JPH10191985A - Modified protein of rho target protein kinase p160 - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain the subject new modified protein having a protein kinase activity and not having an active type Rho protein-binding ability, inhibiting the changes in the forms of cells, the adhesion of cells, etc., and useful for treating cancers, circulatory system diseases, inflammatory diseases, etc. SOLUTION: This new modified protein of Rho target protein kinase 160 comprises an amino acid sequence of the formula in which one or more amino acids are added and/or inserted and/or substituted and/or deleted, has a protein kinase activity, does not have an active type Rho protein-binding ability, inhibits the formation of stress fibers and/or the focal adhesion of cells, and is useful as an antitumor agent, a circulatory system disease medicine, an inflammatory agent, an antiallergic agent, an autoimmune disease medicine, etc. The protein is obtained by screening a cDNA library derived from human leukemic megakaryocyte, inserting the obtained gene into a vector and subsequently expressing the gene in a host cell.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a modified protein having an active Rho protein binding ability and a protein kinase activity.

2. Description of the Related Art In vivo, a molecular weight of 2 to 3 having no subunit structure
There are a large group of low molecular weight GTP binding proteins (G proteins). At present, more than 50 members have been found in the superfamily of low molecular weight G proteins, from yeast to mammals. The low-molecular-weight G protein has Ras, R
ho, Rab, and other four families. It has been revealed that this low-molecular-weight G protein controls various cell functions. For example, Ras protein regulates cell growth and differentiation by Rho.
Proteins are thought to control morphological changes of cells, cell adhesion, cell motility, and the like, respectively.

[0003] Among them, Rho protein is GDP / G
It exhibits TP binding capacity and endogenous GTPase activity and has been implicated in the cytoskeletal response to extracellular signals such as lysophosphatidic acid (LPA) and certain growth factors. GDP-bound Rho that is inactive
When a certain stimulus is given to a protein, Smg GD
By the action of a GDP / GTP converting protein such as S, Dbl or Ost, it is converted into an active GTP-binding Rho protein (hereinafter referred to as “active Rho protein”). It is considered that the activated Rho protein acts on the target protein to form stress fibers and adhesion spots, thereby inducing cell adhesion and cell movement (Experimental Medicine vol.12, No.8, 97-10
2 (1994), Takai, Y. et al. Trends Biochem. Sci., 2
0, 227-231 (1995)). On the other hand, the activated Rho protein is converted to a GDP-bound Rho protein by the Rho protein endogenous GTPase. This endogenous GTPa
GTPase activating protein (GAP) (Lamarche, N. & Hall, A. eta)
l., TIG, 10, 436-440 (1994)).

[0004] RhoA protein, RhoB protein, RhoC protein, Rac1 protein, Rac
The amino acid sequences of Rho family proteins, such as the two proteins, Cdc42 protein, are 50
% Or more similarity. This Rho family of proteins responds to extracellular signals such as lysophosphatidylic acid (LPA) and growth factors to respond to stress fibers (st
ress fiber and focal contact
(AJ Ridley & A. Hall, Cell, 70, 389-399 (1
992), AJ Ridley & A. Hall, EMBO J., 1353,2600-261
0 (1994)). In addition, the subfamily Rho protein is used for morphological changes of cells (HFParterson et al., J. Ce
ll Biol., 111, 1001-1007 (1990)), cell adhesion (Morii,
N. et al., J. Biol. Chem. 267, 20921-20926 (1992),
T. Tominaga et al., J. Cell Biol., 120, 1529-1537 (19
93), Nusrat, A. et al., Proc, Natl. Acad. Sci. US
A, 92, 10629-10633 (1995), Landanna, C. et al., Sc
ience 271, 981-983 (1996)), cell motility (K. Takaishi
et al., Oncogene, 9, 273-279 (1994)), cytokinesis (cy
tokinesis) (K. Kishiet al., J. Cell Biol., 120, 118
7-1195 (1993), I. Mabuchi et al., Zygote, 1,325-331
(1993)) is also considered to be related to physiological functions accompanied by cytoskeletal rearrangement. Furthermore, the Rho protein has been shown to inhibit smooth muscle contraction (K. Hirata et al., J. Biol.
em., 267, 8719-8722 (1992), M. Noda et al., FEBS Let
t., 367, 246-250 (1995), M. Gong et al., Proc. Nat.
l. Acad. Sci. USA, 93,1340-1345 (1996)), phosphatidylinositol 3-kinase (PI3-kinase) (J. Zhang et al., J. Biol. Chem., 268, 22251-2).
2254 (1993)), phosphatidylinositol 4-
Phosphate 5-kinase (PI 4,5-kinase) (L.
D. Chong et al., Cell, 79, 507-513 (1994)) and c-fo
s expression (CS Hill et al., Cell, 81, 1159-1170 (1995)
) Has been suggested to be involved in the control.

[0005] Recently, it has been discovered that when a Rho protein partially substituted with an amino acid sequence is introduced into cells, Ras-dependent tumor formation is suppressed.
Proteins have been shown to play an important role in Ras cell transformation, ie, tumorigenesis (GC Prendergast et al., Oncogene, 1).
0,2289-2296 (1995), Khosravi-Far, R., et al., Mol. Cel
l. Biol., 15,6443-6453 (1995), R. Qiu et al., Proc. Nat.
l. Acad. Sci. USA, 92, 11781-11785 (1995), and Lebowi
tz, P. et al., Mol. Cell. Biol., 15, 6613-6622 (1995)).

[0006] Also, GDP / GTP of Rho protein
Mutations in the conversion protein have been shown to transform cells (Collard, J., Int. J. Oncol., 8, 13).
1-138 (1996)), Hart, M. et al., J. Biol Chem., 269,
62-65 (1994), Horii, Y. et al., EMBO J., 13,4776-478.
6 (1994)).

[0007] Furthermore, it has been clarified that the Rho protein is involved in cancer cell invasion, that is, cancer metastasis (Yoshioka, K. et al., FEBS Lett., 372, 25-28).
(1995)). Changes in cell adhesion of cancer cells are closely related to invasion of cancer cells, but Rho protein has been shown to be involved in cell adhesion (Mo et al., Supra).
rii, N. et al. (1992), Tominaga, T. et al. (1993), Nusr
at, A. et al. (1995), Landanna, C. et al. (1996)).

Further, it has been revealed that the Rho protein enhances not only cell proliferation, cell motility and cell aggregation, but also smooth muscle contraction. According to recent studies, R
The ho protein is known to be involved in smooth muscle contraction (K. Hirata et al., J. Biol. Chem. 267, 8719-872).
2 (1992), Noda, M. et al., FEBS Lett., 367, 246-
250 (1995), Kimura, N. et al., Science 273, 245-248
(1996) and Amano, M. et al., J. Biol. Chem., 271, 2
0246-20249 (1996)). Therefore, active Rho protein binding proteins are also likely to be involved in smooth muscle contraction.

[0009] As described above, the Rho protein regulates many signal transduction pathways such as cell morphology change, cell adhesion, cell motility, cytokinesis, tumor formation and metastasis, and vascular smooth muscle contraction. I understand. From this, it is considered that the Rho protein has many target molecules and regulates the above-mentioned many signal transduction pathways.

Very recently (after the first application on which the priority claim is based), several candidate proteins have been reported in mammals. These proteins are known as protein kinase N (PKN) (Watanabe, G. e.
t al., Science 271, 645-648 (1996); Amano, M. et a
l., Sceince 271, 648-650 (1996)), Lofilin (Watanabe, G. et al., Science 271, 645-648 (199)
6)), citron (Madaule, P. et al., FEBS Lett. 37)
7, 243-248 (1995)), ROKα (Leung, T. et al., J.
Biol. Chem. 270, 29051-29054 (1995)), Rho-linked kinase (Matsui, T. et al., EMBO J. 15, 2208-2216 (199)
6)), rothekin (Reid, T. et al., J. Biol. Chem., 271, 1).
3556-13560 (1996)), and p160 (Ishizaki, T. e.)
t al., EMBO J. 15, 1885-1893 (1996)). All of these proteins bind to GTP-bound RhoA protein (except for citron, which is GTP-bound Rac).
Also binds to one protein).

[0011] Of these, PKN has a catalytic domain having high homology to the protein kinase catalytic domain of protein kinase C, and exhibits serine / threonine protein kinase activity (Mukai, H. & Ono, Y. , Bioche
m. Biopys. Res. Commun. 199, 897-904 (1994); Muka
i, H. et al., Biochem. Biopys. Res. Commun. 204, 3
48-356 (1994)). On the other hand, ROKα (see Leung, T. e.
tal (1995)), Rho binding kinase (Matsui, T. et supra).
al. (1996)), and p160 (supra Ishizaki, T. et.
al., (1996)) also have a serine / threonine protein kinase catalytic domain-like amino acid sequence. Of these, p
For R.160, the Rho protein binding region has been reported in detail (Fujisawa, K. et a; l., J. Biol, C
hem. 271, 23022-23028 (1996)).

On the other hand, in addition to the above-mentioned mammalian proteins,
Recently, in yeast (Saccharomyces cerevisiae), protein kinase C1 (PKC1) has been identified as a target protein of Rho1 protein corresponding to mammalian RhoA (Nonaka, H. et al., EMBO J. 14, 5931-5938).
(1995)). More recently, yeast (Saccharomyces cerevisia)
e) As a target protein of the Rho1p protein,
1,3-β-glucan synthase and BNI1 have been identified (Drgonova, J. et al., Science 272, 277-279 (19
96), Qadota, H. et al., Science 272, 279-281 (199
6), Kohno, H. etal., EMBO J., 15,6060-6068 (199
6)). However, the mechanism of cell signaling involved in the active Rho protein, particularly the mechanism related to tumor formation and smooth muscle contraction, has not been elucidated yet.

[0013]

SUMMARY OF THE INVENTION The present inventors have now found that transfection of the p160 mutant described below into HeLa cells induces or inhibits focal adhesion and stressed fiber formation. The present invention is based on this finding.

That is, an object of the present invention is to provide a modified protein of p160. Further, the present invention provides a nucleotide sequence encoding the protein, a vector containing the nucleotide sequence, a host cell transformed with the vector,
It is an object of the present invention to provide a method for producing the protein, various therapeutic agents containing the protein, and a screening method for inhibiting the binding of an active Rho protein to its target protein. The protein according to the present invention is a modified protein (having an addition, insertion, substitution, or deletion) of a protein having an active Rho protein binding ability and a protein kinase activity.

[0015]

DETAILED DESCRIPTION OF THE INVENTION Definitions In the present invention, the term "amino acid" is used to include both optical isomers, that is, L-form and D-form. Therefore, in the present invention, the term “peptide” means not only a peptide composed of only L-form amino acids but also a peptide containing some or all of D-form amino acids.

In the present invention, the term "amino acid" means not only 20 kinds of α-amino acids constituting natural proteins, but also other α-amino acids, β-,
γ- and δ-amino acids, unnatural amino acids and the like are used. Thus, amino acids that are substituted in a peptide or inserted into a peptide as described below include the 20
It is not limited only to species α-amino acids, but may be other α-amino acids and β-, γ-, δ-amino acids and unnatural amino acids. Such β
-, Γ- or δ-amino acids, β-alanine,
γ-aminobutyric acid or ornithine; and amino acids other than those constituting natural proteins or unnatural amino acids include 3,4-dihydroxyphenylalanine, phenylglycine, cyclohexylglycine, 1,2,3,4-tetraethyl Hydroisoquinoline-3
-Carboxylic acid or nipecotic acid.

In the present specification, the term "protein according to the present invention" is used to include its derivatives. Furthermore, in the present specification, “base sequence” means both a DNA sequence and an RNA sequence.

In the specification, symbols (for example, KD,
Numbers in parentheses following M1, M2, M3, and C) represent regions of the amino acid sequence of SEQ ID NO: 1. For example, KD (2-333) represents the amino acid sequence of positions 2 to 333 of SEQ ID NO: 1. When a specific mutation is represented in the present specification, the original amino acid residue (single letter notation) is first, the position number of the amino acid to be replaced is second, and the substituted amino acid residue (single letter notation) is Third shown. For example, "K921M (906-926)"
Represents the amino acid sequence of positions 906 to 926 in SEQ ID NO: 1, in which K (Lys: lysine), which is the 921st amino acid residue, has been substituted with M (Met: methionine).

[0019] According to proteins present invention, it has a protein kinase activity, and the protein or its derivative not having the activated Rho protein binding activity is provided. Here, “protein kinase activity” is used in a sense including serine / threonine / protein kinase activity. Also, R
Ho proteins include RhoA protein, Rho
B protein, RhoC protein, or RhoG protein.

In the present invention, the term "protein having protein kinase activity" refers to a protein which is evaluated by those skilled in the art to have protein kinase activity. It means a protein that is evaluated as having kinase activity. The term “protein kinase activity” is used to include serine / threonine protein kinase activity.

In the present invention, "a protein having no active Rho protein binding ability" refers to a protein which is evaluated by those skilled in the art as not to be bound to the active Rho protein. And 4-1
It means a protein that is evaluated as not binding to the active Rho protein when the experiment is carried out under the same conditions as 0.

In the present specification, the Rho protein is R
It also includes a Rho protein that has been modified so that the binding between the ho protein and the protein according to the present invention is not substantially impaired. Such modified Rho proteins include Rho in which the 14th amino acid is substituted with valine.
A mutant (RhoA ^Val14 ).

The origin of the protein according to the present invention is not particularly limited, and it may be derived from mammals including humans, or may be derived from other sources.

As used herein, the term “protein derivative” refers to a part or all of the amino group at the amino terminus (N-terminus) of the protein or the amino group in the side chain of each amino acid, and / or the carboxyl terminus of the peptide ( A part or all of the carboxyl group at the C-terminus or the side chain of each amino acid and / or a functional group other than the amino group and the carboxyl group of the side chain of each amino acid of the peptide (for example, hydrogen group, thiol group) Amide group, etc.) are partially or wholly modified with other suitable substituents. Modification with an appropriate other substituent is performed, for example, for the purpose of protecting a functional group present in the peptide, improving safety and tissue transferability, or enhancing activity.

Specific examples of protein derivatives include: (1) Part or all of the hydrogen atoms in the amino group at the amino terminus (N-terminus) of the protein or the amino group in the side chain of each amino acid are substituted or unsubstituted. A substituted alkyl group (which may be linear, branched or cyclic) (for example, a methyl group,
Ethyl group, propyl group, isopropyl group, isobutyl group, butyl group, t-butyl group, cyclopropyl group, cyclohexyl group, benzyl group), substituted or unsubstituted acyl group (for example, formyl group, acetyl group, caproyl group, Cyclohexylcarbonyl group, benzoyl group, phthaloyl group, tosyl group, nicotinoyl group, piperidinecarbonyl group), urethane-type protecting group (for example, p-nitrobenzyloxycarbonyl group, p-methoxybenzyloxycarbonyl group, p-biphenylisopropyloxycarbonyl Group, t-butoxycarbonyl group) or a urea-type substituent (eg, methylaminocarbonyl group, phenylcarbonyl group, cyclohexylaminocarbonyl group)
And (2) those in which part or all of the carboxyl group at the carboxyl terminus (C-terminus) of the protein or the carboxyl group of the side chain of each amino acid has undergone ester-type modification (for example, Those whose hydrogen atoms have been replaced by methyl, ethyl, isopropyl, cyclohexyl, phenyl, benzyl, t-butyl, 4-picolyl), those of amide type modification (eg unsubstituted amide, C1-C6 alkyl) Amides (eg, methylamide, ethylamide, isopropylamide); and (3) functional groups other than amino groups and carboxyl groups on the side chains of each amino acid of the protein (eg, hydrogen group, thiol group, amino group) Etc.) is partially or entirely the same as the above-mentioned amino group, Those such as modified with such groups.

As an example of the above protein, SEQ ID NO: 1
Wherein at least one amino acid is added and / or inserted to the amino acid sequence of SEQ ID NO: 1,
And / or a protein in which one or more amino acids of the amino acid sequence of SEQ ID NO: 1 has been substituted and / or deleted, which has protein kinase activity and does not have an active Rho protein binding ability. Can be
That is, the additions, insertions, substitutions, and deletions herein refer to those which do not impair the protein kinase activity of the protein consisting of the amino acid sequence of SEQ ID NO: 1 and impair the ability to bind to the active Rho protein.

An example of such a deletion is shown in SEQ ID NO: 1 at 93
This is a deletion of the amino acid sequence at positions 4 to 945 or 1005 to 1015, or a region containing an active Rho protein binding ability or a part thereof.

An example of such substitution is K934
M, L941A, E1008A, and I1009A.

The amino acid sequence of SEQ ID NO: 1 (herein referred to as "p160") is derived from human megakaryocytic leukemia cells (Hirata, M. et al., Nature 349, 617-620 (1991) and Ogura, M .; et al., Blood 66, 1384-1392 (1985)).
DNA sequence). This cDNA
The library is based on Kakizuka, M. et al., Nature 349, 61
It can be prepared according to the method described in 7-620 (1991). In addition, the cDNA sequence corresponds to the peptide AP shown in FIG.
It can be obtained by using an oligonucleotide corresponding to -23 as a probe.

The amino acid sequence of SEQ ID NO: 1 (provided that
Active, Rho having protein kinase activity consisting of having an addition, insertion, substitution, and / or deletion)
A protein having no protein binding ability or a derivative thereof may be added, inserted, substituted, and / or deleted in addition to the above addition, insertion, substitution, and / or deletion so as not to impair the protein kinase activity of the protein. You may have a loss.

Examples of such deletions include deletion of the amino acid sequence of SEQ ID NO: 1 from which the amino acid sequence at positions 72 to 343 (protein kinase region) has been deleted or a part thereof. Specifically, the amino acid sequence of Nos. 1 to 71 and its partial sequence, and the amino acid sequences of Nos. 344 to 1354 and the partial sequence are deleted.

According to another aspect of the present invention, 7 of SEQ ID NO: 1
No. 2-343, No. 1-727, No. 1-477, or 1
A protein or a derivative thereof having at least the amino acid sequence of No. 375 is provided. This protein is
It has protein kinase activity and has no ability to bind to active Rho protein. Such proteins include, for example, I1009A (1-1354)
Is mentioned.

Leung, T. et al., J. Biol. Chem. 270,
29051-29054 (1995) describes Rh cloned from a rat brain cDNA library by expression cloning.
o A protein binding protein, ie, a p160 isozyme (ROKα) has been described. According to this, the Rho protein binding fragment of ROKα is:
ROKα amino acid sequence 893-982 (this corresponds to the amino acid sequence of positions 949 to 1039 of SEQ ID NO: 1)
Is covered.

