JPH11507214A - Heat shock protein members of streptococci belonging to the HSP70 family - Google Patents

Abstract

  (57) [Summary] A novel heat shock protein, Streptococcus agalactiae, a novel heat shock protein of Streptococcus pneumoniae, Streptococcus pyogenes and Streptococcus agalactiae with an apparent molecular weight of 70-72 kilodaltons , S. Nucleotide and deduced amino acid sequence of HSP72 of S. Pneumoniae (SEQ ID NO: 4, SEQ ID NO: 5); Nucleotide and deduced amino acid sequence of HSP70 of S. pyrogenes (SEQ ID NO: 19, SEQ ID NO: 20); Disclosed are nucleotide and deduced amino acid sequences of HSP70 of S. agalactiae (SEQ ID NO: 21, SEQ ID NO: 22), an antibody that binds to HSP, a method for producing HSP and immunologically related polypeptides by recombinant DNA. . The polypeptides, DNA sequences and antibodies of the present invention provide a novel means for diagnosing, preventing and / or treating streptococcal disease.

Description

DETAILED DESCRIPTION OF THE INVENTION         A member of the streptococcal heat shock protein belonging to the HSP70 family                               TECHNICAL FIELD OF THE INVENTION   The present invention relates to Streptococcus pneumoniae. , Streptococcus pyogenes, Streptococcus Novel heat shock protein of Streptococcus agalactiae Quality, and immunologically related polypeptides, for the treatment, prevention, Provides the basis for new immunotherapeutic, prophylactic, and diagnostic agents to aid in diagnosis and diagnosis Things. More specifically, the present invention is a member of the HSP70 family, Streptococcus pneumoniae with an apparent molecular weight of 72 kilodaltons Fever, Streptococcus pyogenes, Streptococcus agalactiae For shock proteins and corresponding nucleotide and derived amino acid sequences To produce HSP70 / HSP72 and polypeptides immunologically related thereto. For antibodies that bind to these HSP families, Streptococcus pneumoniae and related Streptococcus pio Genes caused by bacteria like Streptococcus agalactiae And methods for diagnosing, preventing, and treating the diseases.                                 Background of the Invention   Streptococcus pneumoniae is an important pathogen of human disease and This is especially true in infants, middle-aged and immunocompromised people. It is globally expensive Invasive diseases such as bacteremia / sepsis with morbidity and mortality, pneumonia, and meningitis Is a bacterium that is often isolated from patients suffering from illness. The emergence of antimicrobial drugs is pneumococcal Reduced overall mortality from the disease, but increased resistance to pneumococcal organisms Existence has become a major problem in the world today. An effective pneumococcal vaccine is strept Significant impact on morbidity and mortality associated with Coccus pneumoniae disease Was exerted. Such vaccines are also useful in preventing otitis media in infants and children. May be useful.   It is clear that multiple pneumococcal factors are potentially important in the etiology of the disease [G.J.Boulnois, J.Gen.Microbiol., 138,249-259 (1992) C. J. Lee et al., Crit. Rev. Microbiol., 18, 89-114 (1991)]. Streptococcus pneumoniae Despite lack of toxicity, membrane may not be related to virulence of pneumococcus It is considered. More than 80 pneumococcal caps have the same serotype based on antigenicity differences. Is defined. Antibodies are a defense mechanism, and Streptococcus pneumoniae The importance of anti-capsular antibodies in host defense against niae is well established [R. Austrian, Am. J. Med., 67, 547-549 (1979)]. Also Nevertheless, currently available pneumococcal vaccines contain 23 capsular polysaccharides and are often Cause illness, but lack of immunogenicity of capsular polysaccharides, serotype diversity, And differences in the distribution of serotypes across time, geographic region and age group, Have such important disadvantages. In particular, existing vaccines are small from many serotypes Not enough to protect children is another Streptococcus pneumoniae This will spur the evaluation of the minute. Some pneumococcal proteins protect and disease Increasing evidence indicates that it may play an active role in both [J.C. Paton, Ann. Rev. Microbiol., 47, 89-115 (1993)]. Only So far, only a few Streptococcus pneumoniae proteins Has only been studied. This is due to the lack of protein-specific antibodies And this deficiency is a study of the role of protein antigens in defense and virulence. Making it difficult to study. Pneumococcal protein antigens are not very immunogenic, It is also believed that many antibody responses are to phosphocholine and capsular polysaccharides [L.S. McDaniel et al., J. Exp. Med., 160, 386-397 (1984); R.M. Krause, Adv. Immunol., 12, 1-56 (1970); D.G.Braun et al., J. Exp.Med., 129,809-830 (1969)]. Against carbohydrate antigens and phosphocholine Response to protein antigens is relatively normal. Monoclonal that reacts with pneumococcal protein antigens in studies of autoimmune deficient mice The frequency of obtaining null antibodies is less than 10%, indicating that Streptococcus new Moniae protein is a poor immunogen [McDaniel et al., Supra] It suggests.   Streptococcus agalactiae is also called group B streptococcus (GBS), It is a very common cause of sepsis (blood infection) and meningitis in neonates. GBS It is also often the cause of neonatal pneumonia. Approximately 8,000 babies in the United States suffer GBS disease each year It takes 5% to 15% of these babies to die. Surviving infants, especially those with meningitis Infants have long-term problems such as hearing or visual loss or learning disabilities. May be In pregnant women, GBS is an urinary infection, uterine infection (amniotic membrane) Inflammation, endometritis), and stillbirth. Non-pregnant woman Among people and boys, the most common disease caused by GBS is blood infection , Skin or soft tissue infections, and pneumonia. Boys with GBS disease and pregnancy About 20% of women who do not die from the disease. Newborn and adult GBS Infections are usually treated with intravenous antibiotics (eg, penicillin or ampicillin). ). Many GBS diseases in newborns give antibiotics to certain pregnant women at birth. It can be prevented by intravenous administration. Vaccines to prevent GBS disease open It is being emitted. In the future, women who will be vaccinated will make antibodies that pass through the placenta. Is expected to prevent babies at birth and early infancy.   Streptococcus pyogenes is also called group A streptococcus (GAS), Re-emerging as a cause of serious illness due to increased microbial toxicity since the 1980s . GAS is commonly called "streptococcal throat" pharyngitis, and skin infections (impetigo) Erysipelas / cellulitis). "Streptococcal throat" and impetigo are glomerulonephritis ( Kidney disease). About 3% of “strep throat” infections result in Rheumatic fever (moving arthritis) is caused by chorea (neurological symptoms) and And 50% of cases with endocarditis as a possible long-term result Includes equine heart disease (valvular heart disease). Anti-impetigo and "streptococcal throat" It is important to treat with biomaterials to prevent the development of complications. Toxin producing strain Can be scarlet fever (a widespread rash and fever) or a very severe streptococcal toxin Results in shock syndrome (TSS; GAS has been called 'carnivorous bacteria') The latter, the rapid spread of shock and multiple dysfunctions of the organ system Is the feature. TSS is a vigorous treatment that includes the removal of bacterial infection lesions and antibiotic therapy Nevertheless, it has a mortality rate of 30 to 70%. TSS rates between 10 and 20 per 100,000 In cases is there. No vaccine is currently available for GAS.   Heat shock or stress proteins ("HSPs") are found in nature Is extremely high and one of abundant proteins [F.C. Night hull Neidhardt et al., Ann. Rev. Genet., 18, 295-329 (1984); Lindquist St), Ann. Rev. Biochem. 55, 1151-1191 (1986)]. They are various physiological And produced by all cells that respond to non-physiological stimuli. Sudden warmth The heat shock response of which the increase in degree induces the synthesis of HSPs is the best among the stress responses It was studied. Other environmental conditions such as low pH, iron deficiency, hydrogen peroxide HSPs can be induced. HSPs are defined by their size, hsp90, hsp70, And members of the hsp60 family are found in all prokaryotes and eukaryotes It is one of the major HSPs to be issued. These proteins are associated with protein folding and A variety of chaperone functions by helping to stand and helping to move across membranes Perform [C. Georgopoulos, W.J. Welch, Ann.Rev Cell Biol., 9, 601-634 (1993); Ang et al., J. Biol. Chem. 266, 24233-2. 4236 (1991)]. As a molecular chaperone and possibly through other mechanisms, HSPs appear to be involved in protecting cells from the deleterious effects of stress. how many The fact that some virulence factors are regulated by environmental conditions is a factor in microbial virulence. Suggest a role for HSPs [J.J. Mekalanos, J. Bacterio l., 174, 1-7 (1992); P.J. Murray and R.A. Young J. Bacter iol. 174, 4193-4196 (1992)]. In connection with that, the recent Salmonella species Studies show that stress responses are closely linked to the ability of intracellular pathogens to initiate and sustain infection. [N.A. Buchmeir and F.M. Heflo (Heffron), Science, 248, 730-732 (1990); K.Z. Abshire, F.C. . Neidhardt, J. Bacteriol., 175, 3734-3743 (1993); Fi Finlay et al., Science, 243, 940-943 (1989)]. Others have a list Listerioli, an important virulence factor for L. monocytogenes Gin has been shown to be induced under heat shock conditions [Z. Sokolo vic) and W.C. Goebel, Infect. Immun., 57, 295-298 (1989)].   Evidence is growing that HSP is the major antigen of many pathogens. hsp60 Members of the family have been grossing due to their similarity to the E. coli GroEL protein. These are also called EL-related proteins, and these are leprosy, Mycobacterium tuberculosis [D. Young Proc. Natl. Acad. Sci. USA, 85, 4267-4270 (1988)], Legionella pneumonia Fila (Legionella pneumophila) [B.B. Plikaytis et al., J. Clin. Microbiol., 25, 2080-2084 (1987)], Borrelia Burgdorferi (Po rrelia burgdorferi) [B.J. Luft et al., J. Immunol., 146, 2776-2782 (1 991)], and Chlamydia trachomatis [E.A. Wagar et al., J. Infect. Dis., 162, 922-927 (1990)]. It is a major antigen of various bacterial pathogens. This antigen is a ubiquitous “normal antigen” And are believed to be present in all bacteria [JE Saul ( Thole) et al., Microb. Pathogen., 4, 71-83 (1988)]. hsp70 family members Antibodies, or antibodies against Dnak-related proteins, may also cause some bacterial and parasitic Biological infectious diseases have been described [Young et al., Supra; Luft. Et al., Supra; D.M. Engman et al., J. Immunol., 144, 3987-3991 (199). 0); N.M. Rothstein et al., Molec. Biochem. Parasitol., 33, 229-235 (1989); Nussenzweig and R.S. Nussenz Nuissenzweig, Adv. Immunol., 45, 283-334 (1989)]. HSPs are strong B- And T-cell responses can be elicited from mice inoculated with M. tuberculosis. 20% of CD4 + T-lymphocytes show reactivity to hsp60 protein only [S.H.E. Kaufman et al., Eur. J. Immunol., 17, 351-357 (1987). )]. Similarly, in a collection of 24 monoclonal antibodies against the leprosy protein 7 recognized an antigenic determinant on hsp60 [H.D. Engers et al., Infect.Immu n., 48, 603-605 (1985)]. Immune response to stress proteins responds to infection Seem to play an important role in the defenses of the world. Reaction with microbial HSPs Antibodies and T cells neutralize and neutralize protective activity. . Noll et al., Infect. Immun., 62, 2784-2791 (1994); S.L. Danishion ( Danilition) et al., Infect. Imum., 58, 189-196 (1990)]. Stress protein exemption Epidemiological properties make them attractive as vaccine components, and some HSPs It is currently being considered for the purpose of preventing microbial infection and treating cancer. But At present, Research has shown that mycobacteria, salmonella, chlamydia and some parasites Focuses on important intracellular pathogens. Heat shock proteins in extracellular Gram-positive bacteria Providing information on antigens is much less. Streptococcus pneumonia D, Streptococcus pyogenes and Streptococcus agalactia In d, no heat shock proteins or their gene structures have been identified .                                 Disclosure of the invention   The present invention relates to Streptococcus pneumoniae, Streptococcus pio Novel heat shock proteins from Genes and Streptococcus agalactiae Quality and immunologically related polypeptides to provide It solves the problem. A DNA sequence encoding the polypeptide described above; Vectors containing peptides, unicellular hosts transformed with these vectors, And methods for producing substantially pure recombinant polypeptides are also provided. Above Antibodies specific to the polypeptides of are also provided. Polypeptide of the present invention, DNA Sequences and antibodies are novel methods and pharmaceutical compositions for disease detection, prevention and treatment It provides the basis for things. In particular, the invention relates to those strains specific for streptococcal strains. A novel vaccine based on fragments of a polypeptide is provided.   This novel heat shock protein is approximately 72 kD from Streptococcus pneumoniae aHeat shock protein ("HSP72") (SEQ ID NO: 5), Streptococcus pyogene Nest's approximately 70 kDa heat shock protein ("HSP70") (SEQ ID NO: 20) and streptococcus An approximately 70 kDa heat shock protein ("HSP70") of C. agalactiae (SEQ ID NO: 22) ) Wherein the analogue, homologue, and derivative thereof, and at least one immunogen Includes fragments of the above-described polypeptides containing a sexual epitope. HSP70 / 72 A preferred fragment comprises the C-terminal portion of HSP70 / 72. More specifically, it has a C-terminal 169 -Residue fragment ("C-169") (residues 439-607, SEQ ID NO: 5), C-terminal 151-residue fragment ( “C-151”) (residues 457-607, SEQ ID NO: 5), and a peptide epitope within the C-169 region And smaller fragments of the same. Particularly preferred fragment within the C-169 region of HSP72 Is the peptide sequence GFDAERDAAQAALDD (residues 527-541 of SEQ ID NO: 5) and AEGAQATGN AGDDVV (residues 586-600 of SEQ ID NO: 5), which is a Streptococcus new Moni Exclusive to Ae HSP72. Even more preferred is Streptococcus Pneumoniae, Streptococcus pyogenes and Streptococcus Induces an immune response against A. agalactiae but autoimmunizes human hosts A fragment that does not cause a reaction. Such fragments can be selected from the following peptides Good, i.e. CS870, CS873, CS874, CS875, CS876, CS877, CS878, CS879, CS880, CS882, MAP1, MAP2, MAP3 and MAP4 (see Table 5, above). Preferred antibodies of the invention are F1-Pn3.1, F2-Pn3.2, F2-Pn3.3 and F2-Pn3.4 monoclonals. Lonal antibodies ("MAbs"), which are specific for HSP72. More preferred antibodies are F2-Pn3.2 and F2-Pn3.4 specific for both HSP70 and HSP72.   It is a monoclonal antibody. Even more preferred is Streptococcus new -F1-Pn3.1 antibody specific to Moniae. Preferred polypeptides and antibodies of the present invention are useful for detecting, preventing and treating pneumococcal disease. It provides a basis for new methods and pharmaceutical compositions for therapy.                               Outline description of drawings   Figure 1 shows heat shock to Streptococcus pneumoniae protein synthesis. 4 shows a fluorogram showing the effect of. The cell extract in panel A is a streptocyst of type 6 64 strains It is Coccus pneumoniae. Panel B cell extract was strept 4 type 53 strain It is Coccus pneumoniae. Odd-numbered lane cell extracts were incubated at 37 ° C. Was. Cell extracts in even-numbered lanes were incubated at 45 ° C. for 5 minutes. Cell extract 10 minutes using [35S] methionine (lanes 1, 2 and 7, 8) and 30 minutes (lane 3) , 4 and 9, 10), or 60 minutes (lanes 5, 6). The molecular weight marker is Shown on the left in Rodalton. HSP80, HSP72 and HSP62 are located on each panel. It is indicated by an arrow on the right side.   Figure 2 shows the strikes in the case of (...) and no (-) heat shock. [Lepococcus pneumoniae]³⁵[S] Electromigration of methionine-labeled protein Figure 4 graphically illustrates a comparison of dynamic profiles. The change in concentration is indicated by the label protein band. It was measured by the relative absorbance to the mobility (X-axis). Figure 1, lanes 1 and And Sodium Dodecyl Sulfate (PAGE) PAGE (Polyacrylamide gel electrophoresis) ) Are shown.   Fig. 3 shows a detergent soluble Streptococcus pneumoniae protein extract Streptococcus pneumonia immunoprecipitated by sera from infected mice It is a fluorogram showing a Niae protein antigen. Grown at 37 ° C and cultured at 37 ° C ( Lanes 3, 5, 7, and 9) or heat shocked at 45 ° C (lanes 4, 6, 8, and 9). 10), [Streptococcus pneumoniae]³⁵S] methionine-label The protein was obtained from the serum of mouse 1 (lanes 3 to 6) or mouse 2 (lanes 7 to 10). And then analyzed by SDS-PAGE and fluorography. Was. Serum was collected on the first (lanes 3, 4 and 7, 8) and the second (lanes 5, 6 and Tested after immunization of 9, 10). [³⁵S] methionine-labeled, non-thermal And heat shocked cell lysates of Streptococcus pneumoniae Are shown in lanes 1 and 2, respectively. HSPs location arrow to left of fluorogram Indicated by   Figure 4. Immunized with heat-killed Streptococcus pneumoniae Streptococcus pneumoniae protein immunoprecipitated by mouse serum 7 is a fluorogram showing a quality antigen. Grown at 37 ° C and cultured at 37 ° C (lanes 3, 5 And 7) or heat-shocked at 45 ° C (lanes 4, 6, and 8) Cass Numoniae's [³⁵[S] methionine-labeled protein was obtained from mouse 1 (lane 3,4), using serum from mouse 2 (lanes 5, 6) or mouse 3 (lanes 7, 8) Were immunoprecipitated and then analyzed by SDS-PAGE and fluorography. Serum was tested only after the second immunization. [³⁵S] methionine-labeled, heat Not Shocked-Streptococcus pneumonia also heat shocked Cell lysates from flies are shown in lanes 1 and 2, respectively. The location of HSPs An arrow is shown to the left of the fluorogram.   FIG. 5 shows Streptococcus nidus detected by Western blot analysis. Fig. 2 is a photograph showing a humoniae antigen. Whole cell extracts are heat-sterilized Serum from 15 mice (lanes 1-15) immunized with Tococcus pneumoniae Searched using. Lane 16 is detected by monoclonal antibody (MAb) F1-Pn3.1. 2 shows the released HSP72 protein. In panel A, serum was tested after the second immunization Was. In panel B, 4 out of 15 sera tested after the first immunization Responsiveness It is shown. The positions of the 53.5 kDa- and 47 kDa-protein bands are indicated by bars on the left . The location of HSP72 is indicated by an arrow to the right of each panel.   FIG. 6 is a fluorogram showing the specificity of MAb F1-Pn3.1 for HSP72. heat Not shocked (lanes 1, 3 and 5) or shocked (lanes 2, 4 and 6) Streptococcus pneumoniae [³⁵[S] methionine-labeled protein is Ig2 Immunoprecipitated using a-control MAb (lanes 3, 4) or F1-Pn3.1 (lanes 5, 6) And then analyzed by SDS-PAGE and fluorography. [³⁵S] Onin-labeled and not heat shocked-also heat shocked Streptococcus Cell lysates from C. pneumoniae are shown in lanes 1 and 2, respectively. You. The locations of the HSPs (all three) are indicated by arrows to the left of the fluorogram.   Figure 7, Panel A is an immunoblot showing heat shock and heat shock. Not receive [³⁵S] Methionine-labeled Streptococcus pneumoniae D shows the reaction between the cell extract and MAbF1-Pn3.1. Lane 1 receives heat shock Includes cell lysate (45 ° C). Lane 2 shows the cell lysate (3 7 ° C). Panel B shows the fluorogram of the immunoblot shown in Panel A. It is a thing.   FIG. 8 shows the localization site of the cell fraction of Streptococcus pneumoniae HPS72. This is a western blot. Membrane fractionation of Streptococcus pneumoniae ( The sample containing 15 μg of the protein in lane 1) and the cytoplasmic fraction (lane 2) were analyzed on SDS-PAGE Electrophoresis, transferred to nitrocellulose, and probed using MAb F1-Pn3.1. Searched.   FIG. 9 shows a recombinant containing the C-169 region of Streptococcus pneumoniae HPS72. Fig. 4 is a photograph of an immunoblot showing the reactivity of the fusion protein with MAb F1-Pn3.1. Lane 1 shows streptococcal probed using HSP72-specific MAb F1-Pn3.1. Includes whole cell extracts from 64 S. pneumoniae strains. Lanes 2 and 3 are IPTG (a Cultured in the presence (+) or absence (-) of (sopropyl thiogalactoside) Includes phage lysates from E. coli infected with λJBD17. Lanes 4 and 5 are IPTG Infects λJBD7 cultured in the presence (+) or in the absence (-) of HSP72-specific Includes phage lysate from E. coli probed with MAb F1-Pn3.1. Molecular weight marker Is shown on the left. 74 kDa- and 160 kDa-reactive proteins are shown on the left and right, respectively. Have been.   FIG. 10 shows restriction maps of HSP72 (DnaK) and fucose, and recombinant clones. It is a schematic diagram of the insertion sequence of. Relationships between DNA fragments are shown in relation to each other You. FIGS. 10A and 10C show restriction maps of HSP72 (DnaK) and fucose, respectively. It is. FIG.10B shows various phages and plasmids described in Example 3. Shows the insertion sequence. H (HindIII); E (EcoRI); V (EcoRV); P (PstI); and X (XhoI) are restricted It shows an endonuclease site. Position of DNA fragment on HSP72 / DnaK (■) ; Position of fucose (///); and used as a probe in Southern blot analysis Interruption   FIG. 11 shows SDS-PAGE and Western blot analysis of the recombinant 74 kDa protein. Plasmids pJBD179 (lane 1), pJBDf51 (lanes 2 and 3) and pJBDf62 (lane 1) 4 and 5) in the presence (+) or absence (-) of IPTG Whole cell extract from cultured E. coli was subjected to 10% polyacrylamide gel electrophoresis. Was hung The protein was then co-assembled using the HSP-specific MAb F1-Pn3.1. Visualization was performed by Lou staining (A) or Western blotting (B). Molecular weight The car is shown in kilodaltons to the left. The arrow on the left side of each panel indicates the 74 kDa protein Marks quality markers.   FIG. 12 shows detection of native and recombinant HSP72 antigen by Western blot analysis. It was done. Plasmids pJBDk51 (lanes 1 and 3) and pJBD291 (lanes 2) Whole cell lysate and Streptococcus from E. coli transformed using Cell lysate from S. pneumoniae strain 64 was run on a 10% polyacrylamide gel. It was subjected to electrophoresis and electrotransferred to nitrocellulose. Immunoblot is HSP72-specific Was searched using the unique MAb F1-Pn3.1.   Figures 13A-13D show the open readings of Streptococcus pneumoniae HSP72 Gframe (HSP72 SPNEU) deduced amino acid sequence and HSP70 / DnaK protein as follows 2 shows a comparison with previously reported sequences for ECOLI, E. coli; BORBU, Borrelia burgdorferi (human Lyme disease); BRUOV, Brucella Ovis; CHLPN BACME, giant bacteria; BACSU, Bacillus subtilis; STAAU, S. aureus; L AC LA, lactococci; and MYCTU, M. tuberculosis. Only mismatched amino acids are shown I have. Matched and retained amino acids are boxed and shaded, respectively. It is indicated with a suffix.   FIG. 14 shows recombinant strains purified by affinity chromatography. This is a picture of SDS-PAGE showing P. pneumoniae HSP72 . Suspension fraction from E. coli (pJBDk51) lysate (lane 2) and immunoaffinity-purified 20 µg of HSP72rec (lane 3) was subjected to 10% polyacrylamide gel electrophoresis. Was. The protein was visualized by Coomassie staining. Lane 1 is molecular weight marker (106 kDa, 80 kDa, 49.5 kDa, 32.5 kDa, 27.5 kDa, and 18.5 kDa).   FIG. 15 shows recombinant Streptococcus nucleus purified by solubilization of inclusion bodies. 