JPH07502483A - Novel peptide antigens and immunoassays, test kits and vaccines using them - Google Patents

Abstract

(57) [Summary] This bulletin contains application data before electronic filing, so abstract data is not recorded.

Description

[Detailed description of the invention] Novel peptide antigens and immunoassays, test kits and vaccines using the same hmm Background of the invention field of invention The present invention relates to Bnv-1 (HTLV-1; amino acids (a, a, ) 191-215) , IEnv-2 (HTLV-[1;a, a, 187-210), Bnv5 (HTLV-1; a, a, 242-257), Gagla (HTLV-1; a, a, 102-117), Pal-3 (HTLV-1; a, a, 487-5 02), Env-20 (HTLV-11; a, a, 85-102), Bn v-23 (HTLV-[[; a, a, 274-289), Gag-10 (HT LV-[/II; a, a, 364-385) and Ers (endogenous retrovirus) HTLV-1 and HTLV-II selected from the group consisting of peptides derived from the structural gene products of related to assays, test kits and vaccines.

Description of related technology Human T-lymphotropic viruses (HT, LV) summer and summer types are closely related. It is a human retrovirus (Wachsman W, Golde DW, C hen [SY, HTLV and human leukemia: the outlook, Sem1n H ematol 1986; 23; 246-56).

HTLV-1 is associated with adult T-cell leukemia (ATL) and HTLV-1-associated minilobes. -/Chronic neurological ataxia (HAM/TS) known as tropical spastic paraplegia P ; Flhrlich GD, Po1esz BJ, HT L V - Clinical and molecular parameters of n infection, C11n Lab Med 1988; 8:65-84). Meanwhile, patients with a variant of hairy cell leukemia The first isolated HTLV-n (Kalyanaraman VS, Sarngadharan MG, Robert-Guroff M etc. 1 capillary Human T-cell leukemia virus (HTLV-II) associated with T-cell variants of cell leukemia 5science 1982;218:571-3) is a new variant of not associated with specific diseases (Blattner WA, retroviruses, Edited by Bvans AS Human Viral Infections: Pathogenesis and Control, 3rd Edition, New York: Plenum 1989:545-92), HTLV-1 infection It is endemic to southwestern Japan, the Caribbean, and parts of Africa (F3hrlic h GD, Polesz BJ, Clinical and molecular parameters of HTLV-n infection. Data, C11n Lab Med 1988; 8:65-84), HTLV- II has been reported primarily among intravenous drug users (Lee H, Swanso nP, 5horty VS, Zack JA, Rosenblalt JD, Chen [, Seropositivity in New Orleans ■ Elevated in drug abusers. rate of HTLV-n infection, 5science 1989;244:471-5) o The relationship for transmission of HTLV-1/II infection from contaminated blood products is Confirmed by serological evidence of HTLV-1 in blood suppliers of the United States (Willi) ams AB, Pang CT, Slaman DJ, etc. to American blood suppliers Blood epidemics and etiological associations of HTLV-1 infection in 5science 19 88:240:643-6; Anderson D, W.

Bpstein J, S, Lee T, H, et al. Healthy Blood and Plasma Supply Serological infection of human T-lymphocyte virus summer type infection in patients, Blood 1 , 989; 74:2585-91) and the U.S. Food and Drug License Administration provided suggested HT4;V-1 screening of all blood sampled (Public Health Service Group). Screening test for antibodies against human T-lymphocyte-tropic virus type II Permission, MMWR19B8;37:736-47; Kaplan J, 8°, Khabbaz R, F, HTLV-1: For blood donor screening The latest information, ^ta, Fall, Physician 1989; 40:1 89-95). Recent data from blood donor screening show that HTLV-1 showed that more than half of these seropositives could be infected with HTLV-II. (ChenISY, Rosenblat JD, Black AC ? ^rrigo SJ, Green PL.

1990, HTLV-n epidemic and regulation of gene expression: AIDS Res H um Retroviruses 6:134-5)6 Furthermore, the High rates of HTLV seroreactivity among intravenous drug users may be due to HTLV-IF infection (Lee H, Swanson P, 5hourty V, S, Zack J, ^,, Rosenblatt J, D,, Chen 1. = Yuoru Seropositivity in Léan ■High rate of HTLV-n infection in drug abusers, 5cie nce 1989;244:471-5) o HT LV-1 infection and HTLV - Since there are no serological assays that can distinguish it from infection (Chen IsY, R osenhlat JD, Black AC, Arrigo SJ, Gre en PL, 1990. HTLV-II epidemic and control of gene expression Control: AIDS Res) Iuo+ Retroviruses 6:134 -5) Counseling of such individuals regarding HTLV-1 related diseases is inappropriate. It may be urgent.

Overall structural similarity as well as much identity in primary amino acid sequence (Myers G, Josephs S, F, Rabson A, B, Sm1th T, F, Wong 5taal F, human retrovirus and AIDS, L os Alamos National Laboratory, = Niemekki Chico State Ross 75%, 1988) demonstrated the resistance between HTLV-1 and HTLV-II. Virtually any serological assay to date has shown that these two species infection cannot be reliably distinguished (Anderson DJ, l?pste ln J, S, Lee T, Ho et al.

Serology of human T-lymphocyte virus type I infection in healthy blood and plasma donors Blood 1989; 74:2585-91); Lee T, H , Coligan J, B, , McLane M, F, etc., Summer type and ■ type Hi Serological cross-reactivity between envelope gene products of human T-cell leukemia virus, Proc, Natl, Acad, Set.

USA 1984; 81 Near 579). Virus isolation and gene amplification technology (Le e H, Swanson P, 5horty V, S, Zack J, A ,, Rosenblalt J, D,, Chen 1. in new orleans High rate of HTLV-n infection in drug abusers, 5science1 989;244:471-5;mouth e B, 5rinfva A, human immunodeficiency infection virus (HIV) and human lymphotropic virus type I or type ■ dual infection Detection by polymerase chain reaction, Oncogene 1989;4:153 3-5) makes it possible to distinguish HTLV-1 infection from HTL V-It infection. However, these operations are labor intensive and require collection and processing of lymphocytes. shall be. A serological assay that would distinguish between the two infections is highly desirable. So Assays such as the For seroetiological studies that have been carried out, and for testing blood donors and seropositivity, would be very useful for counseling others (Chen [SY, Rosenblat JD, BlackAC, Arrigo SJ, Gre en PL, 1990. HTLV-n prevalence and regulation of gene expression :　AIDS　Res　)Ium　Retroviruses6:134-5) .

Synthetic peptides expressing conserved “immune-determined” epitopes are low cost and positive. It offers an interesting alternative to virus-derived antigens in terms of its reproducible nature. provide, provide. Synthesis of antibodies reactive with predetermined amino acid sequences (Lerne r　R,A, Antibody Adv of predetermined specificity in biology and medicine, Immunol, 1984; 36:1-44), related strains that are mutually infectious. It has previously been shown to be a sensitive and specific means for differentiating between coronaviruses. (Anderson D, W, Bpstein J, S, Lee T, H, etc., human T lymphocyte virus summer in healthy blood and plasma donors Serological infection of type infection, Blood 1989;74:2585-91); LeeT, H, Coligan J, El, McLane M, P, etc. Summer Serological differences between the envelope gene products of type 1 and type 2 human T-cell leukemia viruses. Cross-reactivity, Proc, Natl, Acad, Sci, USA 19 84; 81 Near 579). Structural proteins such as HTLV-1 and HTLV env, gag and poL from -n are the main immune determinants under conditions of natural infection. Because it is a protein (Lee T.

Coljgan J, B,, Homma T,! JcLane M, F,, Tachibana N, Bs5ex M, human T-cell leukemia virus Synthetic membrane antigen (HTLV-MA): the main antigen recognized following viral infection, P roc, Natl, Acad, Sci, USA 1984;81:38 56-60; Kanner S, B, Mayer C, C, Gefff n R, B, etc. env and gag polypeptides of human retroviruses; Serological assays for measuring J. Immunol, 1986; 13 7:374-8), we showed considerable differences in the amino acid sequences. env, gag, and pal regions of HTLV-1 and HTLV-II Serological reactivity was analyzed (Sodroski J.

, Patarca R, Perkins et al. Type II envelope glycoprotein gene sequence, 5science 1984; 225:421-4).

U.S. Patent No. 4,838,701: Specific immune reaction to 1tHTLV-1 antibody The present invention discloses peptide compositions having the following properties.

Summary of the invention One objective of the present invention is to detect cross-reactivity with serum samples from HTLV-II infected individuals. The purpose of this study is to reveal the major immune-determining epitopes of HTLV proteins that are not shown. Ru.

Accordingly, one aspect of the present invention is Bnv-1 (HTLV-1; a, a, 191-215) LPHSNLDHIL BPS[PWKSKLLTLV.

En v-2 (HTLV-[[;a, a, 187-210)VHDSDLE ! HVLTPSTSWTK ILKP t.

Elnv5 ()! TLV-1; a, a, 242-257) 5PNVSVPS SSSTPLLY.

Gagla (HTLV-1; a, a, 102-117) PP5SPTHDPP DSDPQI.

Pal-3 (HTLV-[;a, a, 487-502) KQILSQRSFP LPPPHK.

Env-20 (HTLV-+ 1; a, a, 85-102) KKPNRQ GLGYYSPSYNDP.

Bnv-23 (HTLV-[;a, a, 274-289) QPRLQ^[ TTDNCNNSr.

Gag-10 (HTLV-1/II; a, a, 364-385) GHWSR DCTQPRPPPGPCPLCQDP.

Brs (endogenous retrovirus sequence) PRIPKPCP ICvCPNWK SDCPT, their analogues (The amino acids in the above sequence are derived from the three-dimensional conformation of the sequence. Immunoreactivity to antibodies against HTLV-1 or HTLV-■ is substantially preserved. (may be substituted as long as possible) HTLV-1, HTLV-II or a peptide selected from the group consisting of relates to peptides having specific immunological activity to antibodies directed against the combination thereof.

The invention further provides antibodies against HTLV-1, HTLV-1 or combinations thereof. immunoassay method for detecting the antibody, a test kit for detecting the antibody, The present invention relates to peptide compositions and vaccines containing the peptide.

Brief description of the drawing Figures IA and IB show the HTLV-1 genome (upper panel) and the HTLV-I [ (lower panel) shows the placement of the synthetic peptide. The relative position of each peptide is indicated by the box. This is indicated by the box.

Figures 2A and 2B show HTLV-1 infection (HTLV-1), confirmed by PCR4: HTLV-1 infection (HTLV-T PCR), and PCR confirmed Purified HTLV-1 in patients with HTLV-■ infection (HTLV-I [PCR)] Antibodies against protein (upper panel) and Bnv-5 (lower panel) are shown. . The shaded area shows the average value of the responses of 21 healthy subjects +8 3D.

Figure 3 shows the anti-Env-5 antibody levels of Env-5 (・-button) in HTLV-1-infected individuals. , by HTLV-1(〇-0) or HTLV-1(Δ-Δ) purified protein. Indicates conflict. Continuous 1 of 10ug/ml peptide or HTLV protein solution :2 dilution is mixed 1=1 with 1:1G dilution of test serum. Heat the mixture at 4°C. Keep warm overnight. Each is assayed for anti-Env-5 activity by ELISA. result is expressed as the average % inhibition of four HTLV-1 infected sera.

Figures 4A and 4B show HTLV-1 infection (○), HTLV-It (b) infection and Gag la (upper panel) or Pot- 8 (lower panel) IgG antibodies against the peptide are shown. HTLV- ■ Infected group Filled symbols indicate antibody responsiveness of RAM/TSP or ATL individuals. .

Figures 5 and 5B show HTLV-1 (top) and H TI, V-II (bottom) computer secondary structure of gag-encoded protein Show predictions.

The radius of the circle on a residue is the average antigen index calculated for that residue and the next five residues. is proportional to x. Parameters for hydrophilicity, flexibility and surface appearance are , 0.7 for hydrophilicity, 1.04 for flexibility and 5 for surface appearance. ．． It is averaged over 5 amino acid residues with a limit of 0.

Figure 6): nv2 Q @h-11! ,gnv-202'Mad! ■ and Bn v2 Q3! The juxtaposition of lS-11I with the corresponding HTLV-1 sequence is shown. H Identical amino acid residues between TLV-II and HTLV-1 are boxed. a The amino acid residue numbering is from the N-terminus of each protein.

Figure 7 shows infection with HTLV-II (HT-It) and HTLV-1 (HT-1). Env-20·toi·! in serum samples from blood donors who , Env-2021 1-! Antibodies against el and Env-203″ll-1ll are shown. Shaded. The responses represent the mean+2SD of the responses of 22 healthy blood donors.

Figures 8A and 8B show HTLV"" and HTLV"4 samples and HTLV env. Synthesis from (A) gag (B) region and endogenous retrovirus sequences (B) The figure shows serum reactivity with the synthetic peptide. The data is in HTLV (p19 and/or or p24+gp48/61; n=30) and HTLV"' (pl'9+ p24+r21+, n=1'2; p19+p24+, n=10; p19'+, n =43; p24+, n=6. r = 21+, n = 9) expressed as % reactivity of the sample. It will be done. A: Synthetic HTLV-1-specific Env1181-1 (0 mouths) and Eny l 14t 1mm' (z).