A comparison of the amino acid sequences of the two einzymes is shown in FIG. According to FIG.
The 60 Rho protein binding regions differ from the Rho protein binding regions suggested in the literature.

According to another aspect of the present invention, there is provided a protein or derivative thereof which induces stress fiber formation and / or focal adhesion. This protein has a protein kinase catalytic domain and has some or all of the coiled-coil domain.

In the present invention, the term “protein that induces stress fiber formation and / or focal adhesion” refers to a protein which is evaluated by those skilled in the art as having been found to induce stress fiber formation and / or focal adhesion. It means a protein evaluated to have been induced to induce stress fiber formation and / or focal adhesion when tested under the same conditions as in Examples 12 and 13.

Examples of the above-mentioned protein include, for example, the amino acid sequence of SEQ ID NO: 1, wherein one or more amino acids are added and / or inserted to the amino acid sequence of SEQ ID NO: 1, and / or A protein or a derivative thereof in which one or more amino acids of the sequence have been substituted and / or deleted, and in particular, SEQ ID NO: 1 to 1080, 1 to 946, 1 to 727, or 1 to 477; A protein consisting of an amino acid sequence;

According to yet another aspect of the present invention there is provided a protein or derivative thereof that inhibits stress fiber formation and / or focal adhesion.

In the present invention, the term “protein that inhibits stress fiber formation and / or focal adhesion” refers to a protein that is evaluated by those skilled in the art as having inhibition of stress fiber formation and / or focal adhesion. It means a protein which is evaluated as having been found to inhibit stress fiber formation and / or focal adhesion when tested under the same conditions as in Examples 12 and 13.

As an example of the above protein, SEQ ID NO: 1
Wherein at least one amino acid is added and / or inserted to the amino acid sequence of SEQ ID NO: 1,
And / or a protein in which one or more amino acids in the amino acid sequence of SEQ ID NO: 1 have been substituted and / or deleted.

Examples of the above addition, insertion, substitution and deletion include those in which the protein kinase activity and the activated Rho protein binding activity are inactivated (for example, K105A / I1009A (1-1354)). ).

Further examples of the protein include a protein (for example, a sequence) in which activated Rho protein binding activity and protein kinase activity are inactivated and modified to have at least a pleckstrin homology region (PH region). A protein consisting of the amino acid sequence of Nos. 1081 to 1354 of No. 1).

The protein according to the present invention is an active form of Rho
It has been modified so as to lose one or both of protein binding activity and protein kinase activity.
In addition, Rho protein is closely involved in the expression of cell functions such as tumor formation and metastasis, cell morphology, cell motility, cell adhesion, and cytokinesis (Takai, Y., supra).
et al., GCPrendergast.et al., Khosravi-Far,
R., et al. , R. Qiu et al., Lebowitz, P., et a.
l., and Yoshioka, K. et al.).

A protein according to the present invention is also a protein that has been modified to induce or inhibit stress fiber formation and / or focal adhesion. In addition, the formation of stress fibers and focal adhesion can be explained by tumor formation and metastasis, activation of leukocytes (lymphocytes and leukocytes derived from bone marrow) and their inflammatory response, activation of platelets and thrombus formation thereby, as described below. And so on. Therefore, the protein according to the present invention is considered to be useful for elucidating the mechanism of tumor formation and metastasis, inflammation, and thrombus formation.

The Rho protein is known to be involved in smooth muscle contraction (see K. Hirata et al., Supra).
And M. Noda et al.). Recently, it was reported that Rho protein is involved in cardiomyocyte proliferation and gene expression (Sah, VP et al., J. Biol. Chem., 271, 3118).
5-31190 (1996)). Therefore, the protein according to the present invention is considered to be useful for elucidating the mechanism of various cardiovascular diseases such as hypertension, vasospasm, and cardiac hypertrophy.

[0046] According to the nucleotide sequence present invention, nucleotide sequences encoding the protein according to the invention is provided. A typical sequence of this nucleotide sequence is
It has part or all of the DNA sequence of SEQ ID NO: 2.

The DNA sequence of SEQ ID NO: 2 was obtained from a cDNA library derived from human megakaryocytic leukemia cells as described above. This DNA sequence is p16
It corresponds to 0 open reading frames. Also,
The DNA sequence including its peripheral sequence is continuously described in FIGS. The open reading frame in this sequence starts with ATG at positions 448 to 450 and ends with TAA at positions 4510 to 4512.

Given the amino acid sequence of the protein according to the present invention, the nucleotide sequence encoding it is easily determined, and various nucleotide sequences encoding the amino acid sequence shown in SEQ ID NO: 1 can be selected. Accordingly, the nucleotide sequence encoding the protein according to the present invention refers to a DNA sequence encoding the same amino acid in addition to a part or all of the DNA sequence shown in SEQ ID NO: 2, and a degenerate codon in the DNA sequence. As well as RNA sequences corresponding thereto.

The base sequence according to the present invention may be of natural origin or may be totally synthesized. In addition, a product synthesized using a part of a product derived from a natural product may be used. The nucleotide sequence is a chromosome library or c
It can be obtained from a DNA library by a method commonly used in the field of genetic engineering, for example, a method of screening using an appropriate DNA probe prepared based on partial amino acid sequence information. The nucleotide sequence according to the present invention is described, for example, in Kakizuka, M. et al., Nature 34.
9, 617-620 (1991), according to the method described in Human Megakaryocytic Leukemia Cell MEG-01 (Ogura, M. et al., Blood 6).
6, 1384-1392 (1985)), and can be obtained by performing screening using an oligonucleotide corresponding to the peptide AP-23 shown in FIG. 1 as a probe.

When the nucleotide sequence is of natural origin, its origin is not particularly limited, and it may be derived from mammals including humans, or may be derived from other sources.

Examples of the nucleotide sequence encoding the protein according to the present invention include the nucleotide sequence of SEQ ID NO: 2 and a part of the DNA sequence of SEQ ID NO: 2 (for example, 214 to 10 of SEQ ID NO: 2).
No. 29, 1-2181, 1-1431, 1-112
No. 5, 1-3240, 1-22838, or 324
No. 1-4062).

Vector and Transformed Host Cell According to the present invention, the above-described nucleotide sequence of the present invention can be expressed in a state where the vector can be replicated in a host cell and the protein encoded by the nucleotide sequence can be expressed. A vector comprising the state is provided. Further, according to the present invention, there is provided a host cell transformed with the vector. The host-vector system is not particularly limited, and a fusion protein expression system with another protein can be used. Examples of the fusion protein expression system include those using MBP (maltose binding protein), GST (glutathione S transferase), HA (hemagglutinin), polyhistidine, myc, Fas and the like.

Examples of the vector include a plasmid vector (eg, an expression vector in prokaryotic cells, yeast, insect cells, animal cells, etc.), a viral vector (eg, a retrovirus vector, an adenovirus vector, an adeno-associated virus vector, a herpes virus vector, Sendai virus vector, HIV vector, baculovirus vector), liposome vector (eg, cationic liposome vector) and the like.

In order to express the desired protein by actually introducing the vector into a host cell, the vector according to the present invention requires not only the above-mentioned nucleotide sequence according to the present invention but also a sequence controlling its expression and a host cell. It may contain a genetic marker or the like for selection. In addition, this vector is obtained by repeating the base sequence according to the present invention (for example, in tandem).
May be included. These may be made to exist in a vector according to a conventional method, and a method of transforming a host cell with this vector may be one commonly used in this field.

As the procedure and method for constructing a vector according to the present invention, those commonly used in the field of genetic engineering can be used.

Examples of host cells include E. coli, yeast, insect cells, animal cells (eg, COS cells,
Lymphocytes, fibroblasts, CHO cells, blood cells, tumor cells, etc.).

The transformed host cells are cultured in a suitable medium, and the above-mentioned protein of the present invention can be obtained from the culture. Thus, according to another aspect of the present invention, there is provided a method for producing a protein according to the present invention. The culture of the transformed host cell and its conditions are as follows:
It may be essentially the same as that for the cells used. The recovery and purification of the protein according to the present invention from the culture solution can also be performed according to a conventional method.

The cells to be transformed are, for example, cancer cells in a cancer patient (eg, leukemia cells, gastrointestinal cancer cells, lung cancer cells, suicide cancer cells, ovarian cancer cells, uterine cancer cells, melanoma cells, brain tumor cells) Cells), the protein according to the present invention is introduced into a cancer cell or a peripheral cell thereof in a living body, including humans, by a suitable method. Gene therapy enables gene therapy for malignant tumors and the like.

For example, by expressing a protein having the activity of binding to the active Rho protein and having no protein kinase activity in a living body including humans, the active Rho protein binds to the protein (together with endogenous p160). Inhibition of binding to the active Rho protein), as a result, the signal transmission from the active Rho protein to endogenous p160 is blocked, and the formation or metastasis of a tumor involving the Rho protein can be suppressed.

Furthermore, by expressing a protein modified to inhibit stress fiber formation and / or focal adhesion in a living body including humans, stress fiber formation and / or focal adhesion can be inhibited. Can suppress the formation or metastasis of a tumor involving the Rho protein.

Furthermore, by introducing the above-mentioned nucleotide sequence or a vector containing the same into cells other than cancer cells, for example, cells exhibiting inflammation, smooth muscle cells, and their peripheral cells, circulating cells such as inflammation and hypertension can be obtained. Gene therapy can be used for organ diseases. For gene therapy vectors, see Fumima Takaku, Experimental Medicine (Special Issue) No. 1
Vol. 2, No. 15, "The Forefront of Gene Therapy" (1994)
Can be referred to.

Uses / Pharmaceutical Compositions In the examples described below, the present inventors inhibited the formation of proteins having active Rho protein binding ability and no protein kinase activity and stress fiber formation and / or focal adhesion. It has been found that a protein (hereinafter sometimes referred to as “dominant negative p160”) inhibits the formation of stress fibers and focal adhesion induced by cells.

On the other hand, the Rho protein has the following functions. Activated Rho protein promotes tumor formation and metastasis. First, active Rho proteins include:
Weak, but tumorigenic activity found (Perona, R. et.
al., Oncogene 8, 1285-1292 (1992)). Second, Rh
It is known that the GDP / GTP exchange protein that activates the o protein functions as a proto-oncogene. GDP / GTP activates Rho protein
Exchange proteins include Dbl, Vav, Ost, Lbc
(Collard, J., Int. J. Oncol., 8, 1
31-138 (1996)). All of these proteins, when deleted at their N-terminus, have oncogenic effects in the NIH3T3 transformation assay (Ro
n, D. et al., EMBO J., 7, 2465-2473 (1988), Eva,
A. et al., Nature 316, 273-275 (1985), Katzav, S. e.
t al., EMBO J., 8, 2283-2290 (1989), Horii, Y. et.
al., EMBO J., 4776-4786 (1994), Toksoz, D. etal.,
Oncogene 9, 621-628 (1994)). Thus, Rho proteins activated by these proto-oncogenes are thought to promote tumorigenesis. Third, the Rho signaling pathway has recently been located downstream of the active Ras protein, an oncogene product involved in about 30% of human tumors, and at least some of the tumorigenic effects of the active Ras protein are Type Rho protein (Prendergast, G. et al.,
Oncogene 10, 2289-2296 (1995), Khosravi-Far, R. et.
al., Mol. Cell. Biol., 15, 6443-6453 (1995), Qiu,
R. et al., 92, 11781-11785 (1995)). Finally, it has been shown that activated Rho protein promotes the cell cycle (Yamamoto, M. et al., Oncogene 1
0, 1935-1945 (1993), Olson, M. et al., Science 26
9, 1270-1272 (1995)). As described above, the activated Rho protein promotes tumor formation.

In addition to tumor formation, the active Rho protein promotes tumor metastasis. During metastasis, cancer cells infiltrate the host (patient) barrier such as vascular endothelial cells and mesothelial cell layers. For example, Imamura, F. et al.,
Biophys. Biochem. Res. Commun., 193, 497-503 (199
According to 3), when ascites carcinoma cells (MM1 cells) having high metastatic potential are cultured on the confluent mesothelial cell layer, the MM1 cells enter below the mesothelial cell layer from the gap between the mesothelial cells. And form infiltration foci. This phenomenon is a good indication of cancer cell invasion during metastasis. MM1 cell infiltration is markedly enhanced in the presence of serum or LPA. This serum or LPA-enhancing effect is inhibited by a Rho protein inhibitor (extracellular enzyme C3 of Clostridium botulinum), and thus is known to be mediated by an active Rho protein. This means that MM1 cells into which the gene of the active Rho protein (Rho ^Val14 ) has been introduced infiltrate the mesothelial cell layer in the absence of serum or LPA (Yoshioka, K. et al., FEBS Lett., 372, 25
-28 (1995)). As described above, the activated Rho protein promotes invasion and metastasis of cancer cells.

As described above, the dominant negative p160 according to the present invention, when it is present in a cell, inhibits the action of the active Rho protein endogenously present in the cell. For example, as shown in Embodiment 13,
K105A which is an example of dominant negative p160
・ I1009A (1-1354) was ^converted to RhoA ^Val14.
In addition, when transfected into HeLa cells, induction of stress fiber formation and focal adhesion formation of HeLa cells was inhibited. The induction of stress fiber formation and focal adhesion formation is activated Rh
o is one of the typical biological functions of proteins (Ridley, A. & Hall, A., Cell 70, 389-399 (1992)
And Ridley, A. & Hall, A., EMBO J., 13, 2600-2
610 (1994)). Thus, dominant negative p1
60 can inhibit the action of the active Rho protein endogenously present in the cell by causing it to be present in the cell. Therefore, dominant negative p160 is an inhibitor of the above-mentioned tumor formation or metastasis promoted by the activated Rho protein (hereinafter referred to as “tumor formation inhibitor”).
). In addition, since it inhibits the enhancement of cell adhesion, dominant negative p
In general, 160 can be used as an inhibitor of metastasis of a tumor with enhanced cell adhesion. An inhibitor such as a tumor formation is used to include an antitumor agent.

Here, as tumor formation and metastasis, R
ho involved tumor formation, other low molecular weight G protein (eg Ras, Rac, Cdc42, Ral, etc.) involved tumor formation, low molecular weight G protein GDP /
Tumor formation involving GTP exchange proteins (eg, Dbl, Ost, etc.), lysophosphatidic acid (LP
A) Involvement of tumor formation, receptor-type tyrosine kinase (eg, PDGF receptor, EGF receptor, etc.), transcription control protein (myc, p53, etc.) or formation of tumors involving various human tumor viruses. Can be

Activated Rho protein is also involved in smooth muscle contraction (K. Hirata et al., J. Biol. Che.
m. 267, 8719-8722 (1992), Noda, M. et al., FEBS
Lett., 367, 246-250 (1995), Kimura, N. et al., Sci.
ence 273, 245-248 (1996) and Amano, M. et al., J.
Biol. Chem., 271, 20246-20249 (1996)). Also, Rh
o protein is involved in cardiomyocyte proliferation (Sah,
VP et al., J. Biol. Chem., 271, 31185-31190 (19
96)). Further, according to Examples described later, dominant negative p160 inhibits the function of activated Rho protein. Further, as described below, the cells aggregate or contract due to the formation of stress fibers and focal adhesions,
Dominant negative p160 inhibits the formation of this stress fiber and focal adhesion. Therefore,
Dominant negative p160 is considered to inhibit the contraction of smooth muscle cells and the like.

Therefore, dominant negative p160
Is associated with various circulatory diseases involving smooth muscle contraction and myocardial hyperplasia (such as hypertension, vasospasm (cardiovascular and cerebral vasospasm), angina, myocardial infarction, obstructive atherosclerosis, and cardiac hypertrophy) Can be used as a therapeutic agent. The smooth muscle contraction inhibitor and the cardiomyocyte proliferation inhibitor are used in the sense that they include therapeutic agents for cardiovascular diseases.

The activated Rho protein induces cell adhesion or cell aggregation. Cell adhesion or cell aggregation includes, for example, platelet aggregation (Morii, N. et al.,
J. Biol. Chem., 29, 20921-20926 (1992)) and aggregation of leukocytes (lymphocytes) (Tominaga, T. et al., J. Cell
Biol., 120, 1529-1537 (1993) and Laudanna, C.et
al., Science 271, 981-983 (1996)).
According to Morii, N. et al. (1992), thrombin and p
gpIIb-IIIa complex-dependent platelet aggregation induced by horbol myristate acetate (PMA) was inhibited by botulinum extracellular enzyme C3 (hereinafter referred to as C3 extracellular enzyme). Also, Tominaga, T. et
According to al. (1993), PMA-induced lymphocyte function-related antigen (LFA-1) -dependent lymphocyte aggregation was
Inhibited by 3 extracellular enzymes. In addition, Laudin, supra.
According to a, C. et al. (1996), the formyl peptide (f
ormylpeptide; fMLP), interleukin 8 (IL8)
Alternatively, cell adhesion of lymphocytes and neutrophils stimulated by PMA was also inhibited by C3 extracellular enzyme. And
The C3 extracellular enzyme was due to inhibition of α4β1 lymphocyte and β2 integrin neutrophil adhesion. As described above, activated Rho protein induces cell adhesion and cell aggregation, and the cell adhesion and cell aggregation are induced by cell adhesion molecules (gpIIb of platelets).
-IIIa complex, LFA-1 and α4β1 of lymphocytes,
Neutrophil β2 integrin). All of these cell adhesion molecules are included in the integrin family (Hynes, R. et al., Cell 69, 11-25 (1992)). As described above, the activated Rho protein promotes integrin-mediated cell adhesion.

Recently, Leung et al. (Leung, T. et al., M.
ol. Cell. Biol. 16, 5313-5327 (1996)) reported that expression of p160 isozyme ROKα induced stress fiber formation and focal adhesion. These results indicate that ROKα may play a duplicate role with p160 in cells. In the present invention, RhoA ^Val14- induced focal adhesion and formation of stress fibers are dominant negative p160.
(Kinase inactivation, Rho binding negative mutant) was also shown to be blocked by expression, indicating that p160 functions downstream of Rho to induce the formation of these structures in cells (Example 13). ). Interestingly, R
HoA ^Val14 still increased polymerized actin content in these cells, suggesting that RhoA-induced actin polymerization and focal adhesion formation were mediated by different effectors. This indicates that the kinase inhibitor staurosporine inhibits focal adhesion formation without affecting Rho-induced increase in F-actin, and inhibition of actin polymerization by cytochalasin inhibits Rho-mediated cell and focal adhesion formation. (Tominaga, T. et al., J. Ce)
ll Biol. 120, 1529-1537 (1993); Nobes, CD & Hall, A.,
Cell 81, 53-62 (1995)). Focal adhesion formation requires integrin activation, ligand binding, and clustering of bound integrins. F-actin bundling as a stress fiber is thought to be associated with integrin clustering (Yamada, KM & Miyamoto, S., C
urr. Opin. Cell Biol. 7, 681-689 (1995)).