1 is an SDS-PAGE photograph showing the C. 169 fragment. Various amounts of purified C -169 protein (lane 1, 5 µg; lane 2, 2.5 µg; and lane 3, 1 µg) and Transformed with plasmids pDELTA1 (lane 4) and pJBDΔ1 (lane 5) Whole cell lysate from infected E. coli was subjected to 10% polyacrylamide gel electrophoresis. Was. The protein was then visualized by Coomassie blue staining.   Figure 16 shows that Streptococcus pneumoniae was immunized with HSP72rec. Fig. 4 is a graph showing a survival curve of Balb / c mice protected from Ae infection. Data is Survival (%) over a period of 14 days for a total of 10 mice per experimental group ).   Figure 17 shows Streptococcus pneumoniae by immunization with C-169rec. Fig. 4 is a graph showing a survival curve of Balb / c mice protected from Ae infection. Data is Survival (%) over a period of 14 days for a total of 10 mice per experimental group ).   Figure 18 shows the carboxy-terminal 151 of HSP72 of Streptococcus pneumoniae. Is a map of plasmid pURV3 containing C-151rec, which is a coding region for 12 amino acids ; AmpiR, ampicillin-resistance coding region; ColE1 ori, origin of replication; cI857, Baku Teriophage λ cI857 temperature-sensitive repressor gene; λ PL, bacterio Phage λ transcription promoter; T1, T1 transcription terminator. The direction of transcription is indicated by an arrow It is shown. Bg1II and BamHI are from HS of Streptococcus pneumoniae P72 C Restriction site used to insert the coding region of -151rec.   FIG. 19 shows anti-strep in serum of Balb / c mice immunized with HSP72rec. The distribution of Tococcus pneumoniae titers is shown. 1 μg serum (○) Or collected after 1st, 2nd and 3rd injection with 5μg (●) HSP72rec ELISA for individual anti-streptococcus pneumoniae antibodies Was evaluated. For titers, the A410 value (optical density) is 0.1 above the background value. Defined as some highest dilution. The solid line is the reverse of the antibody titer of each group of mice. The median number is shown, while the dashed line shows the median pre-immune serum.   FIG. 20 shows anti-stress in serum from Balb / c mice immunized with C-169rec. The distribution of Leptococcus pneumoniae titers is shown. 1 μg serum (○ ) Or after 1st, 2nd and 3rd injection with 5μg (●) of C-169rec ELISA for individual anti-streptococcus pneumoniae antibodies Was evaluated. Titer is the highest dilution where the A410 value is 0.1 above background Was defined as The solid line represents the median reciprocal of the antibody titer of each group of mice. The dashed line, on the other hand, shows the median of preimmune serum.   FIG. 21 shows anti-stress in serum from Balb / c mice immunized with C-151rec. The distribution of Leptococcus pneumoniae titers is shown. 1 μg serum (○ ) Or collected after the first, second and third injections with 5 μg (●) of C-151rec And tested individually for anti-Streptococcus pneumoniae antibodies by ELISA. Was evaluated. The titer is based on the highest dilution where the A410 value is 0.1 above the background value. Was defined as The solid line represents the median reciprocal of the antibody titer of each group of mice. On the other hand, the dashed line indicates the median of pre-immune serum.   FIG. 22 shows the immunity of cynomolgus monkey immunized with recombinant HSP72 antigen. 2 shows body response. Two monkey groups use HSP72rec or C-169rec protein Immunized on days 1, 22, and 77. Serum regularly during immunization Collected and analyzed by Western blot analysis for antibodies specific for pneumococcal HSP72. Was assessed individually. Titer is defined as the highest dilution at which the HSP72 band is visualized Justified.   FIG. 23 shows the binding of hyperimmune sera to peptides in a solid phase ELISA. HSP72re Rabbit, mouse and monkey serum immunized with c or C-169rec protein Was tested for reactivity to the peptide. 1: obtained using serum diluted 1000 Reactivity of rabbit serum to peptide MAP2 and to peptide MAP2 and MAP4 Serum tested at a 1: 100 dilution, except for the absorbance corresponding to the reactivity of the murine serum Obtained using   Figure 24 shows Streptococcus pneumoniae (spn-orf), Streptococcus ・ Piogenes (sga-orf) and Streptococcus agalactiae (sgb-orf) hsp70 / dnak Consensus established from the DNA sequence of the open reading frame Sustain sequences are shown, with nucleotide replacement and insertion sequences specific to each species .   Figure 25 shows Streptococcus pneumoniae (spn-prot), Streptococcus S. pyogenes (sga-prot) and Streptococcus agalactiae (sgb-prot) t) shows the consensus sequence established from the protein sequence of Hsp70, Shows amino acid substitution and insertion sequences specific to.   Figure 26 shows the heat shock of Streptococcus agalactiae protein synthesis. Of Streptococcus agar immunoprecipitated by MAb F2-Pn3.4 4 is a florogram showing Lactiae protein antigen. Grown at 37 ° C and cultured at 37 ° C (Odd-numbered lanes) or heat-shocked at 43 ° C (even-numbered lanes) [Streptococcus agalactiae]³⁵S] methionine-labeled protein? The resulting cell lysates were analyzed by SDS-PAGE and fluorography. Lanes 3 and 4 show immunoprecipitates obtained using MAb F2-Pn3.4.                             Detailed description of the invention   One embodiment of the present invention relates to Streptococcus pneumoniae, Streptococcus. Novel heat shock in S. pyogenes and Streptococcus agalactiae Proteins, analogs, homologues, derivatives and at least one immunogenic epitome A fragment containing the loop. As used herein, “heat shock protein” refers to heat shock protein. A naturally occurring protein that indicates preferential transcription under tress conditions. The present invention Heat shock proteins may be of natural origin, or May be obtained by applying the chemical synthesis technology of the above.   As used herein, “immunogenic” refers to the ability to elicit an immune response. means. The novel heat shock proteins of the present invention are more specific against streptococcal infection. Or deadly Streptococcus pneumoniae Protective immune response against Ogenes and Streptococcus agalactiae Characterized by their ability to elicit answers.   The invention is particularly directed to about 72 kDa ("HSP72") having the deduced amino acid sequence of SEQ ID NO: 5. Streptococcus pneumoniae heat shock proteins, and analogs, homologs Body, derivative and fragments thereof comprising at least one immunogenic epitope Is what you do. As used herein, the term "analog" of HSP72 refers to the mechanism of the analog protein. Amino acid sequence of HSP72, provided that the ability and immunogenic properties are retained as a whole. One or more amino acid residues in the sequence (SEQ ID NO: 5) Refers to the Streptococcus pneumoniae protein being replaced You. Such analogs may be naturally occurring or synthetic. Or by recombinant DNA technology, e.g., A mutagenesis technique may be used. Analogs of HSP72 include HSP72, e.g., streptococcal. Antibodies that react with Cas pyogenes and Streptococcus agalactiae Will have at least one antigen capable of inducing a.   As used herein, the "homolog" of HSP72 is Streptococcus pneumoniae. Fly, Streptococcus pyogenes or Streptococcus agalacti A protein derived from a streptococcal species other than fly or a genus other than streptococci, One or more amino acid residues in the amino acid sequence of SEQ ID NO: 5 (SEQ ID NO: 5) Replaced by amino acid residues, and the function and immunogenic properties of homologous What is held as a body. Such congeners are naturally occurring Or can be made synthetically, and can be used in recombinant DNA technology. It may be. HSP72 homologues include HSP72, such as Enterococcus faecalis Will have at least one antigen capable of eliciting antibodies that react with the antigen.   As used herein, "derivative" refers to one or more physical, chemical, or Or a polypeptide whose biological properties have been altered. That Such changes can be amino acid substitutions, modifications, additions or deletions; Or alteration of the phosphorylation pattern; of amino acid residues present in the polypeptide Other organic or non-organic, free amino, carboxyl, or hydroxy side groups Reaction with molecules; both of which can lead to changes in primary, secondary or tertiary structure Including but not limited to other possible changes.   A "fragment" of the invention has at least one immunogenic epitope. “Immunity By "genic epitope" is meant an epitope that serves to elicit an immune response. A preferred fragment of the invention is an infection, for example a Streptococcus pneumoniae infection It will elicit an immune response sufficient to prevent or mitigate the severity. HSP72 good Preferred fragments include the C-terminal region of the polypeptide. More preferred fragments are C-terminal 169-residue fragment ("C-169") (SEQ ID NO: 5, residues 439-607), C-terminal 151-residue ( “C-15”) (SEQ ID NO: 5, residues 457-607) and peptide epitopes within the C-169 region And smaller fragments of the same. Particularly preferred within the C-169 region of HSP72 The fragment consists of the peptide sequence GFDAERAAQAALDD (residues 527-541 of SEQ ID NO: 5) and AEGA QATGNAGDDVV (residues 586-600 of SEQ ID NO: 5), these are Streptococcus ni Exclusive to Hmoniae HSP72 or Streptococcus pyogene Or the corresponding denatured fragment from Streptococcus agalactiae. Even more preferred are fragments that elicit a specific immune response against a streptococcal strain. is there. Such fragments may be selected from the following peptides: CS870, CS873, CS874 , CS875, CS876, CS877, CS878, CS879, CS880, CS882, MAP1, MAP2, MAP3, and And MAP4 (see Table 5, above), or homologs thereof.   In a further aspect of the invention, we provide a polypeptide immunologically related to HSP70 / 72. Provide the peptide. As used herein, an "immunologically related" polypeptide is , Characterized by one or more of the following properties:   a) Infection of a mammalian host with Streptococcus pneumoniae cells Reacts immunologically with the antibodies produced, the antibodies being HSP72 (SEQ ID NO: 5) and HSP70 Reacts immunologically with (SEQ ID NO: 20 and SEQ ID NO: 22);   b) Immunology with HSP72 (SEQ ID NO: 5) and HSP70 (SEQ ID NO: 20 and SEQ ID NO: 22) Has the ability to elicit a reactive antibody;   c) Antibodies against antibodies elicited by immunization of mammals with HSP72 (SEQ ID NO: 5) React epidemiologically.   Analogs, homologs and derivatives of HSP70 / 72 are, by definition, immunologically related Polypeptide. In addition, all immunologically relevant polypeptides Contains at least one HSP70 / 72 antigen. Therefore, “HSP70 / 72 antigen” is HSP70 / 72 antigen. 72 May be found on its own or in immunologically related polypeptides is there.   In a further aspect of the present invention, a polypeptide immunologically related to HSP72 is provided. Offer. As used herein, an “immunologically related” polypeptide has the following properties: One characterized by one or more of the qualities;   a) Infection of a mammalian host with Streptococcus pneumoniae cells Reacts immunologically with the antibody produced, which immunologically reacts with HSP72 (SEQ ID NO: 5). react;   b) has the ability to elicit antibodies immunologically reactive with HSP72 (SEQ ID NO: 5);   c) Antibodies against antibodies elicited by immunization of mammals with HSP72 (SEQ ID NO: 5) React epidemiologically.   Analogs, homologs and derivatives of HSP72 are, by definition, immunologically relevant It is a repeptide. In addition, at least all immunologically relevant polypeptides Also contains one HSP72 antigen. Therefore, "HSP72 antigen" is HSP72 itself, May be found in immunologically related polypeptides.   As used herein, “related bacteria” refers to the ability to elicit antibodies that react with HSP72. Bacteria having potent antigens. Examples of related bacteria include Streptococcus Pneumoniae, Streptococcus pyogenes, Streptococcus Mutans, Streptococcus sanguis, Streptococcus agara Including Kuchiae and Enterococcus faecalis.   By following the embodiments of the present invention, those skilled in the art will recognize certain analogs, homologs, Derivatives, immunologically relevant polypeptides, or fragments can be used to diagnose, prevent, Understand that it can be useful for treatment Will be done. Useful polypeptides and fragments are immunoreactive with HSP72 (Example 4). Will elicit a responsive antibody. Preferably, useful polypeptides and fragments Fragments may demonstrate the ability to elicit a protective immune response against lethal bacterial infection (Example 5).   Polymerized forms of the polypeptides of the present invention are also included. These polymerization types are, for example, Crosslinking assays such as biotin, glutaraldehyde or dimethylsuberimidate Includes one or more polypeptides cross-linked by a drug. Such polymerization type Also resulted from multicistronic mRNAs made by recombinant DNA technology, Polypeptides containing one or more tandem or inverted contiguous protein sequences , Are also contained.   The present invention provides substantially pure HSP72 and immunologically related polypeptides I do. The phrase “substantially pure” refers to polypeptides of the invention and their meaning. That the encoding DNA sequence is substantially free of other proteins of bacterial origin. means. Substantially pure protein samples can be prepared by various conventional methods, for example, Example 3 And may be obtained by the procedure described in 5.   In one aspect, the invention provides, for the first time, Streptococcus pneumoniae. DNA sequence encoding the heat shock protein of D, specifically, HSP72 (SEQ ID NO: 4, Nucleotides 682-2502).   The DNA sequences of the present invention also encode HSP72 analogs and homolog polypeptides. DNA sequence, DNA encoding an immunologically related polypeptide, and the above-described DN DNA sequences that are degenerate for any of the A sequences and all of the above DNA sequences Including fragments. One skilled in the art will appreciate that once a polypeptide has been identified and separated, The DNA sequence of all polypeptides of the present invention can be determined using conventional DNA sequencing techniques. It will be easily recognized that it will.   Oligonucleotides derived from genes encoding polypeptides of the invention Primers and other nucleic acid probes are also available from Streptococcus pneumoniae. Used to isolate and clone other related proteins from flies and related bacteria This related bacterium also includes a range of DNA bacteria that are homologous to the DNA sequences of the present invention. Is also good. In addition, the DNA sequences of the present invention may be used in PCR reactions to It may be used to detect the presence of C. pneumoniae or related bacteria.   Polypeptides of the invention can be used, for example, in ion exchange and gel chromatography. And using conventional separation techniques such as electrophoresis, or using recombinant DNA technology It can be prepared from various methods by protein fractionation from appropriate cell extracts. No. Use of recombinant DNA technology to prepare substantially pure polypeptides according to the invention Especially suitable for doing.   Further forms of the invention include HSP72, immunologically related polypeptides, and A method for producing a fragment of This involves (1) encoding the polypeptide or fragment described above. The DNA sequence to be loaded, and one or more sources operatively linked to the DNA sequence. Culturing a unicellular host microorganism transformed with a vector containing the current control sequence, (2 ) Recovering a substantially pure polypeptide or fragment.   As is well known in the art, the high level of DNA-infected genes in the host To obtain Bell expression, the gene must be transcribed to function in the chosen expression host. And it must be operatively linked to an expression control sequence for translation. Preferably, The expression control sequence and the gene in question are contained in one expression vector, Will also contain one bacterial selectable marker and an origin of replication. If expression host If the is a eukaryotic cell, the expression vector is also available in a eukaryotic expression host. It should include an effective expression marker.   The DNA sequence encoding the polypeptide of the invention may encode a signal sequence. You may not. If the expression host is eukaryotic, the mature protein will be It is generally preferred that the signal sequence be encoded for secretion.   The amino-terminal methionine may be present on the expressed polypeptide of the invention. It is not necessary. If the terminal methionine is not cut off by the expression host, It may be removed chemically, if desired, by standard techniques.   In expressing the DNA sequences of the present invention, a wide variety of hosts / vectors are available. Combinations may be used. Useful expression vectors for eukaryotic hosts are, for example, SV40 Vector containing expression control sequences from (simian vacuole virus), bovine papilloma virus , Adenovirus, adeno-associated virus, cytomegalovirus, and Including Torovirus. Useful expression vectors for bacterial hosts include pBluescript, p Large, including GEX2T, pUC vector, col E1, pCR1, pBR322, pMB9, and derivatives thereof Bacterial plasmids such as those from Enterobacteriaceae, RP4, phage DNAs, e.g. Page Numerous derivatives of lambda, for example λgt10 and λgt11, wider such as NM989 Other DNA plasmids such as host-range plasmids, M13 and filamentous single-stranded DNA phage Page, including Useful expression vectors for yeast cells include 2μ plasmid and Including its derivatives. Useful vectors for insect cells include pVL941.   In addition, any of a wide variety of expression control sequences will express a DNA sequence of the present invention. For use in these vectors. Useful expression control sequences are described above in Expression Vectors. And expression control sequences associated with the structural genes of the vector. . Useful expression control sequences Examples are, for example, the early and late promoters of SV40 or adenovirus, la Major operators and pros of c, trp, TAC or TRC, lambda phage Motor region T3 and T7 promoters, fd coat protein control region, Sphoglycerate kinase or other glycolytic enzyme promoter, acid phosphatase Promoters such as Pho5, yeast alpha-mating promoter, and Control the expression of genes in prokaryotic or eukaryotic cells or their viruses. And other constitutive and inducible promoter sequences, and their variety Including combinations. T7 RNA polymerase promoter Φ10 is used for E. coli HSP72 It is particularly useful for the expression of (Example 3).   Host cells transformed with the aforementioned vectors are a further aspect of the present invention. Extensive A variety of single cell host cells are useful for expressing the DNA sequences of the present invention. These inns The Lord may include well-known eukaryotic and prokaryotic hosts, such as E. coli, Pseudomonas, Bacillus, Streptomyces, Mold, Yeast strain, Spodoptera Insect cells such as Frugiperda (SF9), animal cells such as CHO and mouse cells African green monkey cells such as COS 1, COS 1, COS 7, BSC 1, BSC 40, and BMT 10. Vesicles, human cells, plant cells in tissue culture, etc. More preferred host organisms are E. coli and Bacteria, such as Bacillus subtilis, and mammalian cells in tissue culture.   Not all vectors and expression control sequences are required to express the DNA sequence of the present invention. It must of course be understood that it does not work well. Same expression system Does not work equally well with all hosts. However, It is understood by those skilled in the art that, without undue experimentation and without departing from the scope of the invention, Vector, expression control sequences and host will be selected. example Ba In selecting a vector, it is important to note that the host must be considered. Because they must replicate in the host. Vector copy number, copy Coded by the ability to control the number of cells and vectors such as antibiotic markers The expression of all other proteins performed must also be considered. Expression control sequence A variety of factors must also be considered in choosing. these For example, regarding the relative strength of the sequence, its ability to control, especially potential secondary structure And homology with the DNA sequence of the present invention. The unicellular host is the selected vector And the toxicity of the product encoded by the DNA sequence of the present invention. Lactation properties, its ability to correctly fold proteins, its fermentation or culture conditions, and the book The ease of purifying the product encoded by the invention from the host. I have to. Within these parameters, those skilled in the art will be able to Various vectors / expression systems expressing the DNA sequence of the present invention in large-scale animal rearing A sequence / host combination could be chosen.   The polypeptide encoded by the DNA sequence of the present invention can be used for fermentation or cell culture. And purified using any of a variety of conventional methods, including: High-performance liquid chromatography, high-performance protein liquid chromatography, etc. Normal or reversed phase liquid chromatography such as; affinity chromatography Fees (such as with inorganic ligands or monoclonal antibodies); Chromatograph; immobilized metal chelate chromatography; gel electrophoresis; And so on. Those skilled in the art will appreciate that the most appropriate separation and purification can be made without departing from the scope of the invention. You could choose the technology.   In addition, the polypeptides of the present invention can be made by any of several chemical techniques. You may. For example, they were originally from Merrifield, "Solid Phase Peptide Synthesis. I. Synthesis of Tetrapeptide ”(J. Am. Chem. Soc. , 83, 2149-54 (1963)) Or they may be synthesized in solution using the solid phase synthesis techniques described above. It may be prepared by synthesis. Gross, Minehofer for an overview of peptide synthesis technology , 4 peptides; analysis, synthesis, biology; Technology, John Wiley and Sons (1981) and Bodansky, The principle of peptide synthesis is described in Springer Verlag (1984).   Preferred compositions and methods of the invention include polypeptides with enhanced immunogenicity. Such a polypeptide may be in its native form or a polypeptide thereof. Fragment is modified or treated to enhance immunogenicity in the intended receptor. It may be a digit. Preferred polypeptides are the C-terminal of the native polypeptide Fragments specific to streptococcal species, such as fragments selected from parts. Numerous technologies Can be used and are well known to those skilled in the art, the techniques of which are disclosed herein. Undue experimentation to substantially enhance the immunogenicity of a given polypeptide Will be used without. For example, the polypeptide may be a dinitrophenyl group or an arsani By binding to carboxylic acid (p-aminobenzenearsonic acid) or by heat and And / or denaturation with SDS (sodium dodecyl sulfate). Especially if the peptides are small polypeptides that are chemically synthesized. It may be desirable to couple to an immunogenic carrier. Of course, binding can be Or any of the carriers must not interfere with the ability to function properly. Combination strategy For a discussion on antibodies, laboratory manuals, Cold Spring Harbor See Laboratory, Harlow, Lane (1988). Useful immunogenic carriers are technically well known. An example of such a carrier is Keyhole Rimpet Hemsia Nin (KLH); albumin such as bovine serum albumin (BSA) and ovalbumin , PPD (purified protein derivative of tuberculin); red blood cells; tetanus toxoid; Agarose beads; containing activated carbon or bentonite.   