect of TK1-2 in vivo by CAM assay

생체내 시험상(in vivo)에서의 항 혈관신생효과를 확인하기 위하여, CAM(Chorioallanotic Membrane) 분석을 실시하였다(Nguyen, M. et al.; Microvascular Res., 47, pp31-40, 1994). CAM 분석방법을 간단히 소개하면, 4.5일배 수정란의 CAM 위에 약물을 점적하여 말린 커버슬립(coverslip)을 올리고 2일 후 약물에 의한 혈관신생이 일어났는지 현미경으로 관찰하는 실험이다. 비교를 위한 정상대조군으로 약물을 점적하지 않은 커버슬립만을 CAM 위에 올려, 2 일 후 관찰하면 정상적인 혈관 형태를 관찰할 수 있다.In order to confirm the antiangiogenic effect in vivo, Chorioallanotic Membrane (CAM) analysis was performed (Nguyen, M. et al .; Microvascular Res ., 47 , pp31-40, 1994). Briefly, the CAM analysis method is an experiment in which a drug is placed on a CAM of a 4.5-day fertilized egg, a dried coverslip and a microscope is observed two days after the drug angiogenesis occurs. As a normal control group for comparison, only coverslips without drug dropping were placed on the CAM and observed after 2 days to observe normal vascular morphology.

수정란(풀무원, 한국)을 37℃에서 80 내지 90%의 습도를 유지하면서 배양하였다. 2일째에 알부민 부분을 제거하고 3일째에 윗부분의 껍질을 제거하여 윈도우(window)를 만들었다. 배양 4.5일째에 터마녹스 커버슬립(Thermanox coverslip, Nunc사, Roskilde, Denmark; 커버슬립의 1/4 크기로 자른 것)에, 단백질 TK1-2를 각각 5㎍, 20㎍, 40㎍ 씩 점적하여, 각 수정란의 CAM 위에 올려놓고 2일 동안 배양시킨 후 20%의 지방에멀전(fat emulsion)을 CAM에 주사하여 혈관신생 억제부위(inhibition zone)를 관찰하였다. Fertilized eggs (Pulmuone, Korea) were incubated at 37 ° C. with 80-90% humidity. On day 2 the albumin part was removed and on day 3 the upper shell was removed to create a window. On day 4.5 of cultivation, to Termanox coverslip (Thermanox coverslip, Nunc, Roskilde, Denmark; cut to 1/4 size of coverslip), 5 μg, 20 μg and 40 μg of protein TK1-2 were added dropwise, respectively. Each fertilized egg was placed on the CAM and cultured for 2 days, and then 20% fat emulsion was injected into the CAM to observe the angiogenesis inhibition zone.

도 9에서 화살표가 있는 부분이 혈관신생이 억제된 부위이며, 도 10의 결과에서, TK1-2의 양이 많아질수록 혈관이 없는 부위를 갖는 CAM의 비율이 늘어나는 것으로 보아, 배의 혈관신생을 억제하는 것을 관찰할 수 있었다. TK1-2에 의한 독성은 수정란에서 관찰되지 않았다.In FIG. 9, the area indicated by the arrow is the site where angiogenesis is suppressed, and in the result of FIG. 10, as the amount of TK1-2 increases, the ratio of CAM having a site without blood vessels increases. Suppression was observed. No toxicity by TK1-2 was observed in fertilized eggs.

1-8 : 실험동물 모델을 이용한 항암효과의 조사1-8: Investigation of anticancer effect using experimental animal model

(1-8-1) 세포배양(1-8-1) Cell Culture

가톨릭 의과학연구원 내 신약개발연구소에서 분양 받은 비소세포폐암세포 (Non-small cell lung cancer cell)인 PC14은 10% FBS(Sigma사)가 포함된 DMEM배지 (제일바이오텍서비스, 대구, 한국)로 T75 플라스크에 넣고 5% CO₂, 37℃에서 배양하였다.PC14, a non-small cell lung cancer cell distributed at the Catholic Institute of Medicine and Development, is a T75 flask with DMEM medium containing 10% FBS (Sigma) (Cheil Biotech Service, Daegu, Korea). Incubated at 5% CO ₂ , 37 ℃.

(1-8-2) 실험동물 (1-8-2) Experiment Animal

중앙실험동물(Hamamatsu, Japan)에서 4주령의 체중 18g 내외의 BALB/c 누드 마우스를 분양 받아 항생제가 첨가되지 않은 고형사료(삼양사료(주), 한국)와 수돗물을 멸균하여 충분히 공급하여 실험실 환경에 적응시킨 뒤 실험에 사용하였다. Laboratory animals (Hamamatsu, Japan) received BALB / c nude mice weighing about 18g at 4 weeks of age, and sterilized solid feeds without any antibiotics (Samyang Feed Co., Ltd.) and tap water and supplied them in a laboratory environment. Was used in the experiment.

(1-8-3) 종양세포의 이식 (1-8-3) Transplantation of Tumor Cells

전체 30마리의 실험용 쥐에게 폐암 세포주 PC14인 종양세포 3 x 10⁶ 개를 PBS 200㎕에 현탁시켜서 등부위의 피하에 26게이지 주사바늘을 사용하여 주입하였다. 이식한 후 7일 경과 후에 이식부위에 종양인 작은 혹 (tumor nodule)이 80~110㎣ 크기로 형성되었고, 이 시기부터 TK1-2 단백질을 투여하였다.A total of 30 rats were suspended in 200 μl of PBS with 3 × 10 ⁶ tumor cells of lung cancer cell line PC14 and injected with 26 gauge needles subcutaneously. After 7 days after implantation, tumor nodule was formed at 80 ~ 110mm3 on the graft site, and TK1-2 protein was administered from this time.

(1-8-4) 재조합단백질의 투여 및 관찰 (1-8-4) Administration and Observation of Recombinant Proteins

종양세포를 이식하고 일주일이 경과된 시점에서 실험동물군을 3집단으로 나누어 재조합 단백질을 투여하였다. 3개 집단 중에 대조군(control) 집단에는 PBS를 300 ㎕, 10 ㎎/㎏ 투여군에는 ㎖ 당 1.5 ㎎의 TK1-2를 150 ㎕ 씩, 50 ㎎/㎏ 투여군에는 ㎖ 당 3 ㎎의 TK1-2를 330 ㎕ 씩 매일 복강에 주사하였다. 종양의 크기는 버니어캘리퍼스를 사용하여 ㎜단위로 장경과 단경을 측정한 후 (장경² x 단경 x 0.52(mm³)) 계산법에 의해 산출하였고, 무게는 전자저울을 이용하여 격일로 측정하였다. 측정결과는 10마리의 평균으로 구하였으며, 오차는 표준편차(SD) 값으로 하였다. 유의성은 티-테스트(t-test)에 의해, 대조군과 비교하여 유의성을 검증하였다.One week after tumor cell transplantation, the experimental animals were divided into three groups and the recombinant protein was administered. Of the three groups, 300 μl of PBS was added to the control group, 150 μl of 1.5 mg of TK1-2 / ml to the 10 mg / kg group, and 3 mg of TK1-2 to 3 mg / ml to the 50 mg / kg group. Μl was injected daily into the abdominal cavity. Tumor size was measured by the long diameter and short diameter in mm units using a vernier caliper (long diameter ² x short diameter x 0.52 (mm ³ )), and the weight was measured every other day using an electronic balance. The measurement result was calculated as the average of 10 animals, and the error was taken as the standard deviation (SD) value. Significance was verified by comparison with the control group by t-test.

