JPH09297135A - Immunologic detection of gene - Google Patents

Abstract

PROBLEM TO BE SOLVED: To easily and quickly detect a gene by using an antibody recognizing a composite of a double stranded gene and an intercalating reagent. SOLUTION: A one having an intercalating reagent bonded to different parts of an intended double stranded gene is used as an immunogen to provide an antibody. This is bonded to a solid phase, and the intercalating reagent is reacted with the intended gene or the intended gene after amplified, antigen- antibody reaction is performed to generate a reagent which is highly specific to the double stranded gene and causes a reaction highly specific to the intended gene. As the antibody, any one of polyclonal and monoclonal antibodies may be used, and a part having antibody activity as it is may be also used. As the intercalating reagent, a one having a high affinity to double stranded gene and firmly bonded thereto, for example, ethidium bromide, thiazole orange, acrydine orange, can be used. This method enables the easy and quick detection of a double stranded gene, and is suitable for automation.

Description

Detailed Description of the Invention

[0001]

TECHNICAL FIELD The present invention relates to a method for detecting a gene using an antibody, and can be used in a wide variety of fields such as immunology, molecular biology and diagnostics.

[0002]

2. Description of the Related Art With recent advances in genetic engineering, it has become possible to make a diagnosis based on the gene itself (gene diagnosis), and many methods for greatly amplifying a small amount of gene have been devised. By using these methods, it became possible to increase the trace amount of genes in the sample. The best known gene amplification method is the PCR (polymerase chain reaction) method. This method prepares a gene fragment (primer) complementary to the gene sequences on the 3'side and 5'side of the region containing the target gene, mixes it with a base as a material of the gene, and mixes it with a sample.
This is a method of synthesizing a target gene by activating a gene synthesizing enzyme called NA polymerase. This method consists of repeating three reactions (usually 20 to 30 cycles) of (1) dissociation of a DNA double strand by heat denaturation, (2) annealing with a primer, and (3) synthesis of a complementary strand by a DNA polymerase. At this time, heat the double-stranded gene to 1
Although it dissociates into single strands, by using a DNA polymerase derived from thermostable bacteria, it is possible to supply DNA polymerase without replenishing it every cycle.
It became possible to carry out gene amplification by repeating the reaction only by the temperature change. By using this method, the target gene can be amplified hundreds of thousands times and millions of times.

At present, a large number of devices called thermal cyclers for automatically performing this amplification method are on the market, and are widely used in the fields of medicine, diagnostics, molecular biology and the like.

[0004]

As described above, a method for easily amplifying a gene has been established, but as a method for detecting the amplified gene, the electrophoresis method is still the mainstream. This is a method in which a sample is added to a gel such as polyacrylamide, electrophoresed, and then stained to confirm the presence or absence of a gene, which is time-consuming and time-consuming. Therefore, although the amplification of the gene is completed in several hours, the gene detection process takes a long time, so that the overall gene detection time is a few days.
In addition, it is not suitable for processing a large number of samples, and one of the reasons why the gene diagnosis method in the field of clinical diagnosis is not popular is that this gene detection method is troublesome. HPL in recent years
Attempts have been made to detect genes amplified by C (high performance liquid chromatography) or capillary electrophoresis, but these methods are not effective when trying to process multiple samples.

Further, there is a similar problem in the method of detecting a gene that is not amplified, and at the same time, a highly sensitive gene detecting method for detecting a trace amount of gene is desired.

[0006] On the other hand, as a method for detecting a gene, Japanese Patent Publication No.
There is a method of confirming the presence of a target gene from particle aggregation by using particles having a gene complementary to the target gene shown in No. 3-502875 immobilized. Further, JP-A-3-264863 discloses a method improved on this method to enhance the binding between a complementary gene fragment of a particle and a target gene by using an antibody recognizing a double chain. However, in these inventions, the target gene must be single-stranded. Genes, especially DNA, usually exist in a double-stranded state, and the target gene after gene amplification is also 2
It exists in a single-stranded state. Attempts to perform these assays using this sample require treatment of the sample once at elevated temperature to render the gene single stranded. However, even if these treatments are to be performed thereafter, the same amount of the gene that is complementary to the target gene is present in the sample, and it causes a competitive reaction with the gene fragment on the particle. There is a drawback that it returns to the double strand of. It is clear that adding an antibody there has no effect.