The present inventors presumed that p160 would function in both of these processes and hypothesized its role in Rho-mediated focal adhesion and formation of stress fibers as shown in FIG.

The model described in FIG. 48 is as follows: Rho-GTP acts on p160 and the unidentified target X. Target X induces actin polymerization, while p160 activates integrins, inducing binding integrin clustering and actin fiber bundling.

In summary, not being bound by the following theory, it is considered that the activated Rho protein induces cell adhesion and cell aggregation by the following mechanism. (1) Cells receive various stimuli (eg, thrombin, formyl peptide, IL8, LPA stimulation, etc.). (2) Rho protein in the cell is activated. (3) p160 is activated by the activated Rho protein. (4) As a result, the bundling of the heterodimer of integrin and actin is promoted, the adhesion spots and stress fibers are formed, and the cells adhere, aggregate and contract.

The present inventors have shown that dominant negative p160 inhibits the formation of stress fibers and focal adhesion of cells, as shown in the examples above and below. Therefore, dominant negative p160 is associated with integrin-associated platelet aggregation and activation, aggregation / adhesion and activation of immunocompetent cells (T lymphocytes and B lymphocytes), and inflammatory blood system cells (neutrophils and eosinophils). , Basophils and macrophages), and clearly inhibits the adhesion / aggregation and activation of anti-platelets, anti-inflammatory drugs, anti-allergic drugs, autoimmune diseases (rheumatoid arthritis, SLE, etc.) It can be used as an agent.

The inhibitors and therapeutic agents according to the present invention are used in the sense that they include the gene therapeutic agents described below. In the present invention, the “medicine” refers to a substance used for diagnosis, treatment, treatment, or prevention of diseases in animals including humans.

The inhibitors and therapeutic agents according to the present invention are also administered orally or parenterally (eg, intramuscularly, intravenously, subcutaneously, rectally, transdermally, transnasally, etc.), preferably orally. It can be used in humans and non-human animals in various forms suitable for oral or parenteral administration as medicaments.

The inhibitors and therapeutic agents according to the present invention may be, for example, oral preparations such as tablets, capsules, granules, powders, pills, fine granules and lozenges, intravenous injections and intramuscular injections, depending on their use. Can be prepared in any of the following formulation forms: injection, rectal administration, oily suppository, water-soluble suppository and the like. These various preparations, commonly used excipients,
Use bulking agents, binders, wetting agents, disintegrants, surfactants, lubricants, dispersants, buffers, preservatives, solubilizing agents, preservatives, flavoring agents, soothing agents, stabilizers, etc. And can be manufactured by a conventional method. Examples of the non-toxic additives that can be used include lactose, fructose, glucose, starch, gelatin, magnesium carbonate, synthetic magnesium silicate, talc, magnesium stearate, methyl cellulose,
Examples include carboxymethyl cellulose or a salt thereof, gum arabic, polyethylene glycol, syrup, petrolatum, glycerin, ethanol, propylene glycol, citric acid, sodium chloride, sodium sulfite, sodium phosphate and the like.

The content of the protein of the present invention in the inhibitor and the therapeutic agent varies depending on the dosage form, but is usually about 0.1 to about 50% by weight, preferably about 1 to about 20% by weight in the whole composition. % Concentration.

The dosage for the treatment of the aforementioned conditions may vary according to
The patient's age, gender, and the degree of symptoms are determined as appropriate, but are usually about 0.1 to about 500 mg per adult day,
Preferably, it should be about 0.5 to about 50 mg,
It can be administered once or several times a day.

According to the present invention, the dominant negative p
160, including the presence of cells in which a tumor is formed, cells in which the tumor may metastasize, cells in which smooth muscle contraction is enhanced, or cells in which inflammation or autoimmunity is enhanced, A method for suppressing tumor formation or metastasis, a method for suppressing smooth muscle contraction, a method for suppressing inflammation and autoimmunity, and a method for suppressing platelet aggregation are provided.
In this case, the effective dose, the administration method, the administration form and the like can be in accordance with the above-mentioned inhibitor and therapeutic agent.

The nucleotide sequence encoding dominant negative p160 can be obtained by transforming a target cell with the vector having the same or by using this sequence alone to suppress smooth muscle contraction in a manner that suppresses tumor formation or metastasis. Can be used in such a form as to suppress the increase in inflammatory activity, or as an aspect to suppress the inflammation and autoimmunity and platelet aggregation. That is, the nucleotide sequence can be used as a gene therapy agent for suppressing tumor formation or metastasis, a gene therapy agent for a circulatory disease, a gene therapy agent for an inflammatory disease or an autoimmune disease, or a gene therapy agent for inhibiting platelet aggregation.

[0082] According to the screening method the present invention, the (1) subject to substance screening, be present in the screening system comprising a protein or a derivative thereof according to this invention having protein kinase activity, and (2) protein kinase activity A method for screening a substance inhibiting the protein kinase activity of a protein or a derivative thereof according to the present invention having a protein kinase activity, comprising measuring the degree of inhibition of the protein kinase activity of the protein or a derivative thereof according to the present invention. Is done.

Examples of a method for measuring the “degree of inhibition of protein kinase activity” include a method for measuring the degree of autophosphorylation activity of the protein of the present invention or the activity of phosphorylating an appropriate substrate. The degree of inhibition of protein kinase activity can be measured according to the methods described in Examples 2, 5, and 11.
Further, in the present specification, "measurement of the degree of inhibition of protein kinase activity" is used in a sense including measurement of presence or absence of inhibition of protein kinase activity.

The degree of inhibition of protein kinase activity can be measured, for example, using histone or the like as a substrate.

The screening system may be either a cell system or a cell-free system. Examples of the cell system include yeast cells, COS cells, Escherichia coli, insect cells, nematode cells, lymph cells, fibroblasts (3Y1 Cells, NIH / 3T3 cells, Rat1 cells, Balb / 3T3 cells, Swiss
3T3 cells), CHO cells, blood cells, tumor cells,
Examples include smooth muscle cells, cardiomyocytes, nerve cells, myeloid cells, glial cells, and astrocytes. The target of the screening is not particularly limited, but includes, for example, peptides, peptide analogs, microbial cultures, and organic compounds.

According to the present invention, (1) a substance to be screened is present in a cell line in which stress fiber formation and / or focal adhesion is induced by a protein that induces stress fiber formation and / or focal adhesion. And (2) a method for screening a substance that inhibits stress fiber formation and / or focal adhesion, which comprises measuring the degree of inhibition of stress fiber formation and / or focal adhesion.

Examples of a method for measuring the “degree of inhibition of stress fiber formation and / or focal adhesion” include a method of visualizing actin in cells with a fluorescently labeled probe. Examples thereof are described in Examples 12 and 13. The degree of inhibition can be measured according to the method described above. Further, in the present invention, "measuring the degree of inhibition of formation / adhesion" is used in a sense including measurement of presence / absence of formation / adhesion. Cell lines and screening targets include those similar to the screening methods described above.

In the present invention, the “screening method” is used in a sense including an assay. Activated Rho protein has been confirmed to be closely involved in tumor formation or metastasis, smooth muscle contraction and cardiomyocyte proliferation, and platelet or leukocyte aggregation or activation, as described above. Also, according to the present invention, p160
Has been shown to receive signaling from the activated Rho protein, indicating that p160 is also closely involved in tumor formation or metastasis, smooth muscle contraction and cardiomyocyte proliferation, and platelet or leukocyte aggregation or activation. It is thought that there is. Therefore, the above-mentioned screening method can also be used as a method for cleaning substances that inhibit tumor formation or metastasis, substances that inhibit smooth muscle contraction, substances that inhibit cardiomyocyte proliferation, and substances that inhibit aggregation or activation of platelets or leukocytes.

[0089]

The present invention will be described in detail with reference to the following Examples, but it should not be construed that the invention is limited thereto.

Example 1 Activated Rho protein binding protein
Purification of proteins, etc. (1) Rho by ligand overlay assay
Identification of protein binding proteins Cell homogenate (100 μg protein each)
Alternatively, the purified protein is subjected to 8% gel SDS-PAGE.
, And the separated protein was transferred to a nitrocellulose membrane (Schleicher & Schell).
According to the method described in Manser, E. et al. J. Biol. Chem. 267, 16025-16028 (1992) and Manser, E. et al. Nature 367, 40-46 (1994), Denatured and revived. However, the nature was 0.1% bovine serum albumin, 0.5 mM MgCl ₂ , 50 μM.
ZnCl ₂ , 0.1% Triton X-100 and 5 mM
Dulbecco's saline containing dithiothreitol (P
BS) at 4 ° C. overnight.

Recombinant GST-RhoA protein (Rh
oA and glutathione-S-transferase (GS
T) is a recombinant fusion protein with Morii, N. et al.
Biol. Chem., 268, 27160-27163 (1993). Recombinant GST-RhoA protein [
³⁵ S] GTPγS or [ ³⁵ S] GDPβS (manufactured by DuPont-New England Nuclear) was loaded with 40 μM recombinant RhoA protein and 100 μM of each nucleoside (1,000 Ci /
mmol) along with 1 mM MgCl ₂ , 2 mM E
DTA, 100 mM NaCl, 0.05% Tween 2
25 mM with 0 and 5 mM dithiothreitol
Incubated in Tris-HCl, pH 7.5, 30 ° C. for 30 minutes. Radioactivity bound to the recombinant RhoA protein was determined by Morii, N. et al. J. Biol. Chem. 263,12420-
12426 (1988).
Determined by the assay. The radioactive nucleoside-conjugated recombinant RhoA protein was added to the subsequently lysed protein at 5 nM, Manser, E. et.
Incubation was performed according to the method described in al. Nature 367, 40-46 (1994). Subsequently, the membrane was washed, dried, exposed to X-ray film and subjected to autoradiography. The results were as shown in FIG.

(2) Purification of Rho Protein-Binding Protein Platelets in human blood were obtained from Morii, NJ Biol. Chem. 267,2092.
Collected from the buffy coat fraction according to the method described in 1-20926. (1992). All subsequent experiments are at 4 ° C
It was carried out in. The washed platelets derived from 100 units of blood were added to 100 ml of buffer A (1 mM dithiothreitol, 1 mM EDTA, 1 mM EGTA, 1 m) using a Potter Erbegem homogenizer.
M benzamidine hydrochloride, 1 μg / ml
Leupeptin, 1 μg / ml pepstatin A and 1
10 mM Tris-HCl containing 00 μM PMSF, p
H7.4), after homogenization in 100,000
Centrifuged at xg for 60 minutes. The supernatant containing 970 mg of protein was applied to a DEAE-Sepharose CL-6B column (Pharmacia Biotech, bed volume, 70 ml) equilibrated with buffer A.
Elution was performed using buffer A containing 0 to 0.5 M NaCl.
(Total volume, 1200 ml) with a linear gradient. Approximately 16 molecular weight binding to activated Rho protein
The 0 kD protein (hereinafter referred to as “p160”)
Appeared as a broad peak at a concentration of 0.25M NaCl.

Fractions showing binding activity to Rho protein containing 170 mg of protein were pooled, and buffer A
Was applied to a Red A Sepharose column (manufactured by Amicon, bed volume, 7 ml) equilibrated in step (1). Subsequently, the column was buffered with 1 M NaCl in buffer A (15
0 ml), and then further washed with buffer A (50 ml) containing 1.5 M NaCl. The elution was performed as follows.
The reaction was performed with buffer A (50 ml) containing 5 M NaCl and 50% ethylene glycol. Collected fraction (1
(7.5 mg protein) was dialyzed for 48 hours against 1 liter of buffer A in two portions for 48 hours. The dialyzate was applied to a 2 ml macro-prep ceramic hydroxyapatite (particle size 40 μm) column (manufactured by Bio-Rad) equilibrated with buffer A, and then a 10-300 mM potassium phosphate solution,
Elution was performed with a linear gradient of pH 7.0 (total volume, 90 ml). Then, the Rho protein binding activity fraction (0.7
5 mg of protein) was applied to a Mono Q HR5 / 5 column (manufactured by Pharmacia Biotech), and the protein was collected in a total amount of 35 ml in 150-500 mM Na.
Elution was performed with a linear gradient of Cl solution. p160 is 350m
It eluted as a broad peak at the concentration of M NaCl, which was used as a final standard. The result of the purification was as shown in FIG.

Further, this sample was prepared according to the method described above [
^[32 S] GTPγS was subjected to an overlay assay together with the loaded RhoA protein and the like. The recombinant human RhoA protein, Rac1 protein and Cdc42Hs protein used here were expressed in Escherichia coli as glutathione-S-transferase fusion protein according to a conventional method, and then Morii, N. et al. J. Biol. Chem. 26
Purified according to the method described in 8,27160-27163 (1993). The results were as shown in FIG.

(3) Affinity Precipitation Experiment Using GST-RhoA Protein The hydroxyapatite fraction containing about 0.2 pmol of p160 was dialyzed against an overlay buffer containing 20 μM GTPγS or GDP. To this fraction, recombinant GST-RhoA protein loaded with 20 pM GTPγS or GDP was added, and the total volume was adjusted to 200 μl. Incubation at 4 ° C
For 60 minutes with gentle shaking.

Thereafter, 30 μl of GSH-Sepharose pre-equilibrated with an overlay buffer containing each nucleoside was added, and the incubation was continued at 4 ° C. for another 30 minutes. The mixture was centrifuged at 1,000 xg for 5 minutes. Thereafter, the pellet was washed with a washing buffer (25
mM MES-NaOH, pH 6.5, 150 mM Na
Cl, 5 mM MgCl ₂ , 0.05% Triton X-
2 at 100 and 20 μM GTPγS or GDP)
Washed twice. Then, add Sepharose beads to an equal volume of 2
X Suspended in Laemmli sample buffer. The suspension is boiled and the extract is washed with [ ³⁵ S] GT according to the method described above.
GST-RhoA, G loaded with PγS or GDP
An overlay assay was performed with ST-Rac, GST-Cdc42 and GST. The results were as shown in FIG.

Example 2 Protein Kinase Activity Test (1) Autophosphorylation of p160 and Analysis of Phosphorylated Amino Acids The mono-Q fraction of p160 (8 ng protein) was 4 μM
3 with [γ- ³² P] ATP (DuPont-New England Nuclear, 25 Ci / mmol)
30 minutes at 0 ° C, 50 mM HEPES-NaOH, pH
7.3, 50 mM NaCl, 10 mM MgCl ₂ ,
5 mM MnCl ₂ , 0.03% Brij 35 and 2
Incubated in mM dithiothreitol.
After the incubation, the solution was mixed with an equal volume of 2 × Lemuri sample buffer and boiled for 5 minutes before SDS
-PAGE. The gel was stained with Coomassie Brilliant Blue, dried and subjected to autoradiography. The results were as shown in FIG.

To perform phosphorylated amino acid analysis, radiolabeled proteins were transferred to PVDF membrane. Next, cut out the radiolabeled band and
gai, N. et al. FEBS Lett. 366, 11-16 (1995). The results were as shown in FIG.

(2) Phosphorylation Reaction The monoQ fraction of p160 (17.5 ng protein) was added to 40 μM [γ- ³² P] ATP (3.3 Ci / mmo).
l) and GST-RhoA protein loaded with 0.4 μM GDP- or GTPγS together with 3 μg of histone (HF2A, Worthington), dephosphorylated casein (Sigma) or myelin basic protein (Gibco) (Example 1) In the presence of
Incubation was performed at 30 ° C. in a total volume of 31 μl. Take 7 μl aliquots at 0, 5, 10, 20 minutes and mix with an equal volume of 2 × Remli sample buffer,
It was subjected to S-PAGE. The gel was stained with Coomassie Brilliant Blue, dried and subjected to autoradiography. The results after 20 minutes were as shown in FIG.

Next, for histone, a band having radioactivity was cut out and the radioactivity was determined by Cherenkov assay. The results were as shown in FIG. Note that histone phosphorylation in the presence of GTP-bound Rho protein was clearly enhanced as compared to that in the presence of GDP-bound Rho protein.

Example 3 Amino acid sequence of p160 and
DNA sequence encoding this (1) Determination of peptide fragment Mono-Q fraction containing 30 pmol of p160 was subjected to SDS-PA
After being subjected to GE, it was transferred to a PVDF membrane. The protein was stained with Ponceau S, and the p160 band was cut out. Iwamatsu, A. Electrophoresis 13,14
2-147 (1992) and Maekawa, M. et al. Mol. Cell. Biol. 1
According to the method described in US Pat. .

(2) cDNA Cloning Cultured MEG-01S Human Megakaryocytic Leukemia Cell MEG-0
1 (Hirata, M. et al. Nature 349, 617-620 (1991) and
Ogura, M. et al. Blood 66, 1384-1392 (1985)), poly (A) ⁺ RNA was prepared, and Kakizuka, A. et al. A Pract
ical approach (Oxford: IRL Press), pp. 223-232, according to the method described in λgt-10 and λZAP-IIcD.
An NA library was constructed. λgt-10 is first 20
Residues were screened with a degenerate oligonucleotide probe (corresponding to a partial amino acid sequence AP-23 of 7 residues). One of the positive clones containing the 2.6 kbp insert (clone P2) was 3 × 1
0 ⁵ was isolated from a plaque. This clone contained the nucleotide sequence corresponding to the probe and encoded two other peptide sequences from p160 in frame.

The 5 'portion of this cDNA (450 base pairs)
Was used to screen a λZAP-II cDNA library, and one clone (clone N) was used.
Was isolated. This clone overlapped with P2 and was further 3 '
Side 450 base pairs. Using the portion extending to the 3 'end as a probe, clone 4N
gt-10 library. Clone 4N had a further 350 base pairs 3 'end extension than clone N. Using the 3′-terminal extension as a probe, clone C was isolated from the same library. Clone C has an additional 2.5 kbp at the 3 'end.
It was growing. The positional relationship of each clone was as shown in FIG.