HTL V-It specific Env-1””-”’ ([21) and En, v=20″s, % reactivity to −+@*(b); B: HTLV-1 specific target Q ag 1 aII to 117, (b), HTLV, -1/'I [Special J% G　a　g　-10”!’-”’ (rzJ’) and endogenous retrovirus % reactivity with sequence RTVL"" (IISa).

Figure 9 shows that the RTVL region is located in a similar position to that found in other retroviruses. contains two incomplete copies of the conserved sequence. The period in Figure 9 is Figure 4 shows gaps in the array added for column juxtaposition.

Detailed description of the invention The present invention provides a method for detecting HTLV-■ or HTLV-II in body fluids through the use of synthetic peptides. Concerning a sensitive method for detecting antibodies against. Peptides can also be used in humans. Infection with HTLV-1 or HTLV-■ in healthy mammals, including stimulates the production of HTLV-1 or HTLV-II antibodies to confer protection against It is useful as a vaccine by stimulating the body. Peptides are envelope proteins It has an amino acid sequence corresponding to the commercial segment. The detection method is enzyme-linked immunotherapy. Solvent assay (ELISA), immunoradiometric assay (IRMA) and other forms of immunoassay methods, e.g. enzymes on nitrocellulose paper. Immunoplotting assays and hemagglutination assays using peptides as antigens It includes

The immunoassay for HTLV to be developed must meet two main criteria. is necessary. The test specifically tested both HTLV-1 and HTLV-II viruses. We must distinguish between them where they exist. Whole virus lysate Enzyme immunoassay (EIA), in which the virus is used as a source of antigen, is a Sequence homology in highly conserved regions of core and polymerase proteins Therefore, HTLV-1 and HTLV-II cannot be efficiently distinguished. with high sensitivity Two specific immunoassays are available in laboratories where blood screening is performed. must be available for use. In the current study, the inventors have identified HTLV-1 and H Synthetic peptides from the immunoreactive domain of TLV-II(7) viral protein Design an immunoassay that will differentiate between HTLV-1 and HTLV-II. We request that you make any attempt to do so. The inventors also described the polymerization of HTLV-1. A synthetic peptide derived from the enzyme region detects serum antibodies in many infected individuals. provide evidence that

Amino acid abbreviations used herein are conventionally shown below.

Amino acid 3 letter abbreviation 1 letter abbreviation Alanine Ala ^ Arginine Arg R Asparagine Asn N Aspartic acid ^sp Asparagine or aspartic acid Asn B Cystine Cys C Glutamine Gin Q Glutamic acid Glu E Glutamine or glutamic acid Glx Z Glycine Gly G Histidine 1 (is H Leucine Leu L Lysine Lys Methionine Met H Phenylalanine Phe P Proline Pro P Serin Ser S Threonine Thr T Tryptophan Trp W Tyrosine Tyr Y Valin Val V According to the present invention, for detection of antibodies against HTLV-1 or 1iHTLV-Ill: Useful peptides include Env-1 (HTLV-1; a, a, 191-215) L P) ISNLDHILBPS[PWKSKLLTLV.

Rnv-2 (HTLV-11; a, a, 187-210) VHDSDLB) IV LTPsTsWTTKILKPI.

Bnv5 (HTLV-1; a, a, 242-257) 5PNVSVPSSS STPLLY.

Gagla (HTLV-1; a, a, 102-117) PP5SPTHDPP DSDPQ[.

Pal-3()ITLV-1;a,a,487-502) KQ[LSQRSP PLPPPHK.

Bn v-20 (HTLV-11; a, a, 85-102) KKPNRQG LGYYSPSYNDP.

Bnv-23 (HTLV-1; a, a, 274-289) QPRLQA I TTDNCNNS I.

Gag-10 (HTLV-1/II; a, a, 364-385) GH WSRDCTQPRPPPGPCPLCQDP.

Brs (endogenous retrovirus sequence) PRIPPKPCP ICVCPNWK SDCPT, and their analogs (The amino acids in the above sequence are derived from the three-dimensional conformation of the sequence. Immunoreactivity to antibodies against HTLV-1 or HTLV-■ is substantially preserved. (may be substituted as long as possible) selected from the group consisting of.

These peptides are analogs or fragments, i.e. with amino acids added to or less terminus from either end Consisting of shorter or longer peptide chains with amino acids Good too. Recognized by dominant antibodies against HTLV-1 or HTLv-■ Analogs of synthetic peptides can also be used as long as the possible three-dimensional conformation is preserved. , may contain substitutions and/or deletions of the amino acids listed in the above sequences.

In the present invention, in the immunoreaction of antibodies against HTLV-1 or HTLV-I [ Based on the high degree of sensitivity and specificity of such peptides, they can be used as vaccines. (e.g. for ATL and HAM/TSP) in mammals, including humans. Monoclonal antibodies and polyclonal antibodies against LV-1 and HTLV-I It is useful as an immunogen for the development of antibodies. protein or polymer carrier or by the use of homo- or heteropolyfunctional crosslinkers. - or when polymerized into hetero-dimers or higher oligomers. Tide can be induced in normal subjects to inhibit HTLV-I or HTLV-II. Stimulates the production of antibodies and provides protection against infection in healthy mammals.

Since the peptide according to the present invention is not biochemically derived from a virus, It does not endanger the normal subjects to be vaccinated against the disease.

The advantages of using the peptides according to the invention are many. Peptides are chemically synthesized.

This ensures that the test reagent or vaccine is not HTLV-1 or Means no contact with LV-m. Vaccine production or vaccination process Manufacturers and individuals with health conditions are not at risk during this period. Similarly, above Use of peptides or against HTLV-1 or HTL■-■ in mammals In the development of monoclonal or polyclonal antibodies, HTLV-1 or HT　V　V　-■ There is no risk of exposure. In addition, test reagents may antibodies to HTLV-1 or HTLV-I when exposed to samples of body fluids. Until the final stage of the test to detect HTLV-1 or HTLV- Ill: There is no risk of exposure. Any risk of exposure during this last stage is Heat the serum sample to be tested at 60°C for 30 minutes, thereby inactivating the virus. It can be further avoided by taking preventive steps.

Other problems avoided by the present invention are HTLV-1 or HTLV-1. II virus preparations and purified host cells or expressed virus fragments. In antigenic material from E. coli-derived proteins that are co-purified with antigens. The possibility of false positive results caused by the presence of Some normal individuals , E, C01i or human leukocyte antigen that cross-reacts with antigenic material from host cells. For example, ■ (has antibodies against LA. Serum samples from these normal individuals have antibodies against LA. Even if they were exposed to HTLV-1 or HTLV-1[ may give a positive response in the IRMA test.

If a person is infected with HTLV-■ or ■ based on this type of false-positive response, A diagnosis that a person may have an illness causes significant anxiety for the person or his or her family. It can happen. All of these issues can be addressed using the peptides of the invention as test reagents. This can be avoided by

Furthermore, by using appropriate amino acid analog substitutions, various Peptide analogues with lower background values or HTLV-1 or Characteristics that result in better adsorption to solid phases useful for body screening absorption It can be synthesized to have the following properties.

Furthermore, since the peptides of the invention are produced synthetically, their quality can be controlled; As a result, reproducibility of test results can be guaranteed. Also, a very small amount of peptide is required for each test procedure, and since the cost of producing peptides is relatively low, Cost and cost of screening body fluids for antibodies to HTLV-1 or and vaccine production costs are relatively low.

Method for detecting 4::HTLV-1, HTL, V-II or combinations thereof in body fluids prepare a small amount (at least one of the above peptides, analogs or mixtures thereof) and and at least one peptide in the immunoassay procedure at a pH of about 7.5. 10, preferably about 0.1 m per test in a buffer of about 9.4 to 9.8 g to about 2θ mg, preferably about 1.0 mg to about 10 mg. Become.

The peptides produced according to the invention can be used as test reagents in immunoassays, e.g. Elementary bond immunoassay Solvent assay (ELISA), Enzyme immunodot assay b. Hemagglutination assay, radioimmunoradiometric assay (IRMA) or in any other competitive binding assay format. and HTL.

■-■ Can be used to detect infection.

The present invention further includes: (i) Enough amount to produce the antibody-peptide complex to be detected, HTLV- Peptides of the invention for reaction with l5HTLV-II or combinations thereof (ii) dilute with buffer; HTLV-1 or HTLV in the test serum is added. - an antibody against It forms a peptide-antibody complex with the peptide, (nr) keep the mixture warm, and (Soup) HTLV-1,H, consisting of: detecting the presence of a peptide-antibody complex; Immunoassay for detecting antibodies against TLV-It or combinations thereof Regarding the law. In step (iv), a second known antibody labeled with an enzyme and A substrate is introduced which reacts with the enzyme to form a colored substance. Also, in step (iv) In this step, a second known antibody labeled with a radioactive element is introduced. Also, the stage (i In v), the peptide-antibody complex may be detected as an aggregate. solid support may be coated in a multi-dot array with at least one of said peptides. Pep The amount of tide is preferably in the range of 1 mg to 10 mg per dot. Detection stage (i t) can also be performed competitively using labeled or unlabeled antigen or antibodies to compete with the complex. may be carried out. The antigen in step (i) is a polyethylene If it can be detected by glycol precipitation or Coombs reagent, They do not need to be combined.

The present invention also relates to a solid support or other suitable labeling material attached thereto; Immunoadsorbents with low brightness (also consisting of one type of peptide or simply at least one type of peptide) peptide only, a sample of normal serum as a negative control; of serum containing antibodies against HTLV-1 or HTLV-II as a positive control. sample, and Buffer for diluting serum samples HTLV-L, HTLV-II or a combination thereof) Regarding test kits for distribution.

Furthermore, the present invention relates to a peptide composition containing at least one peptide of the present invention. Ru. When present in more than one composition, each is present in a 1:1 ratio with the other. Ru.

For example, if several peptides are present in a mixture, they are in a 1:i:1 ratio It is in. Preferably, each peptide is present in an amount of 0.5 mg to 5 mg.

- An example of two or more peptides to be mixed together is the combination of Env-1 and Env-5. Includes The mixture of peptides is proposed for improving the sensitivity of HTLV-1 detection. can be provided.

Similarly, Env'-2 and Env-20 can be used to improve HTLV-II detection. Can be combined. If necessary, the peptide can be transported in a suitable carrier such as saline or saline. May be mixed in phosphate buffer in water.

The invention also relates to a vaccine comprising at least one peptide of the invention, and Used to generate antibodies and other cellular and immune responses. Arayu peptides, alone or in combination, can be coupled to conventional, known carrier proteins; The animal can be immunized prior to HTLV-1/n infection. High immune response (B- and Peptides that generate T-cell responses) can be used to develop vaccines using conventional methods. can be used.

Bnv5 (HTLY-1a, a, 242-257) is the best immunodetermined epitope. reacts with all serum from patients infected with HTLV-1, and reacts with all serum from patients infected with HTLV-1. There is no cross-reactivity with the 35 patients infected with I. Trials tested in this study Although the number of specimens is small, they are from different clinical groups as well as from different endemic areas. of HTLV-1/n infected patients and the current estimated HTLV in blood donors - I/n seroprevalence (0,02%) 4: Based on the number of HTLV-1 positive subjects ( n=52) represents the expected number of similar infections for a population of 260,000. Probably.

HTLV-1 envelope protein is variable in different virus isolates It is known to show (Daenka S, , Nightingale S., Cruickshank J., Banghamc, R.M. Human T-lymphocyte virus from patients with tropical spastic paraplegia and adult T-cell leukemia Type I sequence variants are neurologically indistinguishable from leukemia isolates. J. Virol, 1990;64:127B-82), and this does not affect the sensitivity of the test. do not have. Env-5 region (SerProAsnValSerValProSerS erSerSerThrProLeuLeuTyr) and other Comparison with viral isolates shows that 13 out of 16 amino acids (81%) are conserved. and Previous data on the epitope map of Env-5 Three amino acid sites (247, 250 and 251) showing variability in important parts of This suggests that it is not found in

Bnv-1 (HTLV-1; a, a, 191-215) has HTI, V-1 sensation showed high sensitivity (92%) for infection with HTLV-II, but a low proportion of HTLV-II-infected subjects (8,6%). %) also reacts with this peptide. This probably indicates some degree of structural homology. It reflects.

On the other hand, Bnv-2 (HTLV-[1;a, a, 187-210) is HTLV -1 (94%) and HTLV-II (77%) serum samples.

Therefore, HTL with significant differences in amino acid sequence from the HTLV-1 sequence Although peptides are selected from regions within the V-II sequence, in reality, the epitope Antibodies in serum samples infected with both HTLV-1 and HTLV-IF (7) similar to that recognized by the body and the serology of HTLV-1/n infection may be included in other peptide assays of interest.

Other researchers are using recombinant proteins, such as San+uelKP, Laut enberger JA, Jorcyk CL, Joseph S, Wo ng-Staal P, papas’rs, bacterially produced HTLV-1z Diagnosis of Human Malignant Scence of Envelope Proteins 1984; 226: 1094-7HTachibana N, Miyoshj I, Papas TS, Bs5ex M.