투여 7일간은 3개군 간의 차이가 크지 않았으나 10일이 지나면서 대조군과 다른 처리군 간의 차이를 나타내기 시작하였다. 투여 30일이 지난 후 크기의 차이가 약 5배 이상 커졌다. 도 11, 12 및 13은 처리 40일째에 찍은 사진이다. 도 11은 TK1-2를 처리하지 않은 대조군이며, 도 12는 10㎎/㎏의 TK1-2를 투여한 그룹이며, 도 13은 50㎎/㎏의 TK1-2를 처리한 그룹이다. 반면 50 mg/kg 투여군의 종양 크기는 거의 성장하지 않고 그대로 유지되는 것으로 관찰되었다(도 14 참조). 도 15에 생존률에 대한 결과표가 나타나있다. 대조군은 처리 50일까지 생존하였다. 대조군이 모두 죽은 날에 10 mg/kg 투여군도 모두 희생시켰으며 이때의 생존율은 60%였다. 암의 성장은 왕성하여 대조군은 처리 30일째부터 죽기 시작하여 그 후 4~5일 간격으로 죽었다. 전체 중에 대조군의 생존일은 약 58일로 측정되었다. TK1-2 단백질을 50 mg/kg 투여군은 생존율이 100% 이었고(도 15 참조), 암의 성장이 97%이상 억제되어 탁월한 항암 활성을 보여 주었다. 50 mg/kg로 투여한 경우 50%에 해당하는 5마리는 TK1-2 단백질의 투여를 중지하였으나 중지 후, 20일 후까지도 계속해서 TK1-2를 투여한 나머지 5마리에서와 같이 암의 성장을 전혀 보이지 않았다.Seven days of administration did not show a significant difference between the three groups, but after 10 days, the difference between the control group and the other treatment groups began to show. After 30 days of administration, the difference in size increased by about five times or more. 11, 12 and 13 are photographs taken on day 40 of treatment. 11 is a control group not treated with TK1-2, FIG. 12 is a group administered with 10 mg / kg of TK1-2, and FIG. 13 is a group treated with 50 mg / kg of TK1-2. On the other hand, it was observed that the tumor size of the 50 mg / kg administration group remained almost ungrown (see FIG. 14). 15 shows the result table for survival rate. The control group survived to 50 days of treatment. All the 10 mg / kg dosed groups were sacrificed on the day that the control group died, and the survival rate was 60%. The growth of the cancer was so strong that the control group began to die from the 30th day of treatment and then died every 4 to 5 days. The overall survival of the control group was determined to be about 58 days. The 50 mg / kg TK1-2 administration group had a 100% survival rate (see FIG. 15), and showed an excellent anticancer activity because cancer growth was inhibited by more than 97%. When administered at 50 mg / kg, 5% of the 50 mice stopped the TK1-2 protein but continued to develop cancer as in the remaining 5 mice treated with TK1-2 until 20 days after stopping. Did not see at all.

1-9 : 인간 TK1-2와 마우스 TK1-2의 아미노산 서열 비교 1-9: Amino Acid Sequence Comparison of Human TK1-2 and Mouse TK1-2

TK1-2 재조합 단백질은 인간의 t-PA 염기서열을 기초로 하여 제조하였고, 본 발명의 실험에서는 마우스를 실험동물로 사용하였으므로, 이들 염기서열의 차이를 비교하여 보았다. 비교한 결과, 인간과 마우스 TK1-2 아미노산 서열상에서 약 76.6%의 동질성이 확인되었다(도 16 참조). TK1-2 recombinant protein was prepared based on human t-PA sequences, and in the experiments of the present invention, mice were used as experimental animals, and the differences between these sequences were compared. In comparison, about 76.6% homogeneity was confirmed on the human and mouse TK1-2 amino acid sequences (see FIG. 16).

따라서 마우스와 인간의 TK1-2 아미노산 서열이 75.9%이므로, 다음 실시예와 같이 BALB/c 누드 마우스에서 재조합 TK1-2를 장기간 투여하였을 때 항체를 형성하는지 여부를 조사하였다. Therefore, since the amino acid sequence of mouse and human TK1-2 is 75.9%, it was examined whether antibodies were formed when prolonged administration of recombinant TK1-2 in BALB / c nude mice as in the following example.

1-10: 마우스 혈액을 이용한 웨스턴 블롯 분석을 통한 항체 생성 조사1-10: Investigation of antibody production by Western blot analysis using mouse blood

각 집단별(대조군, 10㎎/㎏ TK1-2 투여군, 50㎎/㎏ TK1-2 투여군)로 처리 40일째에 채혈을 실시하였다. 이렇게 채혈한 혈액은 14,000 rpm 에서 5 분 동안 원심분리하여, 혈장과 혈구로 분할하였고, 혈장만 새로운 튜브에 옮겨 담았다. 재조합 단백질 TK1-2를 SDS-PAGE하고, 0.2 ㎛ 니트로셀룰로스막 (Schleicher & Schuell사, Germany)에 전기적으로 블롯팅시켰다. 단백질이 이동된 막을 1시간 동안 블로킹 완충용액(5% skim milk in TBST; 10 mM Tris-HCl, pH 8.0, 150 mM NaCl, 0.1% Tween 20)으로 담구어 교반한 후, 각각의 대조군, 10㎎/㎏ TK1-2 투여군, 50㎎/㎏ TK1-2 투여군으로부터 얻은 혈청을 1:1000의 비율로 블로킹 완충용액에 희석하여 1시간 동안 1차 결합시켰다. 또한, TK1-2 항체(Body-Tech사, 춘천, 한국)를 면역반응을 확인하기 위하여 사용하였다. 니트로셀룰로스막을 TBST로 5분간 3회 반복 수세하고 블로킹 완충용액으로 1:2000 희석한 항-마우스 IgG-HRP 이차항체를 이용하여 1시간 동안 2차 결합시켰다. 반응이 끝난 후 TBST로 5분간 3회 반복 수세하여 WEST-ZOL^TM 용액 (인트론바이오테크놀러지, 성남, 대한민국)으로 발색시켰다.Blood was collected on the 40th day of treatment in each group (control group, 10 mg / kg TK1-2 administration group, 50 mg / kg TK1-2 administration group). The collected blood was centrifuged at 14,000 rpm for 5 minutes, divided into plasma and blood cells, and only plasma was transferred to a new tube. Recombinant protein TK1-2 was SDS-PAGE and electrically blotted onto a 0.2 μm nitrocellulose membrane (Schleicher & Schuell, Germany). The protein-transferred membrane was immersed in blocking buffer (5% skim milk in TBST; 10 mM Tris-HCl, pH 8.0, 150 mM NaCl, 0.1% Tween 20) for 1 hour, and then stirred. Serum obtained from the / kg TK1-2 administration group, 50mg / kg TK1-2 administration group was diluted in blocking buffer at a ratio of 1: 1000 and primary binding for 1 hour. In addition, TK1-2 antibody (Body-Tech Co., Chuncheon, Korea) was used to confirm the immune response. The nitrocellulose membrane was washed three times with TBST three times for 5 minutes and bound for 2 hours using an anti-mouse IgG-HRP secondary antibody diluted 1: 2000 with blocking buffer. After completion of the reaction, washing with TBST was repeated three times for 5 minutes and developed with WEST-ZOL ^™ solution (Intron Biotechnology, Seongnam, Korea).

도 17의 결과를 보면, 레인 A는 TK1-2 항체를 이용한 웨스턴 블롯이고, 레인 B는 대조군의 혈청을 반응시킨 것이고, 레인 C는 10㎎/㎏ TK1-2 투여군의 혈청을 반응시킨 것, 레인 D는 50㎎/㎏ 투여군의 혈청을 반응시킨 결과도이다. 50mg/kg의 용량으로 투여한 처리군에서조차도 항체가 인지되지 않음을 알 수 있었다. 따라서 본 실험동물 모델에서 항체 생성에 의한 재조합 TK1-2의 항암효과 감소는 없는 것으로 판단된다.Referring to the results of FIG. 17, lane A is a Western blot using TK1-2 antibody, lane B is the serum of control group, lane C is the serum of 10 mg / kg TK1-2 administration group, lane D is a result of reacting the serum of a 50 mg / kg administration group. It was found that the antibody was not recognized even in the treatment group administered at the dose of 50 mg / kg. Therefore, the anti-cancer effect of recombinant TK1-2 is not reduced by the production of antibody in the experimental animal model.