To alter the lipidation state, the amino acid sequence of the polypeptides disclosed herein Modifications used to enhance their immunogenicity and biochemical properties But also. For example, a polypeptide or fragment thereof may be a sequence that directs the addition of a lipid moiety. It may be expressed with or without a signal sequence.   In the present invention, in vitro manipulation of DNA encoding a natural polypeptide and its By subsequent expression of the modified DNA, or by chemical synthesis of the derived DNA sequence, or By various methods, including, but not limited to, chemical or biological manipulation of amino acid sequences. Thus, a derivative of the polypeptide may be prepared.   For example, a derivative refers to one or more amino acids that differ from a naturally occurring amino acid. , An amino acid derivative, an unnatural amino acid, If conservative substitutions are preferred, e.g., 3-methylhistidine instead of histidine Substituted for 4-hydroxyproline in place of proline and in place of lysine. Hydroxylysine may be substituted. Causing poorly conserved amino acid substitutions Altering, for example, charge, conformation, and other biological properties Can also produce desirable derivatives. Such a substitution is, for example, Substitution of a hydrophilic residue for a hydrophobic residue, cysteine for another residue Is the substitution of proline for the substitution of residues with small side chains instead of residues with large side chains. Substitution, or substitution of a residue with a net positive charge in place of a residue with a net negative charge, Will be included. If you are uncertain about the outcome of a given replacement, open it here. Facilitate the derivative to determine the presence or absence of the desired property according to the indicated method Could be tested.   Polypeptides may also increase stability or adapt the molecule by purification and preparation. It may be prepared with a purpose to make it easier to see. One such technology is Another Streptococcus pneumoniae or non-Streptococcus pneumoniae Expression of the polypeptide as a fusion protein containing the sequence of M. moniae. You. The fusion protein containing the polypeptide of the present invention may be, for example, a nucleus encoding the fusion. An acid molecule is assembled and a host cell is transformed with the molecule, and the cell transforms the fusion protein. By inducing expression and recovering the fusion protein from cell culture, Preferably, it is made at the DNA level. On the other hand, fusion proteins are It may be created by gene expression. Examples of the fusion protein of the present invention are described in Example 3 below. FucI / HSP72 (C-169) protein.   The polypeptides of the present invention may also be part of a large multiple binding molecule, It may be made recombinantly or synthesized chemically. like that The multiconjugate also comprises a fusion polypeptide or comprises lipids and carbohydrates, You may couple | bond with parts other than an amino acid.   The polypeptides of the present invention may be used for the production of antibodies and for the development of a protective response to disease. Especially well suited. Thus, in another aspect of the invention, HSP72 and immunologically A reactive antibody, or fragment thereof, is provided. Antibodies of the invention may be HSP72 or Immunization-induced or HSP7 with epidemiologically relevant polypeptides 2 also Are identified by their reactivity with immunologically relevant polypeptides. The present invention The body responds to infections caused by naturally occurring Streptococcus pneumoniae. Antibodies that were successfully induced in the animal, and were removed from the animal in which it was induced. Must not be understood to contain or have altered antibodies in animals .   The antibodies of the present invention are known in the art as F (v), Fab, Fab 'and F (ab') 2. Complete immunoglobulin or fragment thereof, including the complete antigen-binding site, including fragments It may be a piece. Antibodies can also be genetically designed or made synthetically. May be performed. Antibodies or fragments may be of animal origin, specifically mammalian origin, or Physically, it may be of mouse, rat, monkey, or human origin. It is natural It may be an antibody or fragment, or if desired, a recombinant antibody or fragment. The antibody or antibody fragment may be polyclonal, or preferably, monoclonal. The source may be. Although they may be specific for multiple epitopes, Preferably, it is specific for one epitope. Specifically preferred are: The monoclonal antibody of Example 2 below, F1-Pn3. 1, F2-Pn3. 2, F2-Pn3. 3 and F2-Pn3 . 4 One of skill in the art would be able to use the polypeptides of the present invention to immunize delicate animals. Streptococcus pneumoniae, Streptococcus pneumoniae Cas pyogenes, Streptococcus agalactiae or other Streptococcus One could screen for its ability to defend against infection by strep bacteria. Once a monoclonal antibody is found to protect, then The particular epitope recognized by the antibody could be identified. Polycloth Methods for making internal and monoclonal antibodies are well known to those skilled in the art. Such methods are described in antibodies, laboratory manuals, supra, and Ann, Ann. Rev. ofBiochem. , 50, 657-80 (1981). The polypeptide of the present invention Measurements of immunoreactivity used include immunoblot assays and ELISA It may be done by any of several methods well known in the art.   The antibodies of the present invention may be derived from different species (eg, mouse and human) or of the same species. Hybrids formed from immunoglobulins from parts of the globulin light and heavy chain sequences It may be a molecule. It can be provided by any one of a number of techniques known to those skilled in the art. It may be a molecule having multiple binding specificities, such as a bifunctional antibody prepared by The techniques include; production of hybrid hybridomas; disulfide exchange; Bridge; addition of peptide cross-linking agent between two monoclonal antibodies; two sets for a particular cell line Introduction of heavy and light chain immunoglobulins of the The antibodies of the present invention can also Human severe combined immunodeficiency mouse or "human" antibody production by dead human cells Human immunoglobulins cloned or cloned by other non-human animals capable It may be a human monoclonal antibody produced by gene expression. Required However, those skilled in the art will appreciate from the disclosure of the present invention to the stability of a given antibody molecule. Or methods to increase or decrease the half-life, immunogenicity, toxicity, affinity, or yield. Modify the biological properties of the antibody of the invention or make it more suitable for a particular application. Various methods used to change in some other direction to make it suitable Will be available.   The polypeptides, DNA sequences and antibodies of the present invention have been used for the prevention, treatment and diagnosis of disease. Useful for prophylactic, therapeutic and diagnostic compositions.   Standard immunological techniques utilize the polypeptides and antibodies of the present invention as immunogens and They may be utilized for use as vaccines. In particular, what is a suitable host Injection of a pharmaceutically effective amount of the polypeptide into a monoclonal or polyvalent It may generate antibodies or induce the development of an immunological defense response against the disease. No. Preferably, the polypeptide is HSP72 (SEQ ID NO: 5), HSP70 (SEQ ID NO: 20) And SEQ ID NO: 22) or fragments thereof.   As used herein, a “pharmaceutically effective amount” of a polypeptide or antibody is defined as the amount administered to a patient. Prevent or reduce the severity of streptococci or related bacteria when given To elicit an effective immune response.   Administration of the polypeptide or antibody of the present invention can be performed by the method described in Example 10 below. , Or by various other standard techniques It may be. For a detailed discussion of this technology, see Antibodies, Laboratory Manuals, Codes See Ludo Spring Harbor Laboratory, Harlow, Lane (1988). if If a polypeptide is used, preferably a complete or incomplete Freundian Adjuvant, RIBI (Muramil dipeptide) or ISCOM (immunostimulating complex) Will be administered with such a pharmaceutically acceptable adjuvant. Preferably, Its composition is water-in-oil emulsion or aluminum hydroxide as adjuvant And will be administered intramuscularly. The vaccine composition may be administered at one time or during the treatment period. It may be administered to a patient. The most effective dosing and dosing regimen will determine the immunogenicity Bell, its composition and / or adjuvant used for treatment, presumed The severity and course of the infection, previous therapies, the patient's health and response to immunization, And the judgment of the treating physician. For example, in immunocompetent patients , The higher the polypeptide's immunogenicity, the higher the dosage and number of immunizations required Lower. Similarly, if the polypeptide is administered with an adjuvant, The amount and required treatment time will be reduced.   In general, dosing should be with HSP72 antigen per patient, approx. 01 to 10 mg, and preferably Is 0. 1 to 1. 0 mg, most likely with an adjuvant, followed by an initial injection Usually will consist of one or more booster doses. Preferably, Booster dosing will be given 1 and 6 months after the first injection.   Any of the polypeptides of the present invention may be used in the form of a pharmaceutically acceptable salt. No. Suitable acids and bases capable of forming salts with the polypeptides of the present invention will be apparent to those skilled in the art. It is well known and includes inorganic and organic acids and bases.   The polypeptides and antibodies of the present invention can be used for Streptococcus pneumoniae or the like. Or its ability to defend against diseases caused by To screen for its ability to reduce the severe symptoms of infection, such as One skilled in the art will recognize that a number of animal models are used. Strike Any animal susceptible to infection with Leptococcus pneumoniae or related bacteria All may be used. Balb / c mice of Example 5 below have active immune protection This is a desirable animal model for screening. All mice are a desirable animal model for passive screening. Thus, By administering certain polypeptides or antibodies to these animal models, Thus, one of skill in the art would appreciate that polypeptides or antibodies may be claimed without undue experimentation. A range of methods and compositions could be determined to be useful.   In one aspect of the invention, a pharmaceutically effective amount of any of the polypeptides of the invention To prevent or severe infection of streptococci or related bacteria with vaccines containing A multi-step method of treating a patient in a manner sufficient to alleviate the condition for a period of time I will provide a. Also, a preferred polypeptide for use in such a method is HSP70 / 7 2, or a fragment thereof.   The polypeptides, DNA sequences and antibodies of the present invention also provide a basis for diagnostic methods and diseases. A kit for detecting protomicrobes can be formed. Several diagnostic methods are possible. For example, a book The invention relates to Streptococcus pneumoniae, Streptococcus pneumoniae in a biological sample. Detect S. pyogenes, Streptococcus agalactiae or related bacteria Provide a way to   Isolating a biological sample from the patient;   Incubating the antibody or fragment thereof of the present invention with a biological sample to form a mixture:   ・ Streptococcus pneumoniae, Streptococcus pyogenes, Features in the mixture that indicate the presence of Streptococcus agalactiae or related bacteria Detecting the differentially bound antibody or fragment. Use in this way Preferred antibodies for use are monoclonal antibody F1-Pn3. 1, F2-Pn3. 2, F2-Pn3 . 3 and F-Pn 3. Including 4.   On the other hand, the present invention relates to Streptococcus pneumoniae or related Provide a method for detecting bacteria,   Separating the biological sample from the patient;   ・ Culture the polypeptide of the present invention or a fragment thereof with a biological sample to form a mixture Do;   ・ Presence of antibodies specific for Streptococcus pneumoniae or related bacteria Detecting specifically bound polypeptides in a mixture showing ing. HSP72 (SEQ ID NO: 5), its C-169 fragment (residues 439-607 of SEQ ID NO: 5), C-151 fragment (residues 457-607 of SEQ ID NO: 5) and peptide fragment GFDAERDAAQAALDD (Residues 527-541 of SEQ ID NO: 5) and AEGAQATGNAGDDVV (residues 586- 600) is a preferred polypeptide for antibody detection in the above method.   Those skilled in the art will recognize this diagnostic test as enzyme-linked immunosorbent assay (ELISA), It may take several forms, including a radioimmunoassay or a latex agglutination assay. You can see.   The diagnostic agent may be included in a kit, which contains instructions for use and appropriate Reagents, preferably means for detecting when the peptide or antibody is bound, May be included. For example, if the polypeptide or antibody binds to the antibody Detection of polypeptides or antibodies against Streptococcus pneumoniae Detection means that allow for the detection of antibodies when bound to flies or related bacteria. May be labeled. Detection means are fluorescein isocyanate (FIC), Fluorescent labeling reagents, such as fluorescein isothiocyanate (FITC), hoses Enzymes such as radish peroxidase (HRP) and glucose oxidase, γ Radiate lines¹²⁵I or⁵¹Radioactive elements such as Cr or present in test solutions Emits positrons that produce gamma rays when encountering¹¹C,^FifteenO, or¹³N Such a radioactive element may be used. The binding can also be, for example, avidin-biotin complex It may be detected by other methods such as through the body. The combination of detection means is technically well known. For example, monoclonal antibodies made by hybridomas Body molecules are metabolically labeled in the medium by incorporation of radioactive element-containing amino acids. The polypeptide may be linked or linked to the detection means via an active functional group. You may.   The DNA sequence of the present invention may be a strain of Streptococcus pneumoniae or related bacteria. Used to design DNA probes for use in detecting the presence of Probe of the present invention The base detection method is   Separating the biological sample from the patient;   -A DNA probe having the DNA sequence of the present invention is cultured with a biological sample to form a mixture. Then;   In mixtures indicating the presence of Streptococcus pneumoniae or related bacteria And the step of detecting specifically bound DNA probes.   The DNA probe of the present invention can also be used for Streptococcus pneumoniae or related proteins. As a method for diagnosing streptomycetes, for example, using the polymerase chain reaction, It may also be used to detect circulating nucleic acids. Probes can be synthesized using conventional techniques Or may be immobilized in a solid phase or labeled with a detectable label. No. A preferred DNA probe for this use is HSP72 (SEQ ID NO: 4, nucleotide 68 2-2502) has a sequence complementary to at least about 6 adjacent nucleotides. Oligomer.   The polypeptides of the present invention may also be used for immunoaffinity purification of antibodies on, for example, antigen columns. Can be used to purify antibodies directed against epitopes present on proteins. No.   The antibody or antibody fragment of the present invention can be used, for example, for immunoaffinity purification of the antibody on an antigen column. The method may be used to prepare a substantially pure protein according to the present invention. .           Example   The following examples are provided to better illustrate the present invention. These examples are illustrative For purposes only and should not be construed as limiting the scope of the invention in any way. Absent.   Example 1 describes the identification of HSP72, an immunoreactive heat shock protein according to the invention. ing.   Example 2 describes the isolation of monoclonal antibodies against the epitope of HSP72 . Example 3 describes the preparation of recombinant HSP72 and fragments of HSP72 according to the invention. Example 4 describes the antigenic specificity and immunoreactivity of a monoclonal antibody directed against HSP72, and And the identification of immunologically relevant proteins according to the invention. Example 5 Methods for preparing qualitatively pure HSP72, and experimental Streptococcus -Describe the use of HSP72 or antibodies against it to protect against Moniae infection I have. Example 6 describes the preparation of a recombinant C-151 fragment of HSP72 according to the invention. Real Example 7 shows the results of immunization using the recombinant HSP72 or HSP72 fragment according to the present invention. Humoral immune response. Example 8 shows linear B-cell epitopes on HSP72. States the location of the Example 9 shows Streptococcus agalactiae Hsp70 gene and HSP70 protein from Streptococcus pyogenes Has been stated. Example 10 describes the use of the HSP72 antigen in a human vaccine. Example 1Immunoreactive Streptococcus pneumoniae heat shock protein Identification     A.procedure   Unless otherwise noted, the following procedures shall be used throughout the embodiments of the present invention. 1．Bacteria   Streptococcus pneumoniae strain is Supplied by Quud Quebec, Sainte Anne de Bellevue. Streptococcus S. pneumoniae strains included 53 strains of type 4 and 64 strains of type 6. Places not specifically noted In this case, 64 strains of Streptococcus pneumoniae type 6 were used. 37 bacterial strains overnight ℃, 5% CO_TwoGrown on medium chocolate agar plates. 2．Antigen preparation   Various Streptococcus pneumoniae antigens are used for immunization and immunoassays Prepared for Heat-killed whole cell antigen is obtained by applying bacterial suspension to a water bath at 56 ° C for 20 minutes. It was obtained by interculturing. Detergent-Soluble protein is Streptococcus pneumonia D. Heat-sterilized bacteria extracted as follows from 10 mM Hepes buffer -(4- (2-hydroxyethyl) -1-piperazinoethane-sulfonic acid) (base Ringer Mannheim, Germany) Suspended at pH 7.4, 4 times at 20,000 Kz / s for 30 seconds, exceeding Sonicated. Complete cells and large debris are removed by centrifugation at 1,700 g for 20 minutes. I left. The suspension was collected and centrifuged at 100,000 g for 60 minutes. 1 ml pellet Suspend in Hepes buffer, 1 ml of 2% N-lauroyl sarcosine (Sigma (St. Louis, Montana). The mixture is incubated for 30 minutes at room temperature, detergent is available The lysate was obtained by centrifugation at 100,000 g for 60 minutes. 3．Heat shock temperature   Streptococcus pneumoniae (type 4 53 strain and type 6 64 strain) is methionine In Eagle's minimum essential medium lacking (ICN Biochemicals, Costa Mesa, Canada) Resuspend, supplement with 1% BIO-XR (Kelab Laboratories, Montreal, Canada) It was kept at 37 ° C. for another 15 minutes and then divided into two equal volumes of two fractions. Sample at 37 ° C or 45 Incubate at 37 ° C for 5 minutes, then at 37 ° C for 10, 30, or 60 minutes at 100 μCi / ml [³⁵S] Labeled with thionin (ICN). Collect the bacteria and extract the cell extract from Tris-HCl described above.  Prepared using lysis buffer or SDS-PAGE sample buffer. Four.Immunization of mice   Female Balb / c mouse (Charles River Laboratory, St. Constant) , (Quebec, CA) was immunized with a Streptococcus pneumoniae antigen. S Immune sera against 64 strains of T. pneumoniae type 6 were given at 2-week intervals, 07 heat-killed bacteria or aluminum hydroxide adjuvant (Alhydrogel R; 20 μl adsorbed on Sedalene Laboratory, Horny, Ontario, Canada) Mice immunized by subcutaneous injection of g of detergent-soluble streptococcal protein Obtained from. The blood sample was prepared prior to the immunization and at the first and second immunizations. Collected 7 days after sensitization. Five.SDS-PAGE And immunoassay   Cell extracts were used for SDS-PAGE, Western blot analysis and radioimmunoprecipitation assays. Tris-HCl lysis buffer (50 mM Tris, 150 mM NaCl, 0.1% dodecyl Sodium sulfate, 0.5% sodium deoxycholate, 2% Triton R X-100 , 100 μg / ml phenylmethylsulfonyl fluoride, and 2 μg / ml aprotinin ) Was prepared by culturing the bacterial suspension on ice for 30 minutes at pH 8.0. Lysed cells are far The suspension was clarified by centrifugation and the suspension was separated and frozen at -70 ° C.   SDS-PAGE was performed on a 10% polyacrylamide gel using Remuri [Nature, 227, 680-6 85 (1970)] according to the method of the mini-protean system (Bio-Rad Laboratory). , Mississauga, Canada). The sample was 2% 2-mercaproetano And denatured by boiling for 5 minutes in a sample buffer containing Protein is polyac Use Lilamide gel with Fast Gel Blue R (Pharmacia Biotech, Baidu) Ruffe, K) stained and sorted. Radiolabeled products are viewed by fluorography Wake up. The fluorogram was scanned using a laser densitometer.   Immunoblotting was performed according to Tobin et al. [Proc, Natl, Acad. Sci. USA, 76, 4350-4354 (197 9)]. Detection of antigens reactive with antibodies Oxidase-labeled anti-mouse immunoglobulin and o-dianisidine color Performed by an indirect antibody immunoassay using the substrate.   Radioimmunoprecipitation assays were performed by Willie et al. [J. Virol., 66, 5744-5751 (1992)]. It was done as described. Briefly, serum or hybridoma cultures Nutrient suspensions should be of equal volume [³⁵S] methionine was added to the radiolabeled sample. The mixture was incubated for 90 minutes at 4 ° C. with constant stirring. The immune complex is then bovine blood Kiyoa Sediment for 1 hour at 4 ° C with albumin-treated protein A Sepharose (Pharmacia) Isolated. Beads are pelleted and tris-buffered saline three times In the sample buffer, and then dissociated by boiling in sample buffer. Was. Antigen was analyzed by electrophoresis on SDS-PAGE. The gel is fixed and the amplifier Ref.R (Amersham Canada, Oakville, Ontario, Canada) Amplified for radiography, dried and then exposed to X-ray film.     B.Characteristics of heat shock response in Streptococcus pneumoniae   By examining the pattern of protein synthesis before and after the shift from 37 ° C to 45 ° C, The heat shock response of Treptococcus pneumoniae was studied. 64 strains of P. pneumoniae type 6 (panel A) and 53 strains of type 4 (panel B) Grow at 37 ° C and either 37 ° C (lanes 1, 3, 5, 7 and 9) or 45 ° C (lanes 2, 4, 6 , 8 and 10) for 5 minutes followed by [35S] methionine for 10 minutes (lanes 1, 2 And 7, 8), 30 minutes (lanes 3, 4 and 9, 10) or 60 minutes (lanes 5, 6) ) Shows the results when labeled.   Fluorograms derived from SDS-PAGE show at least three Increased protein synthesis (Fig. 1). Most prominently induced proteins Is about 72 kDa (HSP72), while the other two are roughly 80 kDa (hsp80) and 62 kDa (HSP6). 2). The increase in protein synthesis was observed after 10 minutes of labeling (Figure 1, lanes 1, 2 and 7). , 8) Already evident, labeling period 30 minutes (Figure 1, lanes 3, 4, and 9, 10), And became more pronounced when stretched for 60 minutes (Figure 1, lanes 5, 6). Two different Temperature on the protein synthesis profile of an isolated Streptococcus pneumoniae strain The effect of increasing the degree was similar, as HSPs of similar molecular weight were synthesized. (Figure 1 Panel A (type 6, strain 53) compared with panel A (type 6, strain 64).   Analysis of densitometric records of scanning protein synthesis profiles estimates relative protein abundance. Enabled. For example, heat shocked Streptococcus pneumonia For Ae type 6 64 strain, HSP80 and HSP62 after labeling for 10 minutes are 0.1% or less at 37 ° C. Compared to 2.9% and 6.8% of the labeled protein, respectively (FIG. 2). 