Antibody reactivity against different regions of human T-cell leukemia virus type I in infected individuals , J. Virol, 1989;63:4952-7), and envelope Synthetic peptides were used to identify the antigenic sites on (Palker TJ, Tanner MB, 5earce RM, 5trailin RD , C1erk MB, Haynes BF, Env-encoded synthetic peptide Human T-cell leukemia virus type I (HTLV-1) gp46 and gp Mapping of the immunogenic regions of the 21 envelope glycoproteins and their effects on gp46. Monoclonal antibodies, J, ImwtunoL, 1989;142:97 1-8; Copeland TD, Tsai WP, Kin YD, 0 roszlan S, human T-cell leukemia virus type I envelope protein Quality: Characterization of antisera against synthetic peptides and identification of natural epitopes, J. Jnmunol 1986;137:2945-51), for example, our pepti One species (Bnv (, a, a, 191-215)) has T cell and B cell epitope. (Pa, which overlaps with the region of gp46 (a, 8.190-209) containing both lker TJ, Tanner ME, 5cearce RM, 5tre ilein RD, C1erk MB, Haynes BF, En V : Human T-cell leukemia virus type I (HTLV- 1) Mapping of immunogenic regions of gp46 and gp21 envelope glycoproteins monoclonal antibody against gp46, J, 1yunoL, 19 89;142:971-8; Copeland TD, Tsai WP, im　YD,　0roszlan　S, Human T-cell leukemia virus type I envelope Rope proteins: characteristics of antisera against synthetic peptides and of natural epitopes. Identification, J, Itmatuno L, 1986;137:2945-51; Kurata A, Pa1ker TJ, 5trailin RD, 5 cearce RM, Haynes BP, Berzofsky JA, Nezu Human T helper T cells IJ member virus type I envelope protein Immunodeterminant site of J, ImrrrunoL, 1989;143:2020 -30), and more recently, recombinant fusion proteins that react with human monoclonal antibodies. HTLV-1-infected serum sample (MTA-4; 42a, a) is unique to HTLV-1 infected serum samples (Foung SKH, Lipka JJ, Bui K, HTL Determination of the unique immune-determining site of V-1: Submitted to the 8th Retrovirus Conference, Hawaii (Summary)). The epitope of this monoclonal antibody lies at amino acids 185-196. The map was determined (Ralston S, Hoeprich P, Akita R, human monoclonal virus capable of neutralizing human T-cell leukemia/mycocytosis type I Identification and synthesis of epitopes for antibody antibodies, J.

BioL, Chettr, 1989; 2642 1634-6), our E Overlaps with nv-1 peptide. HTLV-1gp46 plasmid pKS 300. A plasmid containing a sequence corresponding to amino acids 200-306 (Samuel KP , Lautenberger JA+ JorcykCL, Joseph S, long-3taal P, Papas TS, bacterially produced HT Diagnosis of human malignancy of LV-1 envelope protein 5science 1984 ;226:1094-7) and plasmid RP-C, amino acids 229-308 (Tachibana N, Miyoshi [.

Papas TS, Es5ex M, human T-cell leukemia disease in infected individuals Antibody reactivity against different regions of type I * J, Virol, 1989; 6 3:4952-7) Recognized by antibodies from 1iHTLV-1 infected individuals. Xing Interestingly, the Env-5 synthetic peptide (amino acids 242-257) contained within the area coded by the code. These studies and presented here These data indicate that the C-terminal region of gp46 is highly immunogenic in humans. confirm. Serum samples from HTLV-■ infected individuals do not react with this epitope and Therefore, the C-terminal region of HTLV-Igp46, which is not allocated to HTLV-n, is immunoexpressed. The discovery that it possesses epidemiogenic determinants is of great importance.

Therefore, Env-5 peptide-based assays are useful for HTLV-1 infection and HTLV. A simple, low-cost, highly sensitive, and fairly specific method for distinguishing V-II infection. provides a standard test and therefore is currently used to identify Hl viruses. It can easily replace the PCR method.

The inventors believe that enhanced diagnostic specificity can be achieved with peptide-based ELISA. This finding builds on earlier reports demonstrating serological differentiation of HTV-1 and HIV-2 infections. More supported (Norrby B, Biberfeld G, Chiod iP, et al. Site-related serology among antibodies to HIV and related retroviruses Identification using Natuγe, 1987; 329: 248-50; Gnan nJW, McCormick JB, Mitchell S, Ne1so n, IA, Oldstone MBA, 1987. HI V type I and Synthetic peptide immunoassay to differentiate HIVZ infection, 5science 2 37; 1346-9). The discovery of a specific immunodetermining epitope of HTLV-1 is clearly This epitope may be associated with T-cell proliferation or viral It is also important to recognize the potential role that antibodies may have in inducing neutralizing antibodies.

The proteins encoded by the HTLV env, gtlg and pal genes Proteins are associated with viral pathogenicity and Contributes to many of the functional properties (Hopp TP+ Woods KR++ Ami Prediction of protein antigenic determinants from amino acid sequences Proc, NatL, Acad, Sci, JISA 1981;78:3824-8). conserved amino acids Using a series of synthetic peptides with predicted antigenic epitopes from the The inventor discovered that HTLV-1 and HTLV-It for B cell-specific antibody recognition. An attempt was made to localize the structural motif. HTLV-1 and HTLV-I [ Among the various peptides derived from both g (Xg and pal regions), only Two of the crabs react with specific sera from HTLV-1/n infected individuals. p19 tan G a g -1a determined from the C-terminus of the protein (HTLV-[;a, a , 102-117) are the highest immunodetermined epitopes, with a lower proportion of HTLV -II infected serum also reacts with this peptide (11%). This is HTLV-1 and HTLV-I.

Furthermore, serum antibody reactivity to Gag-1a is determined by the steric structure present on HTLV-1. It can be specifically inhibited with HTLV-1, which conformally exhibits the "native" epitope. So Therefore, the amino acid sequence Pro Pro Ser Ser Pro Thr H is Asp Pro Pro Asp Ser Asp Pro Gln The Gag-1a peptide with ie is present in serum from most HTLV-I infected individuals. The immunodetermining domains of HTLV-1 recognized by antibodies are shown. Furthermore, Gag immunoassays based on the closely related HTLV-1 and HTLV-II Allows serological identification of infection.

p19 Immunodetermination of the C-terminal region of the gag protein is connected with two other discoveries. I'm nervous. Palker et al. (Palker TJ, 5earce RM , Copeland TD, 0roszlan S, Haynes BF.

1986, Human T-lymphocyte virus type I (HTLV-1) p19 core protein The C-terminal region of the C-terminal region is immunogenic in humans and contains HTLV-1-specific epitopes. Contains taupe. J, Irzrnunol, 136:2393-2397) The C-terminus of p19 downstream of our Gag la reacts with 6 of the 8 serum samples tested. An epitope has been described. In their study, only 2 out of 8 samples had Gag The reagents used in their studies are reactive with epitopes that overlap with a. This may be due to the sensitivity of the test system. More recently, Kuroda et al. ashitani Y, 5hiraki H, Kiyokawa H, 0hn o M, 5ato H, Maeda Y, 1990. Using synthetic peptides Detection of antibodies against human T lymphocytes type I virus by

Int, J, Cancer 45.865-868) is HTLV-1 infected blood. 100% reactive with the supernatant sample I) Contained within amino acids 100-130 of the C-terminus of 19 reported immunodetermined epitopes. For HTLV-It infected serum samples The specificity of the peptide was not tested in their study. These studies and The data presented here confirm that the C-terminal region of p19 is highly immunogenic. and identified a strain-specific epitope at the C-terminus of p19 that is HTLV-1 specific. Indicates that it contains.

In natural infections with retroviruses, the host typically has gag or env or Making antibodies against both products (Schupbach J, Kalynara man J, Sarngatiaran G, Blattner W, G a1lo R, 1983, Adult Cell Leukemia - Lymphoma Patients and Caribbean People? Human C retrovirus, human T-cell leukemia-lymphoma in the health blank of Antibodies against three purified proteins of the tumor virus, Cancer Res, 4: LaB5-891; Ga1lo D, Hoffman MN, Loss en CK, Diggs North.

Hurst JW, Penning LM, 198B, Human T-cell leukemia Immunofluorescence, enzyme immunoassay and Comparison of Western plot (immunoplot) methods, J, CLin, Mic robioL, 26.1487-1491).

Antibody responses to pal gene products during HTLV-17TI infection have been described. not present. The results presented here were obtained from infections with HTLV-1 and HTLV-It. The majority of individuals can detect peptides derived from the central region of the poL gene. This indicates that the patient has a competent level of antibodies. The results presented here indicate that during HIV infection Similar to the antibody responsiveness to the pal gene product of HTLV-1poL gene product, They also clearly show that they induce antibody responses. occurs for this peptide The antiserum generated will help evaluate the structural characteristics of the poL gene product.

Example 1 Method In total, 186 serum samples from different study groups are selected for this study (Table 1 ).

Table 1: Standard serological results and PCR data of subjects Serology PCR confirmed group HILV-1/II HIV-111TLV-I HTLV-II group covered number of testers HILV-[ American resident book 20 + - + - Japanese 32 + N mouth n NO n-1 American resident 2B - + NONO Other books in Kyoto 50 - NONON mouth Normal person 21 - - NOND *Two members of the group are Caribbean American residents** ND - To be determined ***For serum HTLV-1/n from patients not infected with retroviruses Eighty-seven samples from subjects who are seropositive are derived from serum. Kagoshima type M, O All samples were from the same person, except for 32 samples kindly provided by Dr. Same. Polymerase chain reaction (PCR) using peripheral blood lymphocytes from 7. (=H due to A TLV-1 or HTLV-I [determined to be positive (DeB , Sr+niνaA, human immunodeficiency virus (HIV) and human lymphotropic Polymerase chain reaction detection of S. coccylus type I or type ■ double infection, Onc ogene 1989;4:1583-5) o Of the 55 samples confirmed by PCR Of these, 20 were from people infected with HTLV-1, and the other 35 were from people infected with HTLV-n. It is the origin. 13 of 20 subjects with HTLV-1 infection had ATL or HAM/T have either SP syndrome and the other 7 are symptomatic blood donors. H Most subjects infected with TLV-■ are intravenous drug users. 20 sera in this group Samples are obtained from commercial sources (Serologics, Inc., Josia State Marietsuta).

For comparison, symptomatic (n=10) or acquired immunodeficiency syndrome (AIDS) (n = 18) with a confirmed human immunodeficiency virus (HIV) infection. Serum samples from 28 patients will be tested. Patients with various other symptoms Serum samples from (n=50) are used to test for specific interference (And erson DW, Bpstein JS, Lee TH, etc., healthy blood samples. Serological confirmation of human lymphotropic virus type I infection in and plasma donors, B lo.

d! 989;74:2585-91). These samples contained rheumatoid factor (n= 8), those with nuclear antibodies (n = 8) and anti-HLA DR antibodies (n = 1), virus infection (cytomegalovirus, n=3; Nibstein-Pall virus, n=3: herpes simplex virus, n=3: hepatitis B virus, n=4: and wind virus, n = 3), and parasitic infections (PLaswrodiu rrt falciparuyr, n = 8; ToxopLasrrr a gondii, n=8: Trypanosoma cruzi, n = 5; 5 chistosortra rtransoni, n = 　5　;　SterongyL.

1des 5tercoraLis, n = 6; Wuchereria bancrofti, n=5). 21 normal serum supply Serum samples from individuals serve as negative controls.

Reference HTLV and HIV antibody tests Patient serum samples were analyzed using a commercially available enzyme-linked immunosorbent assay (HTLV-1 ELISA). HT according to the manufacturer's recommendations using First tested against LV-1 antibodies. A sample that is repeatedly reactive has been previously described. Further by Western blot and radioimmunoprecipitation assay as described. Tested (Hartley TM, Khabbaz RP, Cannon R O, Kaplan J8. Lairmore MD, immunoplot and radioactivity Antibodies against human lymphocytosis type I/IF using radioimmunoprecipitation assay Reactivity characteristics, J, C11n, MicrobioL, 1990; 28, 646-50). Simply put, Hillfrost in Cypress, California. Purified HTLV-1 antigen (MT-2 cell line, Miyoshl I, ubotani 1. Yoshimoto S etc. Induced by co-culturing normal human coded leukocytes and human leukocyte T cells C type T-frus particles in a coded T cell line, Nature 19fl; 296:770-3) in sodium dodecyl sulfate sample buffer (0,125M). Hydrochloric acid, pH 6.8, 5% 2MB, 4% 5DS) and boiled for 3 minutes. , and electrolysis in a 10% polyacrylamide gel containing 3% stacking gel. electrophoresed. Separated proteins were electrically plotted on nitrocellulose paper. Ru. Incubate individual strips with a 1:100 dilution of serum and mash to obtain Othinylated goat anti-human (heavy and light chain) immunoglobulin G (Vector Labora Tory's, Burlingame, CA) 5 mg and keep warm for 1 hour. Abhiji After reaction with biotin-horseradish peroxidase complex, washing and The chemical reaction is visualized using diaminobenzidine-nickel chloride-hydrogen peroxide as a substrate. Ru. Metabolically label the MT-2 cell line for radioimmunoprecipitation ( ("S) cysteine and ("Sol methionine (secondary England nuk) 200mC of each amino acid (Lehr, Boston, MA) in 1/10” cells. /ml).