1-11 : 면역조직화학(Immunohistochemistry) 염색을 통한 혈관신생 및 암에 미치는 효과 조사1-11: Investigation of effects on angiogenesis and cancer through immunohistochemistry staining

각 집단별로 약 50일간 투여 후, 희생시켰고, 종양조직을 포함하여 기관들(간, 비장, 허파, 신장, 심장)을 적출하여 독성의 흔적이 있는지와 PCNA( Proliferating Cell Nuclear Antigen), bFGF, VEGF(Vascular Endothelial Growth Factor), 안지오제닌(angiogenin), vWF(von Willebrand Factor), MMP 9(Matrix MetalloProteinase 9), MMP 10의 발현에 차이가 있는지 조사하였다. Each group was sacrificed for about 50 days, and then sacrificed. The organs (liver, spleen, lungs, kidneys, heart), including tumor tissues, were extracted for signs of toxicity and PCNA (Proliferating Cell Nuclear Antigen), bFGF, VEGF. (Vascular Endothelial Growth Factor), Angiogenin (angiogenin), von Willebrand Factor (vWF), Matrix Metallo Proteinase 9 (MMP 9), and MMP 10 expression were examined.

도 18은 대조군의 적출한 기관들이고, 도 19는 10㎎/㎏ 투여군의 적출기관들이며, 도 20은 대조군에서 적출한 종양조직이다. 조직을 잘게 잘라 분석하였을 때, 육안으로 관찰될 수 있는 조직의 병변이나 전이의 흔적을 관찰할 수 없었다. FIG. 18 shows the harvested organs of the control group, FIG. 19 shows the harvested organs of the 10 mg / kg administration group, and FIG. 20 shows tumor tissues extracted from the control group. When the tissue was chopped and analyzed, no traces of tissue lesions or metastases could be observed.

적출한 각 조직을 10% 포름알데하이드(formaldehyde) 용액에서 4시간 동안 고정시키고, 100% 에탄올에 담구었다. 그런 다음 조직을 파라핀으로 고정시켰다. 7㎛ 두께로 연속적으로 자른 후, 조직절편을 헤마톡실린(hematoxylin, Sigma사)과 에오신(eosin, Sigma사)으로 염색하였다. 각 조직의 염색된 절편에서 전이된 암세포를 관찰할 수 없었다. 대조군의 경우 실험동물의 간 조직에서 건강불량상태인 황달(jaundice) 현상을 나타내는 증후를 관찰할 수 있었다(도 21 참조). Each tissue was extracted for 4 hours in 10% formaldehyde (formaldehyde) solution and immersed in 100% ethanol. The tissue was then fixed with paraffin. After continuous cutting to 7 μm thickness, tissue sections were stained with hematoxylin (hematoxylin, Sigma) and eosin (eosin, Sigma). The metastasized cancer cells could not be observed in the stained sections of each tissue. In the case of the control group, symptoms showing jaundice, a poor health condition, were observed in liver tissues of the experimental animals (see FIG. 21).

그리고 대조군과 10㎎/㎏ TK1-2 투여군의 종양조직을 이뮤노퍼록시데이즈 (immunoperoxidase)가 붙어있는 VEGF, bFGF, vWF, 안지오제닌, MMP9, MMP10, PCNA (DAKO사, Glostrup, Denmark)에 대한 단일클론 또는 폴리클론 항체로 염색하고 관찰을 실시하였다(도 22 및 23 참조). Tumor tissues of the control group and the 10 mg / kg TK1-2 group were treated with VEGF, bFGF, vWF, angiogenin, MMP9, MMP10, and PCNA (DAKO, Glostrup, Denmark) with immunoperoxidase. Staining with monoclonal or polyclonal antibodies was performed (see Figures 22 and 23).

도 22에서 A는 대조군과 TK1-2 투여군의 종양조직절편을 헤마톡실린/에오신 염색한 사진이며, B는 PCNA 단일클론 항체로 반응시킨 사진이며, C는 VEGF 단일클론 항체를 반응시킨 사진이며 D는 bFGF 항체로 반응시킨 사진이다. 사진의 검은 줄은 25㎛를 의미하며, 400배 확대하여 관찰한 사진이다.In Figure 22, A is a picture of hematoxylin / eosin stained tumor tissue sections of the control group and TK1-2 administration group, B is a picture of the reaction with PCNA monoclonal antibody, C is a picture of the reaction of VEGF monoclonal antibody D Is a photograph reacted with bFGF antibody. The black line in the picture means 25㎛, and the picture is magnified 400 times.

도 23에서 A는 대조군과 TK1-2 투여군의 종양조직절편을 안지오제닌 단일클론 항체로 반응시킨 것이고, B는 vWF 폴리클론 항체와 반응시킨 것이고, C는 MMP9 폴리클론 항체로 반응시킨 사진이고, D는 MMP10 단일클론 항체로 반응시킨 사진이다. In FIG. 23, A is a tumor tissue section of the control group and the TK1-2 administration group with an angiogenin monoclonal antibody, B is a reaction with vWF polyclonal antibody, C is a photograph of the reaction with MMP9 polyclonal antibody, D is a photograph reacted with MMP10 monoclonal antibody.

암조직을 염색하였을 때, 대조군 그룹에서 분열중인 세포들(mitotic cells)이 쉽게 관찰되었고, 이와 대조적으로 처리군에서는 분절화된(fragmented) DNA로 구성된 세포자살과정중인 세포들(apoptotic cells)이 자주 관찰되었다. 그러나, PCNA에 대한 단일항체로 염색하였을 때, 대조군과 처리군에서 별다른 차이가 없이 모두 높을 비율로 염색되어 유사분열기(M phase)에 있는 세포 수에는 차이가 있을 수 있어도 모두 세포증식은 모두 활발히 일어남을 알 수 있었다(도 22참조). 처리군과 투여군에서 증식지수(proliferation index)에 차이가 없음은 안지오스태틴을 처리하여 보고한 논문의 결과와도 (O'Reilly et al.; Cell, 79, pp315-328, 1994) 일치하고 있다. Pyknotic nuclei(fragmented DNA)를 가진 세포수가 투여군에서 좀 더 많이 관찰되는 것도 일치하나, 좀더 정량적인 실험분석이 요구된다.When staining cancer tissues, mitotic cells were easily observed in the control group, whereas apoptotic cells composed of fragmented DNA were frequently observed in the treatment group. It became. However, when stained with a single antibody against PCNA, all of the cell proliferation is active even though there may be a difference in the number of cells in the M phase because there is no difference between the control and treatment groups. It can be seen (see Fig. 22). No difference in the proliferation index between the treated and treated groups is consistent with the results reported in the treatment of angiostatin (O'Reilly et al .; Cell , 79 , pp315-328, 1994). . Although the number of cells with Pyknotic nuclei (fragmented DNA) is more observed in the administration group, more quantitative experimental analysis is required.

혈관신생인자(angiogenic factor)의 하나인 안지오제닌(angiogenin)과 암전이에 중요한 인자인 MMP9과 MMP10에 대해 발현을 조사하였을 때, MMP9은 PC14 세포주에서 발현이 적은 것으로 나타났고, 반면에 bFGF, VEGF, MMP10과 안지오제닌은 대조군에서 발현이 비교적 높았고 흥미롭게도 처리군에서 현저히 발현이 감소되는 양상을 보였다 (도 22와 23 참조). 재조합 TK1-2의 투여로 조직의 발현양상이 바뀌는 결과를 보여주었는데, 이는 안지오스태틴의 하나인 플라스미노겐 크링글 (plasminogen kringles) 1-3를 투여하였을 때, 혈관신생인자인 bFGF와 VEGF의 발현이 감소하는 것을 보여준 것과 일치된 양상을 나타내고 있다 (Joe, Y.A. et al., Int. J. Cancer, 82, pp694-699, 1999). vWF의 경우, 혈관벽을 이루는 내피세포에 의해 생성되므로, 염색시 혈관을 염색할 수 있는데, 다른 이식암 모델과 달리 투여군 뿐만 아니라 대조군에서도 혈관을 찾아보기가 힘들어 정량적인 평가가 불가능하였다 (도 23 참조).When expression was examined for angiogenic factors, angiogenin and MMP9 and MMP10, which are important factors for cancer metastasis, MMP9 was found to be less expressed in PC14 cell lines, whereas bFGF, VEGF, MMP10 and angiogenin were relatively high in the control group and interestingly, the expression was significantly decreased in the treatment group (see FIGS. 22 and 23). The expression of tissues was altered by the administration of recombinant TK1-2, which was determined by the angiogenic factors bFGF and VEGF when plasminogen kringles 1-3, angiostatin, was administered. This pattern is consistent with the decrease in expression (Joe, YA et al., Int. J. Cancer , 82 , pp694-699, 1999). Since vWF is generated by endothelial cells constituting the vascular wall, blood vessels can be stained at the time of staining. Unlike other transplant cancer models, blood vessels are difficult to find in the control group as well as in the control group, and thus quantitative evaluation is impossible (see FIG. 23). ).