72kDa look Labeled proteins with different molecular weights were detected at both 37 ° C and 45 ° C (Figure 2). However However, the radioimmunoprecipitation assay revealed that HSP72 was detected at 37 ° C. Sa (See above; and FIGS. 3, 4 and 6), which indicates that peak 9 from FIG. This indicates that it corresponds to the protein component (s) that moves together with P72. Of this substance Assuming no change in labeling, these results indicate that the amount of HSP72 was 8.7% of the total labeled cellular protein after treatment. . Peaks 4, 10, 13, 17, 19, and 21.Equivalent cellular proteins are heat shocked Was synthesized at almost the same speed regardless of the density (Fig. 2). It became clear from the comparison. However, some proteins (peaks 1, 2, 3, 15, 15, 2 The synthesis of 0, 22, 24, and 26) was significantly reduced in response to heat shock.     C.Immune response to Streptococcus pneumoniae HSP   Mouse serum was first released to assess antibody response to pneumococcal HSPs. The potency was assayed by the immunoprecipitation method. Streptococcus pneumoniae antibody The full range of labeled proteins recognized by the sera of mice immunized with 4 and 4. FIG. 3 is involved in detergent soluble protein preparation. Fig. 4 kills by heating Involved in bacterial specimens. Many bands were detected by many antisera However, HSP72 was the major sedimentation product. Proteins belonging only to heat shock products (Fig. 3 , Lanes 4, 6, 8, and 10; HSP72 by detection in FIG. 4, lanes 4, 6, and 8). The specificity of the antibody to was shown. Interestingly, all immunized mice HSP72 was consistently recognized. Streptococcus pneumoniae of different origin D) Since strong reactivity was observed with HSP72, antibodies reactive with HSP72 It was not specific to the strain used during sensitization. One serum at 37 ° C in addition to HSP72 It should be noted that both co-migrating products labeled at both 45 ° C and 45 ° C precipitated No (Fig. 4, lane 4). This 72 kDa product probably correlated with the components from peak 9 in Figure 2. This was not detected by immunoblotting. HSP62 sediments in some sera Is another immune target that does not necessarily precipitate with all serum ( Figure 3, lanes 6 and 4, lanes 4 and 6). All tested sera are HSP80 Did not react. Pre-immune serum from mice used in this study was labeled No protein precipitated when tested for the presence of antibodies that reacted with the product.   As depicted in FIGS. 3 and 5, the antibody to HSP72 was streptococcal. Once with either S. pneumoniae detergent soluble protein or whole cell extract of After immunization, antibodies against HSP72 could be detected. In addition, HSP after the second immunization A significant increase in the antibody response to 72 was observed (Figure 3, lanes 4 and 6, and Compare lanes 8 and 10).   15 immunized with heat-sterilized Streptococcus pneumoniae The immunoblot patterns of the two mice were consistent with the results of the previously described radioimmunoprecipitation assay. Significant agreement was shown. Although antibody response changes occur for various proteins, SP72 is the major immunoreactive antigen with 8 (53%) positive sera after the first immunization (Fig. 5). Antibodies to HSP72 were tested in 15 immune sera tested after the second immunization. It was detected in 13 (87%) of them. Two others with apparent molecular weights of 53.5 and 47 kDa Were detected at 5 (33%) and 7 (47%), respectively (FIG. 5). 72kDa- The reactive band was tested for recombinant HSP72 antigen (see Example 3 below) in an immunoblot assay. ) Was confirmed to be streptococcal HSP72. Example 2HSP72 Of Monoclonal Antibodies Against Epitopes     A.procedure 1．Immunization and fusion of mice   Female Balb / c mouse (Charles River Laboratories) is Streptococcus -Immunized with Pneumoniae antigen. One set of mice (fusion experiment 1) Formalin-killed 107 bacterial MTL suspended in Reint's complete adjuvant Immunized by intraperitoneal injection with whole cell antigen of the strain, Sonicated from heat-killed bacteria in incomplete adjuvant every 2 weeks The antigen was added. A second group of mice (Fusion Experiment 2) was given three times at three week intervals, 75 μg of detergent-soluble streptococcal antigen extracted from 64 strains (type 6) (Kill A adjuvant) To 25μg (Sedah Lane Laboratories, Horny, Ontario, Canada) And was immunized. 3 days before fusion, all mice were PBS (phosphate buffered saline) Each antigen, suspended alone, was injected intraperitoneally. Hybridoma previously Non-secretion described by Hamel [J. Med. Microbiol., 23, 163-170 (1987)]. It was produced by fusion of sex SP2 / 0 myeloma cells with spleen cells. Specificity hybrid Domas were cloned by serial limiting dilution, expanded and frozen in liquid nitrogen. Was. Monoclonal antibody classes, subclasses, and light chain forms are described by Martin et al. [Eur.J.Im munol., 18, 601-606 (1988)]. Reagents obtained from Biotechnology Associates (Birmingham, Alabama) Was determined using 2．Subcellular fractionation   Pneumococci are described in Pierce et al. [Mol. Microbiol., 9,1037-1050) 19930]. According to the following method. In short, Streptococcus ・ 64 strains of Pneumoniae (type 6) are supplemented with 0.5% (w / v)% yeast extract. The cells were grown at 37 ° C. for 6 hours in an it culture medium and separated by centrifugation. Cell pellet 2 5 mM Tris-HCl buffer pH 8.0, 1 mM EDTA, 1 mM phenylmethylsulfonyl Loride (PMSF), resuspended and sonicated for 4 minutes with a 15 second burst. Cell debris was removed by centrifugation. Bacterial membrane and cytoplasmic content is 98,000 g for 4 hours Isolated by heart separation. 1 m / ml of cytoplasm (suspension) and membrane fraction g and subjected to SDS-PAGE and immunoblot analysis.     B.Identification and characterization of MAbs against HSP72 in Streptococcus pneumoniae sex   Hybridoma culture suspensions were prepared according to the procedure described by Martin et al. Therefore, using the whole cells of Streptococcus pneumoniae strain 65 (type 4), Screened by prime immunoassay. Positive hybridomas are followed by HS To identify hybridomas secreting monoclonal antibodies that react with P72 Retested by immunoblotting. Anti-streptococcal on immunoblot Four of the 26 hybridomas with S. pneumoniae reactivity have a 72 kDa reading To recognize epitopes present on protein bands with low molecular weight Was done. The four hybridomas are F1-Pn3.1 (from fusion experiment 1) and F2-Pn3.2, They were designated F2-Pn3.3 and F2-Pn3.4 (from fusion experiment 2). For isotype analysis According to what became clearer, hybridoma F1-Pn3.1 (from fusion experiment 1) ) Secretes immunoglobulin IgG2k, whereas hybridomas F2-Pn3.2, F2 -Pn3.3 and F2-Pn3.4 (from fusion experiment 2) all secrete IgG1k. HSP72 The specificity of the monoclonal antibody for it was obtained from cultures cultured at 37 ° C [³⁵ [S] Release against methionine-labeled Streptococcus pneumoniae protein Lack of radioimmunoprecipitation activity, and using lysates from heat shock cultured at 45 ° C 72kDa-protein Immunoprecipitation, as indicated by: Figure 6 (lanes 5 and 6) shows monoclonal antibody F The results obtained for 1-Pn3.1 are shown. Monoclonal antibodies F2-Pn3.2, F-P Similar results were obtained with n3.3 and F2-Pn3.4.   Non-heat shock and heat shock from Streptococcus pneumoniae cells of[³⁵[S] methionine-labeled lysate was probed with a monoclonal antibody. And subjected to electrophoresis on an SDS-PAGE gel, followed by Western blot analysis. Was done. The resulting immunoblot revealed the presence of HSP72 antigen in both samples. I made it clear. FIG. 7, panel A, shows the results obtained for monoclonal antibody f1-Pn3.1. The result is shown. Similar results were obtained with monoclonal antibodies F2-Pn3.2, F-Pn3.3 and F2-Pn3.4. Was obtained. Therefore, heat shock stress is the same as that of anti-HSP72 monoclonal antibody. The reactivity did not increase significantly. However, immunoblotting fluorography Clearly indicated that a heat shock response had occurred (FIG. 7, panel B). Strep Synthesis rate of Tococcus pneumoniae HSP72 increases in response to heat shock However, these experiments showed that the absolute amount of HSP72 did not increase after heat shock. I made it clear.     C.HSP72 Location in the cell Streptococcus pneumoniae cells to study the subcellular location of HSP72 The lysate was fractionated by differential centrifugation, and the lysate fraction and microparticles enriched in membrane proteins were Particle fractionation occurred (described above). 15 of the membrane fraction of Streptococcus pneumoniae The sample containing the μg protein (lane 1) and the cytoplasmic fraction (lane 2) were analyzed by SDS-PAGE. Electrophoresis, transferred to nitrocellulose, monoclonal antibody F1-Pn3.1 Searched using In the resulting Western blot, HSP72 Found in both fractions, most of the protein is associated with the cytoplasmic fraction Was found (Fig. 8). Example 3HSP72 Molecular cloning and sequencing of the gene encoding the antigen And expression     A.procedure 1．Strains and plasmids   The strains and plasmids used in this study are listed in Table 1.   E. coli was grown at 37 ° C. on L medium or L agar medium. If necessary Then, ampicillin was added to the medium to a final concentration of 50 μg / ml. Magic / Wizard Uses registered trademark Mini-Perps Kit (Promega, Fisher Scientific, Ottawa, Canada) The plasmid was separated and purified. 2.General recombinant DNA technology   Restriction enzymes, T4 DNA ligase, and standard DNA molecular weights were determined by Biotech Mannheim Canada, It was purchased from Laval, Quebec or Pharmacia Biotec, Uppsala, Sweden. Restriction yeast DNA cleavage and ligation of DNA are described in Sambrook et al. (Molecular C loning. A laboratory manual. Cold Spring Harbor Laboratory Press, N.Y. (1 989)). Agarose gel electricity of DNA fragment Electrophoresis was performed using TAE buffer (0.04M Tris-acetate, 0.002M) purchased from Biotech Mannheim. Using EDTA), Performed according to the procedure described by Sambrook et al. Was. Prep-A-Gene® DNA Purification kit (Bio-Rad laboratories Ltd., DNA fragments were purified from agarose gel using Mississauga, Ontario). the G Transformation by electroporation using ene Pulser registered trademark (Bio-Rad) The procedure followed the manufacturer's protocol. 3.Construction and screening of genomic library   Streptococcus pneumoniae genome DNA library Lee expressed the bacteriophage expression vector λgt11 (λgt11 cloning system). Amersham). The method follows the instructions given to the manufacturer. Followed. J. C. According to the procedure of Paton et al. (Infect. Immun., 54, pp. 50-55 (1986)). Thus, chromosomal DNA of Streptococcus pneumoniae type 6 64 strain was prepared. The chromosomal DNA of Streptococcus pneumoniae is partially digested with EcoRI. Then, a 4-7 kb fragment was separated on an agarose gel. These fragments are converted to λgt11 Ligation, arm packaging, and mixing of the resulting phage The solution was used to infect E. coli strain Y1090. Monocloner specific for HSP72 protein Using the antibody F1-Pn3.1 (described above) to express the antigen of the recombinant HSP72 protein Plaque immunoselection was performed. Peptides recognized by monoclonal antibody F1-Pn3.1 The plaque clone expressing the peptide was isolated and purified. Prepare lysate and manufacture Promega LambdaSorb phage sorbent according to the manufacturer's instructions (general DNA purification procedures). DNA was purified from the implant. 4.Southern blot analysis   In this sample, the non-radioactive DIG DNA Labeling and Boehringer Mannheim Southern blot analysis was performed using the Detection kit. Used as a probe The DNA fragment to be used (described later) is purified using agarose gel electrophoresis, Labeled with Nin (DIG) -11-dUTP. J. As described by Sambrook et al. (Supra). Method, cut the chromosomal DNA of Streptococcus pneumoniae with HindIII and cut it. The cuts were separated using 0.8% SDS-PAGE gel electrophoresis and positively charged DNA Was transferred to a membrane (Boehringer Mannheim). According to the manufacturer's protocol, D The nylon membrane was blotted using an IG-labeled DNA probe. 5.DNA Nucleotide sequencing and nucleotide sequence analysis   For this sample, the DNA fragment whose nucleotide sequence was analyzed was first used for plasmid pDELT. A1 (GIBCO BRL Life Technologies, Burlington, Ontario) . Following the procedure by the supplier, the Tn1000 transposon transposition in vivo ( Deletion Factory System (GIBCO BRL) to generate a series of overlapping deletions I was The size of these deletions was measured by agarose electrophoresis and Sanger et al. ( Proc. Natl. Acad. Sci. USA, 74, pp. 5463-5467 (1977)) Appropriate deletion derivatives were selected using the pseudo-chain terminating method. Lack To examine the base sequence of the gap between the lost templates, an oligonucleotide synthesizer 392 was used. (ABI, Applied Biosystems Inc., Foster City, CA). The tide was synthesized. Use Taq DyeDeoxy Terminator Cycle Sequencing Kit (ABI) Was P Perform sequencing reaction with CR (DNA Thermal Cycler 480 registered trademark, Perkin Elmer) Then, the DNA was subjected to electrophoresis using an automatic DNA sequencer 373A (ABI). 6.Clonin in the Escherichia coli T7 RNA polymerase / promoter system Gene expression   Uses the E. coli bacteriophage T7 RNA polymerase / promoter system The high level of the cloned gene in this example Expression was achieved. The DNA fragment identifying the recombinant protein was transferred to plasmid pT5-7 or Is pT7-6 (S. Tabor and CC Richardson, Proc. Natl. Acad. Sci. USA, 82, p. p.1074-1078 (1985)) that the expressed gene is specific for RNA polymerase of T7 phage. The orientation should be such that it is oriented appropriately to be under the control of a different promoter Φ10. I guessed. The resulting plasmid was transformed into E. coli strain BL21 (DE3) (FW Studier, ann. d B. A. Moffatt, J .; Mol. Biol., 189, pp. 113-130 (1986)) Was. This strain has a T7 R on the chromosome under the control of the inducible lacUV5 promoter. It has a structural gene for NA polymerase. Transformation of BL21 (DE3) strain by adding IPTG T7 RNA polymerase induced in the body is specifically under the control of T7 promoter Φ10 The gene was transcribed. Western blotting of overexpressed recombinant protein Alternatively, it was visualized by Coomassie blue staining. 7.HSP72 Analysis of N-terminal amino acid sequence of protein   L. S. By Daniels et al. (Microb. Pathogen., 1, pp. 519-531 (1986)). Details of 64 strains of Streptococcus pneumoniae prepared by the method described Immunoprecipitation with monoclonal antibody F1-Pn3.1 (described above) using cell wall extract as antigen Was performed to purify the HSP72 protein of Streptococcus pneumoniae. Immunity The precipitate was separated by SDS-PAGE. Matsudaira (J. Biol. Chem., 262, pp. 10) 035-10038 (1987)), a polyvinylidene difluoride (PVDF) membrane Moved to Stain the PVDF membrane with Coomassie blue and cut out the HSP72 protein band The protein was analyzed using an automatic protein sequencer (ABI) according to standard procedures.     B.C-169 Streptococcus pneumoniae HSP72 gene fragment corresponding to Construction of plasmid containing   Using the monoclonal antibody F1-Pn3.1 specific to HSP72, λgt11 streptococcal A C. pneumoniae genomic DNA library was screened. Combination Test 1500 total phages to isolate and purify 17 immunoreactive clones did. To confirm the specificity of the protein expressed by recombinant phage Western blot analysis of the recombinant phage lysate was performed. monoclonal 17 positive clones recognized by antibody F1-Pn3.1 were identified in two groups Was done. Named λJBD7 and λJBD17 for further feature analysis Was. As shown in FIG. 9, all of the 64 strains of Streptococcus pneumoniae were Culture in cell extract (lane 1) and in the presence (+) or absence (-) of IPTG E. coli phage lysate infected with λJBD17 (lanes 2 and 3) or λJBD7 (lanes 4 and 5) was electrophoresed on a 10% polyacrylamide gel, Transferred electrically to trocellulose. Monoclonal antibody (MAb) specific for HSP72 Immunoblotting was performed using F1-Pn3.1 as a probe. Clone λJBD17 is 2.4kb And two EcoRI-EcoRI inserts of 2.3 kb and 2.3 kb (FIG. 10) and an SDS-PAGE gel The above expressed a chimeric recombinant protein having an apparent molecular weight of 74 kDa (Fig. 2 and 3). Clone λJBD7 contains a 2.3 kb EcoRI insert, LacZ and Seems to consist of a 74kDa chimeric protein expressed from clone λJBD17 Production of the fusion protein. This fusion protein was analyzed by SDS-PAGE. It has an apparent molecular weight of 160 kDa (FIG. 9, lane 5). By phage λJBD17 Expression of the encoded chimeric recombinant protein is independent of induction by ITPG (FIG. 9, lanes 2 and 3), but encoded by phage λJBD7. Expression of some recombinant fusion proteins was dependent on induction of the lac promoter (FIG. 9). , Lanes 4 and 5).   In an attempt to subclone the HSP72 gene, a clone from clone λJBD17 Remove, purify, and copy low copy of T. pneumoniae DNA insert Plasmid pWSK29 (RF Wang and SR Rushner, Gene, 100, pp. 195-199) (1991)) to prepare plasmid pJBD171. Restrict insert of pJBD171 Characterized by mapping (FIG. 10B), monoclonal antibody F1-Pn3. To define the boundaries of the genes encoding antigens that respond to 1, a series of Subcloning and immunoblotting were performed. 74kDa chimeric protein Source of expression The responsible region was found to be located on the 3.2 kb EcoRI-EcoRV fragment. This fragment had 0% of the normal 2.4 kb EcoR-EcoRI fragment and 2.3 kb EcoRI-EcoRI fragment. It consisted of a .8 kb EcoRI-EcoRV part. Contains 3.2 kb EcoRI-EcoRV insert The resulting plasmid was named pJBD179.     C.C-169 Of chimeric gene encoding DNA and analysis of DNA sequence   Transcription of the gene encoding the 74kDa chimeric protein on a 3.2kb EcoRI-EcoRV fragment 74 kDa chimeric protein for orientation and for immunological research purposes In order to increase the production of T7 RNA and T7 promoter in E. coli, It was decided to express the 74 kDa chimeric protein by using the system. from pJBD179 The 3.2 kb EcoRI-EcoRV fragment was ligated into plasmids pT7-5 and pT7-6. The multiple cloning site of this plasmid contains a T7 RNA polymerase-specific T7 plasmid. It is located in the opposite direction to the motor 10. This ligation solution is Reacts with monoclonal antibody F1-Pn3.1, used to transform strain JM109 Positive transformants were identified as Colonies described by Sambrook et al. (Supra). -Identified using the lifting method. From the resulting pT7-5 and pT7-6 Were named pJBDf51 and pJBDf62, respectively. These pairs Control the normal 3.2 kb EcoRI-EcoRV fragments on the recombinant plasmid and their orientation Determined using restriction mapping. To overexpress the 74 kDa chimeric protein, pJB Df51 and pJBDf62 were separately transformed into E. coli BL21 (DE3) strain. Transformant Was induced with IPTG (1 mM) at 37 ° C. for 3 hours. Collect cells, wash and resuspend in 1% SDS And boiled for 10 minutes. Next, immunoblot analysis was performed using the lysate for SDS-PAGE. Was. As expected, both transformants produced the 74 kDa chimeric protein and MAb F It was easily detected by Western blotting using 1-Pn3.1 (FIG. 11). Only However, under ITPG induction conditions, only the transformant BL21 (DE3) strain (pJBDf51) The kDa chimeric protein was overexpressed (FIGS. 11A and B, lane 2) and the 3.2 kb EcoRI-Eco The transcription direction of the gene on the RV fragment may be from the EcoRI end to the EcoRV end. Suggested (FIG. 10A).   The 3.2 kb EcoRI-EcoRV fragment was cloned into plasmid pDELTA1 and the plasmid pJ BDΔ1 was prepared. A series of overlapping deletions is generated, which serves as a template for DNA sequencing. Used as The entire DNA sequence of the 3.2 kb EcoRI-EcoRV insert fragment is SEQ ID NO: 1. .   Two open reading frames ("ORFs") have been found and their FIG. 10B ([ORF27] and “FucI-HSP72 (c-169)”). These two A putative ribosome binding site was identified in front of the two ORFs (SEQ ID NO: 1, Nucleotides 18-21 and 760-763). The apparent -10 and -35 promoter sequences are Was not found. ORF27 spans nucleotides 30-755 (SEQ ID NO: 1), It encodes a 242 amino acid protein and has a calculated molecular weight of 27,066 Da. Of this protein The deduced amino acid sequence is SEQ ID NO: 2. The present inventors have modified this gene or Named f27 and compared with other known genes. Homologous genes and proteins found I was not issued. The large ORF (nucleotides 771-2912, SEQ ID NO: 1) has 714 amino acids. Encodes a protein of the amino acid and is predicted to have a molecular weight of 79,238 Da. Of this protein The deduced amino acid sequence is SEQ ID NO: 3. Between this ORF and other known sequences Comparisons were made to determine their relationship to other amino acid sequences. With this analysis, the code The proteins involved are the fucose isomerase (FucI) sequence of Escherichia coli and DnaK High similarity to several HSP70 gene families, also known as genes It became clear that. SEQ ID NO: 3 and E. coli FucI and HSP70 (D naK) When the amino acid sequence of the protein is aligned, it is found that the amino acid sequence of the 74kDa chimeric protein is 545 (SEQ ID NO: 3) has a high homology to Escherichia coli FucI. And the C-terminal portion corresponding to amino acids 546 to 714 (SEQ ID NO: 3) is H It turned out to be similar to the SP70 (DnaK) protein. 74kDa protein gene It is noteworthy that an EcoRI restriction site exists at the junction of these two sites in (SEQ ID NO: 1, between nucleotides 2404 and 2405). Other restriction sites are null Between nucleotides 971 and 972 (Pst I), between nucleotides 1916 and 1917 (Pst I), Between nucleotides 1978 and 1979 (Xho I), and nucleotides 3164 and 3165 Between (EcoRV). From these data, we found that the 74 kDa protein Is a fragment of S. pneumoniae chromosomal DNA, a 2.4 kb EcoRI-derived FucI homologous gene Encoded by EcoRI fragment and 2.3kb EcoRI-EcoRI fragment from HSP72 gene Argued that this was a chimeric protein.     D.Southern blot analysis   Perform a Southern blot to confirm that the 74 kDa protein is a chimeric protein. Cloning of all HSP72 genes of Streptococcus pneumoniae saw. Complete digestion of chromosomal Streptococcus pneumoniae DNA with HindIII And separated on a 0.8% agarose gel, two positively charged nylon membranes (Boehringe r Mannheim). 0.8kb EcoRI-EcoRV plasmid derived from 2.3kb EcoRI-EcoRI fragment Lobe or 1kb PstI-PstI probe obtained from 2.4kb EcoRI-EcoRI fragment The membrane was blotted using either. Both probes are digoxigeni Labeled with dUTP. These two probes have two different sizes. Hybridized with each HindIII fragment (FIGS. 10B and 10C) . The 0.8 kb EcoRI-EcoRV probe recognizes a 3.2 kb HindIII fragment and generates a 1 kb PstI-PstI probe. The lobe reacted with the 4 kb HindIII fragment. From this result, the 74 kDa chimeric protein The gene responsible for expression is transformed by in-frame fusion of the two EcoRI fragments. It was suggested that it occurred. One of the two EcoR fragments is Streptococcus new -From the fragment containing the 5 'part of the FucI homolog of M. Derived from a fragment containing the C-169 fragment of the HSP72 gene of P. pneumoniae Was. 0.8kb EcoRI-EcoRV probe hybridizes with 3.2kb fragment alone From the fact that a copy of the HSP72 gene was obtained from Streptococcus pneumoniae It was suggested that only one copy was present in d.     