Labeled cells were washed with phosphate buffered saline (PBS) and incubated with 0.1% SDS and 0. ．． Extract into PBS containing 0.02% Triton X-100. Solubilized with surfactant The obtained protein was reacted with a serum sample, and protein A cephalogram 483 (11) - electrophoresis on a gel, followed by autoradiography of the dry gel (tI artley TiN, ni t+abbaz RP, Cannon RO, Ka Plan JB, Lairmore MD, Immunoplot and Radioimmunology Characterization of antibody reactivity against human lymphotropic virus type ■/■ using precipitation assay. J, C11n, MicrObioL, 1990; 28.646-5 0). Low antibody reactivity by either Western blot or RIPA analysis at least two different HTLV structural gene products Cgag p24 and/or enυ [1p46 and/or gp68), the serum test The patient is determined to be HTLV-1/II positive. gag or env gene production Serum samples that react only with substances are considered equivocal and are not included in this study. I can't do it.

Antibodies against HTV proteins are ELISA and Western Blot (DuPont) and present antibodies against both gag and enD proteins. Only samples that meet the criteria are included.

Polymerase chain reaction assay Polymerase chain reaction (PCR) was performed on patient peripheral blood cells using previously described reaction conditions. Performed using whole genomic DNA isolated from blood cells (SaikJR, Ge1 DNA with thermostable DNA polymerase such as fand, 5toffel S, etc. A primer-directed enzyme amplification 5science 1988;239:487-9) , from the poL and gcLg genes of HTLV-1 and HTLV-II. Oligonucleotide primer pairs were added to 1 mg of total genomic DNA for each PCR amplification. used to amplify (DeB, 5riniva A, human immunodeficiency Full virus, +, (H1■) and human lymphocytic virus type I or type ■ double Detection of infection by polymerase chain reaction, Oncogene 1989;4:1 533-5). Of the 55 samples confirmed by PCR, 20 were HT: De B, 5 riniva A, multiplex primer pair NucL for HTLV-1 detection by PCR eic Ac1ds Res, 1989;17:2142). amplified generation Things are 5. were analyzed on a 0% polyacrylamide gel and identified specific poL and Southern blot hybridization using a gag nucleotide sap-labeled probe. This is further confirmed by analysis. MT-2 cells (HTLV-1), MO- Genomic DNA preparation from T (HTLV-II) and Hut-78 (uninfected) object is used as a control. The sample consists of primer pairs in two separated gene products. It is determined as HTLV-1 or HTLI4 positive based on the reactivity with HTLV-1 or HTLI4.

Peptide selection and synthesis Using published amino acid sequences (Myers G, Josepf SF, Rabson AB, Sm1th TP, Wong-3taal F human During Retroviruses and AIDS, Los Alamos National Laborat.

y, Los Alamos, New Mexico, 1988), the inventors HTLV-1 and HTLV-If sequences were aligned in the envelope region. 4 types of PE HTLV-1 and HTLV-II show considerable amino acid differences. are selected for synthesis by identifying the region (Figure 1). The cysteine residue is each pellet to facilitate binding with proteins for studies not reported here. It is added to the N-terminus of the peptide. The secondary structural features of envelope proteins are Plot Program (M, GribskOv, Rijkonsin University, Uns. (Madison, Consin) was predicted by inputting the amino acid sequence into the uPY, Fasman GD Prediction of protein secondary structure from amino acid sequence A dv, EnzyrttoL 1987;47:45), and the hydrophilicity is Ha Calculated by the method of Hoop and Woods (Hoop TP, Woods KR, prediction of protein antigenic determinants from amino acid sequences, Proc, Na tt, Acad, Sci, IJsA, 1981;78:3824-8) .

Synthetic peptides are produced using 9-fluorenylmethyloxycarbonyl (Fmoc) chemistry. using the manufacturer's reagents and reagents on a MilliGen 9050 Pep synthesizer. and manufactured using recommended chemical cycles. The peptide is cleaved from the resin. precipitated, and extracted several times with anhydrous ether. Final purification is done by Waters C18Delta-Pak (19mm x 30cm, 15u particles, 800 u pore size), water as starting solvent then 0-50% acetonitrol in 0.1% TFA Prepared in a rill gradient by high performance liquid chromatography (HPLC). be done. Amino acid composition, amino acid sequence analysis and analytical reverse phase HPLC column and to confirm purity.

Quantitative evaluation of antibodies against synthetic peptides Polyvinyl plate (Imron L, Dynatec Laboratories, Virginia) Synthetic peptide (Alexandria, State) in 0.01M carbonate buffer (pH 9,6) (100μg/m1) 50μ! and incubate overnight at 4°C. plate were washed 6 times with PBS containing 0.05% Tween-20 (PBS-T), and Add 200 ml of 3% bovine serum albumin (BSA) in PBS-T to each well. Incubate for 1 hour at °C to block excess reaction sites. After well washing, each test serum Add a 1:20 dilution of Warm and rinse with PBS-T. Alkaline phosphatase-conjugated goat anti-human Ig G (Sigma, St. Louis, MO) was added and incubated at room temperature for 90 minutes, then Add p-nitrophenylphosphate (Sigma) substrate. Eliza the plate 405 nm by reader (SLT Lab Instrument, Austria) Read with. Each serum sample was also coated with BSA or an unrelated synthetic peptide. assayed in plates to control for non-specific antibody binding. Seropositive is normal control The value is determined to be larger than the average value + 3flIII standard deviation.

Competitive inhibition assay Inhibition of antibodies that bind to peptides can be achieved using synthetic peptides or peptides! Increasing concentrations of HTLV-1 or HTLV-■ antigen (1-10 mg/ml) It is done by addition. Serum was added to Env-5 peptide coated plates. Immediately before mixing with the inhibiting antigen, the assay described above is performed. Results are % inhibition of antibody binding. Student tests expressed as harm are used for the statistical evaluations described above.

result Quantification of human antibodies against synthetic peptides Non-competitive enzyme-linked immunosorbent assay (ELIZA) uses synthetic peptides as solid phase. HTLV-L was developed using Bnv-2 and Env-5. Detect strain-specific antibodies in I/■ infected subjects. In a series of experiments (data (not shown), intra-assay and inter-assay coefficients of variation (CV), respectively. 15% and less than 8%. If this assay specification is HTLV-1 or HTLV - used to detect antibodies in a collection of serum samples from patients infected with n. When tested, the highest percentage (100%) of seropositivity in the HTLV-1 group was Env-5, Observed for Env-1, Env-2, Galta and Pol-3.

Table 2 - Several positive serum samples for reactivity to synthetic peptides [! nv-I Env-2 [! ny-5 Gagla Pa1-3 group test number of people H le ν-15248 (92) Kimoto 49 (94) 52 (100) 50 (96 ) 50 (96) HTL Sea II 35 3 (8,5) 27 (77) 0 (0 ) 6 (11,5) 34 (8B) HIV-1280 (0) NDm 0 (0) 0 (0) 0 (0) Other infections 34 0 (0) NO0 (0) 0 (0) 0 (0) Control 21 0 (0) 0 (0) 0 (0) 0 (0) 3 (14) 2 books Positive determined from mean value of normal control of 1 + 3S, ctO,D greater than 0 + Value ** Number in parentheses is % positive ***ND-Not decided None of the 35 HTLV-II infected serum samples react with Env-5.

En,v-1 showed high reactivity with serum samples from HTLV-1 infected individuals. 48152: 92%), and samples from HTL V-II infected patients. Is oEnv7 showing this cross-reactivity (3/85.8.6%) an HTLV-II sequence? Although it was induced from HTLV-I infected patients (49152794 %) and HTLV-II infected subjects (27/35.77%).

21 serum samples from normal subjects and from subjects with other infections including HIV Of these 78 samples, no reaction with these peptides occurred.

Gagla (HT One of the synthetic peptides named LV-1; a, a, 102-117) is HTL Shows high reactivity with serum samples from V-1 infected individuals (47152; 90%), Samples from HTLV-II infected individuals (C4785, which cross-reacts; 11 %) (Table 2) apot: 6 types of peptides derived from I-modified gene proteins Among the codes, only pol-8 (HTLV-1; a, a, 487-502) is HTL V-1 infected serum sample (50152).

96%) and HTLV-It infected serum samples (30/!35; 86%). react.

Specificity of antibodies detected by Env-5 HTLV-1 and HTI, VI [ Serological cross-reactivity of serum samples from infected patients has been well discussed (And erson DW, Bpstein JS, Lee TH, etc., healthy blood samples. Serological confirmation of human lymphocytosis type I infection in individuals and plasma donors, B load 1989;74:2585-91; Lee T, Coljgan J, H, Homma T, McLane M, P, et al., Type I and ■ humans Serological cross-reactivity of T-cell leukemia virus envelope proteins c, Mate, Acad, Sci,! JSA, 1984; 8i near 579). The present inventors demonstrated that the Env-5-based assay has high sensitivity (for HTLV-1). 100%) and specificity (no cross-reactivity to ■). They demonstrated that the HTLV-II infection research group utilizes the HTLV-1 viral antigen. to confirm that it actually contains antibodies that cross-react in quasi-serological assays. I hoped. A total of 35 serum samples from H]'LV-II infected subjects were HTL levels of antibodies to V-1 (>33D above the mean of 21 normal controls); Antibiotics were established between these HTLV-1-infected subjects and HTLV-II-infected subjects. There is no significant difference in body level CP > 0.05) (Figure 2), HTLV- ■ feeling When these samples from infected subjects are tested in an Env-5-based (assay) The cross-reactivity observed in the serological assay for HTLV-1 was also It is no longer observed (Fig. 2). The specificity of this significantly enhanced Env-5 assay will definitely not affect the diagnostic sensitivity of the test. infected with HTLV-1 32 samples from asymptomatic Japanese patients and HTLV-1 infected individuals (by PCH! Of the 20 samples from be. Furthermore, HTLV-1 confirmed by PCH in asymptomatic Japanese patients. There was no statistically significant difference in antibody levels against Env-5 between infected individuals and infected individuals. CP > 0.05’).

To further demonstrate the specificity of Env-5, we next tested serum samples with Env-5. -5 peptide and HTLV-1 and HTLV-,II antigens. Competitive inhibition experiments were performed using serum samples from four HTLV-1 infected patients. experiment. Antibody reactivity to Env-5 is determined by whether Env-5 or HTLV-1 Pre-incubation with protein can be specifically inhibited depending on the amount added, while HT Incubation with LV-II protein or unrelated peptides does not show any inhibition (Figure 3).

Distribution of antibodies to Gagla and Po1-3 To evaluate the relative distribution of antibodies, Therefore, serum levels of antibodies against the peptide are lower in HTLV-1 infected individuals (asymptomatic and and HAM/TSP), HTLV-II infected subjects (asymptomatic) and normal controls. and compared. Within this group, those with asymptomatic and HAM/TSP There was no significant difference in the levels of antibodies against Gagla (CP > 0.05). child On the other hand, Pa1-3 serum reactivity is , was significantly higher in HAM/TSP patients (Figure 4). reacts with this peptide The significant ratio of serum samples from HTLV-If and antibody levels to 1 (TLV-1 similar to levels in asymptomatic individuals. In addition, 35 Four of the serum samples showed low levels of reactive HTLV-1 and Po1-3. HTLV-II both gag and p.

Characteristics of the secondary structure of the L protein were developed by Chou and Fasman. Analyzed by using computer algorithms (Chou PY, Fasman GD Amino acid sequence to protein] Preparation of secondary structure Adv , EnzymoL 1987; 47+45). Figure 5 shows HTLV-1 and HT Secondary structure predictions for the gag region of LV-II are shown. of high antigenic index Domains are added onto the structural skeleton. The antigenic index is hydrophilic, flexible and Iame for predicting surface domains for combined values of and surface appearance. This is an algorithm designed by Chou Sson and Wolf (Chou PY , Fasman GD Protein Confirmation Prediction Biocherr rostγy13.222-244). of the four areas with high index One is in the Qag lamidomain. The other three antigenic determinants are near the C-terminus. (amino acid numbers 337-342, 390-395 and 402- 408). The three highest antigenic indices within HTLV-T1gag are amino acid positions Located at U2O5-411 by 343-348.401-408. HTLV-I The absence of a Ni-like structural motif within the I sequence (Figures 5A and 5B) indicates that HTLV- Regarding the lack of antibody responsiveness to this peptide in serum from individuals infected with IT. It is thought that it is connected.

Similar analysis of the HTLV-1 pot protein revealed high hydrophilicity and antigenicity index. Plo-3 is shown located in the area of In contrast, other peptide examples For example, P.

Although 11a and Po1-4 show high antigenic index, <10% of serum does not react with these peptides (data not shown) ).

In the following example, 0.25% by weight of glutaraldehyde was added to the plate or vial. may be added to the coating buffer to promote better peptide binding onto the . In addition, horseradish peroxidase-conjugated mouse monoclonal anti-human IgG Antibody replaces horseradish peroxidase-conjugated goat anti-human IgG antibody (Fc) can be used as a second antibody tracer.

The gelatin used in these methods is bovine skin gelatin, pig skin gelatin. gelatin, fish gelatin or any known available gelatin protein; It can also be exchanged for albumin protein.