(3) Sequence analysis The nucleotide sequences of both strands were determined by the dideoxy chain termination method.
The deduced amino acid sequence and DNA sequence are shown in FIG.
As shown in FIG.

For comparison of sequences, etc., BLAST (Altschul,
Non-redundant PDP + SwisProt + using SF et al. J. Mol. Biol. 215,403-410 (1990)).
SPUpdate + PIR + GenPept + GPup
date database. The algorithm developed by Lupas et al. (Lupas, A. et al. Science 252, 11)
62-1164 (1991)). As a result, p16
The structure of 0 was deduced as shown in FIG.

In the structure of p160, a sequence consisting of 272 amino acids at the N-terminus (corresponding to SEQ ID NOs: 72 to 343 in FIG. 1) is characteristic of a protein of the protein kinase A family which is one of a family of serine threonine kinases. Sequence (SKHankset al., Science 241, 42-52
(1998)). N-terminal 420 containing a sequence characteristic of this protein kinase A
Amino acid sequence (corresponding to SEQ ID NOS: 1 to 420 in FIG. 1)
Is a mitonic dystrophy kinase (MD-P
K) amino acid sequence (JDBrook et al., Cell, 68, 799-8
08 (1992) and MSMahadevan et al., Hum. Mol. Genet,
2,299-344 (1993)) and 44% identity (FIG. 25). 600 following this kinase domain
The amino acid sequence (corresponding to SEQ ID NOs: 423 to 1096 in FIG. 1) revealed that there was a sequence showing similarity to various coiled-coil proteins including myosin heavy chain (FIG. 26). Further, as shown in FIG. 27, a plextrin-like (PH) region is located at the C-terminal side of p160.
(A. Musaccio et al., Trends Biochem Sci, 18, 343-348
(1993)).
As shown in FIG. 8, a cysteine-rich zinc finger region such as that present on protein kinase C (AFQu
estetal, J. Biol. Chem, 269, 2961-70 (1994) and J. Zhan
g et al., J. Biol. Chem, 269, 18727-18730 (1994)). In addition, as shown in FIG. 1, it was revealed that p160 has a leucine zipper-like sequence.

(4) Northern Blot Analysis Northern Blot analysis was performed using Human Multiple
Using Tissue-Blotz I (manufactured by Clontech), the 5P-fragment of ³² P-labeled NotI / BamHI digested fragment of P2 was used as a probe.
Hybridization was performed in 50 mM sodium phosphate buffer, pH 6.5, 50% formamide, 5 × Denhards, 0.1% SDS and 0.2 mg.
16 hours at 42 ° C. in 5 × SSPE containing / ml yeast tRNA. Filter 2 × SSC-0.1%
After washing three times in SDS at 42 ° C. for 15 minutes, they were exposed to X-ray film for 4 days. The results were as shown in FIG.

Example 4 Expression Vector and Transfection
Construction of a full-length cDNA The full-size cDNA used for expression was constructed as follows. Plasmid DNA pBluescript SK ⁺ (Stratagene) into which clone 4N cDNA was inserted was digested with SphI and SacI, ligated with SphI-SpeI fragment of clone C and SpeI-SmaI-EcoRV-SacI linker, and plasmid 4N- C was prepared.
Next, using the clone N cDNA as a template,
Primer (5′-GGGGAGCTCAAGGTAC
CTCGAGTGGGGACAGTTTTGAG-
3 ′) and reverse primer (5′-CGCCT)
GCAGGCTTTTCATCGTAAATCTCTG
PCR was performed using -3 ′). The PCR fragment was subcloned into pBluescript SK ⁺ (Stratagene) and the nucleotide sequence was determined. Plasmids containing this product were inserted into BamHI and E
digested with coRV and digested with XbaI from plasmid 4NC.
-EcoRV fragment and Ba from clone N
Ligation with the mHI-XbaI fragment.
From the resulting plasmid, Asp718-Ec
The oRV fragment was excised and the pCMX vector containing the myc-epitope sequence (Dyck, JA et al. Cell 76, 3).
33-343) (pCMX-myc-p160).

COS-7 cells (ATCC CRL 16
51) was plated on a plate at a density of 10 ⁵ cells / 3.5 cm dish, cultured overnight, and then transfected with 1.5 μg of pCMX vector using Lipofectamine. Cells were incubated in Opti-MEM for 6 hours before DME containing 10% fetal bovine serum.
Cultured in M for 18 hours. Remove the medium and transfer cells to PBS
, And dissolved in 100 µl of 2x Laemmli sample buffer. 30 μl of the lysate was subjected to SDS-PAGE, and the separated protein was subjected to PV
Transferred to DF membrane or nitrocellulose membrane. Immunoblotting and ligand overlay analysis using the 9E10 anti-myc epitope antibody were performed according to the methods described above. The results were as shown in FIG.

Example 5 p160 cDNA and RhoA
^{Cotran with Val14-} and wild-type RhoA cDNA
Sfection COS7 cells were seeded at a density of 1.2 × 10 ⁵ cells / 6 cm dish. After culturing for one day, remove the medium,
2.25 μg of pCMX-myc-p160 or pC
MX-myc was converted to 0.75 μg of pEF-BOS-HA
^Val (the Haemophilus influenza hemagglutinin) is attached as a label 14 -RhoA, pEF
-Transfected with lipofectamine in 2 ml of Opi-MEM with BOS-HA-RhoA or vector alone. After 6 hours, 3 ml of O
Pi-MEM was added and the cells were cultured for an additional 30 hours. After washing the cells once with ice-cold PBS, lysis
Buffer (20 mM Tris-HCl, pH 7.5,
mM EDTA, 1 mM EGTA, 5 mM MgCl
₂ , 25 mM NaF, 10 mM β-glycerophosphate, 5 mM sodium phosphate, 0.2 mM
PMSF, 2 mM dithiothreitol, 0.2 mM
Sodium Vanadate, 0.05% Triton X-
Cells were lysed with 100 and 0.1 μM caliculin A) on ice for 20 minutes. 10,000 lysates
The mixture was centrifuged at 0 × g for 10 minutes, and the supernatant was collected.

Next, the 9E10 antibody or control IgG bound to protein G-Sepharose was added to the supernatant, and the mixture was shaken at 4 ° C. for 3 hours. 1,0 suspension
After centrifugation at 00 × g for 5 minutes, the resulting pellet was washed three times with 0.5 ml of lysis buffer. Morii, N. et al. J. Biol. Chem. 263, 12420-12426 (198
The pellet was resuspended in 500 μl of ADP-ribosylation buffer without dithiothreitol for the ADP-ribosylation reaction according to the method described in 8). 100 μl each was taken, precipitated, and used for immunoblotting using an anti-myc antibody. The results were as shown in the lower part of FIG.

Centrifuge the remaining 400 μl of suspension,
The pellet was resuspended in 34 μl of ADP-ribosylation buffer. [ ³² P] NAD (Dupont-New
England Nuclear, ^Inc., 10 6 cpm / pmo
l) was added to 1 μM, and the mixture was reacted with 400 ng of botulinum C3 enzyme at 30 ° C. for 12 hours. ADP-
Analysis of the ribosylation reaction is described in Morii, N. et al. J. Biol. Chem.
263, 12420-12426 (1988). The results were as shown in the upper part of FIG.

For the kinase assay, the pellet was washed once with 20 mM Tris-HCl, pH 7.5 containing 5 mM MgCl ₂ and 0.1 μM calyculin A, and then resuspended in the phosphorylation buffer. The phosphorylation reaction was performed using histone as a substrate according to the method described above. The results were as shown in FIG.

Example 6 Rho protein binding of p160
As shown in Examples 1, 2, 4, and 5, GTP-bound RhoA specifically binds to p160 and activates it. To identify the Rho protein binding region of p160, p160 was divided into five fragments (FIG. 2).
9), expressing them as His fusion proteins,
Purified by using Ni-NTA resin. Specifically, the measurement was performed according to the following method.

P160 was transformed into five fragments, KD (2-333) and M1 (334-7), as shown in FIG.
26), M2 (727-1021), M3 (1018-
1094) and C (1096-1354),
Each was expressed as a fusion protein with a tag consisting of six histidine residues. First, in order to express these fragments in E. coli, the plasmid vector pQE-
11 (Quiagen) (GGG
ATC CGT CGA CCT GCAGCC A
AG CTT) to GGG ATC CCC GGG T
AC CGAGCT CAA TTG CGG CCG
CTA GAT AGA TAG AAG CGA
BamHI, Sm instead of GCT CGA ATT
Restriction sites for aI, Asp718, SacI and NotI were created.

In order to insert the KD fragment (2-333) in-frame at the SacI site of pQE-11 modified as described above (hereinafter referred to as “modified pQE-11”), SEQ ID NO: 1 CDNA fragment corresponding to the amino acid sequence of 5′-GG GGA GCT
CAA GGT ACC TCG ACT GGGG
AC AGT TTT GAG-3 'and 5'-CG
CCT GCAGGC TTT CAT TCG T
It was amplified by PCR using synthetic primers of AA ATC TCT G-3 '. The DNA template for all PCRs described here is pCMX-myc-p
160 (Example 4). PCR at 95 ° C
For 1 minute, then (95 ° C. for 1 minute, 53 ° C. for 1 minute,
(1 minute at 72 ° C) followed by a 2 minute incubation at 72 ° C. This fragment was digested with SacI and PstI and ligated into pSK ⁺ (Stratagene) into the SacI and PstI sites.

This plasmid was replaced with BamHI and Pst
I digested with the original p160 clone N cDNA
The BamHI-PstI fragment of (Example 3) was inserted into these sites (pSK ⁺ -NT1). Fragment NT2 corresponding to the amino acid sequence of positions 74 to 333 of SEQ ID NO: 1 was also used as a synthetic oligonucleotide primer 5'-
GGG ATC CCC GGT ACC GAA G
AT TAT GAAGTA GTG AAG G-
3 'and 5'-TC AGC TAA TTA GA
G CTC TTT GAT TTC TTC TAC
It was prepared by PCR using ACC ATT TC-3 '. PCR was performed at 95 ° C. for 1 minute,
1 minute at 55 ° C, 1 minute at 55 ° C, 1 minute at 72 ° C).
The cycle was performed by a final incubation at 72 ° C. for 2 minutes. The product was then blunted and ligated into the EcoRV site of pSK ⁺ (Stratagene) (pSK ⁺ -NT2). NT1
And NT2 to link ^and then ligated PstI-PstI fragment of pSK + -NT2 in the PstI site of ^pSK + -NT1, of SEQ ID NO: 1 2
An insert corresponding to the -333 amino acid sequence was obtained (pSK ⁺ -KD). SacI-No of pSK ⁺ -KD
The tI fragment was ligated into modified pQE-11 and
A plasmid expressing is (x6) -KD was prepared.

In order to prepare an M1 fragment, the c-sequence corresponding to the amino acid sequence of positions 334 to 395 of SEQ ID NO: 1
First, the DNA fragment was subjected to 5'-GG GGA GCT
CGA CAT CTC TTC TTC AAA
AAT G-3 'and 5'-CC TAC AAA
AGG TAG TTG A-3 'was amplified by PCR using primers (1 min at 95 ° C, then 9
1 minute at 5 ° C., 1 minute at 53 ° C., 1 minute at 72 ° C.
Cycle, finally incubation at 72 ° C. for 2 minutes).
The product was blunt-ended and digested with SacI.
pSK ⁺ (Stratagene) was digested with Asp718, a 14-mer oligonucleotide was inserted, and NotI was inserted.
Sites were made. The PCR product was then ligated into the SacI and EcoRV sites of pSK ⁺ modified as described above. This plasmid was then replaced with SpeI and Xho.
I digested with the original p160 clone 4N cDN
The SpeI-XhoI fragment of A (Example 3 (2)) was inserted into these sites (pSK ⁺ -M1). pS
The SacI-NotI fragment of K ⁺ -M1 (334
-726) was ligated into modified pQE-11.

M2 fragment (727-1021)
XPS ⁺ (Stratagene) containing the original clone 4N cDNA (Example 3 (2)) encoding the amino acid sequence of positions 273 to 1021 of SEQ ID NO: 1
It was made by digesting with hoI, deleting the N-terminus, and self-ligating. This plasmid was digested with Asp718 and SacI to obtain a modified pQE-
Ligation into 11 Asp718 and SacI sites.

M3 fragment (1018-1094)
15 cycles of 95 ° C. for 3 minutes, then 95 ° C. for 1 minute, 59 ° C. for 1 minute, 72 ° C. for 1 minute, and finally 72 ° C.
5'-C GGG ATC CCC G for 2 minutes
AT AGA AAG AAA GCT AAT AC
A CA-3 'and 5'-TAA CCC GGGA
AG TTT AGC ACG CAA TTG CT
It was prepared by PCR using C-3 'primers.
The product is blunt-ended and digested with BamHI,
BamHI and E of pSK ⁺ (Stratagene)
Inserted into the coRV site (pSK ⁺ -M3). pSK
⁺ -BamHI-Asp718 fragment of M3 (1
018-1094) was ligated into modified pQE-11.

To construct a plasmid expressing His6-C (1096-1354), the original p16
Sau9 of Clone 0 cDNA (Example 3 (2))
The 6I-HincII fragment was blunt-ended and ligated into the Smal site of the modified pQE-11.

E. coli was transformed with the pQE plasmid and grown. Isopropyl β-D-thiogalactoside was added to the culture at a growth stage of A600 of 0.8 and the culture was continued at 30 ° C. for a further 20 hours. Cells were washed with 0.1 M sodium phosphate and 10 mM Tris-HCl (pH 8.
0) was dissolved in 8M urea. After 1 hour incubation at 25 ° C., the lysate was 12,000 × g for 1 hour.
Centrifuged for 0 minutes. Supernatant is transferred to Ni-NTA resin (Qiagen)
For 1 hour at 25 ° C. 8M resin
Urea, 0.1 M sodium phosphate, 0.01 M Tris-H
Washed with Cl (pH 6.3) and boiled for 5 minutes in Laemmli sample buffer. Recombinant human RhoA was expressed as a glutathione-S-transferase fusion protein and was expressed by Morii, N. et al., J. Biol. Chem. 268, 27160-
Purified as described in 27163 (1993).

The purity of the sample used in this assay was determined by SDS.
-Checked by PAGE. As shown in FIG. 32, each protein preparation showed a single band at the expected size, and the amount of each protein increased upon IPTG induction.
The KD fragment was not expressed, presumably because the KD protein functioned as a constitutively activated mutant.

Then, the expressed protein was used as a probe [
^[35 S] GTPγS was loaded into a ligand overlay assay using GST-RhoA. Specifically, first, His-tagged protein extracted with Laemmli buffer was subjected to 8, 10 or 15% SDS-PAGE, and the separated protein was subjected to nitrocellulose membrane (Schleule).
icher & Schuell). Next, the protein on the membrane
Manser, E. et al., J. Biol. Chem. 267, 16025-16028
(1992). Denatured and regenerated as described in (1992). The renatured membrane was then purified from Manser, E. et al., J. Biol. Chem. 267, 1625-
According to the method described in 16028 (1992) (see Example 1), 10 or 20 nM in overlay buffer [
^[35 S] GTPγS was incubated with each loaded Rho protein. Finally, the membrane was washed, dried and exposed to X-ray film.

The results were as shown in FIG. In only lanes 3 and 4, a radioactive band was seen on this filter at the same migration position as the M2 fragment stained with amide black. From these results,
M2 fragment (727-1021) is GTP-Rh
It was shown to contain the oA binding region.

Example 7 Rho in M2 Fragment
Identification of protein binding site In order to identify the minimum part necessary for RhoA binding in the M2 fragment, the M2 fragment was first deleted from the N-terminal side (M2-1 to M2- in FIG. 30).
6) The truncations were expressed as His fusion proteins and purified (Figure 34, lanes 1-7). Specifically, the method was performed according to the method described below.

Various partial fragments of the M2 fragment were
R, and each was expressed in Escherichia coli as His-fused proteins (FIG. 30). Fragments M2-1 (847-1024), M2-2 (906-1)
024), M2-3 (920-1024), M2-4
(934-1024), M2-5 (946-1024)
And M2-6 (974-1024) were amplified using a pair of primers (primer pair) as shown in Table 1. M2-1, M2-2; PCR was performed at 95 ° C for 3 minutes, and then (95 ° C for 1 minute, 59 ° C for 1 minute, 72 ° C
For 2 minutes) followed by 2 minutes at 72 ° C. M2-3, M2-4, M2-5, M2-6; PCR
Is 15 cycles at 95 ° C. for 3 minutes, then (95 ° C. for 1 minute, 55 ° C. for 1 minute, 72 ° C. for 1 minute), then 72 cycles
C. for 2 minutes. All PCs listed here
The DNA template for R is pCMX-myc-p16
0 (Example 4).

Next, the product was used as blunt end, and Ba
It was digested with mHI, pSK ^- of (Stratagene) B
It was inserted into the amHI and EroRV sites. The BamHI-Asp718 fragment of each plasmid was modified p
It was ligated into the BamHI and Asp718 sites of QE-11 and expressed. His6-M2-7
(906-1015) and M2-8 (920-101)
5) In order to prepare a plasmid expressing, pSK ^-
-M2-2 (906-1024) and M2-3 (92
0-1024) were ligated into the BamHI and blunt-ended NotI sites of the modified pQE-11, respectively. M
No. 2-9 (906-1004) cDNA was designated as No. Amplification was performed by PCR using 7 primer pairs (Table 1).

[0129]

[Table 1]

The PCR was carried out at 95 ° C. for 3 minutes and then (at 95 ° C.).
For 1 minute, 59 ° C. for 1 minute, 72 ° C. for 2 minutes), followed by 2 minutes at 72 ° C. Bam the product
Digested with HI and NotI, Ba of modified pQE-11
Ligation into mHI and NotI sites. Expression and purification of the M2 fragment fused to each His in Escherichia coli, and ligand overlay assay were performed according to the method described in Example 6.

The results were as shown in FIG. A strong binding signal was generated for the first three variants, M2-1 (84
7-1024), M2-2 (906-1024) and M2-3 (920-1024). This signal was weakened at M2-4 (934-1024),
5 (946-1024), rarely found, and M
It disappeared at 2-6 (974-1024). Then M2-
After deleting the C-terminals of M2-7 and M2-3, M2-7 (906-101) was deleted according to the method described above.
5), M2-8 (920-1015) and M2-9
(906-1004) His fusion protein was made and subjected to ligand overlay assay.