E. FIG.Recombinant HSP72 product   Pool pools of HindIII digests of chromosomal DNA in sizes ranging from 2.8 to 3.7 kb. By ligation to Rasmid pWSK29 / HindIII, streptococcal A partial genomic library of Cass pneumoniae was generated. This lighe Escherichia coli JM109 strain was transformed using the solution, and the transformant was 0.8 kb EcoRI-E Screening was performed by performing hybridization using a coRV probe. 4 The plasmid from one of the positive hybridizing clones was named pJBD291. Perform restriction analysis of inserts and Western blot of cell lysates of transformants. Thus, plasmid pJBD291 is actually HSP72 expressing recombinant HSP72 protein. It was confirmed to have a 3.2 kb HIndII fragment containing the gene (FIG. 10B). Trait The HSP72 protein expressed by the transformant (pJBD291) was converted to the original HS on an SDS-PAGE gel. P72 protein (See FIG. 12). To sequence all HSP72 genes, 3.2 kb HindIII fragment to overexpress full-length HSP72 protein Isolated from pmid BDJ291 and subcloned into plasmids pDELTA1 and pT7-5 And named pJBDΔ4 and pJBDk51, respectively.   The entire 3.2 kb HindIII DNA fragment on plasmid pJBDΔ4 and the 2.3 kb E on pJBD177 The coRI-EcoRI DNA fragment was sequenced. Is the nucleotide sequence 4320 base pairs in total? And two ORFs appeared (SEQ ID NO: 4). Starting at nucleotide 682 The first ORF ending at nucleotide 2502 (SEQ ID NO: 4) is a strept It was identified as the HSP72 gene of Coccus pneumoniae. Second ORF Extends from nucleotide 3265 to nucleotide 4320 (SEQ ID NO: 4) , Located 764 base pairs downstream of the structural gene for HSP72, Streptococcus pneumoniae It was identified to be the 5 'part of the DnaJ gene of Niae. Putative riboso Site ("AGGA") is located 9 base pairs upstream of the start codon of the HSP72 structural gene However, a typical ribosome binding site ("AGGA") is the start codon of the DnaJ structural gene. 66 base pairs upstream. A typical 5 'in front of these two genes No control region was identified. Between nucleotides 1 and 2 (HindIII), nucleo Between nucleotides 1318 and 1319 (EcoRI), between nucleotides 1994 and 1995 (EcoRI), Between nucleotides 3343 and 3344 (HindIII), and nucleotides 4315 and 4316 The restriction site is located between (EcoRI). HSP of Streptococcus pneumoniae The gene organization of 72 (DnaK) and DnaJ has been identified by several other Gram-positive bacteria (Wetzstei n, M. et al., J. Bacteriol. 174, 3300-3310 (1992)) as well as E. coli. (Saito, H and Uchida, Mol. Gen. Genet. 164, 1-8 (1978)) ing. However, the internal gene region of Streptococcus pneumoniae The region is extremely large, and the ORF of the grpE gene is found upstream of the HSP72 (DnaK) structural gene Was not done.   The predicted HSP72 protein is calculated to have a molecular weight of 64755 Da Corresponds to a 72 kDa molecule estimated by -PAGE. The predicted HSP72 protein has an isoelectric point (p I) It is acidic at 4.35. Extracted from 64 strains of Streptococcus pneumoniae As a result of automatic Edman degradation of the purified original HSP72 protein, the N-terminal It was revealed that the 19 amino acid sequence was SKIIGIDLGTTN-AVAVLE. Amino powder No terminal methionine was detected, which is probably the case in many proteins. What is caused by in situ processing, as is known to happen Will. The 13th amino acid residue was not identified. Derived from the original HSP72 protein The resulting N-terminal 19 amino acid sequence is a recombinant Streptococcus pneumoniae. D) N-terminal 19 amino acids deduced from the nucleotide sequence of the HSP72 gene (SEQ ID NO: 5) The cloning was confirmed completely with the amino acid sequence. This N-terminal sequence is Perfectly consistent with the DnaK protein of Lactococcus lactis, It showed 68.4% agreement with the DnaK protein of Enterobacteriaceae. Similarly, the predicted HSP72 protein Amino acid sequence (SEQ ID NO: 5) and amino acids of HSP70 (DnaK) protein of other bacteria High homology was also observed when the acid sequences were aligned (FIGS. 13A-13D). For example, HSP72 The protein showed 54% homology with the E. coli DnaK protein. Gram-positive bacteria lactoco Comparison with C. lactis shows a high homology value of 85% identity with HSP72. Obtained. When compared to DnaK protein from Gram-negative bacteria, HSP72 Like the HSP70 protein of positive bacteria, it lacks the 24 amino acids near the amino terminus (Fig. 1 3A-13D).   HSP72 protein is homologous to HSP70 (DnaK) protein from other organisms Regardless, it has several features. Diversity of HSP70 (DnaK) protein sequence Sex is mainly located in two regions (residues 244-330 and 510-602, SEQ ID NO: : 5). More characteristic is that GFDAARDAAQAALDD (residues 527 to 541, SEQ ID NO: No .: 5) and the peptide sequence of AEGAQATGNAGDDVV (586-600 residues, SEQ ID NO: 5) Column is restricted to the HSP72 protein. High C-terminal part of HSP72 protein This part is based on the fact that It was suggested that it had an antigenic determinant site specific to Ae. According to this hypothesis The monoclonal antibody against the HSP72 protein C-169 fragment (described above) E. coli and S. cerevisiae, which are known to express DnaK proteins similar in quality. Aure The mouse did not respond.   DnaJ protein that is cut in the middle of Streptococcus pneumoniae Column number: 6) is 352 amino acids; The corresponding part of the lactis DnaJ protein (72% match) and high similarity to E. coli DnaJ protein (51% match). Predicted DnaJ protein cleaved on the way contains a high content of glycine (15%). Strep Between amino acids 148 and 212 of the DnaJ protein of Tococcus pneumoniae, Cys-X-X-Cys-X-Gly-X-Gly motif unique to DnaJ protein (PA Silver and JC . Way, Cell, 74, pp. 5-6 (1993)), 4 Gly-Cys rich repeats identified (SEQ ID NO: 6). Three GGFGG repeats (75 to 79, 81 -85, and 90-94 residues).     F.Reactivity of monoclonal antibodies to recombinant antigens.   Four monoclonal antibodies specific to the HSP72 protein (F1-Pn3.1, F2-Pn3.2, F2- Pn3.3, and F2-Pn3.4, as above) infected with recombinant phage containing the HSP72 sequence, and Reactivity to proteins expressed in Escherichia coli transformed with And tested. Each of the four MAbs was a lac expressed in clone λJBD7. Reacts with the Z-HSP72 fusion protein and is recognized by these MAbs for the C-terminal 169 residues. Localized to the epitope. Surprisingly, the strikes of λJBD7 and λJBDΔ1 Four proteins are encoded by the insert of L. pneumoniae Were recognized by only three of the MAbs. From these results, λJBD7 and The C-169 fragment synthesized in E. coli infected with λJBD17 has the same primary structure. Nevertheless, it was suggested that they had different higher-order structures. MAb F2-Pn3.2 Lack of reactivity with some recombinant proteins The possibility arises that antibodies recognize more complex epitopes. Although it is united The F2-Pn3.2 epitope is still recognizable by Western blot . Complete HSP72rec protein expressed in Escherichia coli containing the recombinant plasmid .LAMBDA.JBD.DELTA.4 Reacted with all four MAbs. Example 4-HSP72 Antigen specificity and reactivity of protein-specific monoclonal antibodies   16 capsular serotypes of Streptococcus pneumoniae (1, 2, 3, 4 , 5, 6, 8, 9, 10, 11, 12, 14, 15, 19, 20, and 22 types), And 17 strains other than Streptococcus pneumoniae shown in Table 2. And D. The dot enzyme immunoassay described by Martin et al. MAbs F1-Pn3.1, F2-Pn3.2, F2-Pn3.3, and F2 -The reactivity of Pn3.4 was tested. Chocolate for dot enzyme immunoassay Cold Bacteria were cultured overnight on a top plate and suspended in PBS pH 7.4. About 10⁹CFU / ml included 5 μl of the suspension, spread on nitrocellulose paper, and add PBS containing 3% bovine serum albumin. 2 followed by monoclonal antibody and peroxidase labeled 2 The cells were cultured with the following antibodies. Boil the bacterial sample buffer suspension for 5 minutes to extract whole cells The preparation was prepared for Western blot analysis.   When tested in a dot enzyme immunoassay, each monoclonal antibody (MAb) Although it reacted with each strain of Streptococcus pneumoniae, None of the isolates other than P. pneumoniae reacted. HSP7 The two proteins are known HSP70 (DnaK) proteins of other bacteria, such as E. coli and S. cerevisiae. Au A comparative study revealed that it was very similar to that of Reus, These results were not expected. Next, an immunoblot was performed and the present inventors The MAb was tested for immunoreactivity. As shown in Table 3, how much each MAb The reactivity was shown. Amino acid sequence of Escherichia coli and amino acid sequence of HSP72 protein Although the similarity of (SEQ ID NO: 5) is 54%, four HSP72-specific M Ab did not recognize E. coli HSP70 (DnaK) protein. Similarly, HSP72-specific MAbs Indicates that 56% of the amino acid sequence matches the amino acid sequence of the HSP72 protein. Trakomate Did not react with HSP70 (DnaK) protein. High amino acid sequence homology is H Observed between SP72 protein and HSP70 (DnaK) protein from Gram-positive bacterial species You. However, again, the HSP72-specific MAb was found to be Staphylococcus aureus ( S. aureus) or Bacillus gram-positive species. this Show 74% and 76% amino acid sequence homology to the HSP72 protein, respectively. These data indicate that the HSP70 (DnaK) protein is structurally related to the HSP72 protein. That may be immunologically distinct, You. Streptococcus pneumoniae or more that reacted with at least one MAb Pure cultures outside are Streptococcus pyogenes, Enterococcus faecalis E. colis (Enterococcus faecalis), Streptococcus mutans (S. mu) tans), and Streptococcus sanguis (S. sanguis). Are all Streptococcus or Streptococcus-related Enterococcus Belongs to the genus. So far, these Streptococcus and Enterococcus species No HSP70 protein or gene structure has been identified. this Taken together, these observations suggest that a highly variable protein in the HSP70 (DnaK) protein The amino acid sequence or residue was suggested to be involved in antigenicity. Interesting thing Finally, by immunoblotting analysis, Streptococcus pneumoniae Pure cultures and pure other than immunoreactive Streptococcus pneumoniae No significant changes were seen in the molecular weight of both HSP70 (DnaK) proteins in the culture. Clearly became. Example 5-HSP72 Purification of proteins and immunogens to prevent lethal transmission of S. pneumoniae Use of HSP72 protein as a primer     A.procedure 1.Preparation of purified recombinant HSP protein and recombinant C-169   Escherichia coli bacteriophage T7 RNA polymerase / T7 promoter system Utilization of HSP72 enabled high-level single expression of the HSP72 gene. Three The .2 kb HindIII fragment was ligated in both directions in front of the T7 promoter φ10 of plasmid pT7-5. Loaned. The resulting plasmid pJBDk51 was transformed into E. coli BL21 (DE3) strain. Transformation. After IPTG was added to a final concentration of 1 mM, antibiotics were added After culturing in a medium for 3 hours, the recombinant HSP72 protein (HSP72_rec) Overexpression Was induced. HSP72_recEscherichia coli expressing high levels of protein by centrifugation concentrated 50 mM Tris-Cl (pH 8.0) containing 0.2 mg / ml lysozyme, 1 mM EDTA, and 10 mM The cells were lysed by gentle sonication in 0 mM NaCl lysis buffer. 12 cell lysate The mixture was centrifuged at 000 g for 15 minutes, and the supernatant was collected. Sepharose 4B beads (Pharmacia) By immunoaffinity using monoclonal antibody (MAb) F1-Pn3.1 immobilized on HSP The 72rec protein was purified. The purity of the eluate was evaluated by SDS-PAGE.   Escherichia coli transformed with the plasmid pJBDΔ1 using the recombinant C-169 protein (C-169rec) It was expressed in the form of a soluble inclusion body in the JM109 strain. Ultrasound described above for protein inclusions It was recovered from bacterial cells that had been disrupted and precipitated by crushing. Remove the precipitate with 1 mM deoxychocolate. The cells were washed with a lysis buffer containing a rate to remove contaminants, and dissolved in urea 6M. protein Centrifuge at 100,000 g of solution, collect the clear supernatant and reconstitute against phosphate buffered saline. Dialyzed. After purification, the protein content was determined using the Bio-Rad protein assay (Bio-Rad Laborato ries, Mississauga, Ontario, Canada). 2.Research on active immune proteins Two glues of 10 female Balb / c mice (Charles River Laboratories) Purified HSP72rec and C-169rec antigen were added subcutaneously three times every two weeks to Immunization was performed with 0.1 ml of the substance dissolved in drogel adjuvant. Antigen doses of 1 and 5 μg was tested at two points. The third group consisted of 10 control mice Immunize in exactly the same way through the same procedure with alhydrogel adjuvant alone did. A blood sample was taken from the sinusoids prior to each immunization and 5 Blood samples were collected after 77 days. Then add about 10 to these mice⁶CFU Type 3 The strain was inoculated with the strain WU2 of T. pneumoniae. Streptococcus ni A sample of the inoculum of P. humoniae was plated on chocolate agar to measure CFU, The amount of inoculation was confirmed. Record death every 6 hours for the first 3-4 days after infection, then Recordings were made every 24 hours for 14 days. After 14 or 15 days, surviving mice are sacrificed Blood samples for the presence of viable Streptococcus pneumoniae bacteria Examined.   Antibodies that reacted with the recombinant HSP protein antigen were described in Example 7. 3.Research on passive immune protection   About 50 of purified C-169rec protein dissolved in Alhydrogel adjuvant μg immunized a number of subcutaneous sites in NZW rabbits (Charles River Laboratories) Was . The rabbits are vaccinated three times with the same antigen every other week, 7-14 days after the last immunization Later, blood samples were taken. Pool serum samples and allow antibody to 40% saturated ammonium sulfate It was precipitated using a system and purified.   Intravenous 5,000 and 880 CFU type 3 Streptococcus pneumoniae strain WU2 One hour before administration, severely immunodeficient SCID mice were challenged with 0.25m of rabbit purified antibody. l injected subcutaneously. Purify from sterile buffer and serum from unimmunized rabbits. The prepared antibody was injected into control SCID mice. Streptococcus pneumonia Plate a sample of Niae inoculum on chocolate agar, measure CFU, and It was confirmed. SCID mice are very sensitive to Streptococcus pneumoniae It was chosen as an experimental material because it is easy to dye. Blood samples obtained 24 hours after inoculation (20 μl each) and plate on Chocolate Agar for Streptococcus pneumoniae The presence or absence of live flora was examined. The level of detection was 50 CFU / ml. 5 Deaths were recorded every 24 hours over the day.     B.result   Streptococcal encoding full and partial (C-169) HSP72 protein S. pneumoniae DNA insert is cloned and the recombinant protein is transformed in E. coli. Useful for studying the viral heritability potential of the HSP72 protein by using the expression of It has become possible to obtain an advantageous purified protein. Both proteins, HSP72rec and C-169rec, Contamination detected on SDS polyacrylamide gels stained with Coomassie Blue It was not seen and was obtained in a relatively pure state (FIGS. 14 and 15, respectively).   To assess the viral heritability potential of the HSP72 protein, we first We investigated the ability of HSP72rec protein to elicit a protective immune response. Mouse 1 A group of 0 animals was immunized with the full-length HSP72rec protein (1 μg or 5 μg dose), Inoculated with 4.2 million CFU of type 3 Streptococcus pneumoniae strain WU2. HS 80% of mice immunized with 1 μg of P72rec protein survived the inoculation, and 50% of the mice receiving μg survived. Alhydrogel adjuva without antigen None of the mice immunized with the singlet survived (FIG. 16). 14 infected Or any blood samples collected from mice that survived after 15 days No P. pneumoniae live bacteria were detected. HSP72rec protein, 3 Causes protection against Streptococcus pneumoniae As a result, the HSP72 protein derived from DNA extracted from the type 6 strain was found to have a different capsular type. Contains an epitope capable of eliciting protection against heterologous strains having It was suggested that   We further expressed in E. coli transformed with the chimeric fucI-HSP72 gene. The immune protein response to the HSP72 protein was tested using the I did it. Mice immunized with the purified C-169rec protein are protected from lethal infection, This suggests that some, but not all, of the epitopes leading to protection are HSP7 It is shown to be present in the C-terminal region containing 169 residues at the back of the two proteins   Groups of 10 mice were immunized with C-169rec protein (1 μg or 5 μg dose). And 6 million CFU of Streptococcus pneumoniae type 3 WU2 strain. C- 60% of mice immunized with 1 μg of 169rec protein survived and injected 5 μg of C-169rec protein. The fed mice survived 70% (FIG. 17). Conversely, do not administer C-169rec protein. All the dead mice died two days after inoculation. Therefore, Streptococcus The C-terminal portion of P. pneumoniae has the largest difference in DnaK protein. And is the target of a protective immune response.   As shown in Table 4 below, two independent experiments showed that rabbit anti-C-169rec SCID mice passively transferred with the antibody are Streptococcus pneumoniae strain WU2 Protected against lethal infection; conversely, no 15 control mice survived Indicated. Control mice receive antibodies from unimmunized rabbits or sterile buffer. Immunization alone was administered. In addition, all mice in the control group were positive 24 hours after inoculation. Had sexually-aware Streptococcus pneumoniae blood cultures, but were immunized All Streptococcus pneumoniae bacteria were detected in all SCID mice. Only 2 out of 10 animals.   In experiments 1 and 2 (Table 4), 5000 and 880 CFU of type 3 streptococ Mice were inoculated with Cas pneumoniae strain WU2. Table 4 shows the results of mouse connection. The number of survivors after seeding, or the number that was positive for Streptococcus pneumoniae And compared with the total number of mice in each group. Recombinant HSP72 and Anti-HSP72 specificity of antibodies obtained by immunizing C-169 and C-169 proteins Western blot analysis using cell lysates of Leptococcus pneumoniae Proven by One band corresponding to HSP72 is rabbit and mouse tissue. Detected in all antisera struck. From these serological results, recombinant The protein produced after immunization of the protein is Streptococcus pneumoniae HSP72 It was suggested that this was due to the production of antibodies that reacted with the protein. Example 6HSP72 Heat-induced expression cis for high-level production of the C-151 terminal portion of the protein Tem     A.The C-terminal 151 amino acids of the HSP72 protein of Streptococcus pneumoniae Construction of plasmid pURV3 containing coding region   The C-terminal 151 amino acids of the HSP72 protein of Streptococcus pneumoniae The linked DNA region is ligated downstream of the lPL promoter, and the translation vector p629 (HJ . George et al., Bio / Technology 5, pp. 600-603 (1987)). This K Bacteriophage lcI857 with a functional PR promoter deleted Contains the sex repressor gene cassette. 30 degrees to 37 degrees to 37 degrees Inactivation of the cI857 protein by increasing the temperature to Leads to the induction of certain genes. Gene shift in E. coli cells by temperature shift Induction is advantageous for large-scale fermentations. Because of the enzyme currently used This can be easily performed. However, E. coli is not described here. Other microbial organisms, such as yeast, were selected according to the present invention. Should be understood to fall within the range of   457 from 2050 to 2506 of the HSP72 gene of Streptococcus pneumoniae The 477 nucleotide DNA fragment containing the base pair region was -OCRR26 (5'-GGCAGATCTATGAAGGCCAAAGACCTTGGAAC) and primer OCRR27 (5'-  CGCGGATCCTTACTTTTCCGTAAACTCTCCGT) to obtain Streptococcus pneumoniae Amplified by polymerase chain reaction (PCR) from 64 genomic DNA of Niae type 6 strain Was. Chromosomal DNA was obtained by the method of Jayarao et al. (J. Clin. Microbiol., 29, pp. 2774-2778). (1991)) in a Heart Infusion medium. It was prepared from 90 ml of a cell culture of the logarithmic growth phase of Pseudomonas. The DNA amplification reaction Performed using a DNA thermal cycler from PerkinElmer San Jose, CA. OCR In R26, the ATG start codon follows the region encoding the amino-terminal region of C-terminal 151. It exists in the upstream frame. Primers OCRR26 and OCRR27 are each Includes BglII (AGATCT) and BamHI (GGATCC) recognition sites. Therefore, dephosphorization of p629 Facilitating cloning of PCR products into oxidized restriction sites BglII and BamHI.   The PCR product was prepared by the phenol freeze method (SA Benson, Biotechniques 2, pp. 67- 68 (1984)) and purified from restriction enzymes BglII and BamHI. Digested. Thereafter, the 471 base pair BglII-BamHI fragment was replaced with the dephosphorylated Bg of p629. Ligation to lII and BamHI recognition sites. Plasmid p thus prepared A partial map of URV3 is shown in FIG. This plasmid was prepared using the Simanis method (Hanahan, D .;   D. M. Glover, DNA Cloning, pp. 109-135, (1985)) E. coli strain XLI Blue MRF '(D (mcrA) 183 D (mcrCB-hsdSMR-m rr) 173 endA1 supE44 thi-1 recA1 gyrA96 relA1 lac [F'proAB lacI^qZDM15 T n10 (Tet^r)] c). Transformants cultured at 37 degrees C. Using the corresponding MAb F1-Pn3.1, colony immunoblotting (J. Sambrook et al. )). Plasmid DNA was purified from the selected transformants and The NA insert was obtained from Applied Biosystems Inc. (ABI) Taq Dye Deoxy Terminator Cyc PCR using le Sequencing kit and using the automatic DNA sequencer 377A (ABI) The base sequence was determined by electrophoresis. Nucleotide sequence of this DNA insert The sequence completely matched the nucleotide sequence of the C-terminal 151 coding region of the HSP72 gene. (Reference amino acid sequence corresponding to SEQ ID NO: 25 and SEQ ID NO: 26) The plasmid was transformed into the original strain E. coli W3110 for the production of C-151rec.     B.C-151rec Expression and antibody preparation   Recombinant C-151rec is an E. coli strain W3110 carrying the plasmid pURV3, Synthesized with terminal methionine. E. coli cells are A₆₀₀100mg until is 0.6 The cells were cultured at 30 ° C. in LB medium containing / ml of ampicillin. And the C-151rec protein The cells were cultured at 40 degrees for 18 hours to induce production. Mid-purified C-151rec protein White matter was prepared by the following procedure. Bacterial cells are collected by a centrifuge and the resulting precipitate is removed. Washed and dissolved with phosphate buffered saline. Add lysozyme and pulse sonication Cells were cultured in ice for 15 minutes prior to cell disruption by Cell lysate is centrifuged. To remove impurities, collect the supernatant, and use Amicon's ultrafiltration system (stirred cells series 80 00, Amicon Canada Ltd Oakville, Ontario). With YM30 membrane Collect the unretained ultrafiltrate, analyze by SDS-PAGE, and stain with Coomassie Blue R-250. Colored. The protein concentration is determined by the staining intensity of C-151rec It was determined by comparing the staining intensity of the bean trypsin inhibitor.     C.C-151rec MAb reactivity   10 selected for their reactivity with the HSP72 protein of Streptococcus pneumoniae A panel of monoclonal antibodies from the YM30-ultrafiltrate prepared as described above. Using Western blot analysis, based on the reactivity to C-151rec, Strike. MAbs include a series of six monoclonals generated against the HSP72rec protein. Monoclonal antibody (F3-Pn3.5 to F3-Pn3.10) or monoclonal antibody F1-Pn3.1, F 2-Pn3.2, F2-Pn3.3 and F2-Pn3.4 were included. F1-Pn3.1, F2-Pn3.3, F2-Pn3.4 Three MAB reacted with C-169rec but also recognized the C-151rec fragment. All other MAbs Reactivity was observed only with HSP72rec. This indicates that the amino terminus of the HSP72 protein Suggests that it is for a certain epitope. Example 7 Combination of Balb / c mice and Macaca-Fascicularis (cynomolgus) monkeys Antibody responses to recombinant HSP72 antigen     A.procedure 1．