Example 2 Antibody to HTLV-1 or HTy, v-n by enzyme-linked immunosorbent assay detection The wells of 96 wells were filled with 1.5 mg per well of at least one peptide of the invention. (mixture in 100 ml of 10 mM N a HCOs buffer, pH 9.5) overnight at 4° C. (or 3 hours at room temperature).

Wells were washed three times with phosphate buffered saline (PBS) and then incubated for 1 hour at 37°C. Incubate with 250 μm of 3 wt% gelatin solution in PBS and remove non-specific proteins. block the tissue junction sites and then PBS containing 0.05% by volume of Tween 2o. Wash three or more times with

The test serum (blood collected from a human patient or normal individual) was mixed with PBS (20% by volume). Contains normal goat serum, 1% gelatin by weight and 0.05% Tween 2o by volume ) at a volume ratio of 1:20 and 1:200, respectively.

Add 200ml of diluted serum to each well and incubate for 1 hour at 37°C. . Wells were washed three times with 0.05 vol% Tween 20 in PBS to remove binding. Excludes antibodies. Goat anti-human Ig conjugated with P. forcella dissi peroxidase G (Fc) with HTLV-1 or HTLV-II formed in positive wells. Use as a second antibody tracer to bind. 1% by volume in PBS Normal goat serum, diluted 1+3000 in Tween 20 at 0.05% by volume. - Oxidase labeled goat anti-human IgG was added to each well for an additional 15 minutes. Keep warm at 37℃.

Wells were washed five times with 0.05 vol% Tween 2O in PBS to remove unbound antibody. and then add 0.04 wt. of the substrate mixture (citrate, p. % orthophenylenediamine (OPD) and 0.012% by volume hydrogen peroxide. have ) was reacted with 100 μl of

Using this substrate mixture, peroxidation can be achieved by forming a colored product. Detect the enzyme-labeled substance.

The reaction was stopped by adding 100ml of 1.0M HtSOs and Measure using an ELIZA reader at A=s*). Ta.

The assay was independent of HTLV-1 or HTLV-n infection, which was used as a negative control. using a single dilution (1:20) of serum from sick patients or from normal individuals. Then do it twice. Absorption reading larger than the value of cutoff value A4゜=0.12, ((A4 Approximately 3 times the wt normal serum control mean value) is taken as positive. ] Example 3 The method of Example 2 was repeated by adding 1 mg of heat-insolubilized NP40-NP40 solubilized H per well to the wells. The same serum sample as in Example 2 was used, except precoated with TLV-1. Determination of HTLV-1 or HTLV-n by repeated immunoradiometric assay (IRMA) Antibody detection Flexible polyvinyl chloride (PV) 96-well wells, 1.5 m per well g of at least one peptide of the invention (100 ml of 10 mM Na1-ICO *Mixture in buffer, pH 9.5) at 4°C overnight (or at room temperature for 3 hours) period) to cover. Wells were washed 3 times with phosphate buffered saline (PBS), then 3 Incubate with 250 μl of 3 wt% gelatin solution in PBS for 1 h at 7°C, Block specificity protein junction sites, then add Tween 20 at 0.05% by volume Wash 3 or more times with PBS containing.

Test serum (collected from blood from human patients or normal individuals) was added to PBS (20 volumes). % normal goat serum, 1% gelatin by weight and 0.05% Tween 20 by volume. (containing) at a volume ratio of 1:20 and 1:2000, respectively.

Add 200 ml of diluted serum to each well and incubate for 1 hour at 37°C. . Wells were washed three times with 0.05 vol% Tween 20 in PBS to remove binding. Excludes antibodies. l-125-labeled affinity purified goat anti-human IgG ( Fc) is added to the second antibody that is bound to the antibody-antigen complex formed in the positive well. Use as a body tracer.

1 vol% normal goat serum in PBS, 0.05 vol% Tween 50 in Tween 20, 100 μl of 1-125 labeled goat anti-human IgG at 000-200,000 cpm was added to each well and incubated at 37°C for an additional hour.

Wells were washed 5 times with 0.05 vol% Tween 2o in PBS to remove binding. Remove the second antibody and dry.

Wells are cut and counted in a gamma-scintillation counter. The test is Two runs are performed using a 1:20 volume ratio dilution. Normal serum test as negative control The materials will also be tested at the same time. Greater than [average reading of normal serum sample + 4SD (standard deviation)] A high cpm reading is taken as a positive solid-phase immunosorbent for the present invention. Gelatin granules, red blood cells or cells from different species of animals, coated with a type of peptide. HTLV-I or HTLV- by hemagglutination using Tex beads Detection of antibodies against 1 [.

Thoroughly washed red blood cells, gelatin particles, and polystyrene latex beads were placed in a 5 m A small amount of the peptide of the invention at a concentration within the range of g/m 1 to 1 mg/m+ Covers at least one type of spider.

Cells, particles or beads coated with the peptide mixture are then placed in a 96-well U-shaped well. Incubate with serially diluted serum samples in the wells of a microplate. room temperature After leaving it for about 1 hour, read the agglutination reaction pattern at the bottom and indicate a positive reaction. Record the highest dilution shown.

This refers to HTLV-1 or HTL in specimens containing serum or biological fluids. Can be used for both qualitative and quantitative analysis of the presence of antibodies against V-II. It is a one-step test method that can be used.

Example 6 Consists of multiple 96-well U-shaped microplates and compartmentalized enclosures containing materials. or (1) red blood cells coated with at least one peptide of the present invention. bottles containing blood cells, gelatin pellets or latex polystyrene beads; (2) normal human serum (as a negative control); and (3) heat-inactivated serum positive Blood clots consisting of HTLV-1 or HTLV-II serum (as a positive control) A third test key for HTLV-1 or HTLV-II detection using Kiki. The method described in Example 2 is followed.

Example 7 A diagnostic test kit for detecting HTLV-1 or HTLV-II antibodies can be constructed. Ru.

The test kit consists of a compartmentalized enclosure, which contains 100 ml of pH 9,5 of at least one peptide of the invention in a buffer solution. Multiple 96-well plates were coated with 1.5 m per well prior to use. Including root.

The kit further includes (1) normal human serum (as a negative control): (2) Heat-inactivated HTLV-1 or HTLV-I [seropositive serum (positive vs. as a light); (3) normal goat serum; (4) peroxidase labeling-goat anti-human IgG; and (5) Discoloration of orthophenylene diamino (OPD) in phosphate citrate buffer Consists of materials for enzyme detection in separate enclosures of indicator and hydrogen peroxide.

This method follows the method described in Example 2.

In this test, 96-well plates precoated with the peptides of the invention were Polystyrene beads precoated with peptides of the invention for use as peptide adsorbents or multiple mini-columns or nitrates packed with glass beads of controlled pore size. Can be replaced with cellulose strips.

Example 8 A second test to detect antibodies using the immunoradiometric assay (IRMA) The kit comprises a compartmentalized enclosure, and the enclosure comprises at least one of the present invention. One type of protein was added to 100% of 10mM NaHCOs buffer at pH 9.5 per well. Multiple 96-well flexible polysalts precoated with 1.5 mg protein in mM (1) Normal human serum (as a negative control); (2) Heat-inactivated HTL V-1 or HTLV-If seropositive serum (as positive control): (3) normal goat serum; and (4) Radioactive immunoassay containing I-125 labeled goat anti-human IgG Consists of materials for sei.

This method follows the method described in Example 4.

This test kit consists of a 96-well PVC plate precoated with the peptide of the invention. The polymer was precoated with the peptide of the present invention for use as a solid-phase immunoadsorbent. It can be replaced with styrene beads.

Human T cell 9 cells 8 Infections caused by type I) and type II (HTLV-II) have been detected worldwide (Man. and Blattner, Transfusion, 31:67-15.1991).

HTLV-1 causes mature T-cell leukemia (ATL) and HTLV-1-associated myelopathy (R AM); which specific disease is HTLV-It definitively associated with? Hairy cell leukemia (hairy cell leukemia) Senblatt et al. ,N. Engl, J. Med, 313:372-377, 1986).

The lack of a serological test method that can easily distinguish between HTLV-1 and HTLV-II is due to the Advise those testing seropositive for HTLV clinical correlation has been difficult to establish.

Molecular methods such as polymerase chain reaction (PCR) amplification and HTLV-II (Cl. Off et al. .

J. Infect. Dis, 158:1193-1197, 1988: Riichi et al. ．． , 5science. 244:471-475.1989).

Studies using these methods have shown that as a high-risk group for HTLV-II infection, The number of intravenous (IV) drug users has been limited (Riichi et al., 5science, 244 : 471-475, 1989: Vanir et al. , JAVA, 265, 597.1 991).

Analysis of HTLVT serum-positive blood donors in the United States indicates that approximately half of infected individuals This indicates that the patient is infected with HTLV-II (CDC.MMWR, 3.9). , 9 1 5, 921-924.1990. Sandra et al. , Yale J. B iol. Med. , 63:353-380.

1990, Fujinire et al. , J. Infect. Dis. .

163:435-440.1990), and more recently, HTLV-I [infection Raw Guaymi Indians (Lermore et al., Proc. Na t1. Acad. Sci. USA, 87:8840-8844.

1990, Hennein et al., N. Eng1. J.Med., 324,565.1 991), Navuajico and Pueblo peoples of New Mexico (Fujinire et al., J. In. fect, Dis, 163:485-440.1991), and of Florida. It has been shown to be endemic in the Zemil Indians (Levinet PH et al. 9, unpublished). This suggests that HTLV-n infection has been prevalent among American Indians for many years. This indicates that it was an endemic disease. HTLV-1 ga, pol and eny The human immune response to structural proteins encoded by genes is well characterized. (Poker et al., J.

Immunol, 142.971-978.1989; Essay) pp. 461-467, Plenum Schuppan, New York 1991), for HTLV-II protein. Little is known about the antibody responses that occur.

HTLV-II" identified by synthetic peptide ENV 21@7-116 1v two genetically dominant epitopes 1-46.1991) or recombinant protein Quality RP-11B"@"" (Chen et al., Lancet, 336.1153-1 155.1990) it, humans infected with both HTLV-1 and HTLV-II showed a significant reaction with the antibody.

HTLV-π envelope glycoprotein (Citroski et al., 5science, 2 25:421-424.1984) to further identify the structural motifs of H Peptides of various lengths spanning the TLv-m”’glycoprotein were synthesized. Linear epitopes recognized by antibodies from patients infected with HTLV-It The group was identified.

More specifically, the human T lymphocyte-tropic virus type II (HTLV-I [)] A series of synthetic proteins derived from envelope glycoproteins Used in enzyme immunoassays to determine genetically dominant epitopes of proteins be done.

10 synthetic peptides spanning the circumferential glycoprotein of HTLV-II (gp 52) 4 from Tide and transmentulan proteins (gp21) and gp5 3 proteins from 2 (ENV-20”-l-ENV-202ITS-1@ I and ENV-203"ll"".'I it, confirmed by most PCR HTLV-IF specimens (83%, 95% and 76%, respectively); all reacted minimally with these specimens.

ENV-20°-182 (73% to 100%) or ENV-203”- ! Compared to 11 (sa% to 83%), ENV-202! 1 is a vein Internal medicine misuser (n=30), North American Indian (n=13), Gua from Panama Including Immi Indians (n=22) and routine blood donors (n=34) A larger percentage (91% or more) for samples from different risk groups. 100%).

Further i: ENV-20’″-112 TOE N V 202 ITS-!@@ Ha, Although there is minimal reactivity with serum from individuals infected with HTLV-1, ENV-2 Reacted 58% with 03""-"'1iHTLV-1 specimen.

Wow, peptide ENV-20”-”” and ENV-202”-! Il is H We conclude that the TLV-II peripheral glycoprotein represents a type-specific, genetically controlled epitope. did.

Example 9 Materials and methods human serum specimen 1, including 123 HTLV-1/n seropositive and 22 routine blood donors. Forty-five serum specimens were selected for this study (Table 3).

Table 3: Characteristics of the serum samples studied HTLν^b” PCR analysis region Group Number of subjects (gag & env) HTL Sea I HTLV-I+ Blood donor 5B + 24 34 Mixed IV drug user 30 + 0 30 America American Indian Guaimi 22 + 0 22 Panama Seminole 4 + 0 4 Florida Napaji! + 4 + 0 4 2l- Mexico Bufu mouth 5 + 0 5 ni Mexico normal donor 22 N mouth NO7 Merica, 24 saw and gp4 Serum determined by antibodies against 6"' and/or gp68 l'Iv Positive.

The 123 seropositive individuals were of various geographic origins and risk factors, and 58 human blood donors, 3 o V drug users, and 35 American Indians. (22 Guaimi Indians from Panama, Zemil Indians from Florida) Ann, and four Navuajico Indians and five Pue from New Mexico. including Bro Indians). None of these specimens were HTLV-1 or HTLV-H. Both were from uninfected individuals.

polymerase chain reaction All serum specimens were DNA derived from peripheral blood lymphocytes from these individuals. HTLV-1 or HTLV-I by polymerase chain reaction performed in The trochanteric region from I was amplified using the L sequence and tax/rex primers, and hybridization with oligo probes end-labeled with ITp from each region. did. Hybridized products were subjected to electrophoresis and autoclaving as previously described. I did traradiography. (Kuok et al., J.