실시예 2 : 효모인 피키아에서의 TK1-2 단백질 발현, 정제 및 효능 검색Example 2 TK1-2 Protein Expression, Purification and Efficacy Screening in Yeast, Pichia

2-1 : TK1-2 발현 Pichia 벡터 제조2-1: Preparation of TK1-2 Expressing Pichia Vector

TK1-2를 발현하는 재조합 플라스미드를 히스-택(His-tag)이 같이 발현이 되는 플라스미드, His-TK1-2 와 택(tag)이 달리지 않은 플라스미드, N-TK1-2로 두 가지를 제조하였다. 인간 티슈타입 플라스미노겐의 89번째 아미노산 아르기닌부터 263번째 아미노산 트레오닌을 암호화하는 525bp의 DNA 조각을 Pfu 복제효소 (Stratagene사)를 사용한 PCR을 통하여 수득하였다. His-TK1-2 플라스미드를 제조할 때, 서열번호 5의 프라이머 3 (5'-CAGTATCGATCAGGGCCACGTGCTACGAG-3' (ClaI))과 서열번호 6의 프라이머 4 (5'-CTGATCTAGAGTGGAGCAGGAGGGCAC -3'(XbaI))을 사용하였으며, N-TK1-2 플라스미드를 제조할 때는, 서열번호 5의 프라이머 3 (5'-CAGTATCGATCAGGGCCACGTGCTACGAG-3'(ClaI))와 서열번호 7의 프라이머 5 (5'-CTGATCTAGATCAGGTGGAGCAGGAGGG-3'(XbaI))를 사용하였다. 이렇게 수득된 PCR 산물을 제한효소 ClaI 및 XbaI으로 처리하였다.Two recombinant plasmids expressing TK1-2 were prepared, including a plasmid with a His-tag expression, a His-TK1-2 with a non-tag plasmid, and N-TK1-2. . DNA fragments of 525 bp encoding the 89 th amino acid arginine to the 263 th amino acid threonine of human tissue type plasminogen were obtained by PCR using Pfu transcriptase (Stratagene). When preparing His-TK1-2 plasmid, using primer 3 of SEQ ID NO: 5 (5'-CAGTATCGATCAGGGCCACGTGCTACGAG-3 '(ClaI)) and primer 4 of SEQ ID NO: 6 (5'-CTGATCTAGAGTGGAGCAGGAGGGCAC-3' (XbaI)) In preparing the N-TK1-2 plasmid, primer 3 of SEQ ID NO: 5 (5'-CAGTATCGATCAGGGCCACGTGCTACGAG-3 '(ClaI)) and primer 5 of SEQ ID NO: 7 (5'-CTGATCTAGATCAGGTGGAGCAGGAGGG-3' (XbaI)) Was used. The PCR product thus obtained was treated with restriction enzymes ClaI and XbaI.

벡터는 상기 같은 제한효소인 ClaI 및 XbaI으로 처리 후 탈인산화시킨 pPICZα-C 벡터(Invitrogen사)로 준비하여, 벡터와 PCR 산물을 T4 DNA 리가아제(Takara사)를 이용한 라이게이션(ligation) 방법으로 붙인 후, 이어 대장균 TOP10F'(Invitrogen사)에 형질전환(Transformation)시켰다. 형질전환체의 플라스미드를 가지고 DNA 시퀀싱을 수행하여 삽입 DNA의 염기서열을 확인하였고, 그 결과로 재조합 플라스미드 His-TK1-2/pPICZα-C(도 24 참조) 및 N-TK1-2/pPICZα-C(도 25 참조)를 수득하였고, 이들은 모두 부가적 아미노산(Glu-Ala-Glu-Ser-Ile)을 N-말단에 포함하고 있다.The vector was prepared with pPICZα-C vector (Invitrogen) dephosphorylated after treatment with the same restriction enzymes ClaI and XbaI, and the vector and PCR products were ligated using T4 DNA ligase (Takara). After attaching, E. coli TOP10F '(Invitrogen) was transformed. DNA sequencing was performed with the plasmid of the transformant to confirm the base sequence of the inserted DNA. As a result, the recombinant plasmids His-TK1-2 / pPICZα-C (see FIG. 24) and N-TK1-2 / pPICZα-C (See FIG. 25), all of which contain an additional amino acid (Glu-Ala-Glu-Ser-Ile) at the N-terminus.

2-2 : 2-2: P.pastorisP.pastoris 로의 형질전환 Transformation to

효모의 한 종류인 피키아 파스토리스 GS115 또는 X-33(Pichia pastoris GS115 또는 X-33, Invitrogen사) 균주에, 제한효소 SacI으로 처리한 상기 실시예 2-1의 His-TK1-2/pPICZα-C 및 N-TK1-2/pPICZα-C를 형질전환시켰다. 대략 3 ㎍ 정도의 선형 플라스미드 DNA를 일렉트로포레이션 (Gene Pulser, Bio-Rad사, 0.2㎝ 큐벳사용, 조건: 1.5kV, 25㎌, 400Ω) 방법으로 형질전환시켰다. 전기적 충격을 준 후 바로 차가운 1M 솔비톨 용액 1㎖을 큐벳에 첨가한 다음, 30℃에서 1시간동안 흔들지 않고 배양하였다. 배양된 효모세포들을 제오신(zeocin)이 1000㎍/㎖의 농도로 첨가된 YPD (yeast extract peptone dextrose medium, 1% yeast extract, 2% peptone, 2% dextrose) 아가배지에 도말하였고, 30℃에서 16 시간 배양하여 형질전환체를 수득하였다.One kind of yeast, Pichia pastoris GS115 or X-33, Invitrogen) strains were transformed with His-TK1-2 / pPICZα-C and N-TK1-2 / pPICZα-C of Example 2-1 treated with restriction enzyme SacI. Approximately 3 μg of linear plasmid DNA was transformed by electroporation (Gene Pulser, Bio-Rad, 0.2 cm cuvette, conditions: 1.5 kV, 25 kV, 400 Ω). Immediately after the electric shock, 1 ml of cold 1M sorbitol solution was added to the cuvette, and then incubated at 30 ° C. for 1 hour without shaking. Cultured yeast cells were plated on YPD (yeast extract peptone dextrose medium, 1% yeast extract, 2% peptone, 2% dextrose) agar medium to which zeocin was added at a concentration of 1000 μg / ml, and at 30 ° C. 16 hours of incubation yielded the transformants.

2-3 : Mut 표현형 선별2-3: Mut Phenotype Screening

메탄올을 탄소원으로 사용하는지 스크리닝하기 위하여, 상기 실시예 2에서 수득된 형질 전환체를 MM (1.34% YNB, 4×10^-5 비오틴, 0.5% 메탄올, 1.5% 아가) 또는 MMH 배지 (MM배지에 0.4% 히스티딘을 첨가한 것), 및 MD (1.34% YNB, 4×10^-5 비오틴, 2% 덱스트로스, 1.5% 아가) 또는 MDH 배지 (MD배지에 0.4% 히스티딘을 첨가한 것)에 스트리킹하였다. Mut⁺ 대조군(GS115/His+/β-갈락토시다제, Invitrogen사) 및 Mut^s 대조군(GS115/His+/알부민, Invitrogen사)도 비교를 위해 실험하였다. 30℃에서 48시간 배양 후 Mut⁺ 콜로니들은 Mut^s 콜로니들보다 현저하게 많이 자라있었다.To screening that uses methanol as a carbon source, in Example 2 the obtained transformant in MM (1.34% YNB, 4 × 10 -5 biotin, 0.5% methanol, 1.5% agar) or MMH medium (0.4 to MM medium was streaked in that the addition of histidine%), and MD (1.34% YNB, 4 × 10 -5 biotin, 2% dextrose, 1.5% agar) or MDH medium (not containing added 0.4% histidine in the medium MD). Mut ⁺ control (GS115 / His + / β-galactosidase, Invitrogen) and Mut ^s control (GS115 / His + / albumin, Invitrogen) were also tested for comparison. After 48 hours of incubation at 30 ° C., Mut ⁺ colonies grew significantly more than Mut ^s colonies.