Further, in Japanese Patent Laid-Open No. 4-286957, 2
A technique of a gene detection method using an antibody that recognizes a single-stranded gene has been disclosed. Although it is possible to detect genes by particle aggregation using this method, it is expected to be quite difficult to carry out. Information on a gene is stored by the sequences of four types of bases. In other words, since there are only four types of bases as a component of a gene, it is difficult to make an antibody that reacts only with a specific base sequence, and an antibody that recognizes a certain gene sequence has a similar gene sequence to that of another gene sequence. It also reacts with the part. This phenomenon is called cross-reaction, and it is a major problem of antibodies that recognize genes.

The object of the present invention is to provide a simple and rapid method for detecting a gene. Moreover, it aims at providing a safe and highly sensitive detection system.

[0009]

In view of the above circumstances, the present inventors have earnestly studied, and as a result, obtain an antibody that can detect a double-stranded gene and that is highly specific to a specific gene. I found a way.

[0010] It is known that a certain fluorescent dye penetrates into the base pair of a double-stranded gene and strongly binds while non-covalently binding. These substances are generally called intercalating reagents. The intercalating reagent changes its higher-order structure when it enters inside the gene and binds to it, and therefore, if it is a fluorescent dye, it may cause a change in fluorescence intensity or a change in fluorescence wavelength. The present inventor has succeeded in obtaining an antibody capable of recognizing a gene having low specificity with high specificity by using a gene bound with such an intercalating reagent as an immunogen.

That is, the present invention provides an immunological detection method for a gene, which comprises using an antibody that recognizes a complex of a double-stranded gene and an intercalating reagent.

The gene detection method of the present invention uses, as an immunogen,
An antibody is obtained by using an intercalating reagent bound to a different portion of the target double-stranded gene. By binding the obtained antibody to a solid phase, reacting the target gene or the target gene after amplification with an intercalating reagent, and reacting with an antigen-antibody, the double-stranded gene has high specificity, and It is possible to supply a reagent capable of causing a highly specific reaction to a target gene.

The antibody that recognizes the complex of the double-stranded gene and the intercalating reagent used in the present invention may be a polyclonal antibody or a monoclonal antibody. Monoclonal antibodies are preferred to increase the specificity of the reaction. For the production of polyclonal antibodies, a conventional method (for example, Shinsei Chemistry Experiment Course 1, Protein
I, p389-397, 1992), immunization with an antigen (complex of a double-stranded gene and an intercalating reagent) in animals such as rabbits, rats, goats, sheep, mice, etc. It can be obtained by collecting the antibody. The titer of the obtained antibody can be measured by a method known in the art. Preparation of monoclonal antibodies is also conventional (eg, Kohler et al., Nature 256: 496, 1975; K
ohler et al., Eur. J. Immunol. 6: 511, 1976). That is, it is carried out by immunizing an animal as described above to obtain antibody secretor cells, fusing this with a myeloma cell line, and selecting a hybridoma that produces an antibody.

The obtained antibody can be used as it is or as a part having antibody activity.

As the solid phase, those known in the art such as a test tube and a microtiter plate can be used, but if the agglutination reaction is carried out using particles, it is advantageous that B / F separation is not necessary. Although various types of particles can be used, it is important to have uniform particle size when performing analysis in a flow, and latex particles of uniform size are most useful for that purpose. it is conceivable that.

The agglutination generated by the antigen-antibody reaction can be measured visually or by turbidity, absorbance, etc., but the forward scattered light intensity generated by irradiating each particle with laser light while flowing in the flow is measured. The degree of aggregation can also be known by. By using this method, the gene can be detected with higher sensitivity.

Therefore, in a preferred embodiment of the method of the present invention, the first particles to which the antibody recognizing the first part of the complex is bound and the antibody to recognize the second part of the complex are bound. The presence of the gene of interest is detected by the agglutination reaction of the particles using the above-mentioned first particles and the second particles having substantially the same particle size.

When a reaction container other than particles is used as the solid phase and the intercalating reagent is a fluorescent dye, B / F separation is performed after the antigen-antibody reaction, and the fluorescence intensity is measured to obtain the solid phase. The bound gene complex can be detected. Usually, the labeled antibody required in a heterogeneous system is unnecessary. When the intercalating reagent is not a fluorescent dye, it can be measured by the sandwich method. At that time, a labeled antibody is required, and examples of conventionally known labeling substances include enzymes, fluorescent dyes, and luminescent substances. Further, the method of labeling the antibody with the labeling substance can also be performed by a method conventionally known in the art.

When particles are used as the solid phase, if fluorescent dyes are used as the intercalating reagent, many fluorescent dyes will be bound to the particles after the antigen-antibody reaction. Since strong fluorescence is emitted when irradiated with light having a wavelength capable of exciting this fluorescent dye, the presence of a gene can be detected by measuring the fluorescence intensity.