±nfect, Dis,, 158.1193-1197°1981 Riichi et al., 5 science, 244:471-475.1989) Specimen, tax/ HTLV-1 and HTLV-1 based on type-specific amplification based on both the rex region. It was classified as II.

Reference HTLV antibody test Serum specimens from all patients were LV-1/I[-positive] according to the manufacturer's guidelines. It was decided that

-1111・赫-) FF ``6g/ζ no l1EEda'' was identified. (Labo and Griffs, in press, 1991) was first tested. synthetic pepti 9-fluorenylmethyloxycarbonyl (Fm OC) Chemistry Mjllgen 9050 Bev Synthesizer (Mjllgen 9 050 Pepsynthesizer).

Quantitative enzyme immunoassay for antibiotics against synthetic peptides (E1 person) Polybiocytes were used to detect antibodies against synthetic peptides as previously described. Nilplate (Ino50n■, Dynatic Laboratories, Inc., (Bar) ) in 0.01 M carbonate buffer, pH 9.6. of synthetic peptides (Env-202, Env-203, Env-20 4, 5 mg/ml for Env-208 and Env-212, all other Peptides are coated at 100 mg/ml. ). 0.0 that plate Phosphate buffered saline (PBS) containing 5% Tween 20 (0,05% Wash six times with Tween 20 (PBS-T) and then each well with PBS-T). Incubate with 200 μl of 3% bovine serum albumin in BS-T for 1 hour at 37°C. Warm to block excess reaction sites. After washing the wells, dilute 1:20. Each test serum was added to two wells and the plate was incubated overnight at 4°C. Then p-nitrophenylphospade substrate (Sigma) is added. plate ELIZA reading (SLT Love Instrument, based in Australia) is 40 Read at 5nm. Each serum specimen was tested with BSA alone or for nonspecific antibody binding. and coated with an unrelated synthetic peptide for control.

Seropositivity is defined as any value greater than (mean value of normal controls + 2 x standard deviation). Also define.

result Non-competitive EIA was performed on HTLV-II (n = 99) or HTLV-1 (n = 2 ．． 4) antibodies in infected humans or in normal blood donors (n-22) Initial analysis of synthetic peptides for detection revealed three major domains with strong reactivity. was identified (Table 4).

Table 4: Synthetic peptides derived from the envelope glycoprotein of HTL Sea II. Seroreactivity of Peptide a, a sequence Serum reactivity” n=30 (Hanbe sex) p46 Env 4 3-19 NVPFLLLP SLT) IPPI, AQ 2(7)E nv 7 45-60 TWNLDLNSLTTDQRLH3(10)Env 20 85-102 KKPNRQGL [1YYSPSYN Exit P22 (73) [ ! nv 21 120-135 YTGPν5SPSIIKPHSDV 5 ( 17) Env 202 173-209 TSEPTQPPPTSPPLνHD SDLEHVLTPSTSSWTT to ILKP 29 (97) Env 2 187 -209　ν)l[]sDLE)IVLTPSTSwTTKILKI'　2B( 93) F, nv 203 219・-256YSCMνCν[1R8SLSSW IIVL, YTPNISIPQQTSSRTILPPS 18 (6O) Hnv 204 232-255 SWHνLYTPNISIPQQTSSRT ILPP 3 (10) nv 22 261-277 ＾PP5QPPPIIT HCYQPRL 2(7) Env 23 274-289 QPRI, QAIT TDNCNNSI 3(10)gp211In' Env 24 296-312 L^PVl’PPATRRRAVPI 1 ( 3) Env 208 361-369 1 (QNILRVAQ 3(10) En v 25 369-384 ^QYAAQNRRGLDLLFII 3 (10) 已nv　212　397-408　CFLNISNT)IVsν　2(7)゛Blood A positive result was determined as a value greater than two standard deviations from the mean value of the normal control.

N-terminus of gp52 as represented by peptide Env-20''-1@ff The epitope located at the edge was found in 73 samples collected from patients infected with HTLv-■. % (22 out of 30). Peptide E nv-2021ffl-11 A second CVX vitobe located in the central region of gp52 as represented by , reacted with 9796 (29 out of 30) of the HTLV-In samples. Env-2 Deletion of 13 amino acids from the N-terminus of 02 (Env-211ff-′@I) has some loss of activity (93% = 30 HT L,V-It serum 28). Peptide E nV 203 located at the C-terminus of gp52 The third epitope defined by lll-11@ It reacted with 60% (18/30) of the serum from patients. The main reactivity of this epitope is the smaller peptide Env-20411! -III to HTLV-In specimen It was placed at the N-terminus because it had the least reactivity towards. HTLV- ngll! or all other peptides derived from HTLV-II"" had minimal reactivity to serum samples from TLV-II infected patients (Table 4 ).

Immunodominant epitope (Env-20""", Env-202171-III, To further study the heterogeneity of biological responses to Env2031+8-160) For this purpose, serum samples and risk factors of patients from different geographical origins were evaluated (Table 5).

Table 5: Synthesis of 1-ITL Sea II Envelope with Antibodies in 1ITL Sea-Seropositive Sera Recognition of peptides Group Env-208nv-202 [! nv-203HTL sea I+ infected person Blood donor 27 (79) 3H91) 23 (68) IVDII (n:30) 22 (73) 29 (97) 25 (83) American inch Panama (n=22) 22 (100) 22 (100) 1B (82) America (n=13°) 11 (85) 12 (92) 9 (69) Total (n=99 ) 82 (83) 94 (95) 75 (76) HTLV-1 infected person Blood donor (n=24) 2 (8) 6 (25) 14 (58) Normal donor (n =22) 0 0 0 4 in this sample are Flock's t minor Indian anchor A et al., 4 and 5 are from the Navajo Indian and Pueblo Indians of New Mexico. .

E nv-2021ffl-2el is mostly isolated from patients infected with HT L V-II. 91% of blood donors, 97% of drug users, 100% of Guaymi Indians and North American Indians. 92% of B nV21@ff-! @* indicates high serum reactivity. (data not shown). En　v　2　Q　l　to1 6” is 79% of blood donors, 73% of drug users, and 1% of Guaimí Indians. 00% and 85% of North American Indians: Env-2032 1-""1 is 68% of blood donors, 83% of drug users, Guaimi Indians and 69% of North American Indians. Env-20, What are the specific differences in the antibody profiles of Env-202 and Env-203? It was not recognized at all among any research group.

High seroreactivity of HTLV-n specimens to these peptides (62%-100 %), we then determine whether they may express format-specific epitopes. We evaluated the squid. Env-20, Env- for the corresponding region of HTLV-1 Structural analysis of the main amino acids of Env-202 and Env-203 revealed variations in homology. (78%, 43%, and 57%, respectively) (Figure 6). HTLV-n test Another analysis (Figure 7) regarding serum reactivity to Env-20 and Env -202 has the lowest reactivity with low optical density (8% and 25%), Env-203 has sufficient reactivity (58%) with high optical density. ). In 22 healthy blood donors, what It did not react with any of the peptides at all.

discussion It is equally prevalent in blood donors in the United States as in HTLV-1. Expression of HTLV-■, a virus [Sandler et al. Vale J, Biol.

1 Jed, 63: pp. 353-360, 1990) This is important not only for devising but also for understanding host-virus interactions. It was necessary to define possible immunodominant epitopes. In this study, we There are three types recognized by serum antibodies in most HTLV-II infected patients. identified an epitope.

Env-20”-II! located at the N-terminus of HTLV-II It reacted with 83% of sera from II-infected patients. Surprisingly, HTLV-1 Despite the sufficient homology of Env-20 to observed for the body (Fig. 6). Detailed mapping of Env-20 has not been performed. However, the antibody binding site is probably a homologous region between Env-20 and HTLV-I. It is expected that the region consists of amino acids that are not observed between the two regions. HTLV Peptides (a, a, 89-110) from the homologous region of the -1 envelope are HT Contains an epitope that reacts with LV-I positive serum [Horal et al. Human Retrovirology: HTLV (Human Retrovirology) :HTLV) (W, A, Blattner) edition), pp. 461-467, Blenheim Publishing (P1enu+a Press, ) New York, 1990], and other peptides from this region (sp. 2. a.

Polyclonal antibodies raised against a, 86-107) are syncytial inhibitors. Neutralizes HTLV-1 for both analysis and HTLV-1 pseudotype analysis [Palker et al., “In Human Retrovirology] Fluid organization: HTLV (Current l5sues InHuman Retrovirology:) ITLV) Montego Bay (MonL Ego Bay), Jamaica, February 10-14, 1991. ].

Reacted with 95% of HTLV-It infected specimens and showed minimal reaction with HTLV-1 specimens. Env-20201-111 that responded was the most dominant HTLV-It external glycoprotein. It was a type-specific epitope. HTLV-I [Central area of envelope immunodominance has been previously reported [Lal et al., J. Inf. ect, Dis,, 163. Pages 41-46.

1991; Chen et al., J. Virol, 68. No. 495 2-4957, 1990). Recombinant protein R containing amino acids 96-235 P-IIB reacts with all HTLV-■ sera, but not with HTLV-I sera. It also reacts with 65%. We previously introduced the peptide Env-2 (a).

a, 187-209) used a large number of HTLV-II sera and several cross-sections to reported that it reacts with TLV-1 (Lal et al., J. Infect, Dis,, 163. pp. 41-46, 1991) o En v -20 The additional 13 amino acids at the N-terminus of 2""-"" compared to Env-2. significantly increased the specificity of its reactivity. Larger peptides probably This would change the conformation of the epitope so that it no longer recognizes the HTLV-I specimen. cormorant. Because of this high seroreactivity and format specificity, EnV-202 To develop an assay that can serologically distinguish between I and HTLV-II. [Viscidi et al., J.A.], which has recently been successfully used in cquir, Immune, Defic, 5yndr, (currently in print)) , the central region of the HTLV-I glycoprotein can also be expressed by recombinant proteins such as MTA-4 [rib Lfpka et al., J, Infect, Dis, 162° No. 35 3-357, 1990] and RP-Bl''-!01 (Chen et al., Lan cet, 336. 1153-1155, 1990) or synthetic peptide analogy ba SP 4 a” 卜! ■ [Palker et al., J, Imm unol, 142: pp. 971-978, 1989] and Env-1 ”’-t+i (Lal et al., J. Infect, Dis,, 163. 4th 1-46, 1991). showed major seroreactivity against infected patients. In addition, 3p 4 allll- The epitope defined by 41@ is furthermore a neutralizing epitope [Ralston ( Ralst.

n) et al., J. Biol, Chem, 264. No. 16343-16346 Page, 1989], Human Cytotoxic T Cell Epitopes [Jacobs. on) et al. + J, Immunol, 146°, pp. 1155-1162, 1 991], and murine helper epitopes [Kurata et al., J. , Ima+uno1. .

143: No. 2024-20fllO, 1989].

The third feature represented by E ny -2,032I 1211 is HTL It reacted almost equally with V-n and HTLV-I. a, a, 232- A smaller peptide (Env-204) with 255 The antibody binding region of Env-203 is directed towards the N-terminus as it has minimal reactivity. It is clear that it should be placed as follows. Format specificity of HTLV-I external glycoprotein The immunodominant epitope is the envelope protein (Bnv-5141-!i?) mapped to the C-terminus and subsequently on the cell surface of HTLV-1 infected cells. [Lal et al., J. Infect, Dis. , 163°, pp. 41-46, 1991; J, Gen, Virol, + (currently in print)].

Four synthetic peptides derived from the semipermeable membrane protein of HTLV-1 -II did not show sufficient binding to serum samples from infected patients. As little is known about the immunogenicity of HTLv-■ semipermeable membrane proteins, Replacement RP p@1l-486 (chiz”/etc., J, Virol,, 63, 4952-4957, 1989), rgp215et-t4@(Samuel Samuel, 5science.

226. 1094-1097, 1984] and Synthesis TN 101 I 7to4・Fist [Vissidi et al., J, ^equir, immune, Def ic, 5yndr, (in press)] are all HTLV-1 infected patients and HTLV-1 infected patients. It showed reactivity with serum samples from both LV-II infected patients. HTLV- For detecting antibodies against synthetic proteins from similar regions of It semipermeable membrane proteins. Our inability to do so may be attributed to the small dimensions of the peptides used. . Conversely, the conformation of a peptide once bound to a solid phase means that it no longer interacts with antibodies in serum. It may be something that does not react. Env-25@@@-*@4 is lymphocyte Proliferation (Ruegg) +J, Virol, 63, No. 325 0-3256, 1989] and immunoglobulin secretion [Mitani i) et al., Proc, Na order, Acad, Sci, USA, 84. Second pp. 37-240.

[1987] and represent a putative immunosuppressive region that suppresses both The active site for suppressing bulb proliferation is 10 amino acids (AQNRRGLDLL) mapped as (Rue's r J, V+rol,, 63 r No. 3250 -3256 pages, 1989).

One practical aspect of these perceptions regarding the immunodominant region of the HTLV-4 external glycoprotein Its use would be in the development of formal specificity analysis. Therefore, Env-20--181 and Env　2021　’　I-*　8　@ Two of them represent 1-ITL type V-Wataru-specific epitopes and H Distinguish between infection with TLV-11m and infection with TLV-n. could be used in combination to develop a serological analysis of the disease.