Animal immunity   Groups of 10 female Balb / c mice were treated with HSP72rec as described in Example 5. Or immunized subcutaneously with either C-169rec. Assess antibody response to C-151rec For this purpose, groups of 6 mice were dissolved in Alhydrogel adjuvant. 0.5 mg of C-151rec was intraperitoneally inoculated three times at two-week intervals and immunized. .   Serum from blood samples taken before immunization and 4 to 7 days after the third immunization was , Plate coated with cell wall extract of Streptococcus pneumoniae ELISA used to determine antibody reactivity with Streptococcus pneumoniae Tested.   Female cynomolgus monkeys were treated with 150 mg of spirit dissolved in Alhydrogel adjuvant. 0.5 ml containing the prepared HSP72rec or C-169rec antigen intraperitoneally on days 1, 22, 77 And immunized. Blood samples are collected periodically before and after immunization, respectively. Serum was analyzed by Western blotting for Streptococcus pneumoniae HS Antibody reactivity with P72 protein was tested. Streptococcus New Moniae HSP72 protein antibody specificity was determined by Streptococcus pneumoniae. Western blot analysis of cell wall extracts and purified recombinant antigens I confirmed.     B.result   The results described previously in Example 5 indicate that the protective state of the antibody reaction was It clearly shows that the next immunization with the antigen was elicited. Where we immunize Results of serum antibody responses from planned mice (Figures 19, 20 and 21) and monkeys (Figure 22) Examine the reality. Both species have an average titer of 1: 64000 immunogens after the third inoculation. The total length of the recombinant HSP72 protein used and the HSP72 protein Strongly anti I responded. From detailed analysis of individual sera, each animal was individually Antibodies against immunization with developing antibodies that react with the HSP72 protein of C. pneumoniae And was shown to respond. In mice immunized with C-169rec, two injections The doses tested, i.e., 1 and 5 mg, led to a similar antibody titer induction. In that respect, it was equally effective (Figure 20). The strong second reaction was after the third inoculation This was observed after the second inoculation of C-169rec, without an increase in antibody titer. this In contrast, we observed that the immune response to HSP72rec was dose-dependent did. Elevated titers of specific antibodies indicate that either HSP72rec or C-151rec And observed after the second and third inoculations (FIGS. 19 and 21).   From studies of monkey immune response, the immunogenicity of the recombinant HSP72 antigen was It has been shown that it is not limited to rodents such as mice. Twice with each antigen The humoral response following eye inoculation is accompanied by a detectable decrease in antibody titer. Of HSP72-specific antibodies, which can be maintained for a few weeks (Figure 22). In addition, specific serum antibodies can be obtained after a single inoculation of the recombinant antigen. In addition, it was detectable in the serum of each monkey. Example 8-HSP72 Mapping B cell epitopes on stress proteins   In Example 3, a significant change in the initial sequence of the HSP72 protein was Cass pneumoniae HSP72 proteins 244-330 and 510-607 It was mainly located in two regions corresponding to the noic acid sequence. These variable regions May contain a B cell epitope that responds to the heterogenicity of the antigen reported in Example 4. You. To investigate this possibility, Streptococcus pneumoniae HSP72 protein was The reactivity of white matter polyclonal and monoclonal antibodies The test was performed on 14 peptides selected for inclusion.     A.procedure   Fourteen peptides with a 14 to 30 amino acid sequence were synthesized. This pep in protein The sequences and positions of the tides are summarized in Table 5. Peptides CS870, CS873, CS874, CS875, CS876, CS877, CS878, CS879, CS880 and CS882 are automated peptide synthesizers Using a Biochem Immunosystem Inc. (Montreal, Canada) Was. Peptides MAP1, MAP2, MAP3 and MAP4 are de Sequence de Peptides de  Supply of l'Est du Quebec, Center de recherche du CHUL (Sainte-Foy, Canada) Was synthesized on a side chain with lysine as the core. Peptides were purified by reversed-phase high-pressure liquid chromatography. Peptide CS874 And CS876 are small amounts of either 6M guanidine hydrochloride or dimethyl sulfoxide. The dissolved peptide was dissolved in a liquid adjusted to 1 mg / ml with distilled water, and the remaining peptide was Dissolved in distilled water.   Peptide ELISA is described in According to the procedure described by Hamel et al. At a concentration of g / ml, Immunolon 4 microtitraton plates (Dynatech Laboratories, Inc., Chantilly, VA). To confirm the reactivity of the MAb with the peptide, a solid HSP72 protein The ability to inhibit MAb binding to quality was measured. In the experiment for measuring the binding inhibition ability, the microtitraton Rates were coated with Streptococcus pneumoniae cell wall extract. The hybridoma culture supernatant containing HSP72-specific MAb was The cells were divided and cultured at 4 degrees overnight. The treated peptide and control supernatant were then The test was performed by ELISA as described above.   Immune supernatants were obtained from animals immunized three times with the recombinant HSP72 antigen. Described in Example 5 One rat was immunized with 37.5 mg of purified HSP72rec according to the immunization protocol Quarreled. The murine serum pool was from three Balb / Immune immunized with HSP72rec from Example 5. c Obtained from mice. Monkey serum pools were either HSP72rec or C-169rec. From a group of two animals immunized with     B.Identification and localization of linear B-cell epitopes   From the results shown in FIG. 23, many immunological reactivities indicate that the C-terminal 151 It was found in peptides located in the amino acid sequences 457 and 607 corresponding to the fragments. set Rabbits and mice obtained from animals immunized with either the modified HSP72rec or C-169rec Mouse and monkey serum antibodies react with both peptides MAP2 and MAP4. Interest Deeply, the sequence of the peptides MAP2 and MAP4 was Streptococcus pneumoniae HSP72 protein based on comparison with protein Sequence GFDAERDAAQAALDD (sequences 527 to 541) and sequence AEGAGATGNAG DDVV ( Present over the C-terminal hypervariable region, including sequences 586 to 600). Like this Our data indicate that both peptide sequences contain a linear B-cell epitope Was done. Furthermore, peptide MAP4 alone was also recognized by MAb F1-Pn3.1. this Reactivity was confirmed by fluid phase inhibition experiments. Among them, 10 mg / ml of MAP4 is F1-Pn 3.1 completely inhibited the binding to HSP72 protein. Free with complete recombinant HSP72 protein Polyclonal antisera from quarantined animals was also obtained from peptides CS875, MAP1 and MAP The B cell epitope located above 3 was recognized. From all of these data, HSP72 protein White matter C-terminal 151 hypervariable region fragment stimulates B cell response and immunodominant HSP72 protein It is suggested that the region can be composed. MAbs F2-Pn3.3 and F2- with synthetic peptides Due to the lack of reactivity of Pn3.4, this is the structure-determining site at the C-terminus of HSP72 protein Reacts with. The presence of the protected epitope in the C-terminal 151 region was determined in Example 5 Strongly indicated. There, mice immunized with purified C-169rec are Protected against deadly infection with malignant strains of Coccus pneumoniae HSP72 protein C-terminal 169 or C-terminal 151, or even a smaller fragment thereof, It is shown to be very effective for the development of upcoming vaccines.   The variable region consisting of the amino acid sequences 244 to 330 also constitutes the antigen domain. You. Overlapping peptides CS877 (amino acids 257 to 271) and CS878 ( Amino acids 268 to 281), peptides CS880 (amino acids 286 to 299) and CS882 (A Linear epitopes on amino acids 315 to 333) were identified by hyperimmune serum. Example 9-Streptococcus pyogenes and Streptococcus agala HSP70 (DnaK) obtained from Kuchiae: Cloning and nucleotide sequence of Hsp70 gene; Nucleotide and protein sequence analysis; with Streptococcus pneumoniae Antigenic relationship; Streptococcus agalactiae HSP increased in response to heat 70 Protein Synthesis     A.procedure 1．Strains and plasmid vectors   Streptococcus pyogenes (Group A streptococci) and And Streptococcus agalactiae (Group B streptococci) strains he Laboratoire de la Sante Publique du Quebec (LSPQ), Sainte-Anne de Bel levue, Quebec, Canada. Streptococcus agalactiae Type II strain V8 corresponds to ATCC strain 12973. Streptococcus pyogenes strain Brun o corresponds to ATCC strain 19615. E. coli strain XLI Blue MRF 'was obtained from Stratagene.   5% CO for streptococcal strains_TwoThe cells were cultured at 37 degrees in an incubator. Streptococcus uses 5% sheep blood Tryptic soy plates including (Les Laboratories Quelab. Montreal, Canad a), and shake the liquid culture without shaking, using a heart infusion medium (Dif co Laboratories, Detroit, MI). E. coli strain is 250 rp at 37 degrees C in L medium m shaking culture or culture on L agar medium.   A common cloning phagemid, pBluescript KS (-), was purchased from Stratagene. Entered. 2．Recombinant DNA technology   Restriction enzymes, T4 DNA ligase, and calf intestinal phosphorylase were purchased from suppliers (Pharmac ia (Canada) Inc., Baie d'Urfe, Canada; and New England Biolabs Ltd., M ississauga, Canada). Cesium-ethidium bromide Preparation of plasmid by equilibrium density gradient centrifugation, agarose gel electrophoresis of DNA fragment, Southern hybridization and colony DNA hybridization J. The procedure was as described by Sambrook et al. (Supra). Chromosome D of streptococci NA is B. M. Jayarao et al. (J. Clin. Microbiol., 29, pp. 2774-2778 (1991)). The procedure was prepared applying 90 ml of bacterial culture. For rapid plasmid preparation, D . Performed according to Ish-Horowicz et al. (Nucl. Acids Res. 9, pp. 2989-2998 (1981)). Was. The plasmid used for the determination of the nucleotide sequence of DNA was obtained from Qiagen Inc. (Chatsworth, C Purification was performed using a plasmid kit purchased from A). DNA fragment is phenol According to the freeze method (SA Benson, Biotechniques 2, pp. 67-68 (1984)), Purified from a loin gel. DNA probes were purchased from Boehringer Mannheim (Laval, Canada). ) Using the random primer labeling kit³²P-dCTP or digoxy Labeled with genin (DIG) -11-dUTP. The transformant of the plasmid was Simanis (H anahan, D .; In D. M. Glover (ed.), DNA Cloning, pp. 109-135, (1985)) Made by law. The nucleotide sequence of the plasmid DNA insert should be a synthetic oligonucleotide. Determined using nucleotides. The base sequence determination reaction is performed by Taq Dye Deoxy Term inator Cyc Perform DNA polymerase chain reaction (PCR) using the DNA sequencing kit The electrophoresis was performed using an automatic DNA sequencer 373A (ABI). Assembly of DNA base sequence Is a Sequencer 3.0 program from Gene Codes Corporation (Ann Arbor, MI) Performed with ram. DNA base sequence and polypeptide encoded therefrom Is a program from Intelligenetics, Inc. (Mountain View, CA) This was performed using Gene Works version 2.45. DNA amplification reaction was performed using Perkin Elmer DNA  This was performed using a Thermal Cycler 480. Oligonucleotides are oligonucleotides It was synthesized using a peptide synthesizer model394 (ABI). 3．S. Agalactiae and S. Molecular clonin of the pyogenes gene hsp70 / dnak G   S. Agalactiae and S. The chromosomal DNA derived from Piogenes is It was completely digested with various restriction enzymes having a sequence that recognizes a nucleotide. Initiate 332 bases downstream from the ATG start codon of the S. pneumoniae HSP72 gene DNA probe corresponding to the 782 base pair region The digest was analyzed by Southern hybridization (see SEQ ID NO: 4). This DNA region was selected because of the known Gram-positive bacteria among the hsp70 genes. Because it is well preserved. Oligonucleotide OCRR2 (5'-AAGCTGTTATCACAG TTCCGG) and OCRR3 (5'-GATACCAAGTGACAATGGCG). Pneumoniae PCR amplification of genomic DNA was performed. Of the hybridizing restriction fragments of the genome , Suitable for encoding a 70 kDa polypeptide (> 1.8 kb) A genomic fragment of a corresponding size was extracted from an agarose gel and partially purified. Spirit 782 bp labeled to demonstrate the presence of the hsp70 gene in the genomic restriction fragment S. Perform Southern hybridization using a Pneumoniae DNA probe. Was.   Purified genomic DNA restriction fragments are dephosphorylated and compatible with pBluescript KS (-) Cloned into restriction sites, E. coli strain XLI Blue MRF '. 782 bp S. DNA hybridization using labeled Pneumoniae DNA probe Was screened for colonies. Extracted plasmids are various restriction enzymes To evaluate the size of the inserted sequence and a 782 bp S. pneumoniae DNA probe. The Labeled Southern hybridization confirms the presence of the hsp70 gene Revealed. Plasmid pURV5 is a 4.2 kb HindIII insert of S. agalactiae genomic DNA. Includes the input sequence. Plasmid pURV4 is available from S. 3.5 kb HindII of pyogenes genomic DNA Includes I fragment. Four.Heat shock and protein labeling   S. The stress response to heat shock of Agalactiae was described above in Example 1. like,[³⁵Analyzed by pulse labeling with [S] methionine. SMAN (Methio In nin analysis medium, methionine 1 mg / l, isovitarex 1% (v / v), and choline S. agalactiae bacteria grown overnight (containing 1 mg / l chloride) After separation into pellets, they were resuspended in SMAN medium without methionine. The Bacteria were incubated at 37 ° C. for 1 hour and then bisected by volume. Both samples After incubating at 37 ° C or 43 ° C for 10 minutes, 100 μCi / ml [³⁵S] with methionine Labeled for 30 minutes at 37 ° C. Bacteria are thoroughly washed with PBS, and cell extracts are subjected to DNA Isolation ( M. Mutanolidine and lysoza as described in Jayarao et al., Supra). It was prepared by treating with an imine and subjected to ultrasonic treatment. Five.Immunological features   A series of 6 monoclonal antibodies (F3-Pn3.5 to F3 -Pn3.10) and monoclonal antibodies F1-Pn3.1, F2-Pn3.2, F2-Pn3.3, F2-Pn3 .4 to S. Piogenes and S.A. Reactivity to HSP70 antigen from Agalactiae Was examined by Western blot analysis. S. Piogenes and S. agalacti Treatment of cell lysates from fly with mutanolidine and lysozyme (M. Jayarao et al., supra), sonication, and boiling in SDS-PAGE sample buffer. obtained. Transformed with either pURV4 or pURV6, cut and shortened S. oyrjgenes E. coli producing HSP70 antigen cell lysate from E. coli Checked after boiling in buffer.     B.Streptococcus pyogenes, Streptococcus agalactia DNA sequence of hsp70 / dnak gene of Streptococcus pneumoniae analysis   The sequence of the 2438 base region in the 4.2 kb HindIII insertion sequence of plasmid pURV5 was Were determined. This sequence encodes a polypeptide of 609 amino acids and has 1830 nucleobases. Tide Has an open reading frame (ORF) and a molecular weight of 64907 (SEQ ID NO: 7). reference). ORF starts at the ATG start codon at position 248 and at the TAA stop codon at position 2077. Ends. In front of the ATG start codon is a GAGG sequence starting at position 237. It is complementary to 16S rRNA and is known as the Escherichia coli ribosome binding site. (GD Stormo et al., Nucleic Acids Res. 10, pp. 2971-2996 (1982)). Strep The ORF and polypeptide of the HSP70 protein of Tococcus agalactiae To the ORF and polypeptide of Hsp72 protein of P. pneumoniae , 85% and 95% respectively correspond.   Preliminary nucleotide sequence with the HSP72 protein of Streptococcus pneumoniae By comparison, the 3.5-kb HindIII insert on plasmid pURV4 was The lack of 3'-terminal coding region of hsp70 gene of S. pyogenes . 3-kb Sa containing the entire coding region of the hsp70 gene of Streptococcus pyogenes Attempt to clone the lI gene fragment, lacking the 5'-end coding region of this gene. A plasmid pURV6 containing a .1-kb insert was obtained. On plasmid pURV4 or pURV6 Analysis of the hsp70 gene region of To be 2183 nucleotides including an 1824 base pair ORF encoding the repeptide Found (see SEQ ID NO: 20). Starting from the ATG start codon at position 204, Ends at the 2030th TAA stop codon. Streptococcus agalacti Presumed to be located at position 193 before the ATG start codon, similar to the fly hsp70 gene The upper ribosome binding sequence GAGG is present (GD Stormo, supra). Streptocco ORF of the hsp70 gene of C. pyogenes and the polypep encoded thereby Pride is the ORF and polypeptide of the HSP72 protein of Streptococcus pneumoniae. For the peptide, 85% and 94% respectively correspond. The ORF of plasmid pURV4 is Encodes the C-terminal 41 amino acids of the HSP70 protein of Streptococcus pyogenes 125 base pairs are missing. This ORF is the N-terminal 567 amino acids of the HSP70 protein (N-567rec) Is coded. The ORF of plasmid pURV6 is Streptococcus pyogenes The HSP70 protein lacks 114 base pairs encoding the N-terminal 38 amino acids. This ORF Encodes the C-terminal 570 amino acids (C-570rec) of the HSP70 protein. Streptocco Caucus pyogenes, Streptococcus agalactiae and Streptococcus Kas New DNA open reading frame (Figure 24) and HSP70 / DnaK protein of Extensive comparisons of the amino acid and amino acid sequences (Figure 25) show 82% and 93% I knew it was there.     C.Of HSP70 protein synthesis in Streptococcus agalactiae in response to heat Rise [³⁵Heat shock pulsed with [S] methionine and a control streptococcal One-dimensional SDS-polyacrylamide gel electrophoresis of cell extracts of Cass agalactiae Analysis shows that 70 kDa protein synthesis is significantly increased after heat stress (FIG. 26, lanes 1 and 2). Heat-induced 70 kDa from radioimmunoprecipitation analysis Protein can be easily detected at 43 degrees using monoclonal antibody F2-Pn3.4 Indicated. This indicates that this protein is a heat shock protein 70 (hsp70 / DnaK) family. (Fig. 26, lanes 3 and 4).     D.Streptococcus pneumoniae, Streptococcus pyogene Antigenicity of HSP70 protein in E. coli and Streptococcus agalactiae Involvement   In this study, a panel of MAbs was identified as Streptococcus pyogenes, Streptococcus. Coccus agalactiae and Streptococcus pneumoniae HSP70 protein I have studied it in terms of white matter antigenic involvement. 8 out of 10 MAbs are all 3 streptococcal species React, which suggests that some B cell epitopes are Streptococcus ni Humoniae, Streptococcus pyogenes and Streptococcus aureus It is suggested to be widely present in Galactiae. Streptococcus New -Epitope located between amino acids 584 and 607 of H. moniae HSP72 protein and parent Compatible MAb F1-Pn3.1 is Streptococcus pyogenes or Streptococcus pyogenes It does not react with any of the HSP70 antigens of Coccus agalactiae. Three linked balls A comparison of this region of the strain indicates that 5 to 8 amino acids located between amino acids 589 and 596. Differences were seen with amino acids. MAbs that also have an affinity for the epitope present in the C-151 region  F2-Pn3.3 reacts with Streptococcus agalactiae, Does not react with Tococcus pyogenes. Based on these results, the streptococcal species The HSP70 protein is clearly shown to be structurally or immunologically related. doing. Only However, there are immunological differences.   MAbs with truncated recombinant Streptococcus pyogenes HSP70 protein  From the analysis of the reactivity of F3-Pn3.5, F3-Pn3.6, F3-Pn3.7 and F3-Pn3.10, Antigen region near the amino terminus of Tococcus pneumoniae HSP72 protein identified Was. These MAbs reacted with the construct expressing the N-terminal 567 amino acids, but did not It did not react with the construct expressing the -570 fragment. From these data, MAbs  Epitopes recognized by F3-Pn3.5, F3-Pn3.6, F3-Pn3.7, and F3-Pn3.10. Is located between residues 1 and 38 of the HSP72 protein. Example 10 Use of HSP70 / HSP72 as a human vaccine   To prepare a vaccine for use by humans, the vaccine described herein may be used. A suitable HSP72 antigen will be selected from the peptides. For example, those skilled in the art will recognize HSP70 / HSP72 A vaccine containing an immunogenic epitope centered on a polypeptide or a fragment thereof Let's design a chin. To prepare a substantially pure recombinant antigen, The use of techniques of offspring biology is particularly suitable.   The composition of the vaccine can take various forms. These include, for example, powders, aqueous Administration of solids, semi-solids, and liquids, such as liquids or suspensions, and liposomes Forms are included. The HSP70 / HSP72 antigen of the present invention has a protective immunity when administered to humans. Based on the inventors' belief that it would induce an epidemic reaction, the composition of the present invention Others used to immunize humans, such as Tetanus and Diphtheria Will be similar to the protein. Accordingly, the compositions of the present invention are preferably And adjuvants that are commercially acceptable. They include, for example, incomplete Freud Bant, aluminum hydroxide, muramyl peptide, w / o emulsion, liposo Or non-toxic B subunits derived from cholera toxin is there. Most preferably, the composition is a w / o emulsion or aluminum hydroxide Includes N as an adjuvant.   The composition will be administered to the patient in various pharmaceutically acceptable forms. It These include intramuscular, intradermal, subcutaneous, or topical administration. Preferably, Wakuchi Is administered intramuscularly.   Generally, the dose will be approximately 0.01 per patient with HSP72 antigen with adjuvant. Consist of a first dose of 10 mg, preferably 0.1 to 1.0 mg, followed by one or more doses. The above additional administration is performed. Preferably, the additional dose is given at 1 and 6 months after the first dose Do.   An important aspect of the development of pneumococcal vaccines is the issue of mucosal immunity. ideal Mucosal vaccine can be safely taken orally or intranasally in 1 or 2 or 3 doses Then, protective antibodies are induced on an appropriate body surface in response to systemic immunity. Mucosal wrap The composition of the adjuvant, inert particulate carrier, or live recombinant vehicle Will include   The anti-HSP72 antibody of the present invention can be obtained from S. pneumoniae, S. pirogenes, Agaractia D) It is useful for passive immunotherapy and immunoprevention in humans infected with or related bacteria. is there. Dosage forms and treatment regimens for such passive immunization are It will be similar to the law.   The antibodies according to the present invention can be obtained from the American Type Culture Collection In Rockville, Mar. Hybrid producing MAb F1-Pn3.1, deposited with yland, USA on July 21, 1995 And identified as the murine hybridoma cell line F1-Pn3.1 . The deposit number for this deposit is HB 11960.   Although the inventors have described herein some embodiments of the present invention, Other aspects in which our basic aspects make the compositions and procedures of the invention useful. Obviously, it can be modified to provide the same. Therefore, aspects of the present invention Modifications of the aspects defined in the foregoing specification and appended claims and It is recommended that all changes be included. The present invention is described herein. It is not limited to the specific embodiments presented as examples.