2-4 : TK1-2 발현 스크리닝2-4: TK1-2 Expression Screening

P. pastoris 형질전환체들을 10㎖ BMG (100mM 인산칼륨 (pH 6.0), 1.34% YNB, 4×10^-5 비오틴, 1% 글리세롤) 또는 BMGH 배지 (BMG배지에 0.4% 히스티딘을 첨가한 것)를 사용하여, 30℃, 250 rpm으로 배양하였으며, OD₆₀₀이 3.0에 도달할 때까지 배양하였다. 배양세포를 원심분리로 수집하여 2㎖의 BMM (100mM 인산칼륨 (pH 6.0), 1.34% YNB, 4×10^-5 비오틴, 0.5% 메탄올) 또는 BMMH 배지 (BMM 배지에 0.4% 히스티딘을 첨가시킨 것)에 현탁시켰다. 메탄올은 매 24시간마다 0.5% 농도가 되도록 첨가하였다. TK1-2의 분비여부를 확인하기 위하여, 배양배지를 사용하여 SDS-PAGE 및 코마시블루 염색을 수행하였다(도 26, 27a 및 27b 참조).Of the P. pastoris transformants 10㎖ BMG (100mM potassium phosphate (pH 6.0), 1.34% YNB , 4 × 10 -5 biotin, 1% glycerol) or BMGH medium (which will be added to 0.4% histidine in the culture medium BMG) Were incubated at 30 ° C., 250 rpm and incubated until the OD ₆₀₀ reached 3.0. By collecting the cultured cells by centrifugation of 2㎖ BMM (100mM potassium phosphate (pH 6.0), 1.34% YNB , 4 × 10 -5 biotin, 0.5% methanol) or BMMH medium (having the addition of 0.4% histidine in the BMM medium ) Is suspended. Methanol was added to a concentration of 0.5% every 24 hours. In order to confirm the secretion of TK1-2, SDS-PAGE and coomassie blue staining was performed using a culture medium (see FIGS. 26, 27a and 27b).

도 26 의 레인 1은 형질전환체 중 His-TK1-2-4, 레인 2는 His-TK1-2-5, 레인 3은 His-TK1-2-6, 레인 4는 His-TK1-2-7이다. Lane 1 of Figure 26 His-TK1-2-4 transformant, Lane 2 His-TK1-2-5, Lane 3 His-TK1-2-6, Lane 4 His-TK1-2-7 to be.

도 27a 는 N-TK1-2 GS115 형질전환체들 중 단백질 분비정도를 스크리닝한 것으로 레인 1은 N-TK1-2-4이고, 레인 2는 N-TK1-2-6, 레인 3은 N-TK1-2-7, 레인 4는 N-TK1-2-8, 레인 5는 N-TK1-2-9의 단백질 발현양상을 나타낸다. Figure 27a is a screening of the protein secretion of the N-TK1-2 GS115 transformants, lane 1 is N-TK1-2-4, lane 2 is N-TK1-2-6, lane 3 is N-TK1 -2-7, lane 4 shows N-TK1-2-8, lane 5 shows the protein expression patterns of N-TK1-2-9.

도 27b 는 N-TK1-2 X-33 형질전환체들 중 단백질 분비정도를 스크리닝한 것으로, 레인 1은 N-TK1-2-1이고, 레인 2는 N-TK1-2-2, 레인 3은 N-TK1-2-3, 레인 4는 N-TK1-2-4, 레인 5는 N-TK1-2-5, 레인 6은 N-TK1-2-6, 레인 7은 N-TK1-2-7, 레인 8은 N-TK1-2-8, 레인 9는 N-TK1-2-9의 단백질 발현양상을 나타낸 것이다. Figure 27b is a screening of the protein secretion of N-TK1-2 X-33 transformants, lane 1 is N-TK1-2-1, lane 2 is N-TK1-2-2, lane 3 N-TK1-2-3, lane 4 is N-TK1-2-4, lane 5 is N-TK1-2-5, lane 6 is N-TK1-2-6, lane 7 is N-TK1-2- 7, lane 8 shows N-TK1-2-8, lane 9 shows the protein expression patterns of N-TK1-2-9.

2-5 : TK1-2 단백질 발현 및 정제2-5: TK1-2 Protein Expression and Purification

TK1-2 단백질을 대량으로 발현시키기 위하여 P.pastoris 형질전환체를 BMG 또는 BMGH 배지 500㎖를 담은 2 리터 플라스크에 접종하여 30℃에서 250rpm으로 OD₆₀₀= 3에 이를 때까지 배양하였다. 이어 배양한 세포를 원심분리(1500×g, 5분)하여 수집하고 BMM 또는 BMMH 배지 100㎖에 현탁하였다. 순수한 메탄올을 매 24시간마다 최종농도 0.5%가 되도록 첨가해주었다. 120시간 후, 세포를 원심분리 (1500×g, 5분)하고, 배양액은 -70℃에서 사용 전까지 보관하였다. TK1-2 단백질을 함유하고 있는 정제하지 않은 배양액(200㎖)을 14000×g에서 20분간 원심분리를 수행하여 맑은 상등액을 얻었고, YM10 멤브레인(Amicon사)을 사용한 초여과 (ultrafiltration)에 의하여 원래 부피의 10% 정도까지 농축한 후, 50mM 인산완충액(pH 7.5)을 사용하여 완충액을 교환하였다. 그런 다음 시료를 50mM 인산완충액(pH 7.5)으로 투석하였다. tPA의 크링글 도메인이 리신 잔기(lysine residue)에 결합하는 성질이 있으므로, 라이신-세파로스 4B(Lysine-Sepharose 4B, Phamacia사)가 친화기질로서 사용되었다. 50mM 인산완충액(pH 7.5)으로 충진되고 평형화된 라이신-세파로스 컬럼에 시료를 통과시킨 후, 컬럼을 레진의 1.5배 부피의 50mM 인산완충액(pH 7.5)으로 씻어내었다. 그 다음 컬럼을 다시 레진의 1.5배 부피의 PBS(pH 7.4)로 씻어내었다. 재조합 His-TK1-2 및 N-TK1-2 단백질은 0.2M ε-아미노-N-카프로익산으로 용출하였다. 용출분획은 48시간동안 탈이온수로 투석된 후, 동결건조하였다. 도 28 및 29는 라이신 세파로스 컬럼으로 정제한 재조합 His-TK1-2 단백질 및 N-TK1-2 단백질을 전기영동하여 염색한 사진으로, 레인 1은 정제하기 전 단백질이고, 레인 2는 프로우 쓰루 분획(flow through fraction)이고, 레인 3은 50mM 인산완충액으로 씻어낸 분획이고, 레인 4는 PBS(pH 7.4)로 씻어낸 분획이며, 레인 5 및 6 은 0.2M ε-아미노-N-카프로익산으로 용출된 분획이다.In order to express a large amount of TK1-2 protein, P.pastoris transformants were inoculated into a 2-liter flask containing 500 ml of BMG or BMGH medium and incubated at 30 ° C. at 250 rpm until OD ₆₀₀ = 3. The cultured cells were then collected by centrifugation (1500 × g, 5 minutes) and suspended in 100 ml of BMM or BMMH medium. Pure methanol was added every 24 hours to a final concentration of 0.5%. After 120 hours, cells were centrifuged (1500 × g, 5 minutes) and the cultures stored at −70 ° C. until use. The crude supernatant (200 ml) containing the TK1-2 protein was centrifuged at 14000 × g for 20 minutes to obtain a clear supernatant, and the original volume was obtained by ultrafiltration using a YM10 membrane (Amicon). After concentration to about 10% of the buffer was exchanged using 50mM phosphate buffer (pH 7.5). The sample was then dialyzed with 50 mM phosphate buffer (pH 7.5). Since the kringle domain of tPA has a property of binding to a lysine residue, Lysine-Sepharose 4B (Phamacia) was used as an affinity substrate. After passing the sample through a lysine-Sepharose column packed and equilibrated with 50 mM phosphate buffer (pH 7.5), the column was washed with 1.5 volumes of 50 mM phosphate buffer (pH 7.5). The column was then washed again with 1.5 volumes of PBS (pH 7.4) of resin. Recombinant His-TK1-2 and N-TK1-2 proteins were eluted with 0.2M ε-amino-N-caproic acid. The elution fractions were dialyzed with deionized water for 48 hours and then lyophilized. 28 and 29 are photographs stained by electrophoresis of recombinant His-TK1-2 protein and N-TK1-2 protein purified by lysine sepharose column, lane 1 is a protein before purification, and lane 2 is prothrough Fraction (flow through fraction), lane 3 is the fraction washed with 50 mM phosphate buffer, lane 4 is the fraction washed with PBS (pH 7.4), lanes 5 and 6 are 0.2M ε-amino-N-caproic acid Eluted fraction.