To better understand the clinical significance of HTLVI''-, isolated HT A group of low-risk blood donors in the U.S. Army with LV” reactivity was identified. All viral antigens and immunodominant epitopes of HTLV-I and HTLV-II was evaluated by a number of serological analyses, including:

Its presence in the viral DN in the genome is due to polymerase chain reaction [this is , rapidly and directly extracts viral DNA through amplification of specific viral sequences in blood samples. Direct detection (Lee et al. + 5science + 244: No. 47 pp. 1-475, 1989: Kratt. et al., J.

Infect, Dis, 158, pp. 1193-1197, 1988 )] was analyzed. In Example 10, having the HTLV"' pattern Analysis of blood donors reveals immunodominant epitopes of HTLV-I and HTLV-II According to HTLV antibody enzyme immunoassay using synthetic antigen showing HTLV-I or I] TLV-I [showed no evidence of infection .

Of the 267,650 blood donations from United States Army personnel, 27 (0,01 0%) against human T-lymphocyte virus, type-I/n (HTLV″″°) 879 (0°14%) were confirmed to be positive by serology. Limited to proteins encoded only by the g gene (HTLV'm'). The Western plot (WB) using the determined binding pattern was indeterminate.

These apparently healthy HTLV''' blood donors may be infected with HTLV-1 or HTLV- from 73 said Army blood donors to determine whether they were infected with The coded samples were analyzed using Western plot and HTLV-I (MT-2). and by radioimmunoprecipitation analysis using HTLV-II (Mo-T) antigen. by enzyme immunoassay using synthetic peptides representing immunodominant epitopes of HTLV. Polymerase chain reaction for HTLV and DNA sequences was tested for antibodies against HTLV.

73 people (7) HTLV”’ provider know, HTLV-I or HTLV-Il , WB and RIPA showed no env reactivity. minimum The reactivity of env proteins (Env-1 bird-1-111, E nv5 ff42 -417゜Env-2''-1■, and Env-20''-'''') and gag Protein (Q agl aI@!-11?, and Gag-16*@4-**** ) was observed using synthetic immunodominant traits derived from . HTLV (class) g Endogenous retroviral sequences with structural homology to the ag protein (RTVL a s・) not only expressed antibodies against one sample of HTL and V′, but also expressed antibodies against normal It also reacted with the irradiating substance. In addition, 73 HTLV'' specimens had pol and tax/ (when amplified in the rex region) does not show any presence of the ITLV gene. It was. Six to 23 months after initial testing, 23 specimens still had similar WB. Given the pattern, the 9 re-analyses were still negative for the presence of the HTLV gene. It was sex. Therefore, even if infected with HTLV-I and HTLV-■, HTLV '''1 Low risk for HTLV infection with Western plot reactivity People are rare.

Judgments for seropositivity are determined by the United States Public Health Service Working Group. Group (Public Health 5service Working 9240g and gp46 fist and/or Or serum samples showing reactivity to gp61/68″my are HTLV-1/■ can be considered seropositive for and radioimmunoprecipitation analysis (RIPA) for gag and env. used to visualize antibody reactivity [Anderson et al. , Blood, 74. Pages 2585-2591.

1989, CDC, MMWR, 39: 915. pp. 921-924, 19 1990] ; any test system lacking the above-mentioned sufficient arrangement of bands. This pattern can be considered as Western plot indeterminate (HTLV'°4). That's what I mean. The test for blood donors in the United States is A positive plot indicates a low seroprevalence of 0.01% to 0.025%. [Anderson et al., Blood + 7L, pp. 2585-2591, 1 989; Sandra et al., Vale J, Rial.

Med, 63: pp. 353-360, 1990]. However, the initial More than 50% of the E1-reactive specimens were found to be HTLV-1″1 in WB analysis. showed responsiveness to one or two band characteristics [Sandra et al.

Vale J, Biol, ued, 63: pp. 353-360, 199 Hartley et al., 28: pp. 646-650, 199 0 years). (due to the importance of the remaining reactivity, the direct groove reaction Retrospective studies on recipients of sexually transmitted blood revealed that the recipients had HTLV-I/n It showed that the test result was negative (Shih et al. + Blood + 75: pp. 546-549, 1990].

Example 1O Method Reference HTLV Autologous samples from all blood donors were collected using the first approved enzyme-linked immunosorbent. assay (i ■-unosorbentl () ITLV-I engineering + J the (EL) Recommended by the manufacturer (ISA), DuPont, Wilmington, Germany) HTLV-1/II antibody testing was performed according to the procedure. Samples with repeated reactivity The WB-purified recombinant envelope (r21) was injected into HTLV-1-infected cell lines. In, HuT-102 (Cambridge Biotech, Rockville) MT- By using lysates from two cell lines (Cambridge) and incorporating , did further testing. HTLV structural genes with at least two different antibody reactivities products (gag p24 and env gp46 and/or gp6B) determine whether the serum sample is HTLV-positive or not. did. If WB exhibits at least one IITLV-I/II band characteristic, (p19, p24 or gp46) If the criteria for a positive result are not met, then The results of this analysis are inconclusive for HTLV-I/II (HTLvl''' )it is conceivable that. Samples with HTLV11 pattern were from the Mo-T cell line. Further analysis of WB and RIPA containing induced HTLV-II antigens did.

proof JLI5 Between December 1988 and April 1991, approximately 26 7650 units of blood.

Waiter Reed Army Medical Center, Washin Antibodies against HTLV-1/II were tested in 1999.

Of the 2676501'll donations, 2376 (0.89%) were fermented from the beginning. The primary immunoassay was reactive and this was used for serological confirmation of HTLV infection. was tested by Western blot and RIPA (Table 6).

Table 6 = Army Blood Donors) ITL Sea[/I + Immunoassay and PCR Results] Fruit 11B/RIPA results PCR results Variable Initial 3-23 After 3-23 months Initial 3-23 After 1 (TLVP” 72 (0 ,027) )ITLv-r 43 30 36/36 28/28HTLV-412925 16/16 13/13) ITLV”d 379 (0,14) 23 0/73 0/9 p21 + p19 + p24 + 4 NOO/3 N.

p21 + p19 + p24 + to NOO/I N0p21 + p19 +p24 + 7” NOO/4 N0p19 +p24 + 28 2 0/ 10 0/1p24 + 61 5 0/12 0/2p21 + 12 N mouth 075 N mouth p19+ 257’ 16 0/38 0/6HTLV “e” 1925 N mouth O/26 8 mouths 1 some unspecified bands 28KO and 128 samples with 01 and p19 bands in 26 21 (Samples from IV infected persons) Of these, 72 are HTLV"" (0,027%) and 379f[l is HTLV"', and 1,925 samples did not show any virus-specific bands. There was none (HTLV mouth 1).

8 Hebutid ゛ Synthetic peptides derived from HTLV-1 and HTLV-11 sequences are n v -1”’-”” (HTLV-1, LPH3NLDHI LEPS I PWKSKLLTLV), Env-21@4-16@(Summer (TLV-Il, V) IDSDLEHVLTPSTSSWTTK ILKF), Env-5"" ” (HTLV-1, 5PNVSVPSSSSTPLLY), Env-201- "" (HTLV-Il, KKPNRQGLGYYSPSYNDP), Gag- 1, all′”-eyes (HTLV-I, PP5SPTHDPPDSDPQ1) , Gag -10"'-"' ()iTL, V-II, G HWSRDCT QPRPPPGPCPLCQDP) and HT　LV　V　”Tamper Contains a histidine tRNA primer binding site with sequence homology to the C-terminus of protein. The endogenous retrovirus containing the peptides was synthesized by FMOC chemistry, and Antibodies against Tide were tested as previously described (La1. et al., J. Vir. ol,, 65: 1B7 (1-1876°+9911, simply put, poly Vinyl plate (ImmulonIl, DynaLech Laborato ries, Inc., Alexandria, Virginia) to 0. old μ carbonate slow Coated with 50 ml of synthetic peptide (100 ug/ml) in solution, pl+ 9.6 and cultured overnight at 4°C. The plate was washed with 0.05% Tve containing PBS. Washed 6 times with en-20 (PBSS-T) to remove excess reactive sites. 1+20 dilutions of each test serum blocked by addition of 3% BSA in BS-T. This was followed by the addition of 1000 ml and the plates were incubated overnight at 4°C. 6 washes After that, the goat antibody was conjugated to human IgG with an Fc-specific, alkaline phosphor. Ze (Sigma.

St. Louis) and p-nitrophenyl phosphate (Sigma) group. This is followed by the addition of a nstrument, Austria) at 405 nm. serum positive sex (ser.

pnsitivity) is typically greater than the mean of the control + 211 standard deviations. Defined as a value.

to polymerase Amplification and detection of HTLV sequences by PCR was performed in a blind manner using performed on DNA samples from donors (n=52) and HTLV” donors (n=73). became. Two gene regions (L9Li and tax-rex) from each patient were PCH was grown using conditions previously described (1.ee et al., 5ci ence, 244 2471-475.1989; Kwok et al., J. Infect, Dis, 158: 1193-7.

1988), briefly, 50 ml of cell lysate was added to IX PCR jil buffer. (50 nM KC1, 10yaMTr i 5-11c l.

p) 18.3, 0.1 + wg/ml geladin) with dNTP, primer, and Added to 50 ml of reagent mixture containing 1 polymerase (all 2X) . The optimal concentration was determined as follows. dNTP 200 tau each; Bly 7-0 ．． 5. M each; 1 IU of polymerase, and 1.25 μM of MgC1*, increased The cultivation conditions were as follows. Denaturation at 94°C for 90 seconds; denaturation at 58°C for 2 minutes. Knealing: Extensin for 1 min at 72°C, PC for 40 cycles Add 10 ml of the B product to the 0P end-FIi! in solution. Oligonucle subtidobu Hybridization was carried out at 53°C and 45°C, respectively. primer pair and the 5°-3° sequence of the probe is the HTLV-I sequence (Genbank rating N o, JO2029) and HTLV-II sequence (Genbank evaluation No. Based on MIO060), it is as follows.

5KIIO (1 standing Yu, HTLV-1""-"", HTLV-II""-"" )-CCCTACAATCCAACCAGCTCAG; 5K111 (L9L i, HTLV-I""-"",) (TLV-IT41O-""')-GT GGTGAAGCTGCCATCGGGTTTT, SK 112 (, Ho1 , HTLV-1””-””)-GTACTTTACTGACAAACCCG ACCTAC: SK 188 (Aol, HTLV-II’°’-”” )-TCATGAACCCCAGTGGTAA, 10% hybrid product Electrophoresed on polyacrylamide gel and autoradiographed .

A second expansion was performed in the previously described tax rex region. simply Briefly, 50ml of cell lysate was injected with 5"-labeled primer 2X10'cpm, d NTP (5o + 1M), TL! L polymerase (2,5tJ), and MgCl* (1.25mM) was added. The primer used was Txl (tax rex, HT L V-I””-””.

HTLV-II"4m-"")-CGGATACCCAGTCTACGT: and TX2 (tax rex, HTLV-I) 4-74”, HT L V -11T4"-Ma■")-GAGCCGATAACGCGTCCA It was TCG. Growth conditions were as above, except that the annealing temperature was 55°C. It was the same as described in . The propagation product was digested with restriction enzymes and 5au 3A and electrophoresed the product on an 8% polyacrylamide gel. , and autoradiography. HTLV sequence is part of both primers A sample is considered positive for PCH if it is detected by PCH. if, If the sample is positive for one of the two growths, the third growth is positive. The cells are labeled with each of the two primer portions to determine whether the cells are positive or negative. If no HTLV sequences are detected when analyzed in duplicate for P. It is considered that the patient is HTLV negative due to CR.

Results western plot pattern The most common uncertain band pattern is a single band (257/379.6 8%), a single band at p24 (61/379.16%), $)19 and and p24 band (2B/379.7%), p19 and/or p24 band (2B/379.7%), , a band with reactivity with rgp21 (21/379.5.6%), and rgp21 This was followed by a single band at p21 (12/379.3%), followed by HTLy1mg protein. All samples without turns were HTLV-■ lysates and HTLV-11 In HTLV-[WB or RIPA analysis using both lysates, showed no envelope reactivity.

Western blot analysis was performed between 6 and 23 months after the first hemorrhage. Repeated in 23 sets of 379 IITLV" samples. Of 23 labeled samples. For 21 of them, no difference was observed in the band pattern, p19+p2 One of the samples with the 4+ pattern lost p24 reactivity, and the ple+ sample One of them obtained r21+ reactivity upon rebleeding.

The affinity and binding activity of antibodies in oral serum to the LM epitope are , affecting detection in standard serology assays using whole virus lysates. 1 (synthetic immunosensor of TLV-I and HTLV-II). determined by the structural motif. 92% to 9 of those infected with HTLV-I (9%) (TLV-I-specific 1-YE-E-vitope (Env-11111-Ill)) and E n v -514''-Umugi 1), a small reactivity (0 12%) was observed for samples with HTLV''/(turns (Figure 8). , similarly, 75% to 96% of those infected with HTLV-11 -II specific! Danyu epitope (Eny-2+at-3′′@ and l: During the reaction with nv-2Q @l-1111), the minimum reactivity (0 to 12 %) h month (TL g-1a”-zt), and from the N-terminus of pis (Ga g-10”’-3 0) Analysis of derived synthetic peptides shows 65 to 95% difference with HTLV samples. It showed reactivity. HTLV” samples, 23 of those with p19 band % reacted only with Gag-1a, all other samples reacted with Gag-1a or Gag-1a. It had the lowest reactivity of 10.