The results were as shown in lanes 8 to 10 in FIG. M2-7 (906-1015) (lane 8) and M2-8 (920-1015) (lane 9)
Thus, the deletion of 9 amino acids is equivalent to [ ³⁵ S] GTPγS-Rho
Had little effect on binding to A, but M2-9
(906-1004) showed no signal (lane 10).

Example 8 Yeast two hybrid cis
Identification of Rho Protein Binding Site by System To confirm the results of the ligand overlay assay, a yeast two-hybrid assay was performed using the M2 partial mutant (Example 7) (FIG. 36). Each mutant fused to the VP16 activation region was expressed in yeast strain AMR70 and Rho fused to the LexA DNA binding region.
^Mated with yeast strain L40 expressing A or RhoA ^Val14 . Binding was measured by β-galactosidase activity. Specifically, it was carried out according to the method described below.

To implement the yeast two-hybrid system, the BamHI-NotI fragment of each pQE plasmid DNA containing M2-2 to M2-9 was pVP
-16 (Vojtek, A. et al., Cell 74, 205-214 (1993)
). pBTM116 (Vojtek, A. et a
l., Cell 74, 205-214 (1993)) by Madaule, P. et al., F.
Modified according to the method described in EBS Lett. 377, 243-248 (1995) ^* . According to the method described in Madaule, P. et al. (1995) ^* , pGEX-rhoA and rhoA
The BamHI-EcoRI fragment of ^Val14 was inserted into BamHI and EcoRI sites of pBTM116 that is modified as described above. Madaule, P. et al., Supra.
(1995) ^{* According} to the method described in ^* , pGEX-rhoB
The BamHI-BamHI fragment of and -rhoC was inserted into the BamHI site of the modified pBTM116. The β-galactosidase activity of diploids obtained by crossing the AMR70 strain expressing the Rho protein binding regions of various partial fragments of p160 with the L40 strain transformed with each BTM construct was examined.

The results were as shown in FIG. Strong staining was observed for M2-2, M2-3, M2-4, M2-7 and M2-8. The binding is more R than wild-type RhoA.
hoA ^Val14 was strong. A very faint signal was observed for M2-5, but no signal was observed for M2-6 and M2-9. Thus, the results obtained with the two-hybrid system were consistent with the results of the ligand overlay assay (Example 7).

Example 9 Using site-specific mutants of M2
Analysis of Rho Protein Binding Sites Analysis using the overlay assay and the two-hybrid system described in Examples 7 and 8 suggested the importance of several regions within M2 in GTP-Rho binding. . First, loss of binding at M2-9 and a significant decrease in binding at M2-5 resulted in two regions: 934-945 and 1005 of SEQ ID NO: 1.
This shows that the amino acid sequence of 〜１０1015 plays an essential role in Rho protein recognition. Second, M2-4
The decrease in binding at indicates that regions 920-933 may have a supporting role. However, the role of the intervening region 946-1004) remains unknown.

To confirm or further examine these, the following experiments were performed. To identify the amino acids required for binding to RhoA, we introduced some point mutations in M2-8 (see FIG. 37) to generate GTP-Rho.
Their effects on binding were analyzed. The mutant is p1
60 and its homologue, ROKα (ROCK-II)
(Leung, T. et al., J. B.)
iol. Chem. 270, 29051-29054 (1995) ^* ). These mutants were expressed as His fusion proteins and purified according to the method described in Example 6. Approximately the same amount of purified protein was subjected to SDS-PAGE and used for the ligand overlay assay (FIG. 38). Specifically, it was carried out according to the method described below.

A total of 15 different point mutations were introduced into the cDNA corresponding to amino acid sequence 906-1094 by replacing the wild-type sequence with a sequence having each mutation (FIG. 31). First, the wild-type fragment (906-10)
94) using the primer pair (No. 8, Table 2)
It was produced by CR.

[0139]

[Table 2]

The PCR described in this paragraph was performed at 95 ° C. for 2 hours.
Minutes, then (95 ° C. for 1 minute, 45 ° C. for 1 minute, 72 minutes
C. for 1 minute) followed by 2 minutes at 72.degree. The product was blunt-ended, digested with BamHI, pSK ^- was inserted into BamHI and EcoRV sites of (Stratagene) ^(pSK - -M2-1
0). pSK ^- A of -M2-10 (906-1094)
The sp718 fragment was ligated into modified pQE-11.

To generate the first three mutants, K
921M (906-926), M2-11 (924-1)
024), M2-12 (906-926), R926A
(924-1024) and E930A (924-10)
The cDNA of 24) was prepared by PCR using the primers shown in Table 2. The product was then blunt-ended, digested with BamHI and inserted into the BamHI and HincII sites of pSK ⁺ (Stratagene) (pSK ⁺ -K921M (906-926, respectively),-
M2-11 (924-1024), -M2-12 (90
6-926), -R926A (924-1024),-
E930A (924-1024)). K921M (90
6-926) and -M2-11 (924-1024)
PSK ⁺ -M2-11 (924-
1024) with the Nhel-Xhol fragment
⁺ Nhel and X of -K921M (906-926)
Ligation into the hoI site. Similarly, pSK ⁺
-R926A (924-1024) and pSK ⁺ -E
The Nhel-Xhol fragment of 930A (924-1024) was converted to pSK ⁺ -M2-12 (906-926).
In the NheI and XhoI sites. B of these pSK ⁺ (Stratagene) DNA
The amHI-HincII fragment was converted to pQE-M2-1.
BamHI and HincII at 0 (906-1094)
Ligation into the site.

K934M, L941A and E943A
Mutants were identified as primer pair No. 14, No. Fifteen
And No. In PCR using No. 16, 90 of SEQ ID NO.
It was introduced into the cDNA corresponding to the amino acid sequence at positions 6 to 948. The BamHI-SphI fragment of the PCR product was then combined with the BamHI and Sph of pQE-M2-10.
Ligation into the phI site. D951A, E9
Similarly, the mutants of primer pair No. 17, No. 18 and No. 19 and by PCR as shown in FIG. The SphI-HincII fragments of these products were then ligated into the SphI and HincII sites of pQE-M2-10. Two other mutants E995Q
And K999M, respectively.
20 and no. 21 was prepared by PCR as shown in FIG. BamHI- of PCR product
The HincII fragment was replaced with the Bam of pQE-M2-10.
Ligation into HI and HincII sites.

The four sequences with other mutations, E100
8A (1003-1094), I1009A (1003
-1094), R1012L (1003-1094), and K1013M (1003-1094), respectively. 22, no. 23, no. 24 and No. Amplified by PCR using 25. The product was blunt-ended, digested with HincII, and pSK ⁺
(Stratagene) into the HincII site (pSK ⁺ -E1008A (1003-109 each)
4), -I1009A (1003-1094), -R1
012L (1003-1094) and -K1013M
(1003-1094)). The HincII-NotI fragments of these pSK ⁺ (Stratagene) were then ligated into the HincII and NotI sites of pQE-M2-10.

The result was as shown in FIG. Wild-type peptide (M2-10 (906 to 1094)
The strong signal observed in 934-94 of SEQ ID NO.
K934M and L94 located in the 5th amino acid sequence
The 1A mutation and the E1008A mutation significantly reduced the
It disappeared with the 9A mutation. Extra bands are likely to be degradation products. This result shows that the amino acid sequence regions of positions 934 to 945 and 1004 to 1015 of SEQ ID NO: 1 are Rh
Consistent with the above assumption that it is important for oA binding.

Example 10 Site-Specific Mutants of p160
Cell Biology for Rho Protein Binding Activity of
Analysis The present inventor has identified KD (2-333) as a recombinant protein.
Since the fragment could not be expressed, M
The possibility that Rho protein binding activity exists not only in the two regions but also in the KD (2-333) region remains without being denied. Therefore, the M2 region is the only Rh at p160
o It was examined whether it is a protein binding region. First, Es as a myc-labeled protein in COS cells
Mutant p160 having the 1008A, I1009A or R1012L mutation (ie, p160 containing the KD region and the mutant M2 region) or its wild type was expressed. Immunoprecipitating these proteins with the 9E10 anti-myc antibody,
A ligand overlay assay was performed. More specifically, it was carried out according to the method described below.

For transfection into cultured cells, each mutation (E1008A, I1009A and R10
12L) was generated. M
2-10 (E1008A), M2-10 (I1009
A) and p encoding M2-10 (R1012L)
Each Sph of QE plasmid (Quiagen) DNA
The I-BalI fragment was inserted into the SphI and BalI sites of the pSK plasmid containing the full length p160 cDNA (Example 4). Xho from the resulting plasmid
The I-SmaI fragment was cut out and then pCMX
XhoI and Sm of -myc-p160 (Example 4)
Inserted into the aI site. COS-7 cells (ATCC C
RL 1651) 1.2 × 10 per 6 cm Petri dish
Plated at a density of ⁵ cells. After one day of culture,
The medium was removed and the cells were treated with 3 μg of pCMX-my using lipofectamine according to the method described in Example 4.
c, transfected with pCMX-myc-p160 wild-type or mutant plasmid DNA. Cells were lysed and immunoprecipitates with anti-myc antibody were subjected to immunoblot and ligand overlay assays according to the method described (Examples 1 and 4).

The results were as shown in FIGS. 40 and 41. From this operation, each p160 was quantitatively recovered in the sediment. A strong signal of Rho protein binding was observed for wild type and the R1012L mutant. The signal was significantly reduced with the E1008A mutation and abolished with the I1009A mutation. From these results, 934 to SEQ ID NO.
Amino acid sequence region at position 1015 is the only Rh in p160
o It was revealed to be a protein binding region.

As described above, the minimum Rho protein binding region was located in the amino acid sequence at the C-terminus of the α-helix of p160 (the amino acid sequence at positions 934 to 1015 in SEQ ID NO: 1) (Examples 6 to 8). This contains a leucine zipper-like motif (Example 3). In this region, residues important for Rho protein binding were also identified (Examples 9 and 10). The amino acid sequence of this region is shown in FIG.

Example 11 p16 Having Kinase Activity
Generation of 0 mutant p160 is a kinase domain, coiled-coil forming α-
It is a multidomain protein containing a helical region, a Rho binding domain, a region rich in PH and cysteine (Example 3). Wild-type (WT) and variants of this protein were expressed to identify its role in cellular processes mediated by Rho and to identify the function of each domain. The variants used in this test were:
Five partial deletion mutants (Δ1 to Δ5) in which the above domains are deleted from the C-terminus, a C-terminal fragment (C) containing only a region rich in PH and cysteine, and a full-length protein having a point mutation in the kinase domain ( KD), as well as a full-length protein (KD-IA) with point mutations in both the kinase and the Rho binding domain (FIG. 43A). Plasmids carrying these constructs were transfected into HeLa cells and lysates of the transfected cells were used for immunoprecipitation and immunoblotting analysis. Specifically, the procedure was performed as follows.

<Expression Constructs> All constructs of p160 were labeled at the amino terminus with a Myc epitope and expressed. The 5'-HindIII fragment of pCMX-myc-p160 (Example 4) was ligated to plasmid pBluescriptSK + (Stratagene) cut with HindIII to prepare pBluescript-myc-N. pBluescri
To construct pt-myc-p160, pBluescript
-Myc-N is cut with BamHI-NotI and pCM
The BamHI-SmaI fragment of X-myc-p160 was ligated. SalI- of pBluescript-myc-p160
The BstXI fragment was converted to a pCAG vector (Niwa, H. et al.,
Gene 108, 193-200 (1991)) and pCAG-m
yc-p160 (WT) was produced. XhoI-Eco
RV-XhoI linker was replaced with pCAG-myc-p160
PCAG-myc-p160 with 3 frame stop codon inserted into 3′-XhoI site of (WT)
^Myc-727 was built. Asp718-MscI, Asp
718-SphI, Asp718-XhoI, Asp7
The 18-XbaI and Asp718-SpeI fragments were
Asp718-E of CAG-myc-p160 ^myc-727
ligated to the coRV fragment, each with pCAG-myc-p16
0Δ1, 2, 3, 4 and 5 were made.

For site-directed mutagenesis of Lys ¹⁰⁵ to Ala, the nucleotide sequence 50-71, 300-331, 300-33 of the coding region of p160 cDNA was used.
Primer A, corresponding to 1 and 526-550,
Oligonucleotides 5'- designated B, C and D
TGCTGCGGGATCCCAAATCGG- 3 ',
5'- CAAATTTGCTGAGAAGC GC CAT
GGCATATAC- 3 ', 5'- GGTATATG
CC ATG GC GCTCTCTCAGCAAATTTG-
3 'and 5'- GAACTACTTCTGCAGTA
TAGAATCG- 3 'was synthesized (underlined portions are complementary sequences). Polymerase chain reaction (PCR) was performed separately using primer pairs A and B and C and D, and using pCMX-myc-p160 as a template. These products were combined and PCR was performed using primers A and D. The products were BamHI and PstI
With pCMX-myc-p160 and pCMX
BamHI-Pst of -p160 ^I1009A (Example 10)
Kinase inactivating mutant (KD) inserted into fragment I
And a kinase inactivated / Rho binding inactivated mutant (KD-IA) were prepared. pCMX-p160
(KD) and the fragment of p160 (KD-IA) were excised and inserted into the pCAG vector, resulting in pCAG-myc
-KD and -KD-IA were each produced. pCAG-
To generate myc-C, the PCR was performed using the forward primer 5'-CGGGGTACCGCCAGCAAAG
AGAGTGATATTGAG-3 'and reverse primer 5'-TTGTTCCAATTATGTCACA
PCMX-myc-p16 using CCACAG-3 '
0 was used as a template. These products were converted to Asp718-
Cleavage with SmaI followed by pCAG-myc-p160
^It was ligated to the Asp718-EcoRV fragment of ^myc-727 .

<Transfection, immunoprecipitation test,
Western Blotting> HeLa cells were placed on coverslips for immunofluorescence and immunoprecipitation studies at a density of 7.5 × 10 ⁴ cells per 3.5 cm dish and 1.5 × 10 ⁵ cells per 6 cm dish, respectively. . HeLa cells were grown in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal calf serum (FCS). After one day of culture, cells were transfected with the pCAG construct by lipofectamine-DNA coprecipitation.
After 4 hours, DMEM containing 10% FCS was added, and the cells were further cultured for 12 hours. The cells were then washed twice with phosphate buffered saline (PBS). Lysis of washed cells and immunoprecipitation of cell lysate with anti-Myc antibody was performed as described in Examples 4 and 5.

The immunoprecipitates were then subjected to Western blotting as described in Examples 4 and 5.

The results were as shown in FIG. 43B.
The expected size protein was recovered in each transfectant. The expression levels of mutant Δ2 and KD-IA were significantly lower than others.

Next, the immunoprecipitate obtained above was subjected to a phosphorylation test using histone as a substrate. The phosphorylation test was performed as described in Example 2.

The results were as shown in FIG. 43C. Histone phosphorylation is dependent on WT protein and Δ1-Δ4
Observed in the mutant. The Δ5 mutant showed little histone phosphorylation, but it gave an autophosphorylated band. Clearly, no phosphorylation was observed with the C or KD-IA mutant. It was not detected in the KD mutant (data not shown).

Example 12 p160 or kinase activity
Stress fiber by p160 mutant having
In this example, My-labeled N-terminal of each protein was used.
Cells expressing these proteins were identified by staining for the c epitope, and the morphology of each transfectant was characterized. The transfected cells were then subjected to vinculin and actin double staining.

Specifically, HeLa cells were isolated from the vector alone or from p160 wild type (WT), Δ1, Δ2,
1 μg of vector carrying Δ3, Δ4 or Δ5 mutant
Was transfected. After a 16 hour incubation, cells were double stained with rhodamine-phalloidin and anti-vinculin antibodies. Double staining (immunofluorescence) was performed as follows.

<Immunofluorescence> Fixation, permeabilization, and blocking procedures for immunofluorescence were performed at room temperature as previously described (Stokoe, D. et al., Science 264, 1463-14).
67 (1994)). However, cells for anti-vinculin staining
The cells were fixed with 4% formaldehyde in Ca ⁺⁺ and Mg ⁺⁺ free PBS containing 0.1% Triton X-100 (PBS (-)). In tests without anti-vinculin staining, cells were first fixed with 4% formaldehyde in PBS (-) for 15 minutes, followed by 0.1% Triton X-1 in PBS.
Permeabilized with 00 (PBS-TX). The permeabilized cells are washed with PBS-TX and PBS-TX containing 5% skim milk and 0.1% Tween 20 (blotto)
For 1 hour. The cells are then replaced with anti-Myc
(9E10) Antibody (17 mg / ml) (1:50 in blotto)
0), anti-vinculin antibody (1: 100 in blotto), anti-RhoA antibody (1:50 in blotto), anti-p160C9 antibody (1: 100 in blotto), or with a combination of anti-vinculin and anti-RhoA or anti-p160 antibody Incubated. Anti-Myc (9E10) and anti-vinculin antibodies were detected with FITC-conjugated anti-mouse IgG. Rhodamine-conjugated or Cy2-conjugated
Using anti-rabbit IgG, anti-Rho antibody and anti-p1
The signal of 60 antibodies was detected. For F-actin staining, rhodamine-conjugated phalloidin (Molecular Probe) in PBS-TX was added after incubation with the secondary antibody. Cells are photographed with a Zeiss Axiophot fluorescence microscope or Bio-Rad MRC-1024 Confocal Imaging
Analyzed with 0.36 μm optical section in the System
Built image.

The above anti-vinculin antibody (V-4505)
And anti-RhoA polyclonal antibody (SC-179)
Were purchased from Sigma and Santa Cruz Biochemical, Inc., respectively. In addition, the anti-Myc antibody (9E10) (Evan,
GI et al., Mol. Cell. Biol. 5, 3610-3616 (1985)) was obtained from S. Nishikawa of Kyoto University.