2-6 : 웨스턴블롯 분석2-6: Western blot analysis

단백질 시료들은 14% SDS-PAGE를 수행하여 분석되었고, 니트로 셀룰로오스멤브레인에 전기적으로 블롯팅시켰다. E. coli로 부터 발현된 재조합 TK1-2 단백질에 반응하는 폴리클로날 항체를 사용하여 단백질 시료들을 탐색하였다. 일차항체/항원 복합체는 호올스래디쉬 퍼록시다제가 컨쥬게이트된 마우스 IgG(Santa Cruz biotechnology사)를 사용하여 탐색하였고, NEN사의 웨스턴 블롯 화학형광시약을 사용하여 필름을 감광시켰다. 그 결과 도 30을 보면, 레인 1은 재조합 His-TK1-2 단백질이고, 레인 2는 재조합 N-TK1-2 단백질이며, 대장균에서 발현된 재조합 TK1-2 단백질의 항체가 상기 실시예 2-5의 정제된 단백질과 반응한 것을 관찰할 수 있었다.Protein samples were analyzed by performing 14% SDS-PAGE and electrically blotted onto nitro cellulose membranes. Protein samples were searched using polyclonal antibodies that respond to recombinant TK1-2 protein expressed from E. coli . Primary antibody / antigen complexes were searched using mouse IgG (Santa Cruz biotechnology) conjugated with Hoolradish peroxidase and photosensitized using Western blot chemical fluorescent reagent from NEN. As a result, referring to Figure 30, lane 1 is a recombinant His-TK1-2 protein, lane 2 is a recombinant N-TK1-2 protein, and the antibody of recombinant TK1-2 protein expressed in Escherichia coli is Reaction with the purified protein was observed.

2-7 : 산화도 분석2-7: Oxidation Degree Analysis

이황화결합(disulfide bond)의 존재 여부를 확인하기 위하여, 정제된 재조합 단백질은 β-머캅토에탄올을 함유한 완충액으로 처리하였다. 대조군 시료는 β-머캅토에탄올을 처리하지 않고 준비하였다. 두 단백질 시료는 SDS-PAGE를 통하여 분석되었다. 도 31 의 레인 1은 환원제 처리한 재조합 His-TK1-2 단백질을 전기영동한 사진이고, 레인 2는 환원되지 않은 재조합 His-TK1-2 단백질이다. 도 32 의 레인 1은 환원제 처리한 재조합 N-TK1-2 단백질을 전기영동한 사진이고, 레인 2는 환원되지 않은 재조합 N-TK1-2 단백질이다. 환원된 단백질이 전기영동상 이동이 느림을 알 수 있다.To confirm the presence of disulfide bonds, the purified recombinant protein was treated with a buffer containing β-mercaptoethanol. Control samples were prepared without treatment of β-mercaptoethanol. Two protein samples were analyzed via SDS-PAGE. Lane 1 of FIG. 31 is a photograph of electrophoresis of the reducing His-TK1-2 protein treated with a reducing agent, and lane 2 is the recombinant His-TK1-2 protein not reduced. 32 is a photograph of electrophoresis of a reducing agent-treated recombinant N-TK1-2 protein, and lane 2 is a non-reduced recombinant N-TK1-2 protein. It can be seen that the reduced protein is slow in electrophoretic migration.

2-8 : His-TK1-2의 제대정맥 내피 세포 (HUVEC)의 증식 억제 효과2-8: Inhibitory Effect of His-TK1-2 on Umbilical Vein Endothelial Cells (HUVEC)

실시 예 (1-6-2)에서와 같이 His-TK1-2에 대해 [³H]-티미딘 인코포레이션 분석(thymidine incorporation assay)을 실시하여 HUVEC에 대한 증식 억제 효과를 조사하였다. 도 33에서와 같이, 단백질 His-TK1-2는 bFGF에 의해 자극된 HUVE 세포에 대한 성장억제효과를 나타냈으며, 단백질 양에 의존적인 양상을 보였다.As in Example (1-6-2), [ ³ H] -thymidine incorporation assay was performed on His-TK1-2 to investigate the effect of inhibiting proliferation on HUVEC. As shown in FIG. 33, the protein His-TK1-2 showed a growth inhibitory effect on HUVE cells stimulated by bFGF, and showed a protein dependent dependence.

상기에서 살펴본 바와 같이, 본 발명에 따른 플라스미노겐의 크링클 도메인 1, 2에 해당하는, 대장균에서 발현 정제된 재조합 TK1-2 단백질 및 효모인 피키아에서 발현 정제된 재조합 TK1-2 단백질은 내피세포의 성장을 억제, 혈관신생 억제, 암의 성장억제 효과를 가짐으로써, 혈관신생으로 인한 질환의 치료제 및 암질환의 치료제 등에 유용하게 사용될 수 있다. As described above, the recombinant TK1-2 protein expressed in E. coli and purified TK1-2 protein expressed in E. coli, which corresponds to the Krinkle domains 1 and 2 of the plasminogen according to the present invention, are endothelial cells. By inhibiting the growth of, inhibiting angiogenesis, and inhibiting the growth of cancer, it can be usefully used for the treatment of diseases caused by angiogenesis and the treatment of cancer diseases.

도 1 은 본 발명의 제작된 TK1-2/pET-15b의 플라스미드 구조를 나타낸 도이고,1 is a diagram showing a plasmid structure of the produced TK1-2 / pET-15b of the present invention,

도 2 는 TK1-2 단백질 정제 단계별로 수득된 시료의 SDS-PAGE한 사진이고,Figure 2 is a SDS-PAGE photograph of the sample obtained by the step of TK1-2 protein purification,

도 3 은 정제된 TK1-2 단백질을 비환원 및 환원 조건하에서 SDS-PAGE한 사진이고,3 is a SDS-PAGE photograph of purified TK1-2 protein under non-reducing and reducing conditions,

도 4 는 재조합 TK1-2 단백질의 MALDI 결과도이고,4 is a MALDI result of recombinant TK1-2 protein,

도 5 는 라이신-세파로스 컬럼 통과 후 수득된 단백질시료의 SDS-PAGE한 사진이고,5 is a SDS-PAGE photograph of a protein sample obtained after passing through a lysine-sepharose column.