In addition, the expression of endogenous retroviral gene products is expressed by the HTLV g” protein. Provide antigenic stimulation for potential producers of antibodies that may be cross-reactive with quality. HTLV- 1 and HTLV-11 (7) C-terminus (RTVLwag ) However, it has a histidine tRNA primer binding site) (RTVL-H). do. Peptides derived from endogenous retroviral elements were synthesized. Also, H While reacting 88% of the TLV'' sample with this peptide, HTLV'' Between 42% and 66% of the serum samples from the samples were reacted with RTVL''. However, further analysis of the HTML samples revealed that 60% of these samples was also shown to react with this peptide.

' of HTVL DNA.

The existence of HTVL DNA or Peripheral blood lymphocytes were analyzed by PCH to determine the absence. ply Mer pairs were selected from the 2 and 15 ZL tan Δ regions, both of which were and highly protected in HTLV-II. The area from LAJL and 1 Yue is , with endogenous retroviral sequences and variations in various isolated sequences. Due to their sequence homology, they have not been able to proliferate.

According to previous studies, primers from Ldanyu and 115ZanyΔ regions are both , was very sensitive in identifying HTLV” samples (52 HTLV ), all of the 15 HTL V” gave detectable signals. "None of the samples gave a detectable signal. 15 IITLV" None of the samples reacted with any primer/probe combinations and These are used to check the retention properties of the primers, and they have various band patterns. Of the 73 HTLV''-samples (Table 6), none of the primer/probe pairs did not grow products with combinations. Regarding the nine HT　V　V　’ samples PCR analysis of repeat samples drawn 6 to 23 or 8 times after the original test It did not show the presence of HTLV gene in any of the samples.

discussion Serological confirmation of HTLV-1 and HTL, V-11 infection is l! -JL and l Depends on the presence of antibody reactivity against the gene product [Anderson et al. erson etal, ), B1o Yut 74: 2585-91,198 9; CDC, MMWR, 39:315.921-924.1990). these Overall, a total of 72 cases were used, giving a seroprevalence of o,027%. The donated blood (0°027%) is HTLV positive. specific oligopeptides and Another analysis of these seven positive specimens by classifying oligo primers 43 were infected with HTLV-■ (60%) and therefore 29 were susceptible to HTLV-11. It was shown that it was dyed (40%). These percentages are generally accepted in previous studies. Random American donors received equivalent doses of HTLV-1 and HTLV-2. Depending on the distribution, it was shown that the positive rate was 0.01 to 0.02%. [Anderson et al.

), Blood, 74:2585-91.1989; Sandi et al. er et al, ), J, B i o 1. M1 stop-, 63:353- 60.1990).

In addition, individuals with isolated 832 reactivity are often included in blood donation screening assays. It is found in between and applies to HTLV indeterminate (HTLV'''6). The number of donors in this study was HTLV'4. The most common reactivity was P19'. ``1, but then P24'' has a structural epitope with white matter. Similarity [Lal et al. J, Virol, 65:1870-76.1991 ; McLauglin et al., Amer, J.;

Tro　Med. The immunogenic nature of the C-terminal group of may explain these reactivities [Lal et al. aletal, ) J, Med, Vfol,, in press]. Indeed, in the WB test , 23% of the samples with p19 reactivity were synthetic G showed an antibody response against the epitope, which was previously associated with the immunodominant epitope of HTLV-1. shown to represent a specific type of pitope [Lal et al., J. Virol, , 65:1870-76.1991]. Furthermore, monochrome for P19'・1 The null antibody reacted with antigens in the normal thymus or human placenta [Hines () Raynes et al., J. Ex, Med, 157+907-2L 1983; Suni et al.

Int. J. Cancer 83:293-8.1984].

Furthermore, the C-terminus of HT L V "" representing a quasi-periodic structure is a miniphosphorus salt. has significant homology to the amino terminal segment of basic protein (MBP); and vines with the potential for false-positive antibodies [quauori] +J, Theor, Biol, 148:279-81.1991).

Isolated ll ball reactivity in the absence of one reactivity is the detection of env reactivity The inability to assay currents available for testing or interaction with closely related retroviruses can be attributed to either mixed reactivity or represent an early HTL infection. Can be done. Deficient antibody responses to membrane proteins, HTLV-1 and HTLV- WB and RIPA using both 11 antigens and HTLV-1 and HT Membrane protein of LV-II (Env-1, Env-2, Env-5, Env-20) assayed for minimal response to synthetic immunodominant motifs derived from Defects are likely due to minimal viral transduction resulting in defects in the immunogenic signal threshold. Can't be ignored. On the other hand, those with isolated 832 reactivity showed that membrane proteins and threshold H can be infected by variants of the TLV virus. The mutated version of the virus later became Babua, isolated from New Guinea (Yanagihara et al., Proc. Natl., Acad. , Sci, USA, 88:1446-51), 1991).

gag antibodies are among the first antibodies to appear in subsequent seroconversion (Ma nn) et al., Blood, 77:896-905.1991), HTLV'' test It remains a possibility that isolated nuclear antibodies in the body represent early sero-converters.

However, PBMC from isolated m-reactive specimens was determined by PCR analysis. However, there is no indication of the presence of the HTLV genome. More importantly, the opening of the exam Rebreeding in a limited number of specimens after the initial 6 to 23 months caused similar bands on the WB. pattern, no env reactivity in RIPA, negative by PCR analysis. leave. Retrospective study of prescriptions for blood donors with HTLV's 1-year follow-up showed no evidence of seroconversion to HTLV [Sa J. Biol. Med., 63:353-60.1990].

Antibodies against recombinant membrane-transporting glycoprotein (r2.1) have recently been developed in early HTLV. [Mann et al. .

Blood, 77:896-905.1991), but the specificity of r21 detection Not confirmed yet. In this study, samples with R21'' and m antibodies were R analysis shows no presence of HTLV genome. Tests with R21°11v reactivity The body cannot be traced and therefore it is unclear whether such reactivity exists in true seroconversion. It is not possible to draw any conclusions.

Antigenic mimics of endogenous retroviral sequences containing the gag protein of HTLV are L! 6:1-8.1990], the antibody response is) (TLV” ’ and) fTLVIs’ specimens. synthetic peptide (RTVL"') derived from Manger et al. + J Virol, 61:40130-4066). endogenous leto The loviral sequence is 60% similar to the 50 amino acid sequence at the C-terminal end of gag. Having the same sex. Highly conserved retroviral CX, CX4HX4C motifs HTL, containing V(7) This U region is present in other types of retroviruses, if The association of this protein with the retroviral genome exist through them in relation to their union. [Covey, Nuc 1 eic acids Res, 14:623-38.198 6]. The RTVL region was very similar to that found in other retroviruses. Contains two incomplete copies of this converted sequence in place (Figure 9).

Still other ERS are intrinsically encrypted for 25kD and 15kD2 contains two open reading frames, and the ga of HTLV-1/I Shows 32-39% homology with g protein [Peri et al., Nucleic Acids Res, 17:6841-54.1989). The majority of ERS Although structurally defective and not expressed as an infectious virus, the ERS gene product The phenotype of certain sites can provide antigenic stimulation for antibody production. RTVL” ’ introduces an antibody response to the antigen in both HTLV-infected and uninfected individuals, appears as one such epitope. HTLV"'In those who have a batan These same interests will be focused in our exploration of the HTLV genome. The L view and tax/rex area that was added to HTI, V-1 and HTLV-II HTLV specimens indicate the presence of the HTLV genome. However, samples with HTLV"' were amplified with Ldanyu and tax/LL5 primers. do not. Attempt to isolate HTLV virus from a limited number of specimens using co-culture technology showed no evidence of HTLV antigen in the medium supernatant (not published). HTL Virus isolation is a sensitive method for detecting HTLV due to the organized cell structure of HTLV. It is not an acceptable procedure. The mechanism of serum reactivity to these 11 proteins remains unknown. However, in order to detect evidence of HTLV infection in 4 HTLV samples, This defect in PCR has been reported by the present inventor and others [Kwok et al. nsfuston, 30:491 6 + l 990; bbaz et al., presented), these reactivities were observed by HT We cannot ignore the possibility that this corresponds to an incomplete phenotype of the Lvm protein. Ru. Continued efforts are underway to determine the causes of these typical HTLV WB results. HTLV-1 and HTLV-II whole viral antigens or deficiencies in detection of env reactivity using or synthetic immunodominant structural motifs and Defects for amplifying HTLV sequences from these individual 232 reactions were isolated. We propose that gender does not exist in authentic HTLV completion.

All publications, including U.S. patents and all U.S. patent applications mentioned in this order, are: It is now added to the references.

The invention thus described, it is obvious that the same may be varied in many ways. Dew. Such modifications shall not be deemed to depart from the spirit and perspective of the invention. , and such improvements as would be obvious to all those skilled in the art are within the scope of the following claims. intended to be included in the

FIC7,2A FT(,3 Akihara (ug/m1) FIG, 4A FIG. 4B Submission of translation of written amendment (Article 184-8 of the Patent Law) August 1, 1993

Claims (26)

[Claims] 1. [There is an array], [There is an array], [There is an array], [There is an array], [There is an array], [There is an array], [There is an array], [There is an array], Ers (endogenous retroviral sequence) [There is an array], and their analogues (The amino acids in the above sequence are derived from the three-dimensional conformation of the sequence. Immune activity to antibodies against HTLV-I or HTLV-II is substantially preserved. (may be substituted as long as possible) HTLV-I, HTLV-II or a peptide selected from the group consisting of is a peptide that has specific immunological activity to antibodies against the combination thereof. 2. [There is an array] The peptide according to claim 1. 3. [There is an array] The peptide according to claim 1. 4. [There is an array] The peptide according to claim 1. 5. [There is an array] The peptide according to claim 1. 6. [There is an array] The peptide according to claim 1. 7. [There is an array] The peptide according to claim 1. 8. [There is an array] Peptide according to claim 1 9. [There is an array] The peptide according to claim 1. 10. Claim 1: Brs (endogenous retrovirus sequence) Peptides described. 11. (i) HT in an amount sufficient to produce the antibody-peptide complex to be detected; Claim 1 for reacting with LV-I, HTLV-II or a combination thereof. providing an effective amount of the peptides listed above; (ii) adding a test serum diluted in a compound solution, whereupon the HTLV in the test serum -I or HTLV-II is combined with the peptide to form a peptide-antibody complex. form the body, (iii) keeping the mixture warm; and (iv) detecting the presence of a peptide-antibody complex; Immunoassay for detecting antibodies against HTLV-II or combinations thereof Seiho. 12. The peptide is in the following group: [There is an array] Brs (endogenous retroviral sequence) [There is an array] 12. The immunoassay according to claim 11, wherein the immunoassay is selected from: 13. In step (iv), the oxygen-derived second known antibody and the 12. Immunoassay according to claim 11, wherein a substrate is introduced which reacts to form a colored substance. . 14. In step (iv), a second known antibody labeled with a radioactive element is introduced. 12. The immunoassay according to claim 11. 15. 12. The immunoassay of claim 11, wherein the peptide-antibody complex is detectable as an aggregate. Yes. 16. A multi-dot arrangement in which the solid support is coated with at least one of said peptides. 12. The immunoassay of claim 11, which is a strip in columns. 17. The amount of the peptide coated on the solid support is 1 per well dot. 12. The immunoassay according to claim 11, wherein the immunoassay is in the range of μg to 10 μg. 18. An immunoadsorbent comprising at least one peptide according to claim 1; a sample of normal serum as a negative control; of serum containing antibodies against HTLV-I or HTLV-II as a positive control. sample, and Slow solution for diluting serum samples to detect antibodies against HTLV-I, HTLV-II, or a combination thereof. test kit for release. 19. The peptide is in the following group: [There is an array] Brs (endogenous retroviral sequence) [There is an array] The test kit according to claim 18, selected from: 20. A peptide composition comprising a mixture of at least two peptides according to claim 1. thing. 21. The peptide is in the following group: [There is an array], [Sequence available], Br8 (endogenous retrovirus sequence) [Sequence available] 21. The peptide composition according to claim 20, selected from: 22. Each peptide present in the mixture is present in a 1:1 ratio to each other, and 21. The peptide composition of claim 20, wherein each peptide is present in an amount of 0.1-10 μg. thing. 23. A vaccine comprising at least one peptide according to claim 1. 24. The peptide is in the following group: [There is an array] Brs (endogenous retroviral sequence) [There is an array] 24. The vaccine according to claim 23, selected from: 25. given to mammals for the treatment of HTLV-I and HTLV-II infections. Use of at least one peptide according to claim 1 for the preparation of a medicament for how to. 26. The peptide is in the following group: [There is an array] Brs (endogenous retroviral sequence) [There is an array] 26. The method of use according to claim 25, wherein the method is selected from among the following.