The results were as shown in FIGS. 44 and 45. Figures 44 and 45 show the characteristic phenotype of each transfectant. Expression of WT resulted in rectangular to polygonal cell shapes with sharp edges (FIG. 44).
C and D). A thin actin bundle formed and converged at the sharp end. Spotted vinculin staining was observed at the end of the actin bundle. With expression of the Δ1 mutant, actin bundles across cells became thicker and more numerous. Consistently, vinculin staining increased in size and number and became more dense (FIGS. 44E and F). An essentially similar form is Δ2
Observed in cells transfected with the mutant (FIG. 4).
4G and H), indicating that Rho binding was not required to induce this change. In cells expressing the Δ3 mutant, vinculin staining is more dense and large,
Some of them were located intracellularly or concentrated at one end of the cell (FIGS. 45I and J). Actin bundle is Δ
It was thicker and shorter than that seen in cells transfected with 1 and Δ2, and was seen between vinculin-containing structures (FIGS. 45I and J). Similar changes were seen in cells expressing Δ4 (FIGS. 45K and L). In contrast to these findings, no significant morphological changes were seen in cells expressing the kinase domain alone, Δ5 (FIG. 45).
M and N). Expression of the kinase inactivating mutant KD also did not induce phenotypic changes (data not shown).

The above results indicate that p160 expression can induce focal fiber-like actin bundles extending between focal adhesion-like structures as evidenced by vinculin accumulation. They also suggested that both kinase activity and a portion of the coiled-coil forming region were required for this induction.

Example 13 p160 Mutation Containing PH Region
Stress fiber formation and focal bonding by the body
To investigate the inhibition Rho-induced or Rac-induced focal adhesion and involvement of p160 in stress fiber formation, ^{RhoA Val14} and KD-IA (kinase inactivation, Rho binding inactivating mutant) were co-transfected HeLa cells .

Specifically, HeLa cells were cultured in the absence or presence of 2 μg of the p160 mutant, pCAG-KD-IA, with pEXV-Val ¹⁴ -RhoA (Nobes, CD
& Hall, A. Cell, 81, 53 (1995); Ridley, PM et a
l., Mol. Cell. Biol. 15, 1110 (1995)) or pEX.
Transfected with 0.2 μg of V-Val ¹² -Rac. After 16 hours of incubation, cells are double-stained with rhodamine-phalloidin and anti-vinculin, anti-RhoA and anti-vinculin antibodies, anti-RhoA and rhodamine-phalloidin, anti-p160 and rhodamine phalloidin, or anti-p160 and anti-vinculin antibodies did. Vector construction, transfection, immunofluorescence, and the like were performed according to the method described in Example 12.

The results were as shown in FIG. R
For transfection with hoA ^Val14 alone,
Both stress fibers and focal adhesion were strongly induced (FIGS. 46A and B). KD-IA of p160
Co-expression of the mutant suppressed the induction of focal adhesion as shown in FIG. 46D. Although no stress fibers were seen, an overall increase in F-actin levels was observed in these cells (FIG. 46F). Co-expression of the C mutant also suppressed RhoA ^Val14- induced focal adhesion and stress fiber formation (data not shown).

When HeLa cells were transfected with only Rac ^Val14 , membrane ruffling and formation of a dot-like focal complex were induced by stress fiber Rho.
Strongly induced with dependent formation (Ridley, A., supra).
J. et al. And FIGS. 47G and H). Co-expression of the KD-IA mutant did not inhibit Rac-induced structure formation, but did inhibit Rho-dependent structure formation (FIGS. 47I and J).

These results strongly suggest that p160 selectively acts downstream of Rho and induces focal adhesion and stress fiber formation in cells.

[0168]

[Sequence list]

 SEQ ID NO: 1 Sequence length: 1354 Sequence type: amino acid Number of chains: single-chain Topology: linear Sequence type: protein Origin: Biological name: human Sequence Met Ser Thr Gly Asp Ser Phe Glu Thr Arg Phe Glu Lys Met Asp Asn 1 5 10 15 Leu Leu Arg Asp Pro Lys Ser Glu Val Asn Ser Asp Cys Leu Leu Asp 20 25 30 Gly Leu Asp Ala Leu Val Tyr Asp Leu Asp Phe Pro Ala Leu Arg Lys 35 40 45 Asn Lys Asn Ile Asp Asn Phe Leu Ser Arg Tyr Lys Asp Thr Ile Asn 50 55 60 Lys Ile Arg Asp Leu Arg Met Lys Ala Glu Asp Tyr Glu Val Val Lys 65 70 75 80 Val Ile Gly Arg Gly Ala Phe Gly Glu Val Gln Leu Val Arg His Lys 85 90 95 Ser Thr Arg Lys Val Tyr Ala Met Lys Leu Leu Ser Lys Phe Glu Met 100 105 110 Ile Lys Arg Ser Asp Ser Ala Phe Phe Trp Glu Glu Arg Asp Ile Met 115 120 125 Ala Phe Ala Asn Ser Pro Trp Val Val Gln Leu Phe Tyr Ala Phe Gln 130 135 140 Asp Asp Arg Tyr Leu Tyr Met Val Met Glu Tyr Met Pro Gly Gly Asp 145 150 155 160 Leu Val Asn Leu Met Ser Asn Tyr Asp Val Pro Glu Lys Trp Ala Arg 165 170 175 Phe Tyr Thr Ala Glu Val Val Leu Ala Leu Asp Ala Ile His Ser Met 180 185 190 Gly Phe Ile His Arg Asp Val Lys Pro Asp Asn Met Leu Leu Asp Lys 195 200 205 Ser Gly His Leu Lys Leu Ala Asp Phe Gly Thr Cys Met Lys Met Asn 210 215 220 Lys Glu Gly Met Val Arg Cys Asp Thr Ala Val Gly Thr Pro Asp Tyr 225 230 235 240 Ile Ser Pro Glu Val Leu Lys Ser Gln Gly Gly Asp Gly Tyr Tyr Gly 245 250 255 Arg Glu Cys Asp Trp Trp Ser Val Gly Val Phe Leu Tyr Glu Met Leu 260 265 270 Val Gly Asp Thr Pro Phe Tyr Ala Asp Ser Leu Val Gly Thr Tyr Ser 275 280 285 Lys Ile Met Asn His Lys Asn Ser Leu Thr Phe Pro Asp Asp Asn Asp 290 295 300 Ile Ser Lys Glu Ala Lys Asn Leu Ile Cys Ala Phe Leu Thr Asp Arg 305 310 315 320 Glu Val Arg Leu Gly Arg Asn Gly Val Glu Glu Ile Lys Arg His Leu 325 330 335 Phe Phe Lys Asn Asp Gln Trp Ala Trp Glu Thr Leu Arg Asp Thr Val 340 345 350 Ala Pro Val Val Pro Asp Leu Ser Ser Asp Ile Asp Thr Ser Asn Phe 355 360 365 Asp Asp Lep Glu Glu Asp Lys Gly Glu Glu Glu Glu Thr Phe ProIle Pro 370 375 380 Lys Ala Phe Val Gly Asn Gln Leu Pro Phe Val Gly Phe Thr Tyr Tyr 385 390 395 400 Ser Asn Arg Arg Tyr Leu Ser Ser Ala Asn Pro Asn Asp Asn Arg Thr 405 410 415 Ser Ser Asn Ala Asp Lys Ser Leu Gln Glu Ser Leu Gln Lys Thr Ile 420 425 430 Tyr Lys Leu Glu Glu Gln Leu His Asn Glu Met Gln Leu Lys Asp Glu 435 440 445 Met Glu Gln Lys Cys Arg Thr Ser Asn Ile Lys Leu Asp Lys Ile Met 450 455 460 Lys Glu Leu Asp Glu Glu Gly Asn Gln Arg Arg Asn Leu Glu Ser Thr 465 470 475 480 Val Ser Gln Ile Glu Lys Glu Lys Met Leu Leu Gln His Arg Ile Asn 485 490 495 Glu Tyr Gln Arg Lys Ala Glu Gln Glu Asn Glu Lys Arg Arg Asn Val 500 505 510 Glu Asn Glu Val Ser Thr Leu Lys Asp Gln Leu Glu Asp Leu Lys Lys 515 520 525 Val Ser Gln Asn Ser Gln Leu Ala Asn Glu Lys Leu Ser Gln Leu Gln 530 535 540 Lys Gln Leu Glu Glu Ala Asn Asp Leu Leu Arg Thr Glu Ser Asp Thr 545 550 555 560 Ala Val Arg Leu Arg Lys Ser His Thr Glu Met Ser Lys Ser Ile Ser 565 570 575 Gln Leu Glu Ser Leu Asn Arg Glu Leu Gln Glu Arg Asn ArgIle Leu 580 585 590 Glu Asn Ser Lys Ser Gln Thr Asp Lys Asp Tyr Tyr Gln Leu Gln Ala 595 600 605 Ile Leu Glu Ala Glu Arg Arg Asp Arg Gly His Asp Ser Glu Met Ile 610 615 620 Gly Asp Leu Gln Ala Arg Ile Thr Ser Leu Gln Glu Glu Val Lys His 625 630 635 640 640 Leu Lys His Asn Leu Glu Lys Val Glu Gly Glu Arg Lys Glu Ala Gln 645 650 655 Asp Met Leu Asn His Ser Glu Lys Glu Lys Asn Asn Leu Glu Ile Asp 660 665 670 Leu Asn Tyr Lys Leu Lys Ser Leu Gln Gln Arg Leu Glu Gln Glu Val 675 680 685 Asn Glu His Lys Val Thr Lys Ala Arg Leu Thr Asp Lys His Gln Ser 690 695 700 Ile Glu Glu Ala Lys Ser Val Ala Met Cys Glu Met Glu Lys Lys Leu 705 710 715 715 720 Lys Glu Glu Arg Glu Ala Arg Glu Lys Ala Glu Asn Arg Val Val Gln 725 730 735 Ile Glu Lys Gln Cys Ser Met Leu Asp Val Asp Leu Lys Gln Ser Gln 740 745 750 Gln Lys Leu Glu His Leu Thr Gly Asn Lys Glu Arg Met Glu Asp Glu 755 760 765 Val Lys Asn Leu Thr Leu Gln Leu Glu Gln Glu Ser Asn Lys Arg Leu 770 775 780 780 Leu Leu Gln Asn Glu Leu Lys Thr Gln Ala Phe Glu Ala Asp AsnLeu 785 790 795 800 Lys Gly Leu Glu Lys Gln Met Lys Gln Glu Ile Asn Thr Leu Leu Glu 805 810 815 Ala Lys Arg Leu Leu Glu Phe Glu Leu Ala Gln Leu Thr Lys Gln Tyr 820 825 830 Arg Gly Asn Glu Gly Gln Met Arg Glu Leu Gln Asp Gln Leu Glu Ala 835 840 845 Glu Gln Tyr Phe Ser Thr Leu Tyr Lys Thr Gln Val Lys Glu Leu Lys 850 855 860 Glu Glu Ile Glu Glu Lys Asn Arg Glu Asn Leu Lys Lys Ile Gln Glu 865 870 875 880 Leu Gln Asn Glu Lys Glu Thr Leu Ala Thr Gln Leu Asp Leu Ala Glu 885 890 895 Thr Lys Ala Glu Ser Glu Gln Leu Ala Arg Gly Leu Leu Glu Glu Gln 900 905 910 Tyr Phe Glu Leu Thr Gln Glu Ser Lys Lys Ala Ala Ser Arg Asn Arg 915 920 925 Gln Glu Ile Thr Asp Lys Asp His Thr Val Ser Arg Leu Glu Glu Ala 930 935 940 Asn Ser Met Leu Thr Lys Asp Ile Glu Ile Leu Arg Arg Glu Asn Glu 945 950 955 960 Glu Leu Thr Glu Lys Met Lys Lys Ala Glu Glu Glu Tyr Lys Leu Glu 965 970 975 Lys Glu Glu Glu Ile Ser Asn Leu Lys Ala Ala Phe Glu Lys Asn Ile 980 985 990 Asn Thr Glu Arg Thr Leu Lys Thr Gln Ala Val Asn Lys Leu AlaGlu 995 1000 1005 Ile Met Asn Arg Lys Asp Phe Lys Ile Asp Arg Lys Lys Ala Asn Thr 1010 1015 1020 Gln Asp Leu Arg Lys Lys Glu Lys Glu Asn Arg Lys Leu Gln Leu Glu 1025 1030 1035 1040 Leu Asn Gln Glu Arg Glus Phe Asn Gln Met Val Val Lys His Gln 1045 1050 1055 Lys Glu Leu Asn Asp Met Gln Ala Gln Leu Val Glu Glu Cys Ala His 1060 1065 1070 Arg Asn Glu Leu Gln Met Gln Leu Ala Ser Lys Glu Ser Asp Ile Glu 1075 1080 1085 Gln Leu Arg Ala Lys Leu Leu Asp Leu Ser Asp Ser Thr Ser Val Ala 1090 1095 1100 Ser Phe Pro Ser Ala Asp Glu Thr Asp Gly Asn Leu Pro Glu Ser Arg 1105 1110 1115 1120 Ile Glu Gly Trp Leu Ser Val Pro Asn Arg Gly Asn Ile Lys Arg Tyr 1125 1130 1135 Gly Trp Lys Lys Gln Tyr Val Val Val Ser Ser Lys Lys Ile Leu Phe 1140 1145 1150 Tyr Asn Asp Glu Gln Asp Lys Glu Gln Ser Asn Pro Ser Met Val Leu 1155 1160 1165 Asp Ile Asp Lys Leu Phe His Val Arg Pro Val Thr Gln Gly Asp Val 1170 1175 1180 Tyr Arg Ala Glu Thr Glu Glu Ile Pro Lys Ile Phe Gln Ile Leu Tyr 1185 1190 1195 1200 Ala Asn Glu Gly Glu Cys Arg Lys Asp Val Glu Met Glu Pro Val Gln 1205 1210 1215 Gln Ala Glu Lys Thr Asn Phe Gln Asn His Lys Gly His Glu Phe Ile 1220 1225 1230 Pro Thr Leu Tyr His Phe Pro Ala Asn Cys Asp Ala Cys Ala Lys Pro 1235 1240 1245 Leu Trp His Val Phe Lys Pro Pro Pro Ala Leu Glu Cys Arg Arg Cys 1250 1255 1260 His Val Lys Cys His Arg Asp His Leu Asp Lys Lys Glu Asp Leu Ile 1265 1270 1275 1280 Cys Pro Cys Lys Val Ser Tyr Asp Val Thr Ser Ala Arg Asp Met Leu 1285 1290 1295 Leu Leu Ala Cys Ser Gln Asp Glu Gln Lys Lys Trp Val Thr His Leu 1300 1305 1310 Val Lys Lys Ile Pro Lys Asn Pro Pro Ser Gly Phe Val Arg Ala Ser 1315 1320 1325 Pro Arg Thr Leu Ser Thr Arg Ser Thr Ala Asn Gln Ser Phe Arg Lys 1330 1335 1340 Val Val Lys Asn Thr Ser Gly Lys Thr Ser 1345 1350