The intercalating reagent preferably has a high affinity to the double-stranded gene and binds as strongly as possible. The most well-known reagent is ethidium bromide, and thiazole orange, acridine orange, Texas red, etc. have been widely used as a gene fluorescence detection reagent for many years. In recent years, in response to the increasing popularity of fluorescence detection as a gene detection method,
New intercalating reagents are being developed. For example, “Bunseki” (12: 1002-1004, 1995) reported a newly synthesized intercalating reagent.
thD (ethidium bromide cationic dimer), TOTO (thiazole orange dimer), YO
YO (oxazole yellow dimer) and the like can be used.

[0021]

EFFECTS OF THE INVENTION According to the present invention, simple and rapid detection of a double-stranded gene can be realized, which is particularly suitable for automation. In addition, the antibody obtained by using the conjugate of the target gene and the intercalating reagent as an immunogen has higher specificity than the conventional gene recognition antibody, and aggregation using particles in which this antibody is bound to the particle surface is used. The reaction can achieve higher specificity than the conventional one.

If a fluorescent dye is used as the intercalating reagent, the measurement can be performed without using the labeled antibody.

[0023]

【Example】

Example 1: Preparation of immunogen In this example, a human gene detection system was constructed as a model.

The β-globin primer set sold by Takara Shuzo Co., Ltd. is a gene in the β-globin region of the human gene (Saiki, RK et al., Science 239: 487-49).
1, 1988), and 6
By combining different kinds of primers, 9 kinds of gene fragments having different lengths can be amplified. Here, we decided to obtain the immunogen by combining PC03 and PC04, which give the shortest fragments. The sequence of this primer is as follows, and a 110 bp gene fragment is amplified by PCR by using this primer.

PC03: ACACAACTGTGTTCACTAGC PC04: CAACTTCATCCACGTTCACC

Human blood was used as a sample. Blood collected using trisodium citrate as an anticoagulant was centrifuged (3000 rpm, 15 minutes) to collect a buffy coat. The collected buffy coat was diluted with physiological saline, and from there, a guanidinium thiocyanate method (molecular cell biology basic experiment method, Nankodo) was used to prepare a DNA sample for PCR.

PCR was performed using a thermal cycler manufactured by Perkin Elmer.

The liquid composition used in the PCR reaction is as follows: Buffer: 5 μl (200 mM Tris buffer, pH8.4, 15 mM MgCl ₂ , 1 mg / ml BSA) Purified water: 39.5 μl 10 mM dNTP mixture: 1 μl Primer (PC03, PC04 10 μM each): 1 μl each Taq DNA polymerase (AmpliTaq ^™ , Takara Shuzo Co., Ltd.): 0.5 μl Extracted DNA solution: 2 μl

The PCR reaction is 94 ° C. for 45 seconds, 55 ° C. for 25 seconds
20 cycles at 72 ° C. for 3 minutes. The amplified gene fragment was purified using liquid chromatography, and thiazole orange was added thereto as an intercalation dye to bind the gene to the dye. The amount of the amplified gene was measured by absorbance, and it was 1000 per molecule of the gene.
Molecular thiazole orange was added and reacted at 4 ° C. for 1 day. The sample after the reaction was subjected to gel filtration with PD-10 (Pharmacia) to remove unbound thiazole orange.

Example 2: Immunization and screening of antibodies Immunize mice with the dye-binding gene prepared in Example 1,
Antibodies were obtained. Balb / c was used for mice, and 50 μg / mouse was subcutaneously immunized with complete Freund's adjuvant. The same immunization was performed three times every two weeks, and the fourth immunization was performed intraperitoneally without adjuvant.

Four days after the final immunization, the spleen was taken out and fused with myeloma cells according to a standard method. PE for fusion
G was used.

The obtained hybridoma was examined for the reaction to only the gene fragment (PCR product) used as the immunogen, the reaction to only the dye, and the reaction to the dye-binding gene. Clones that did not react with the dye were selected.
For the screening, a dye-binding gene, a gene or a dye was immobilized on a microplate, and a hybridoma culture solution was added thereto. After washing, an ALP (alkaline phosphatase) -labeled anti-mouse IgG goat antibody is added, and after washing, the enzyme activity of ALP is measured.
Method A was used (10 mM p-nitrophenyl phosphate pH 9.6, 50 mM citrate buffer solution was used as a substrate). Hybridomas that did not react to the plate containing only the dye or the plate containing only the gene and reacted relatively strongly to the dye-binding gene were selected as complex-specific clones.