도 6 은 라이신-세파로스 컬럼 통과한 TK1-2 및 히스-택 친화 컬럼 통과한 TK1-2 단백질의 전기영동사진이며,6 is an electrophoresis picture of TK1-2 protein passed through lysine-sepharose column and TK1-2 protein passed through a heat-tack affinity column,

도 7 은 TK1-2 단백질에 의한 소의 모세혈관 내피(BCE) 세포 증식억제를 관찰한 것으로, 안지오스태틴의 효과와 비교하여 나타낸 도이고,7 is a diagram showing the inhibition of capillary endothelial (BCE) cell proliferation of bovine by TK1-2 protein, which is compared with the effect of angiostatin,

도 8 은 TK1-2 단백질에 의한 제대정맥 내피세포 (HUVEC)의 세포 증식억제를 관찰하여 나타낸 도이고, 8 is a diagram showing observation of cell proliferation inhibition of umbilical vein endothelial cells (HUVEC) by TK1-2 protein,

도 9 는 닭의 수정란의 CAM에 20㎍의 TK1-2를 처리한 후 48시간째에 관찰한 혈관신생억제부위(>)를 찍은 사진이며,9 is a photograph of angiogenesis inhibitory site (>) observed at 48 hours after treatment with 20 μg of TK1-2 in chicken embryos.

도 10 은 용량의존적인 TK1-2 단백질의 혈관신생억제효과를 나타낸 도이고,10 is a diagram showing the angiogenesis inhibitory effect of dose-dependent TK1-2 protein,

도 11 은 폐암세포를 이식한 마우스에 TK1-2를 처리하지 않고 40일이 지난 대조군 마우스의 사진이며, FIG. 11 is a photograph of control mice 40 days old without TK1-2 in mice transplanted with lung cancer cells,

도 12 는 폐암세포를 이식한 후, 40일 동안 10㎎/㎏의 TK1-2를 처리한 마우스의 사진이며,12 is a photograph of a mouse treated with 10 mg / kg TK1-2 for 40 days after transplanting lung cancer cells,

도 13 은 폐암세포를 이식한 후, 40일 동안 50㎎/㎏의 TK1-2를 처리한 마우스의 사진이고, FIG. 13 is a photograph of a mouse treated with 50 mg / kg TK1-2 for 40 days after transplanting lung cancer cells,

도 14 는 본 발명의 재조합 TK1-2 단백질에 의한 시간별 인간 폐암세포 PC14의 종양크기 성장 억제를 나타낸 도이고,14 is a diagram showing the tumor size growth inhibition of human lung cancer cells PC14 by time by the recombinant TK1-2 protein of the present invention,

도 15 는 폐암세포를 이식한 마우스 대조군 및 TK1-2 처리군의 생존율을 나타낸 도이고,15 is a diagram showing the survival rate of the mouse control and TK1-2 treated group transplanted with lung cancer cells,

도 16 은 마우스-TK1-2 및 인간-TK1-2의 아미노산서열을 비교한 도이고16 is a diagram comparing amino acid sequences of mouse-TK1-2 and human-TK1-2;

도 17 은 TK1-2 투여 마우스에서 TK1-2 단백질에 대한 항체생성이 되었는지 여부를 관찰한 웨스턴 블롯 결과사진이고,17 is a Western blot result photograph observing whether or not the production of antibodies to TK1-2 protein in TK1-2 administered mice,

도 18 은 대조군에서 적출한 기관들이고, 18 are the organs extracted from the control group,

도 19 는 10㎎/㎏ TK1-2를 처리한 마우스에서 적출한 기관들이며, 19 shows organs extracted from mice treated with 10 mg / kg TK1-2,

도 20 은 대조군에서 적출한 종양조직이고,20 is tumor tissue extracted from the control group,

도 21 은 대조군의 간조직 절편을 헤마톡실린/에오신 염색한 사진이고,Figure 21 is a hematoxylin / eosin stained picture of the liver tissue section of the control group,

도 22 는 A는 대조군과 TK1-2 투여군의 종양조직절편을 헤마톡실린/에오신 염색한 사진이며, B는 PCNA 단일클론 항체로 반응시킨 사진이며, C는 VEGF 단일클론 항체를 반응시킨 사진이며 D는 bFGF 항체로 반응시킨 사진이다. 사진의 검은 줄은 25㎛를 의미하며, 400배 확대하여 관찰한 사진이고,Figure 22 is a photograph of the tumor tissue sections of the control group and TK1-2 administration group hematoxylin / eosin staining, B is a photograph of the reaction with PCNA monoclonal antibody, C is a photograph of the reaction of VEGF monoclonal antibody D Is a photograph reacted with bFGF antibody. The black line in the picture means 25㎛, and the picture is magnified 400 times.

도 23은 A는 대조군과 TK1-2 투여군의 종양조직절편을 안지오제닌 단일클론 항체로 반응시킨 것이고, B는 vWF 폴리클론 항체와 반응시킨 것이고, C는 MMP9 폴리클론 항체로 반응시킨 사진이고, D는 MMP10 단일클론 항체로 반응시킨 사진이고, Figure 23 is a reaction of tumor tissue sections of the control group and TK1-2 administration group with angiogenin monoclonal antibody, B is a reaction with vWF polyclonal antibody, C is a photograph of the reaction with MMP9 polyclonal antibody, D is a photograph reacted with MMP10 monoclonal antibody,

도 24 는 본 발명의 피키아 발현 플라스미드인 His-TK1-2/pPICZα-C의 제작도이고,Fig. 24 is a preparation diagram of His-TK1-2 / pPICZα-C, which is a pichia expression plasmid of the present invention,

도 25 는 본 발명의 피키아 발현 플라스미드인 N-TK1-2/pPICZα-C 의 제작도이고,Fig. 25 is a preparation diagram of N-TK1-2 / pPICZα-C which is a pichia expression plasmid of the present invention,

도 26 은 His-TK1-2 형질전환체(GS115) 중 단백질 분비정도를 스크리닝한 것이고,26 is a screen for the degree of protein secretion in His-TK1-2 transformant (GS115),

도 27a 는 N-TK1-2 형질전환체(GS115) 중 단백질 분비정도를 스크리닝한 것이고,Figure 27a is a screening of the degree of protein secretion in the N-TK1-2 transformant (GS115),

도 27b 는 N-TK1-2 형질전환체(X-33) 중 단백질 분비정도를 스크리닝한 것이고,Figure 27b is a screen for the degree of protein secretion in the N-TK1-2 transformant (X-33),

도 28 은 라이신 세파로스 컬럼으로 정제한 재조합 His-TK1-2 단백질을 전기영동하여 염색한 사진이며, Figure 28 is a photograph stained by electrophoresis of recombinant His-TK1-2 protein purified by lysine Sepharose column,

도 29 는 라이신 세파로스 컬럼으로 정제한 재조합 N-TK1-2 단백질을 전기영동하여 염색한 사진이고, 29 is a photograph stained by electrophoresis of recombinant N-TK1-2 protein purified by lysine sepharose column,

도 30 는 재조합 His-TK1-2 단백질 및 N-TK1-2 단백질의 웨스턴 블롯 사진이고,30 is a Western blot picture of recombinant His-TK1-2 protein and N-TK1-2 protein,

도 31 은 환원제 처리한 재조합 His-TK1-2 단백질을 전기영동한 사진이고,Figure 31 is a photograph of the electrophoresis of the reducing His-TK1-2 protein treated with,

도 32 는 환원제 처리한 재조합 N-TK1-2 단백질을 전기영동한 사진이다.Figure 32 is a photograph of electrophoresis of the reducing agent-treated recombinant N-TK1-2 protein.

도 33은 재조합 His-TK1-2 단백질에 대한 제대정맥 내피세포 (HUVEC)의 증식억제 효과를 나타낸 그래프이다. 33 is a graph showing the proliferation inhibitory effect of umbilical vein endothelial cells (HUVEC) on recombinant His-TK1-2 protein.