SEQ ID NO: 2 Sequence length: 4065 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: cDNA to mRNA Origin: Organism: Human sequence ATG TCG ACT GGG GAC AGT TTT GAG ACT CGA TTT GAA AAA ATG GAC AAC 48 Met Ser Thr Gly Asp Ser Phe Glu Thr Arg Phe Glu Lys Met Asp Asn 1 5 10 15 CTG CTG CGG GAT CCC AAA TCG GAA GTG AAT TCG GAT TGT TTG CTG GAT 96 Leu Leu Arg Asp Pro Lys Ser Glu Val Asn Ser Asp Cys Leu Leu Asp 20 25 30 GGA TTG GAT GCT TTG GTA TAT GAT TTG GAT TTT CCT GCC TTA AGA AAA 144 Gly Leu Asp Ala Leu Val Tyr Asp Leu Asp Phe Pro Ala Leu Arg Lys 35 40 45 AAC AAA AAT ATT GAC AAC TTT TTA AGC AGA TAT AAA GAC ACA ATA AAT 192 Asn Lys Asn Ile Asp Asn Phe Leu Ser Arg Tyr Lys Asp Thr Ile Asn 50 55 60 AAA ATC AGA GAT TTA CGA ATG AAA GCT GAA GAT TAT GAA GTA GTG AAG 240 Lys Ile Arg Asp Leu Arg Met Lys Ala Glu Asp Tyr Glu Val Val Lys 65 70 75 80 GTG ATT GGT AGA GGT GCA TTT GGA GAA GTT CAA TTG GTA AGG CAT AAA 28 8 Val Ile Gly Arg Gly Ala Phe Gly Glu Val Gln Leu Val Arg His Lys 85 90 95 TCC ACC AGG AAG GTA TAT GCT ATG AAG CTT CTC AGC AAA TTT GAA ATG 336 Ser Thr Arg Lys Val Tyr Ala Met Lys Leu Leu Ser Lys Phe Glu Met 100 105 110 ATA AAG AGA TCT GAT TCT GCT TTT TTC TGG GAA GAA AGG GAC ATC ATG 384 Ile Lys Arg Ser Asp Ser Ala Phe Phe Trp Glu Glu Arg Asp Ile Met 115 120 125 GCT TTT GCC AAC AGT CCT TGG GTT GTT CAG CTT TTT TAT GCA TTC CAA 432 Ala Phe Ala Asn Ser Pro Trp Val Val Gln Leu Phe Tyr Ala Phe Gln 130 135 140 GAT GAT CGT TAT CTC TAC ATG GTG ATG GAA TAC ATG CCT GGT GGA GAT 480 Asp Asp Arg Tyr Leu Tyr Met Val Met Glu Tyr Met Pro Gly Gly Asp 145 150 155 160 CTT GTA AAC TTA ATG AGC AAC TAT GAT GTG CCT GAA AAA TGG GCA CGA 528 Leu Val Asn Leu Met Ser Asn Tyr Asp Val Pro Glu Lys Trp Ala Arg 165 170 175 TTC TAT ACT GCA GAA GTA GTT CTT GCA TTG GAT GCA ATC CAT TCC ATG 576 Phe Tyr Thr Ala Glu Val Val Leu Ala Leu Asp Ala Ile His Ser Met 180 185 190 GGT TTT ATT CAC AGA GAT GTG AAG CCT GAT AAC ATG CTG CTG G AT AAA 624 Gly Phe Ile His Arg Asp Val Lys Pro Asp Asn Met Leu Leu Asp Lys 195 200 205 TCT GGA CAT TTG AAG TTA GCA GAT TTT GGT ACT TGT ATG AAG ATG AAT 672 Ser Gly His Leu Lys Leu Ala Asp Phe Gly Thr Cys Met Lys Met Asn 210 215 220 AAG GAA GGC ATG GTA CGA TGT GAT ACA GCG GTT GGA ACA CCT GAT TAT 720 Lys Glu Gly Met Val Arg Cys Asp Thr Ala Val Gly Thr Pro Asp Tyr 225 230 235 240 ATT TCC CCT GAA GTA TTA AAA TCC CAA GGT GGT GAT GGT TAT TAT GGA 768 Ile Ser Pro Glu Val Leu Lys Ser Gln Gly Gly Asp Gly Tyr Tyr Gly 245 250 255 AGA GAA TGT GAC TGG TGG TCG GTT GGG GTA TTT TTA TAC GAA ATG CTT 816 Arg Glu Cys Asp Trp Trp Ser Val Gly Val Phe Leu Tyr Glu Met Leu 260 265 270 GTA GGT GAT ACA CCT TTT TAT GCA GAT TCT TTG GTT GGA ACT TAC AGT 864 Val Gly Asp Thr Pro Phe Tyr Ala Asp Ser Leu Val Gly Thr Tyr Ser 275 280 285 AAA ATT ATG AAC CAT AAA AAT TCA CTT ACC TTT CCT GAT GAT AAT GAC 912 Lys Ile Met Asn His Lys Asn Ser Leu Thr Phe Pro Asp Asp Asn Asp 290 295 300 ATA TCA AAA GAA GCA AAA AAC CTT ATT TGT GCC T TC CTT ACT GAC AGG 960 Ile Ser Lys Glu Ala Lys Asn Leu Ile Cys Ala Phe Leu Thr Asp Arg 305 310 315 320 GAA GTG AGG TTA GGG CGA AAT GGT GTA GAA GAA ATC AAA CGA CAT CTC 1008 Glu Val Arg Leu Gly Arg Asn Gly Val Glu Glu Ile Lys Arg His Leu 325 330 335 TTC TTC AAA AAT GAC CAG TGG GCT TGG GAA ACG CTC CGA GAC ACT GTA 1056 Phe Phe Lys Asn Asp Gln Trp Ala Trp Glu Thr Leu Arg Asp Thr Val 340 345 350 GCA CCA GTT GTA CCC GAT TTA AGT AGT GAC ATT GAT ACT AGT AAT TTT 1104 Ala Pro Val Val Pro Asp Leu Ser Ser Asp Ile Asp Thr Ser Asn Phe 355 360 365 GAT GAC TTG GAA GAA GAT AAA GGA GAG GAA GAA ACA TTC CCT ATT CCT 1152 Asp Asp Leu Glu Glu Asp Lys Gly Glu Glu Glu Thr Phe Pro Ile Pro 370 375 380 AAA GCT TTC GTT GGC AAT CAA CTA CCT TTT GTA GGA TTT ACA TAT TAT 1200 Lys Ala Phe Val Gly Asn Gln Leu Pro Phe Val Gly Phe Thr Tyr Tyr 385 390 395 400 AGC AAT CGT AGA TAC TTA TCT TCA GCA AAT CCT AAT GAT AAC AGA ACT 1248 Ser Asn Arg Arg Tyr Leu Ser Ser Ala Asn Pro Asn Asp Asn Arg Thr 405 410 415 AGC TCC AAT GCA GAT AAA AGC TTG CAG GAA AGT TTG CAA AAA ACA ATC 1296 Ser Ser Asn Ala Asp Lys Ser Leu Gln Glu Ser Leu Gln Lys Thr Ile 420 425 430 TAT AAG CTG GAA GAA CAG CTG CAT AAT GAA ATG CAG TTA AAA GAT GAA 1344 Tyr Lys Leu Glu Glu Gln Leu His Asn Glu Met Gln Leu Lys Asp Glu 435 440 445 ATG GAG CAG AAG TGC AGA ACC TCA AAC ATA AAA CTA GAC AAG ATA ATG 1392 Met Glu Gln Lys Cys Arg Thr Ser Asn Ile Lys Leu Asp Lys Ile Met 450 455 460 AAA GAA TTG GAT GAA GAG GGA AAT CAA AGA AGA AAT CTA GAA TCT ACA 1440 Lys Glu Leu Asp Glu Glu Gly Asn Gln Arg Arg Asn Leu Glu Ser Thr 465 470 475 480 GTG TCT CAG ATT GAG AAG GAG AAA ATG TTG CTA CAG CAT AGA ATT AAT 1488 Val Ser Gln Ile Glu Lys Glu Lys Met Leu Leu Gln His Arg Ile Asn 485 490 495 GAG TAC CAA AGA AAA GCT GAA CAG GAA AAT GAG AAG AGA AGA AAT GTA 1536 Glu Tyr Gln Arg Lys Ala Glu Gln Glu Asn Glu Lys Arg Arg Asn Val 500 505 510 GAA AAT GAA GTT TCT ACA TTA AAG GAT CAG TTG GAA GAC TTA AAG AAA 1584 Glu Asn Glu Val Ser Thr Leu Lys Asp Gln Leu Glu Asp Leu Lys Lys 515 520 520 GTC AGT CAG AAT TCA CAG CTT GCT AAT GAG AAG CTG TCC CAG TTA CAA 1632 Val Ser Gln Asn Ser Gln Leu Ala Asn Glu Lys Leu Ser Gln Leu Gln 530 535 540 AAG CAG CTA GAA GAA GCC AAT GAC TTA CTT AGG ACA GAA TCG GAC ACA 1680 Lys Gln Leu Glu Glu Ala Asn Asp Leu Leu Arg Thr Glu Ser Asp Thr 545 550 555 560 GCT GTA AGA TTG AGG AAG AGT CAC ACA GAG ATG AGC AAG TCA ATT AGT 1728 Ala Val Arg Leu Arg Lys Ser His Thr Glu Met Ser Lys Ser Ile Ser 565 570 575 CAG TTA GAG TCC CTG AAC AGA GAG TTG CAA GAG AGA AAT CGA ATT TTA 1776 Gln Leu Glu Ser Leu Asn Arg Glu Leu Gln Glu Arg Asn Arg Ile Leu 580 585 585 590 GAG AAT TCT AAG TCA CAA ACA GAC AAA GAT TAT TAC CAG CTG CAA GCT 1824 Glu Asn Ser Lys Ser Gln Thr Asp Lys Asp Tyr Tyr Gln Leu Gln Ala 595 600 605 ATA TTA GAA GCT GAA CGA AGA GAC AGA GGT CAT GAT TCT GAG ATG ATT 1872 Ile Leu Glu Ala Glu Arg Arg Asp Arg Gly His Asp Ser Glu Met Ile 610 615 620 GGA GAC CTT CAA GCT CGA ATT ACA TCT TTA CAA GAG GAG GTG AAG CAT 1920 Gly Asp Leu Gln Ala Arg Ile Thr Ser Leu Gln Glu Glu Val Lys His 625 630 635 640 CTC AAA CAT AAT CTC GAA AAA GTG GAA GGA GAA AGA AAA GAG GCT CAA 1968 Leu Lys His Asn Leu Glu Lys Val Glu Gly Glu Arg Lys Glu Ala Gln 645 650 655 655 GAC ATG CTT AAT CAC TCA GAA AAG GAA AAG AAT AAT TTA GAG ATA GAT 2016 Asp Met Leu Asn His Ser Glu Lys Glu Lys Asn Asn Leu Glu Ile Asp 660 665 670 TTA AAC TAC AAA CTT AAA TCA TTA CAA CAA CGG TTA GAA CAA GAG GTA 2064 Leu Asn Tyr Lys Leu Lys Ser Leu Gln Gln Arg Leu Glu Gln Glu Val 675 680 685 AAT GAA CAC AAA GTA ACC AAA GCT CGT TTA ACT GAC AAA CAT CAA TCT 2112 Asn Glu His Lys Val Thr Lys Ala Arg Leu Thr Asp Lys His Gln Ser 690 695 700 ATT GAA GAG GCA AAG TCT GTG GCA ATG TGT GAG ATG GAA AAA AAG CTG 2160 Ile Glu Glu Ala Lys Ser Val Ala Met Cys Glu Met Glu Lys Lys Leu 705 710 715 715 720 AAA GAA GAA AGA GAA GCT CGA GAG AAG GCT GAA AAT CGG GTT GTT CAG 2208 Lys Glu Glu Arg Glu Ala Arg Glu Lys Ala Glu Asn Arg Val Val Gln 725 730 735 ATT GAG AAA CAG TGT TCC ATG CTA GAC GTT GAT CTG AAG CAA TCT CAG 2256 Ile Glu Lys Gln Cys Ser Met Leu Asp V al Asp Leu Lys Gln Ser Gln 740 745 750 CAG AAA CTA GAA CAT TTG ACT GGA AAT AAA GAA AGG ATG GAG GAT GAA 2304 Gln Lys Leu Glu His Leu Thr Gly Asn Lys Glu Arg Met Glu Asp Glu 755 760 765 GTT AAG AAT CTA ACC CTG CAA CTG GAG CAG GAA TCA AAT AAG CGG CTG 2352 Val Lys Asn Leu Thr Leu Gln Leu Glu Gln Glu Ser Asn Lys Arg Leu 770 775 780 TTG TTA CAA AAT GAA TTG AAG ACT CAA GCA TTT GAG GCA GAC AAT TTA 2400u Leu Gln Asn Glu Leu Lys Thr Gln Ala Phe Glu Ala Asp Asn Leu 785 790 795 800 AAA GGT TTA GAA AAG CAG ATG AAA CAG GAA ATA AAT ACT TTA TTG GAA 2448 Lys Gly Leu Glu Lys Gln Met Lys Gln Glu Ile Asn Thr Leu Leu Glu 805 810 815 GCA AAG AGA TTA TTA GAA TTT GAG TTA GCT CAG CTT ACG AAA CAG TAT 2496 Ala Lys Arg Leu Leu Glu Phe Glu Leu Ala Gln Leu Thr Lys Gln Tyr 820 825 830 AGA GGA AAT GAA GGA CAG ATG CGG GAG CTA CAA GAT CAG CTT GAA GCT 2544 Arg Gly Asn Glu Gly Gln Met Arg Glu Leu Gln Asp Gln Leu Glu Ala 835 840 845 GAG CAA TAT TTC TCG ACA CTT TAT AAA ACC CAG GTA AAG GAA CTT AAA 2592 Glu Gln Tyr Phe Se r Thr Leu Tyr Lys Thr Gln Val Lys Glu Leu Lys 850 855 860 GAA GAA ATT GAA GAA AAA AAC AGA GAA AAT TTA AAG AAA ATA CAG GAA 2640 Glu Glu Glu Ile Glu Glu Lys Asn Arg Glu Asn Leu Lys Lys Ile Gln Glu 865 870870 875 880 CTA CAA AAT GAA AAA GAA ACT CTT GCT ACT CAG TTG GAT CTA GCA GAA 2688 Leu Gln Asn Glu Lys Glu Thr Leu Ala Thr Gln Leu Asp Leu Ala Glu 885 890 895 ACA AAA GCT GAG TCT GAG CAG TTG GCG CGA GGC CTT CTG GAA GAA CAG 2736 Thr Lys Ala Glu Ser Glu Gln Leu Ala Arg Gly Leu Leu Glu Glu Gln 900 905 910 TAT TTT GAA TTG ACG CAA GAA AGC AAG AAA GCT GCT TCA AGA AAT AGA 2784 Tyr Phe Glu Leu Thr Gln Glu Ser Lys Lys Ala Ala Ser Arg Asn Arg 915 920 925 CAA GAG ATT ACA GAT AAA GAT CAC ACT GTT AGT CGG CTT GAA GAA GCA 2832 Gln Glu Ile Thr Asp Lys Asp His Thr Val Ser Arg Leu Glu Glu Ala 930 935 940 940 AAC AGC ATG CTA ACC AAA GAT ATT GAA ATA TTA AGA AGA GAG AAT GAA 2880 Asn Ser Met Leu Thr Lys Asp Ile Glu Ile Leu Arg Arg Glu Asn Glu 945 950 955 960 GAG CTA ACA GAG AAA ATG AAG AAG GCA GAG GAA GAA TAT AAA CTG GAG 2928 Glu Leu Thr Glu Lys Met Lys Lys Ala Glu Glu Glu Tyr Lys Leu Glu 965 970 975 AAG GAG GAG GAG ATC AGT AAT CTT AAG GCT GCC TTT GAA AAG AAT ATC 2976 Lys Glu Glu Glu Ile Ser Asn Leu Lys Ala Ala Plu Lys Asn Ile 980 985 990 AAC ACT GAA CGA ACC CTT AAA ACA CAG GCT GTT AAC AAA TTG GCA GAA 3024 Asn Thr Glu Arg Thr Leu Lys Thr Gln Ala Val Asn Lys Leu Ala Glu 995 1000 1005 ATA ATG AAT CGA AAA GAT TTT AAA ATT GAT AGA AAG AAA GCT AAT ACA 3072 Ile Met Asn Arg Lys Asp Phe Lys Ile Asp Arg Lys Lys Ala Asn Thr 1010 1015 1020 CAA GAT TTG AGA AAG AAA GAA AAG GAA AAT CGA AAG CTG CAA CTG GAA 3120 Gln Asp Leu Arg Lys Lys Glu Lys Glu Asn Arg Lys Leu Gln Leu Glu 1025 1030 1035 1040 CTC AAC CAA GAA AGA GAG AAA TTC AAC CAG ATG GTA GTG AAA CAT CAG 3168 Leu Asn Gln Glu Arg Glu Lys Phe Asn Gln Met Val Val Lys His Gln 1045 1050 1055 AAG GAA CTG AAT GAC ATG CAA GCG CAA TTG GTA GAA GAA TGT GCA CAT 3216 Lys Glu Leu Asn Asp Met Gln Ala Gln Leu Val Glu Glu Cys Ala His 1060 1065 1070 AGG AAT GAG CTT CAG ATG CAG TT G GCC AGC AAA GAG AGT GAT ATT GAG 3264 Arg Asn Glu Leu Gln Met Gln Leu Ala Ser Lys Glu Ser Asp Ile Glu 1075 1080 1085 CAA TTG CGT GCT AAA CTT TTG GAC CTC TCG GAT TCT ACA AGT GTT GCT 3312 Gln Leu Arg Ala Lys Leu Leu Asp Leu Ser Asp Ser Thr Ser Val Ala 1090 1095 1100 AGT TTT CCT AGT GCT GAT GAA ACT GAT GGT AAC CTC CCA GAG TCA AGA 3360 Ser Phe Pro Ser Ala Asp Glu Thr Asp Gly Asn Leu Pro Glu Ser Arg 1105 1110 1115 1120 ATT GAA GGT TGG CTT TCA GTA CCA AAT AGA GGA AAT ATC AAA CGA TAT 3408 Ile Glu Gly Trp Leu Ser Val Pro Asn Arg Gly Asn Ile Lys Arg Tyr 1125 1130 1135 GGC TGG AAG AAA CAG TAT GTT GTG GTA AGC AGC AAA AAA ATT TTG TTC 3456 Gly Trp Lys Lys Gln Tyr Val Val Val Ser Ser Lys Lys Ile Leu Phe 1140 1145 1150 TAT AAT GAC GAA CAA GAT AAG GAG CAA TCC AAT CCA TCT ATG GTA TTG 3504 Tyr Asn Asp Glu Gln Asp Lys Glu Gln Ser Asn Pro Ser Met Val Leu 1155 1160 1165 GAC ATA GAT AAA CTG TTT CAC GTT AGA CCT GTA ACC CAA GGA GAT GTG 3552 Asp Ile Asp Lys Leu Phe His Val Arg Pro Val Thr Gln Gly Asp Val 1170 1175 1180 TAT AGA GCT GAA ACT GAA GAA ATT CCT AAA ATA TTC CAG ATA CTA TAT 3600 Tyr Arg Ala Glu Thr Glu Glu Ile Pro Lys Ile Phe Gln Ile Leu Tyr 1185 1190 1195 1200 GCA AAT GAA GGT GAA TGT AGA AAA GAT GTA GAG ATG GAA CCA GTA CAA 3648 Ala Asn Glu Gly Glu Cys Arg Lys Asp Val Glu Met Glu Pro Val Gln 1205 1210 1215 CAA GCT GAA AAA ACT AAT TTC CAA AAT CAC AAA GGC CAT GAG TTT ATT 3696 Gln Ala Glu Lys Thr Asn Phe Gln Asn His Lys Gly His Glu Phe Ile 1220 1225 1230 CCT ACA CTC TAC CAC TTT CCT GCC AAT TGT GAT GCC TGT GCC AAA CCT 3744 Pro Thr Leu Tyr His Phe Pro Ala Asn Cys Asp Ala Cys Ala Lys Pro 1235 1240 1245 CTC TGG CAT GTT TTT AAG CCA CCC CCT GCC CTA GAG TGT CGA AGA TGC 3792 Leu Trp His Val Phe Lys Pro Pro Pro Ala Leu Glu Cys Arg Arg Cys 1250 1255 1260 CAT GTT AAG TGC CAC AGA GAT CAC TTA GAT AAG AAA GAG GAC TTA ATT 3840 His Val Lys Cys His Arg Asp His Leu Asp Lys Lys Glu Asp Leu Ile 1265 1270 1275 1280 TGT CCA TGT AAA GTA AGT TAT GAT GTA ACA TCA GCA AGA GAT ATG CTG 3888 Cys Pro Cys Lys Val Se r Tyr Asp Val Thr Ser Ala Arg Asp Met Leu 1285 1290 1295 CTG TTA GCA TGT TCT CAG GAT GAA CAA AAA AAA TGG GTA ACT CAT TTA 3936 Leu Leu Ala Cys Ser Gln Asp Glu Gln Lys Lys Trp Val Thr His Leu 1300 1305 1310 GTA AAG AAA ATC CCT AAG AAT CCA CCA TCT GGT TTT GTT CGT GCT TCC 3984 Val Lys Lys Ile Pro Lys Asn Pro Pro Ser Gly Phe Val Arg Ala Ser 1315 1320 1325 CCT CGA ACG CTT TCT ACA AGA TCC ACT GCA AAT CAG TCT TTC CGG AAA 4032 Pro Arg Thr Leu Ser Thr Arg Ser Thr Ala Asn Gln Ser Phe Arg Lys 1330 1335 1340 GTG GTC AAA AAT ACA TCT GGA AAA ACT AGT TAA 4065 Val Val Lys Asn Thr Ser Gly Lys Thr Ser 1345 1350

[Brief description of the drawings]

FIG. 1 shows a deduced amino acid sequence of p160. A thick underline indicates peptide AP-23, and a thin underline indicates another amino acid sequence. The asterisk indicates a leucine residue in the leucine zipper-like sequence.