[Procedural amendment] [Date of submission] December 11, 1997 [Details of amendment] Claims 1. (a) HSP72 polypeptide having the amino acid sequence of SEQ ID NO: 5; (b) HSP70 (Dnak) polypeptide having the amino acid sequence of SEQ ID NO: 20; (c) HSP70 (Dnak) having the amino acid sequence of SEQ ID NO: 22 A) a polypeptide, and (d) a fragment of the C-terminal portion of the HSP70 / 72 polypeptide. 2． The fragment of (d) comprises amino acids 439-607 (C-169) of SEQ ID NO: 5, amino acids 457-607 (C-151) of SEQ ID NO: 5, amino acids 527-541 of SEQ ID NO: 5, and the sequence 2. The polypeptide of claim 1, wherein the polypeptide is selected from the group consisting of amino acids 586-600 of No. 5 . 3． SEQ ID NO: amino acid sequence of the 5, or having an analogue or derivative thereof請 Motomeko 1 wherein the polypeptide. Four. 2. The polypeptide according to claim 1 , which has the amino acid sequence of SEQ ID NO: 20, or an analog or derivative thereof . Five. 2. The polypeptide according to claim 1 , which has the amino acid sequence of SEQ ID NO: 22, or an analog or derivative thereof . 6． 2. The polypeptide according to claim 1 , which has the amino acid sequence of SEQ ID NO: 26, or an analog or derivative thereof . 7． SEQ ID NO: 7 amino acid sequence of, or having an analogue or derivative thereof請 Motomeko 1 wherein the polypeptide. 8． SEQ ID NO: 8 amino acid sequence of, or having an analogue or derivative thereof請 Motomeko 1 wherein the polypeptide. 9． SEQ ID NO: 9 amino acid sequence, or having an analogue or derivative thereof請 Motomeko 1 wherein the polypeptide. Ten. 2. The polypeptide according to claim 1 , which has the amino acid sequence of SEQ ID NO: 10, or an analog or derivative thereof . 11． 2. The polypeptide according to claim 1 , which has the amino acid sequence of SEQ ID NO: 11, or an analog or derivative thereof . 12． 2. The polypeptide according to claim 1 , which has the amino acid sequence of SEQ ID NO: 12, or an analog or derivative thereof . 13. 2. The polypeptide according to claim 1 , which has the amino acid sequence of SEQ ID NO: 13, or an analog or derivative thereof . 14. 2. The polypeptide according to claim 1 , which has the amino acid sequence of SEQ ID NO: 14, or an analog or derivative thereof . 15． 2. The polypeptide according to claim 1 , which has the amino acid sequence of SEQ ID NO: 15, or an analog or derivative thereof . 16． 2. The polypeptide according to claim 1 , which has the amino acid sequence of SEQ ID NO: 16, or an analog or derivative thereof . 17． 2. The polypeptide according to claim 1 , which has the amino acid sequence of SEQ ID NO: 17, or an analog or derivative thereof . 18． 2. The polypeptide according to claim 1 , which has the amino acid sequence of SEQ ID NO: 18, or an analog or derivative thereof . 19. 2. The polypeptide according to claim 1 , which has the amino acid sequence of SEQ ID NO: 23, or an analog or derivative thereof . 20. 2. The polypeptide according to claim 1 , which has the amino acid sequence of SEQ ID NO: 24, or an analog or derivative thereof . twenty one. 21. The polypeptide according to any one of claims 1 to 20 , which exhibits an immune response specific to a Streptococcus strain. twenty two. (a) a group consisting of an HSP72 polypeptide having the amino acid sequence of SEQ ID NO: 5, and ( b ) fragments of the above polypeptide, alone or linked to another polypeptide to form a fusion protein 2. The polypeptide of claim 1, wherein the polypeptide is selected from: twenty three. The fragment of paragraph (b) is selected from the group consisting of amino acids 439-607 (C-169) of SEQ ID NO: 5, amino acids 527-541 of SEQ ID NO: 5, and amino acids 586-600 of SEQ ID NO: 5 23. The polypeptide of claim 22 . twenty four. 23. The polypeptide according to claim 22 , wherein the fusion protein of ( b ) is a fucose-isomerized HSP72 (C-169) protein having the amino acid sequence of SEQ ID NO: 3. twenty five. (a) HSP72 DNA sequence of SEQ ID NO: 4, (b) HSP70 (DnaK) DNA sequence of SEQ ID NO: 19, (c) HSP70 (DnaK) DNA sequence of SEQ ID NO: 21, ( d ) Any of the above DNA sequences And ( e ) a DNA sequence selected from the group consisting of fragments of any of the above DNA sequences, alone or combined with other DNA sequences to form a fusion DNA sequence . 26. SEQ ID NO: Equation 4 nucleotides 682～ nucleotide 2502, claim 25 Symbol mounting of DNA sequences. 27. 26. The DNA sequence of claim 25 comprising the formula from nucleotide 1996 to nucleotide 2502 of SEQ ID NO: 4 . 28. 26. The DNA sequence of claim 25, comprising the formula from nucleotide 2050 to nucleotide 2502 of SEQ ID NO: 4 . 29. 26. The DNA sequence of claim 25, comprising the formula from nucleotide 2260 to nucleotide 2304 of SEQ ID NO: 4 . 30. 26. The DNA sequence of claim 25, comprising the formula from nucleotide 2437 to nucleotide 2481 of SEQ ID NO: 4 . 31. 26. The DNA sequence of claim 25 comprising the formula from nucleotide 204 to nucleotide 2027 of SEQ ID NO: 19 . 32. 26. The DNA sequence of claim 25, comprising the formula from nucleotide 248 to nucleotide 2074 of SEQ ID NO: 21 . 33. 26. The DNA sequence of claim 25, comprising the formula from nucleotide 4 to nucleotide 456 of SEQ ID NO: 25 . 34. A DNA sequence encoding a polypeptide according to any one of claims 1 to 20 . 35. The DNA sequence according to claim 25 , which is selected from the group consisting of the following (a) to (c): (a) a HSP72 DNA sequence of SEQ ID NO: 4; ( b ) a degenerate DNA sequence to the DNA sequence; and ( c ) A fragment of any of the above DNA sequences, alone or in combination with another DNA sequence to form a fusion DNA sequence. 36. The fragment of section ( c ) comprises nucleotides 1996 to 2502 (C-169) of SEQ ID NO: 4 (amino acids 439 to 607), nucleotides 2260 to 2304 of SEQ ID NO: 4 (amino acids 527 to 541), and SEQ ID NO: 4 36. The DNA sequence of claim 35 , wherein the DNA sequence is selected from the group consisting of: nucleotides 2437-2481 (amino acids 586-600). 37. 36. The DNA sequence of claim 35 , wherein the fusion DNA sequence of paragraph ( c ) is the fucose isomerized HSP72 (C-169) DNA sequence of SEQ ID NO: 1 (nucleotides 771-2912). 38. An expression vector comprising at least one DNA sequence according to claim 35 operably linked to a promoter. 39. A recombinant DNA molecule comprising a DNA sequence according to any one of claims 25 to 34 and one or more expression control sequences operably linked to the DNA sequence. 40. 40. The recombinant DNA molecule according to claim 39 , wherein the expression control sequence is an inducible expression vector. 41. 41. The recombinant molecule according to claim 40 , wherein the expression vector comprises a λ PL promoter. 42. 40. The recombinant molecule according to claim 39 , comprising a plasmid selected from the group consisting of pURV3, pURV4, pURV5, pURV6, pJBD291, pJBDΔ4, pJBDk51, pJBD171, pJBD177, pJBD179, pJBDΔ1, pJBDf51, and pJBDf62. 43. A single cell host transformed with the expression vector according to claim 38 . 44. A single cell host transformed with the recombinant DNA molecule of claim 39 . 45. 45. The single cell host of claim 44 , wherein the single cell host is selected from the group consisting of a cerebral strain XLI Blue MRF ', W3110, JM109, Y1090, and BL21 (DE3). 46. A method for producing a polypeptide or a fragment thereof, comprising culturing the single-cell host according to any one of claims 43 to 45 and separating the polypeptide or the fragment. 47. 47. A polypeptide in a substantially pure form obtained by the method of claim 46 . 48. An antibody or a fragment thereof that specifically binds to the polypeptide according to any one of claims 1 to 20 . 49. An antibody or a fragment thereof that specifically binds to an epitope recognized by monoclonal antibody F1-Pn3.1. 50. 49. The antibody or fragment according to claim 48 , which is a monoclonal antibody. 51. 51. The monoclonal antibody or fragment according to claim 50 , which is derived from a mouse. 52. 52. The monoclonal antibody or fragment of claim 51 , which is of the IgG type. 53. Monoclonal antibody F1-Pn3.1. 54. A method of isolating the antibody of claim 48 comprising the steps of: (a) introducing a preparation of the polypeptide of any one of claims 1 to 20 into a mammal; and (b) And b) isolating serum from a mammal containing the antibody. 55. A method for isolating the monoclonal antibody according to claim 50 , comprising the steps of: (a) introducing a preparation of the polypeptide according to any one of claims 1 to 20 into a mammalian antibody-producing cell; (B) fusing the antibody-producing cells with myeloma cells to produce hybridoma cells; and (c) isolating the monoclonal antibodies from the hybridoma cells. 56. A pharmaceutical composition comprising the polypeptide according to any one of claims 1 to 20 . 57. 57. The pharmaceutical composition according to claim 56, which is a vaccine. 58. 57. The pharmaceutical composition according to claim 56 , further comprising one or more pharmaceutically acceptable excipients. 59. A pharmaceutical composition comprising one or more antibodies or fragments thereof according to claim 48 . 60. 60. The pharmaceutical composition according to claim 59 , which is a vaccine. 61. 61. The pharmaceutical composition according to claim 60 , further comprising a pharmaceutically acceptable excipient. 62. 62. The pharmaceutical composition according to claim 60 or 61 , wherein the antibody is F1-Pn3.1. 63. A method of preventing infection of a patient with Streptococcus pneumoniae or a related bacterium, comprising administering a pharmaceutically effective amount of the vaccine of claim 57 , 60 or 61 . 64. Including administering the claims 57, 60 or 61 wherein the vaccine, the pharmaceutically effective amount, Streptococcus pneumoniae, Streptococcus pyogenes, were or a method of preventing infection of a patient by Streptococcus agalactiae. 65. A method of treating a patient infected or potentially infected with Streptococcus pneumoniae or a related bacterium, comprising administering a pharmaceutically effective amount of the vaccine of claim 60 or 61 . 66. 49. A method for detecting Streptococcus pneumoniae or related bacteria in a biological sample, comprising: ( a ) incubating the antibody or fragment of claim 48 with a biological sample to form a mixture. And ( b ) detecting a specifically bound antibody or fragment in the mixture indicating the presence of Streptococcus pneumoniae or related bacteria. 67. 67. The method according to claim 66 , wherein the antibody is F1-Pn3.1. 68. 23. A method for detecting an antibody specific for Streptococcus pneumoniae or a related bacterium in a biological sample, comprising the steps of: ( a ) Biologically transforming the polypeptide of claim 2 or 22 to form a mixture. Incubating with the target sample; and ( b ) detecting the specifically bound polypeptide in the mixture, indicating the presence of antibodies specific for Streptococcus pneumoniae or related bacteria. 69. A method for detecting Streptococcus pneumoniae or related bacteria in a biological sample comprising the steps of: ( a ) combining a DNA probe having the DNA sequence of claim 35 with a biological sample to form a mixture. Incubating; and ( b ) detecting a specifically bound DNA probe in the mixture indicating the presence of Streptococcus pneumoniae and related bacteria. 70. 70. The method of claim 69 , wherein the DNA probe is an oligomer having a sequence complementary to at least about 6 adjacent nucleotides of the DNA sequence of claim 35 . 71. 71. The method of claim 70 , further comprising: (a) providing a series of oligomers that are primers for the polymerase chain reaction and flanking the target region; and (b) amplifying the target region by the polymerase chain reaction. 72. ( a ) incubating the antibody or fragment of claim 48 with a biological sample to form a mixture; and ( b ) indicating the presence of Streptococcus pneumoniae, Streptococcus pyogenes, or Streptococcus agalactiae. Detecting a specifically bound antibody or fragment of Streptococcus pneumoniae, Streptococcus pyogenes, or Streptococcus agalactiae in a biological sample comprising: 73. ( a ) incubating the polypeptide of claim 1 or 21 with a biological sample to form a mixture; and ( b ) an antibody specific for Streptococcus pneumoniae, Streptococcus pyogenes, or Streptococcus agalactiae. Detecting a specifically bound polypeptide in the mixture that indicates its presence. A method for detecting an antibody specific for Streptococcus pneumoniae, Streptococcus pyogenes, or Streptococcus agalactiae in a biological sample comprising: 74. ( a ) incubating a DNA probe having the DNA sequence of claim 25 or 34 with a biological sample to form a mixture; and ( b ) a Streptococcus pneumoniae, Streptococcus pyogenes, or Streptococcus agalactiae. Detecting a specifically bound DNA probe in the mixture that indicates its presence. A method for detecting Streptococcus pneumoniae, Streptococcus pyogenes, or Streptococcus agalactiae in a biological sample comprising: 75. 75. The method of claim 74 , wherein the DNA probe is an oligomer having a sequence complementary to at least about 6 adjacent nucleotides of the DNA sequence of claim 25 or 34 . 76. 76. The method of claim 75 , further comprising: (a) providing a series of oligomers that are primers for the polymerase chain reaction and flanking the target region; and (b) amplifying the target region by the polymerase chain reaction. 77. Prevention, diagnosis, and an object immunotherapy or therapy, the use of polypeptide of claim 1 or 21, wherein. 78. 22. Use of a pharmaceutically effective amount of the polypeptide according to claim 1 or 21 for the purpose of preventing the transmission of streptococci to humans. 79. 22. Use of the polypeptide according to claim 1 or 21 for the manufacture of a medicament for preventing transmission of streptococci to humans . 80. For the manufacture of a vaccine for the prevention of infection of Streptococcus humans, the use of 請 Motomeko 1 or 21 wherein the polypeptide. 81. 22. Use of the polypeptide according to claim 1 or 21 for the production of a kit for detecting and diagnosing infection of a human with streptococcus . 82. For the manufacture of a vaccine for the prevention of infection of Streptococcus humans, using methods 請 Motomeko 46 wherein. 83. 47. Use of the method of claim 46 for the manufacture of a kit for detecting and diagnosing streptococcal infection in humans . 84. Prevention, diagnosis, for the purpose of immune therapy, or therapy, the use of claim 48, wherein the antibody. 85. 54. Use of a pharmaceutically effective amount of the antibody according to claim 48 or 53 for the purpose of preventing human infection with streptococci . 86. 54. Use of the antibody according to claim 48 or 53 for the manufacture of a medicament for preventing transmission of streptococci to humans . 87. For the manufacture of a vaccine for the prevention of infection of Streptococcus humans, the use of 請 Motomeko 48 or 53, wherein the antibody. 88. 54. Use of the antibody according to claim 48 or 53 for the manufacture of a kit for detecting and diagnosing streptococcal infection in humans . 89. For the manufacture of a vaccine for the prevention of infection of Streptococcus humans, the use of 請 Motomeko 54 or 55 A method according. 90. You for the manufacture of a kit for detecting and diagnosing infection of Streptococcus humans, the use of claim 54 or 55 A method according. 91. For the purpose of treatment of infections of the streptococcal humans, the use of the antibody of claim 48 or 53 wherein the pharmaceutically effective amount. 92. 54. Use of an antibody according to claim 48 or 53 for the manufacture of a medicament for treating streptococcal infection in humans . 93. Use of a DNA sequence according to any one of claims 25 to 34 for prevention, diagnosis, immunotherapy or therapy . 94. Use of a DNA sequence according to any one of claims 25 to 34 for the manufacture of a kit for detecting and diagnosing streptococcal infection in humans . 95. Streptococcal infection is Streptococcus pneumoniae, Streptomyces cock Kas pyogenes, or is provoked by Streptococcus agalactiae, use according to any one of claims 77 to 94.