<110> JOE, YOUNG-AE <120> Composition comprising TK1-2 peptide having anti-angiogenic activity and cancer growth inhibitory activity and its use thereof <160> 9 <170> KopatentIn 1.71 <210> 1 <211> 174 <212> PRT <213> Homo sapiens <400> 1 Ala Thr Cys Tyr Glu Asp Gln Gly Ile Ser Tyr Arg Gly Thr Trp Ser 1 5 10 15 Thr Ala Glu Ser Gly Ala Glu Cys Thr Asn Trp Asn Ser Ser Ala Leu 20 25 30 Ala Gln Lys Pro Tyr Ser Gly Arg Arg Pro Asp Ala Ile Arg Leu Gly 35 40 45 Leu Gly Asn His Asn Tyr Cys Arg Asn Pro Asp Arg Asp Ser Lys Pro 50 55 60 Trp Cys Tyr Val Phe Lys Ala Gly Lys Tyr Ser Ser Glu Phe Cys Ser 65 70 75 80 Thr Pro Ala Cys Ser Glu Gly Asn Ser Asp Cys Tyr Phe Gly Asn Gly 85 90 95 Ser Ala Tyr Arg Gly Thr His Ser Leu Thr Glu Ser Gly Ala Ser Cys 100 105 110 Leu Pro Trp Asn Ser Met Ile Leu Ile Gly Lys Val Tyr Thr Ala Gln 115 120 125 Asn Pro Ser Ala Gln Ala Leu Gly Leu Gly Lys His Asn Tyr Cys Arg 130 135 140 Asn Pro Asp Gly Asp Ala Lys Pro Trp Cys His Val Leu Lys Asn Arg 145 150 155 160 Arg Leu Thr Trp Glu Tyr Cys Asp Val Pro Ser Cys Ser Thr 165 170 <210> 2 <211> 522 <212> DNA <213> Homo sapiens <400> 2 gccacgtgct acgaggacca gggcatcagc tacaggggca cgtggagcac agcggagagt 60 ggcgccgagt gcaccaactg gaacagcagc gcgttggccc agaagcccta cagcgggcgg 120 aggccagacg ccatcaggct gggcctgggg aaccacaact actgcagaaa cccagatcga 180 gactcaaagc cctggtgcta cgtctttaag gcggggaagt acagctcaga gttctgcagc 240 acccctgcct gctctgaggg aaacagtgac tgctactttg ggaatgggtc agcctaccgt 300 ggcacgcaca gcctcaccga gtcgggtgcc tcctgcctcc cgtggaattc catgatcctg 360 ataggcaagg tttacacagc acagaacccc agtgcccagg cactgggcct gggcaaacat 420 aattactgcc ggaatcctga tggggatgcc aagccctggt gccacgtgct gaagaaccgc 480 aggctgacgt gggagtactg tgatgtgccc tcctgctcca cc 522 <210> 3 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> primer 1 <400> 3 atcggatccc atggccacgt gctacgagga ccag 34 <210> 4 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> primer 2 <400> 4 atcggatcct caggtggagc aggagggcac atc 33 <210> 5 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> primer 3 <400> 5 cagtatcgat cagggccacg tgctacgag 29 <210> 6 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer 4 <400> 6 ctgatctaga gtggagcagg agggcac 27 <210> 7 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer 5 <400> 7 ctgatctaga tcaggtggag caggaggg 28<110> JOE, YOUNG-AE <120> Composition comprising TK1-2 peptide having anti-angiogenic activity and cancer growth inhibitory activity and its use <160> 9 <170> KopatentIn 1.71 <210> 1 <211> 174 <212> PRT <213> Homo sapiens <400> 1 Ala Thr Cys Tyr Glu Asp Gln Gly Ile Ser Tyr Arg Gly Thr Trp Ser 1 5 10 15 Thr Ala Glu Ser Gly Ala Glu Cys Thr Asn Trp Asn Ser Ser Ala Leu 20 25 30 Ala Gln Lys Pro Tyr Ser Gly Arg Arg Pro Asp Ala Ile Arg Leu Gly 35 40 45 Leu Gly Asn His Asn Tyr Cys Arg Asn Pro Asp Arg Asp Ser Lys Pro 50 55 60 Trp Cys Tyr Val Phe Lys Ala Gly Lys Tyr Ser Ser Glu Phe Cys Ser 65 70 75 80 Thr Pro Ala Cys Ser Glu Gly Asn Ser Asp Cys Tyr Phe Gly Asn Gly 85 90 95 Ser Ala Tyr Arg Gly Thr His Ser Leu Thr Glu Ser Gly Ala Ser Cys 100 105 110 Leu Pro Trp Asn Ser Met Ile Leu Ile Gly Lys Val Tyr Thr Ala Gln 115 120 125 Asn Pro Ser Ala Gln Ala Leu Gly Leu Gly Lys His Asn Tyr Cys Arg 130 135 140 Asn Pro Asp Gly Asp Ala Lys Pro Trp Cys His Val Leu Lys Asn Arg 145 150 155 160 Arg Leu Thr Trp Glu Tyr Cys Asp Val Pro Ser Cys Ser Thr 165 170 <210> 2 <211> 522 <212> DNA <213> Homo sapiens <400> 2 gccacgtgct acgaggacca gggcatcagc tacaggggca cgtggagcac agcggagagt 60 ggcgccgagt gcaccaactg gaacagcagc gcgttggccc agaagcccta cagcgggcgg 120 aggccagacg ccatcaggct gggcctgggg aaccacaact actgcagaaa cccagatcga 180 gactcaaagc cctggtgcta cgtctttaag gcggggaagt acagctcaga gttctgcagc 240 acccctgcct gctctgaggg aaacagtgac tgctactttg ggaatgggtc agcctaccgt 300 ggcacgcaca gcctcaccga gtcgggtgcc tcctgcctcc cgtggaattc catgatcctg 360 ataggcaagg tttacacagc acagaacccc agtgcccagg cactgggcct gggcaaacat 420 aattactgcc ggaatcctga tggggatgcc aagccctggt gccacgtgct gaagaaccgc 480 aggctgacgt gggagtactg tgatgtgccc tcctgctcca cc 522 <210> 3 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> primer 1 <400> 3 atcggatccc atggccacgt gctacgagga ccag 34 <210> 4 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> primer 2 <400> 4 atcggatcct caggtggagc aggagggcac atc 33 <210> 5 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> primer 3 <400> 5 cagtatcgat cagggccacg tgctacgag 29 <210> 6 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer 4 <400> 6 ctgatctaga gtggagcagg agggcac 27 <210> 7 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer 5 <400> 7 ctgatctaga tcaggtggag caggaggg 28

Claims

Recombinant protein TK1-2 having the amino acid sequence as set forth in SEQ ID NO: 1 having an inhibitory activity on angiogenesis and cancer, derived from human tissue type plasminogen activator, was selected for rheumatoid arthritis, osteoarthritis, psoriasis, diabetic retinopathy, Pharmaceutical composition for the prevention and treatment of atherosclerosis or cancer disease.

The pharmaceutical composition according to claim 1, wherein the recombinant protein TK1-2 is a recombinant E. coli expression plasmid comprising the nucleotide sequence of SEQ ID NO: 2.

The pharmaceutical composition according to claim 1, wherein the recombinant protein TK1-2 is produced from His-TK1-2 / pPICZα-C and N-TK1-2 / pPICZα-C, which are recombinant yeast expression plasmids comprising the nucleotide sequence of SEQ ID NO: 2 .

PET-15b / TK1-2 which is a recombinant E. coli expression plasmid expressing the TK1-2 protein of claim 1.

E. coli strain transformed with pET-15b / TK1-2 of claim 4, expressing the TK1-2 protein.

His-TK1-2 / pPICZα-C and N-TK1-2 / pPICZα-C, which are recombinant Pichia expression plasmids expressing the TK1-2 protein of claim 1.

Yeast Pichia strain expressing TK1-2 protein transformed with N-TK1-2 / pPICZα-C of claim 6 (Accession No .: KCTC 10415BP).

A method for producing a TK1-2 protein comprising the following steps;

1) preparing E. coli transformed with TK1-2 / pET-15b, an E. coli expression plasmid comprising SEQ ID NO: 2;

2) inducing and expressing protein expression in E. coli;

3) collecting and crushing the cultured Escherichia coli;

4) separating the soluble portion and the non-soluble portion;

5) washing the enclosure

6) passing the non-soluble portion through heat-tack affinity column chromatography;

7) refolding; And

8) obtaining the recombinant protein TK1-2.

delete