FIG. 2 shows the nucleotide sequence encoding p160 and the corresponding amino acid sequence. 2 to 10
The figures up to the end of FIG. 1 show a continuous sequence of nucleotide and amino acid sequences.

FIG. 3 shows a nucleotide sequence encoding p160 and an amino acid sequence corresponding thereto. It is a continuation of FIG.

FIG. 4 is a diagram showing a nucleotide sequence encoding p160 and an amino acid sequence corresponding thereto. It is a continuation of FIG.

FIG. 5 shows a nucleotide sequence encoding p160 and an amino acid sequence corresponding thereto. FIG. 4 is a continuation of FIG. 4.

FIG. 6 is a diagram showing a nucleotide sequence encoding p160 and an amino acid sequence corresponding thereto. It is a continuation of FIG.

FIG. 7 shows the nucleotide sequence encoding p160 and the corresponding amino acid sequence. It is a continuation of FIG.

FIG. 8 shows the nucleotide sequence encoding p160 and the corresponding amino acid sequence. It is a continuation of FIG.

FIG. 9 shows a nucleotide sequence encoding p160 and an amino acid sequence corresponding thereto. It is a continuation of FIG.

FIG. 10 is a view showing a base sequence encoding p160 and an amino acid sequence corresponding thereto. It is a continuation of FIG.

FIG. 11 is an electrophoretic photograph showing the identification of an active Rho protein-binding protein in human platelets by a ligand overlay assay. Lanes 1 and 2: [ ³⁵ S] GTPγS-Rho protein, lanes 3 and 4: [ ³⁵ S] GDPβS-R
ho protein, lane 5: [ ³⁵ S] GTPγS.

FIG. 12 is an electrophoretic photograph showing the results of purification of p160.

FIG. 13 is an electrophoretic photograph showing the binding between p160 and Rho subfamily proteins.

FIG. 14: GST-RhoA, GST-Rac, GST
9 is an electrophoretic photograph showing the results of an affinity precipitation experiment using -Cdc42 and GST.

FIG. 15 is an electrophoretic photograph showing autophosphorylation of p160.

FIG. 16 is an electrophoretic photograph showing the results of phosphorylated amino acid analysis. P-Ser, P-Thr, and PT
yr indicates the positions of phosphorylated serine, phosphorylated threonine, and phosphorylated tyrosine, respectively.

FIG. 17 is an electrophoresis photograph showing phosphorylation of MBP and histone by p160.

FIG. 18 is a diagram quantitatively showing histone phosphorylation activity by GTPγS-bound Rho protein. ●: GTPγS binding GST-Rho protein, ○: G
DPγS binding GST-Rho protein.

FIG. 19 shows an outline of the isolated p160 clone. Thick arrows indicate open reading frames.

FIG. 20 is an electrophoretic photograph showing the binding of Rho protein to an expressed protein. Lanes 1 and 3: mock transfected cells, lanes 2 and 4: transfected cells.

FIG. 21 is a diagram showing an outline of the structure of p160.

FIG. 22 is an electrophoretogram showing Northern blot analysis of p160 expression in various human tissues.

FIG. 23 is an electrophoresis photograph showing co-precipitation of p160 and Rho proteins derived from COS cells. Upper: ADP-ribosylation reaction, Lower: immunoblotting with anti-myc antibody. One arrow indicates the expressed Rho protein labeled with HA, and two arrows indicate the expressed p160 labeled with myc.

FIG. 24 shows activation of p160 kinase activity in vivo.

FIG. 25 is a view in which the amino acid sequence of p160 is aligned with that of mitonic dystrophy kinase (MD-PK).

FIG. 26 is a diagram showing an analysis result of a coiled-coil region of p160.

FIG. 27 is a diagram in which the amino acid sequence of p160 is aligned with the PH region.

FIG. 28 is a diagram in which the amino acid sequence of p160 is aligned with a cysteine-rich region.

FIG. 29 is a schematic diagram showing a truncation mutant of p160. Five deletion mutants: KD, M1, M2, M3 and C are indicated by bold lines. The numbers below each line indicate the amino and carboxyl terminal amino acid residues of each fragment. The functional and structural regions of p160 are shown schematically in the middle. The upper line shows the position of the restriction enzyme site of p160 cDNA used for producing these mutants.

FIG. 30 shows a terminal mutant of the M2 fragment. The lengths of the nine mutants (M2-1 to M2-9) and the portion of M2 covered by each mutant are indicated. The numbers in the upper amino acid line indicate the amino and carboxyl terminal residues of M2 and truncation mutants. The numbers indicate the amino acid residues at p160. The arrow is M
The positions of primers used for PCR amplification of each mutant other than 2-7 and M2-8 are shown. M2-7 and M2-8 were excised from the original p160 cDNA. The primer sequences used are shown in Table 1.

FIG. 31 is a diagram showing PCR products used for production of M2-10 mutant. Primers used for PCR are indicated by arrows. The position of the point mutation introduced by PCR is indicated by an asterisk. The restriction enzyme sites used for construction are shown in the upper line. M2-10 corresponding to the PCR fragment
The position of the amino acid in is indicated by a line in the middle. The sequences of the primers used for PCR are shown in Table 2.

FIG. 32 is an electrophoresis photograph showing the result of purification of a terminal deletion mutant of p160. Truncated mutant, M1, M
2, M3 and C with IPTG (lanes 2, 4,
6 and 7) or without IPTG (lanes 1, 3 and 5) and purified protein at 10% (M1, M2
And C) or 15% (M3) SDS-PAGE. The location of the molecular weight marker protein is shown in kilodaltons on the left.

FIG. 33 is an electrophoretic photograph showing the results of a ligand overlay assay of a terminal deletion mutant of p160. The truncated mutants, M1, M2, M3 and C, are IPTG
Expressed with (lanes 2, 4, 6 and 7) or without IPTG (lanes 1, 3 and 5), purified protein was purified to 10% (M1, M2 and C) or 15% (M
It was subjected to SDS-PAGE of 3). Fig. 3
It is the amount of 1 in 2 of 10. The location of the molecular weight marker protein is shown in kilodaltons on the left.

FIG. 34 is an electrophoretic photograph showing the result of purification of a terminal deletion mutant of M2. The location of the molecular weight marker protein is shown in kilodaltons on the left.

FIG. 35 is an electrophoretic photograph showing the result of a ligand overlay assay of a truncation mutant of M2. The location of the molecular weight marker protein is shown in kilodaltons on the left.

FIG. 36 is a photograph showing the results of a two-hybrid assay for binding of a truncation mutant of M2 to Rho. Yeast L40 cells expressing each truncated mutant protein fused to the M2-VP16 transcription activation region were
LexA DNA binding region-RhoA or RhoA
^It was crossed with AMR70 cells expressing the ^Val14 fusion protein.

FIG. 37 is a diagram showing a point mutation introduction site introduced into a part of M2-10 (906-1024) by an asterisk. Other truncation mutants (M2-2 to M2-9) are shown above the sequence. Leucine zippers are indicated by #.

FIG. 38 is an electrophoretic photograph of M2-10 having a point mutation (Example 9). The location of the molecular weight marker protein is shown in kilodaltons on the left.

FIG. 39 is an electrophoretic photograph showing the results of a ligand overlay assay of M2-10 having a point mutation (Example 9). The location of the molecular weight marker protein is shown in kilodaltons on the left.

FIG. 40 is an electrophoretic photograph showing the result of immunoblotting an immunoprecipitate of a mutant p160 protein with an anti-myc antibody in COS-7 cells using an anti-myc antibody.

FIG. 41. Immunoprecipitates of mutant p160 protein with anti-myc antibody in COS-7 cells were analyzed using [ ³⁵ S] GTPγS.
9 is an electrophoretic photograph showing the results of a ligand overlay assay performed with Rho protein loaded with Rho.

FIG. 42 is a diagram comparing putative RhoA binding regions of p160 and ROKα. Rho identified at p160
The protein binding region and the Rho protein binding region presented by ROKα are indicated by bold lines. Conserved amino acids are shown as shading. The asterisk indicates the position of the point mutation. The sequence of ROKα is Leung, T. et al., J. Biol. Che.
m. 270, 29051-29054 (1995).

FIG. 43 is a schematic diagram of the p160 mutant (A) and an electrophoresis photograph of immunoblotting of the expressed protein (B) and immunocomplex kinase assay (C). A: The structural domain of p160 is schematically represented at the top,
Eight mutants are represented by bold lines below. The numerical values indicate the amino and carboxyl terminal amino acid residues of each mutant. The position of the point mutation is indicated by an X. B: Expression of p160 mutant in HeLa cells (Western blotting). Lane 1, WT; Lane 2, Δ
1: Lane 3, Δ2; Lane 4, Δ3; Lane 5, Δ
4; Lane 6, Δ5; Lane 7, KD-IA; Lane 8, C. In B, cell lysates from one 6 cm petri dish were used, while lysates from six petri dishes were used for analysis of mutant Δ2 and KD-IA. The position of the molecular weight marker is shown on the right. C: Expression of p160 mutant in HeLa cells (kinase assay). Each lane has the same contents as B. In C, each of the melts from seven 6 cm dishes was
/ 10 was used. Arrowheads indicate autophosphorylation bands of each mutant. M represents cells transfected with the vector alone.

FIG. 44 is a photograph showing the morphology of HeLa cells overexpressing the p160 mutant. HeLa cells were transfected with the vector alone (A and B) or 1 μg of the vector carrying the WT (C and D), Δ1 (E and F), Δ2 (G and H) variants of p160.
After a 16-hour incubation, cells were double-stained with rhodamine-phalloidin (left panel; A, C, E, and G) and anti-vinculin antibodies (right panel; B, D, F, and H). An image constructed from an optical section with a confocal imaging system is shown. Scale bar: 20 μm.

FIG. 45 is a photograph showing the morphology of HeLa cells overexpressing the p160 mutant. HeLa cells are p160
Δ3 (I and J), Δ4 (K and L) or Δ5
Transfected with 1 μg of vector carrying the (M and N) mutant. After 16 hours of incubation,
Cells were treated with rhodamine-phalloidin (left panel; I, K and M) and anti-vinculin antibody (right panel; J, L
And N). An image constructed from an optical section with a confocal imaging system is shown. Scale bar: 20 μm.

FIG. 46 is a photograph showing inhibition of Rho-induced focal adhesion formation by co-expression of a KD-IA mutant of p160. HeLa cells were transformed with the p160 mutant pCAG-K
In the absence (A and B) or presence (CF) of 2 μg of D-IA, 0.2 μL of pEXV-Val ¹⁴ -RhoA
g. After 16 hours of incubation, cells were treated with rhodamine-phalloidin (A) and anti-vinculin (B), anti-RhoA antibody (C) and anti-vinculin antibody (D), or anti-RhoA antibody (E) and rhodamine-phalloidin (F). Double stained. Arrows indicate cells expressing RhoA ^Val14 . A photograph taken with a fluorescence microscope is shown. Scale bar: 20 μm.

FIG. 47 is a photograph showing inhibition of Rho-induced focal adhesion formation by co-expression of a KD-IA mutant of p160. HeLa cells were transformed with the p160 mutant pCAG-K
In the absence (G and H) or presence (I and J) of 2 μg of D-IA, pEXV-Val ¹² -Rac10.
Transfected with 2 μg. After 16 hours of incubation, cells were harvested with anti-p160 antibody and rhodamine-
Double staining was performed with phalloidin (I) or anti-p160 and anti-vinculin antibodies (J). The arrow is KD-IA
1 shows cells expressing. A photograph taken with a fluorescence microscope is shown. Scale bar: 20 μm.

FIG. 48 shows the effect of p160 proposed in Rho-mediated focal adhesion and formation of stress fibers.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁶ Identification code FI A61K 48/00 ADU C07H 21/04 B C07H 21/04 C12N 1/19 C12N 1/19 1/21 1/21 9/12 9 / 12 C12P 21/02 C15 / 02 C07K 14/47 C12P 21/02 A61K 37/02 ABE // C07K 14/47 C12N 15/00 B

Claims (37)

[Claims] (1) A protein or a derivative thereof having a protein kinase activity and not having an active Rho protein binding ability. 2. The amino acid sequence of SEQ ID NO: 1, wherein one or more amino acids are added and / or inserted to the amino acid sequence of SEQ ID NO: 1, and / or
The protein or derivative thereof according to claim 1, wherein one or more amino acids of the amino acid sequence of (1) are substituted and / or deleted. 3. The substituted amino acid is K934M, L94.
The protein or derivative thereof according to claim 2, which is selected from the group consisting of 1A, E1008A, and I1009A. (4) SEQ ID NO: 934 to 945 or 10
The amino acid sequence of Nos. 05 to 1015, or active Rh
o The protein or its derivative according to claim 2, wherein a part thereof having a protein binding ability is deleted. (5) SEQ ID NO: 1 from 72 to 343, 1 to 727
The protein or a derivative thereof according to any one of claims 2 to 4, which comprises the amino acid sequence of Nos. 1 to 477 or 1 to 375. 6. A protein or derivative thereof that induces stress fiber formation and / or focal adhesion. 7. The protein or derivative thereof according to claim 6, which has a protein kinase catalytic region and has a part or all of a coiled coil region. 8. The amino acid sequence of SEQ ID NO: 1, wherein one or more amino acids are added and / or inserted to the amino acid sequence of SEQ ID NO: 1, and / or
The protein or its derivative according to claim 6 or 7, wherein one or more amino acids of the amino acid sequence of (1) are substituted and / or deleted. 9. The sequence of SEQ ID NO: 1 from 1 to 1080, 1 to 946
9. The protein or derivative thereof according to claim 8, which comprises the amino acid sequence of No. 1, 1 to 727, or 1 to 477. 10. A protein or a derivative thereof that inhibits stress fiber formation and / or focal adhesion. 11. The amino acid sequence of SEQ ID NO: 1 wherein one or more amino acids are added and / or inserted to the amino acid sequence of SEQ ID NO: 1 and / or the amino acid sequence of SEQ ID NO: 1 is one or more amino acids. The protein or derivative thereof according to claim 10, which has been substituted and / or deleted. 12. The protein kinase activity and activated form R
SEQ ID NO: 1 with inactivated ho protein binding activity
The protein or derivative thereof according to claim 11, comprising the amino acid sequence of 13. The protein or derivative thereof according to claim 12, having the substitutions K105A and I1009A. 14. The protein or derivative thereof according to claim 12, which has at least a plextrin homology region (PH region). 15. The protein or its derivative according to claim 14, which comprises the amino acid sequence of positions 1081 to 1354 of SEQ ID NO: 1. 16. A base sequence encoding the protein according to any one of claims 1 to 9 or a derivative thereof. [17] a base sequence encoding the protein or a derivative thereof according to any one of [10] to [15]; 18. The base sequence according to claim 16, which has a part or all of the DNA sequence of SEQ ID NO: 2. 19. A nucleotide sequence comprising part of the nucleotide sequence of 214 of SEQ ID NO: 2.
# 1029, # 1-2181, # 1-1431, # 1
25. The DNA sequence of No. 1125, No. 1-3240, No. 1-2838, or No. 3241-4062.
The base sequence described in 1. 20. A vector comprising the nucleotide sequence according to any one of claims 16 to 19. 21. A vector comprising the nucleotide sequence according to claim 17. 22. The vector according to claim 20, which is selected from the group consisting of a plasmid vector, a virus vector, and a liposome vector. 23. A host cell transformed with the vector according to any one of claims 20 to 22 (however, in the case of a human cell, it is limited to a cell isolated from a human). 24. Escherichia coli, yeast, insect cells, COS cells,
24. The host cell according to claim 23, which is selected from the group consisting of lymph cells, fibroblasts, CHO cells, blood cells, and tumor cells. 25. A method comprising culturing the host cell according to claim 23 or 24, and isolating the protein according to any one of claims 1 to 15 or a derivative thereof from the culture. A method for producing the protein according to any one of claims 1 to 15 or a derivative thereof. (1) A substance to be screened is present in a screening system containing the protein or its derivative according to any one of claims 1 to 5,
And (2) measuring the degree of inhibition of the protein kinase activity of the protein or derivative thereof according to any one of claims 1 to 5. A method for screening a substance that inhibits the activity of protein kinase of a protein or a derivative thereof. 27. The screening method according to claim 26, wherein the screening system is a cell line or a cell-free system. (1) A substance to be screened is present in a cell line in which stress fiber formation and / or focal adhesion is induced by the protein or a derivative thereof according to any one of claims 6 to 9. And (2) measuring the extent of inhibition of stress fiber formation and / or focal adhesion,
A method for screening a substance that inhibits stress fiber formation and / or focal adhesion. 29. The method according to any one of claims 26 to 28, which is a method for screening a substance for suppressing tumor formation or metastasis, a substance for suppressing smooth muscle contraction, a substance for suppressing cardiomyocyte proliferation, or a substance for suppressing leukocyte or platelet aggregation or activation. The screening method according to the above section. 30. The protein according to any one of claims 10 to 15 or a derivative thereof, or the base sequence according to claim 17 or the vector according to claim 21.
A pharmaceutical composition comprising a pharmaceutically acceptable carrier. 31. The pharmaceutical composition according to claim 30, which is used as a therapeutic agent selected from an antitumor agent, a therapeutic agent for a circulatory system disease, an antiinflammatory agent, an antiallergic agent, and a therapeutic agent for an autoimmune disease. 32. The protein according to any one of claims 10 to 15 or a derivative thereof, or the base sequence according to claim 17 or the vector according to claim 21,
Use for the manufacture of a medicament. 33. A pharmaceutical composition comprising: an antitumor agent, a therapeutic agent for a cardiovascular disease,
The use according to claim 32, which is used as a therapeutic agent selected from an anti-inflammatory agent, an anti-allergic agent and an autoimmune disease therapeutic agent. 34. An agent for suppressing tumor formation or metastasis, comprising the protein according to any one of claims 10 to 15 or a derivative thereof, or the base sequence according to claim 17 or the vector according to claim 21. (35) A smooth muscle contraction inhibitor comprising the protein according to any one of (10) to (15) or a derivative thereof, or the base sequence according to (17) or the vector according to (21). (36) a cardiomyocyte proliferation inhibitor comprising the protein or a derivative thereof according to any one of (10) to (15), or the base sequence of (17) or the vector of (21); 37. Aggregation or activity of leukocytes or platelets, comprising the protein or derivative thereof according to any one of claims 10 to 15, or the base sequence according to claim 17 or the vector according to claim 21. Chemical inhibitor.