──────────────────────────────────────────────────の Continued on the front page (51) Int.Cl. ⁶ Identification code FI C12N 1/21 C12N 1/21 C12P 21/00 C12P 21/00 C 21/08 21/08 C12Q 1/68 C12Q 1/68 A G01N 33/53 G01N 33/53 D 33/569 33/569 E // (C12N 1/21 C12R 1:19) (C12P 21/00 C12R 1:19) (81) Designated countries EP (AT, BE, CH) , DE, DK, ES, FI, FR, GB, GR, IE, IT, LU, MC, NL, PT, SE), OA (BF, BJ, CF, CG, CI, CM, GA, GN, ML) , MR, NE, SN, TD, TG), AP (KE, LS, MW, SD, SZ, UG), UA (AM, AZ, BY, KG, KZ, MD, RU, TJ, TM), AL , AM, AT, AU, Z, BB, BG, BR, BY, CA, CH, CN, CZ, DE, DK, EE, ES, FI, GB, GE, HU, IS, JP, KE, KG, KP, KR, KZ, LK , LR, LS, LT, LU, LV, MD, MG, MK, MN, MW, MX, NO, NZ, PL, PT, RO, RU, SD, SE, SG, SI, SK, TJ, TM, TR, TT, UA, UG, US, UZ, VN (72) Inventor Martin Dennis Saint-Augustin-Dude-Demaure Gaborry Street, Quebec, Canada 4728-Gee (72) Inventor Riox Clement Ville, Quebec, Canada Capu-Rouge Jean Charles Can Tin 1012

Claims (1)

[Claims] 1. (a) an HSP72 polypeptide having the amino acid sequence of SEQ ID NO: 5;     (b) an HSP70 (Dnak) polypeptide having the amino acid sequence of SEQ ID NO: 20;     (c) an HSP70 (Dnak) polypeptide having the amino acid sequence of SEQ ID NO: 22;     (d) Infection of Streptococcus pneumoniae cells into mammalian hosts A polypeptide that shows an immunological reaction with the resulting antibody, wherein the antibody is (a), ( those which show an immunological reaction with the polypeptide of b) or (c);     (e) An antibody that produces an immunological reaction with the polypeptide of (a), (b), or (c). A native polypeptide;     (f) antibodies and immunity raised by immunizing the polypeptide of (a), (b), or (c); A polypeptide that exhibits a biological response; and     (g) alone or combined with other polypeptides to form a fusion protein A fragment of any of the above polypeptides, wherein A polypeptide selected from the group consisting of: 2. The polypeptide of claim 1, wherein the polypeptide of (d) is a polypeptide. Selected from the group consisting of Leptococcus and Enterococcus polypeptides The polypeptide of (d). 3. The polypeptide of claim 1, wherein the polypeptide of (d) is a polypeptide. Leptococcus pneumoniae, Streptococcus agalactiae, strike Leptococcus pyogenes, Streptococcus mutans, Streptococcus Polypeptides of the species Chacus sanguis and Enterococcus faecalis A polypeptide selected from the group consisting of: 4. The polypeptide of claim 1, wherein the polypeptide of (d) is a polypeptide. Leptococcus pneumoniae, Streptococcus agalactiae, and Selected from the group consisting of polypeptides of the species Streptococcus pyogenes Polypeptide. 5. The fragment of (g) in the polypeptide according to claim 1, wherein the fragment of SEQ ID NO: 5 (C-1 69); amino acids 457-607 of SEQ ID NO: 5 (C-151); Selected from the group consisting of amino acids 527-541 and amino acids 586-600 of SEQ ID NO: 5 Polypeptide. 6. Polypeptide having the amino acid sequence of SEQ ID NO: 5, analogs, homologs and derivatives thereof peptide. 7. Polypeptide having the amino acid sequence of SEQ ID NO: 20, analogs, homologs and derivatives thereof peptide. 8. Polypeptide having the amino acid sequence of SEQ ID NO: 22, analogs, homologs and derivatives thereof peptide. 9. Polypeptide having the amino acid sequence of SEQ ID NO: 26, analogs, homologs and derivatives thereof peptide. Ten. Polypeptide having the amino acid sequence of SEQ ID NO: 7, its analogs, homologs and derivatives peptide. 11． Polypeptide having the amino acid sequence of SEQ ID NO: 8, its analogs, homologs and derivatives peptide. 12． Polypeptide having the amino acid sequence of SEQ ID NO: 9, analogs, homologs and derivatives thereof peptide. 13. Polypeptide having the amino acid sequence of SEQ ID NO: 10, analogs, homologs and derivatives thereof peptide. 14. Polypeptide having the amino acid sequence of SEQ ID NO: 11, analogs, homologs and derivatives thereof peptide. 15． Polypeptide having the amino acid sequence of SEQ ID NO: 12, analogs, homologs and derivatives thereof peptide. 16． Polypeptide having the amino acid sequence of SEQ ID NO: 13, analogs, homologs and derivatives thereof peptide. 17． Polypeptide having the amino acid sequence of SEQ ID NO: 14, analogs, homologs and derivatives thereof peptide. 18． Polypeptide having the amino acid sequence of SEQ ID NO: 15, analogs, homologs and derivatives thereof peptide. 19. Polypeptide having the amino acid sequence of SEQ ID NO: 16, analogs, homologs and derivatives thereof peptide. 20. Polypeptide having the amino acid sequence of SEQ ID NO: 17, its analogs, homologs and derivatives peptide. twenty one. Polypeptide having the amino acid sequence of SEQ ID NO: 18, analogs, homologs and derivatives thereof peptide. twenty two. A polypeptide according to any one of claims 1 to 21 and 100-101. The polypeptide exhibits an immune response specific to the Streptococcus strain. A polypeptide characterized by the following. twenty three. (a) an HSP72 polypeptide having the amino acid sequence of SEQ ID NO: 5;     (b) Infection of Streptococcus pneumoniae cells into mammalian hosts A polypeptide that exhibits an immunological reaction with an antibody produced therefrom, wherein the antibody is (a) Which show an immunological reaction with the HSP72 polypeptide of     (c) a polypeptide capable of producing an antibody reactive with the HSP72 polypeptide of (a). Repeptide;     (d) Antibody and immunological reaction generated by immunization with HSP72 polypeptide of paragraph (a) A polypeptide that exhibits     (e) alone or linked to other polypeptides to form a fusion protein A fragment of any of the above polypeptides, wherein A polypeptide selected from the group consisting of: twenty four. The polypeptide of claim 23, wherein the polypeptide of (b) is a polypeptide. Selected from the group consisting of Leptococcus and Enterococcus polypeptides Polypeptide. twenty five. The polypeptide of claim 23, wherein the polypeptide of (b) is a polypeptide. Leptococcus pyogenes, Streptococcus mutans, Streptococcus Polypeptides of the species Chacus sanguis and Enterococcus faecalis A polypeptide selected from the group consisting of: 26. The polypeptide of claim 23, wherein the fragment of (e) is SEQ ID NO: 5 (C-1 69) amino acids 439-607; SEQ ID NO: 5 amino acids 527-541; SEQ ID NO: 5 amino acids 5 27-541, and a polypeptide selected from the group consisting of amino acids 586-600 of SEQ ID NO: 5 Puchido. 27. The polypeptide of claim 23, wherein the fusion protein of (e) is SEQ ID NO: 3. Characterized by being a fucose isomerized HSP72 (C-169) protein having the amino acid sequence of Polypeptide. 28. (a) the HSP72 DNA sequence of SEQ ID NO: 4;     (b) HSP70 (Dnak) DNA sequence of SEQ ID NO: 19;     (c) the HSP70 (Dnak) DNA sequence of SEQ ID NO: 21;     (d) Infection of Streptococcus pneumoniae cells into mammalian hosts A DNA sequence encoding a polypeptide that is immunologically reactive with the resulting antibody. The antibody shows an immunological reaction with the HSP72 polypeptide (SEQ ID NO: 5);     (e) producing an antibody reactive with the HSP72 polypeptide (SEQ ID NO: 5); A DNA sequence encoding the resulting polypeptide;     (f) Antibodies generated by immunization with HSP72 polypeptide (SEQ ID NO: 5) and immunology A DNA sequence encoding a polypeptide that exhibits a response;     (g) a degenerate DNA sequence for any of the above DNA sequences; and     (h) alone or combined with other DNA sequences to form a fusion DNA sequence A fragment of any of the above DNA sequences; A DNA sequence selected from the group consisting of: 29. The DNA sequence according to claim 28, wherein the DNA sequence according to (d) is a streptococcal A DNA sequence selected from the group consisting of DNA sequences of the genus Cass and Enterococcus. 30. The DNA sequence according to claim 28, wherein the DNA sequence according to (d) is a streptococcal Cas pneumoniae, Streptococcus agalactiae, Streptococcus Cas Piogenes, Streptococcus mutans, Streptococcus sa From the group consisting of the DNA sequences of Nguisu and Enterococcus faecalis DNA sequence to be selected. 31. The DNA sequence according to claim 28, wherein the DNA sequence according to (d) is a streptococcal Cas pneumoniae, Streptococcus agalactiae, and Strep A DNA sequence selected from the group consisting of DNA sequences of the species Tococcus pyogenes. 32. SEQ ID NO: 4 from nucleotide 682 to nucleotide 2502 encoding HSP72 DNA sequence of the sequence, or a derivative thereof. 33. Nucleotide 1996 to nucleotide 2502 coding for fragment C-169 of HSP72 The DNA sequence of SEQ ID NO: 4, or a derivative thereof. 34. Nucleotide 2050 to nucleotide 2502 coding for fragment C-151 of HSP72 The DNA sequence of SEQ ID NO: 4, or a derivative thereof. 35. SEQ ID NO: 4 from nucleotide 2260 to nucleotide 2304, or a derivative thereof DNA sequence of conductor. 36. SEQ ID NO: 4 from nucleotide 2437 to nucleotide 2481, or a derivative thereof DNA sequence of conductor. 37. Nucleotide 204 encoding Streptococcus agalactiae HSP70 From SEQ ID NO: 19 to nucleotide 2027, or a derivative thereof. 38. From nucleotide 248 encoding HSP70 of Streptococcus pyogenes The DNA sequence of SEQ ID NO: 21 at nucleotide 2074, or a derivative thereof. 39. A nucleotide from nucleotide 4 encoding the C-terminal residue fragment (C-151) of HSP72; DNA sequence of SEQ ID NO: 25 of SEQ ID NO: 456, or a derivative thereof. 40. A polypeptide according to any one of claims 1-21 and 100-101. DNA sequence to be loaded. 41. A DNA sequence selected from the group consisting of the following (a)-(f):     (a) the HSP72 DNA sequence of SEQ ID NO: 4;     (b) Infection of Streptococcus pneumoniae cells into mammalian hosts A DNA sequence encoding a polypeptide that is immunologically reactive with the resulting antibody. The antibody shows an immunological reaction with the HSP72 polypeptide (SEQ ID NO: 5);     (c) producing an antibody reactive with the HSP72 polypeptide (SEQ ID NO: 5); A DNA sequence encoding the resulting polypeptide;     (d) Antibodies generated by immunization with the HSP72 polypeptide (SEQ ID NO: 5) and immunology A DNA sequence encoding a polypeptide that exhibits a response;     (e) a degenerate DNA sequence for any of the above DNA sequences; and     (f) alone or combined with other DNA sequences to form a fusion DNA sequence A fragment of any of the above DNA sequences. 42. The DNA sequence of claim 41, wherein the DNA sequence of (b) is Streptococcus and A DNA sequence selected from the group consisting of DNA sequences of the genus Enterococcus. 43. 42. The DNA sequence according to claim 41, wherein the DNA sequence according to (b) is a Streptococcus pi Ogenes, Streptococcus mutans, Streptococcus sanguis , And a DNA sequence of Enterococcus faecalis sp. DNA sequence. 44. The DNA sequence of claim 41, wherein the fragment of (f) is the nucleotide of SEQ ID NO: 4 (C-169). 1996-2502 (amino acids 439-607); nucleotides 2260-2304 of SEQ ID NO: 4 (amino acids No. 527-541); and nucleotides 2437-2481 of SEQ ID NO: 4 (amino acids 586-600) A) a DNA sequence selected from the group consisting of: 45. The DNA sequence of claim 41, wherein the fusion DNA sequence of (f) is the fucose of SEQ ID NO: 1. A DNA sequence which is an isomerized HSP72 (C-169) DNA sequence. 46. At least one DNA sequence according to claim 41 operatively linked to a promoter; Expression vector containing. 47. A DNA sequence according to any one of claims 28 to 40, wherein the DNA sequence is functional. A recombinant DNA molecule comprising one or more expression control sequences linked to 48. 48. The recombinant DNA molecule of claim 47, wherein the expression control sequence is inducible. A recombinant DNA molecule, which is a vector. 49. 49. The recombinant molecule of claim 48, wherein said expression vector comprises a λ PL promoter. A recombinant molecule comprising: 50. pURV3, pURV4, pURV5, pURV6, pJBD291, pJBDΔ4, pJBDk51, pJBD177, pJBD Select from the group consisting of 171, pJBD177, pJBD179, pJBDΔ1, pJBDf51, and pJBDf62 48. The recombinant molecule of claim 47, comprising a plasmid obtained. 51. A single cell host transformed with the expression vector of claim 46. 52. A single cell host transformed with the recombinant DNA molecule of claim 47. 53. 53. The unicellular host of claim 52, wherein the host is E. coli sp.XLI Blue MRF. , W3110, JM109, and BL21 (DE3). 54. Culturing the single cell host of claim 51 and isolating said polypeptide or fragment And producing a polypeptide or fragment. 55. An antibody or a fragment thereof that specifically binds to the polypeptide of claim 23. 56. Specific binding to the epitope recognized by monoclonal antibody F1-Pn3.1 Antibodies or fragments thereof. 57. 56. The antibody or fragment of claim 55 which is a monoclonal antibody. 58. 58. The monoclonal antibody or fragment of claim 57, derived from a mouse. 59. 59. The monoclonal antibody or fragment of claim 58, which is of the IgG type. 60. Selected from the group consisting of F1-Pn3.1, F2-Pn3.2, F2-Pn3.3, and F2-Pn3.4 60. The monoclonal antibody of claim 59. 61. Monoclonal antibody F1-Pn3.1. 62. (a) introducing a preparation of the polypeptide of claim 23 into a mammal; and     (b) Isolation of serum from mammals containing the above antibodies 56. A method for isolating the antibody of claim 55 comprising: 63. (A) antibody production in a mammal of the polypeptide preparation of claim 23 Introduction into cells;     (b) Hybridoma by fusing antibody-producing cells with myeloma cells Production of cells, and     (c) Isolation of the above monoclonal antibody from hybridoma cells 58. A method for isolating the monoclonal antibody of claim 57 comprising: 64. A pharmaceutical composition comprising the polypeptide of claim 23. 65. 65. The pharmaceutical composition of claim 64, which is a vaccine. 66. The drug of claim 64, further comprising one or more pharmaceutically acceptable excipients. Composition. 67. Comprising administering a pharmaceutically effective amount of the vaccine of claim 65. A method of preventing infection of a patient with Cass pneumoniae or related bacteria. 68. 56. A pharmaceutical composition comprising one or more antibodies or fragments thereof of claim 55. 69. 70. The pharmaceutical composition of claim 68, which is a vaccine. 70. 70. The pharmaceutical composition of claim 69, further comprising a pharmaceutically acceptable excipient. 71. The pharmaceutical composition of claim 69, wherein the antibody is F1-Pn3.1, F2-Pn3.2, F2-Pn3.3, And a pharmaceutical composition selected from the group consisting of F2-Pn3.4. 72. The pharmaceutical composition of claim 69, wherein the antibody is F1-Pn3.1. Pharmaceutical composition. 73. Comprising administering a pharmaceutically effective amount of the vaccine of claim 69. Infected or presumed infected with Cass pneumoniae or related bacteria Treatment method for patients to be treated. 74. (a) isolation of a biological sample from a patient;     (b) incubating the antibody or fragment of claim 55 with a biological sample. The formation of a mixture; and     (c) indicate the presence of Streptococcus pneumoniae or related bacteria Detection of specifically bound antibodies or fragments in admixtures Streptococcus pneumoniae or related cells in a biological sample containing A method for detecting bacteria. 75. The method of claim 74, wherein the antibodies are F1-Pn3.1, F2-Pn3.2, F2-Pn3.3, and F A method selected from the group consisting of 2-Pn3.4. 76. 75. The method of claim 74, wherein the antibody is F1-Pn3.1. 77. (a) isolation of a biological sample from a patient;     (b) incubation of the polypeptide of claim 23 with a biological sample. To form a mixture; and     (c) specific for Streptococcus pneumoniae or related bacteria Detection of specifically bound polypeptides in the mixture indicating the presence of antibodies Streptococcus pneumoniae or related in a biological sample comprising A method for detecting bacteria-specific antibodies. 78. (a) isolation of a biological sample from a patient;     (b) incubating the DNA probe having the DNA sequence of claim 41 with a biological sample; Formation of the mixture by the oxidation; and     (c) indicates the presence of Streptococcus pneumoniae and related bacteria Of specifically bound DNA probes in mixtures Streptococcus pneumoniae or related in a biological sample comprising How to detect bacteria. 79. The method of claim 78, wherein the DNA probe is adjacent to the DNA sequence of claim 41. A method which is an oligomer having a sequence complementary to at least about 6 nucleotides . 80. (a) Primers for polymerase chain reaction and Providing a series of oligomers located therein; and     (b) Amplification of target region by polymerase chain reaction 80. The method of claim 79, further comprising: 81. Of human infection with Streptococcus pneumoniae or related bacteria Use of a pharmaceutically effective amount of the polypeptide of claim 23 for prevention. 82. Of human infection with Streptococcus pneumoniae or related bacteria Use of a pharmaceutically effective amount of an antibody specific for HSP72 for prophylaxis. 83. Culturing the single-cell host of claim 52 or 53, wherein the polypeptide or fragment is A method for producing a polypeptide or a fragment thereof, comprising a step of isolating. 84. 84. A polypeptide in substantially pure form as obtained by the method of claim 83. 85. An antibody or a fragment thereof that specifically binds to the polypeptide of claim 1 or 22. 86. (a) introducing a preparation of the polypeptide according to claim 1 or 22 into a mammal; ;and     (b) Separation of serum from mammals containing the above antibodies 89. The method for isolating the antibody of claim 86, comprising: 87. A pharmaceutical composition comprising the polypeptide of claim 1 or 22. 88. 90. The pharmaceutical composition of claim 87 which is a vaccine. 89. 90. The drug of claim 87, further comprising one or more pharmaceutically acceptable excipients. Composition. 90. Comprising administering a pharmaceutically effective amount of the vaccine of claim 88. Cas pneumoniae, Streptococcus pyogenes, or Streptococcus How to prevent infection of patients with C. agalactiae. 91. An antibody or a fragment thereof that specifically binds to the polypeptide of claim 1 or 22. 92. (a) separation of a biological sample from a patient;     (b) incubating the antibody or fragment of claim 91 with a biological sample. The formation of a mixture; and     (c) Streptococcus pneumoniae, Streptococcus pyogene In the mixture indicating the presence of N. or Streptococcus agalactiae. Streptococcal in biological samples, including detection of differentially bound antibodies or fragments. Cas pneumoniae, Streptococcus pyogenes, or Streptococcus A method for detecting C. agalactiae. 93. (a) separation of a biological sample from a patient;     (b) incubation of the polypeptide of claim 1 or 22 with a biological sample. To form a mixture; and     (c) Streptococcus pneumoniae, Streptococcus pyogene Indicates the presence of an antibody specific for Nes or Streptococcus agalactiae Detection of specifically bound polypeptides in a mixture. Streptococcus pneumoniae, Streptococcus pyogenes, or A method for detecting an antibody specific to Streptococcus agalactiae. 94. (a) separation of a biological sample from a patient;     (b) incubating the DNA sequence according to claim 28 with a biological sample. The formation of a mixture; and     (c) Streptococcus pneumoniae, Streptococcus pyogene In the mixture indicating the presence of N. or Streptococcus agalactiae. Detection of differentially bound DNA probes, including Streptococcus in biological samples Pneumoniae, Streptococcus pyogenes, or Streptococcus A method for detecting Cas agalactiae. 95. 94. The method of claim 94, wherein the DNA probe is adjacent to the DNA sequence of claim 28. A method which is an oligomer that exhibits a sequence complementary to at least about 6 nucleotides. 96. (a) It is a primer for polymerase chain reaction and is located on the side of the target region. Supply of a series of oligomers to be placed; and     (b) Amplification of target region by polymerase chain reaction 97. The method of claim 95, further comprising: 97. Streptococcus pneumoniae, Streptococcus pyogenes, Or to prevent the transmission of Streptococcus agalactiae to humans Use of a pharmaceutically effective amount of the polypeptide of claim 1 or 22. 98. Streptococcus pneumoniae, Streptococcus pyogenes, Or to prevent the transmission of Streptococcus agalactiae to humans Use of a pharmaceutically effective amount of an antibody specific for HSP72. 99. A pharmaceutically effective amount of claim 2 to 21 for the prevention of human transmission of streptococci. Use of any one of the above polypeptides. 100. A polypeptide having the amino acid sequence of SEQ ID NO: 23, an analog, a homolog, or a derivative thereof. Ripeptide. 101. A polypeptide having the amino acid sequence of SEQ ID NO: 24, an analog, a homolog, or a derivative thereof. Ripeptide.