In order to examine the optimum combination for agglutination reaction in this clone, each antibody was cultured and purified by a standard method. A part of the purified antibody was immobilized on a microplate and the other part was labeled with biotin (NHS biotin was used as a label, and after reacting by a standard method, gel filtration was performed to obtain a biotin-labeled antibody). .

A dye-binding gene fragment is sandwiched between each solid phase and a biotin-labeled antibody, and streptavidin-labeled A
It was detected using LP. The ease with which a sandwich was formed was judged depending on which position of the dye-binding gene each antibody recognizes. It was considered that the detection sensitivity of the sandwich method becomes higher as the recognition sites of the two antibodies are more distant, and that the higher sensitivity of the agglutination method can be expected by using the antibodies in combination.

As a result of the screening, B-52 and C-4
Since the clone 3 showed a relatively high specificity for the dye-binding gene, a gene detection system was examined using this antibody.

As a control, an antibody which reacts to both a single gene and a dye-binding gene to the same degree was selected, and C-88 and E-09 were used as this clone.

Example 3 Preparation of Specimen Sample As in Example 1, DNA was separated from human blood by the guanidinium isothiocyanate method. Two primers, PC03 and PC, described in Example 1 for this DNA
PCR was performed using 04 under the same conditions as in Example 1 to obtain a product.

The PCR products were prepared with and without addition of 1.5 μg of thiazole orange and used for the experiments.

Example 4 Antibody-Bound Latex Particles 0.78 μm polystyrene latex particles (custom-made product purchased from Sekisui Chemical Co., Ltd.) were added to 10 mM PBS, p.
The concentration was adjusted to 5% (w / v) in H7.0, 50 μg / ml of each antibody was added, and the mixture was reacted at 4 ° C. for 24 hours. After that, centrifugation was performed at 12000 rpm, the supernatant was removed, and then 0.1 M PBS containing 1 mg / ml BSA was added in the same amount as the initial amount to disperse the particles. After that, the same treatment was performed once more and finally dispersed in the same buffer to obtain a latex reagent.

Four kinds of antibody-bound latex reagents were prepared, and B-52 and C-43 and C-88 and E-09 were mixed at a ratio of 1: 1 and used in the experiment.

Example 5: Measurement of aggregation To measure the aggregation rate, a fully automatic immunoassay device PAMIA-3 was used.
0 ^™ (Toa Medical Electronics Co., Ltd.) was used.

This apparatus is an apparatus capable of measuring the degree of particle aggregation by irradiating particles flowing in a sheath flow with a semiconductor laser beam and measuring the forward scattered light intensity thereof.

Antibody-bound latex particles (5% w / v), 10 μl of sample, and 80 μl of 0.1 M PBS containing 1 mg / ml BSA as a reaction buffer were added thereto, and 45
After reacting at 15 ° C. for 15 minutes, the aggregation rate was measured. The degree of aggregation was determined by the number of aggregated particles (P / T%) relative to the total number of particles.

As a sample, a sample before carrying out PCR (referred to as sample A), which was prepared by adding a dye thereto, was used as a control.
The agglutination rate of the sample after PCR (referred to as sample B) and the sample to which the dye was added was compared.

The results are shown in Table 1. In the combination of B-52 and C-43, aggregation was confirmed only in the sample containing the PCR product and the dye, and no aggregation was confirmed in the sample containing only the PCR primer and the dye.

On the other hand, in the latex reagent in which C-88 and E-09 were combined, some aggregation was observed even in the sample containing no PCR product. This indicates that an antibody obtained by immunizing only a gene has low specificity for a particular gene and produces a reaction against other genes, although it is weak. An antibody obtained by using an intercalating reagent bound to a double-stranded gene as an immunogen,
It was confirmed that the target double-stranded gene could be specifically captured.

[0047]

[Table 1]

─────────────────────────────────────────────────── ─── Continuation of the front page (51) Int.Cl. ⁶ Identification code Internal reference number FI technical display location G01N 33/58 G01N 33/58 A

Claims (4)

[Claims] 1. A method for immunologically detecting a gene, which comprises using an antibody that recognizes a complex of a double-stranded gene and an intercalating reagent. 2. Particles having substantially the same particle size as the first particles bound with an antibody recognizing the first portion of the complex and the first particles bound with an antibody recognizing the second portion of the complex. The method for immunological detection of a gene according to claim 1, wherein the presence of the target gene is detected by agglutination reaction of the particles using the second particles having 3. The immunological detection method for a gene according to claim 2, wherein the aggregation of particles is measured by detecting light scattering. 4. The immunological detection method for a gene according to claim 1, wherein the intercalating reagent is a fluorescent dye.