JPH04200400A - Extraction of virus genom specimen originated human body and detection of the virus genom - Google Patents

Abstract

PURPOSE:To enable easy, quick and accurate detection of a virus genom by treating a bio-specimen with a proteinase in the presence of a nonionic surfactant. CONSTITUTION:A bio-specimen such as 1-20mul of the serum or plasma of viral infection patient or <=10mg of an extracted tissue is mixed with a nonionic surfactant (e.g. Nonidet P40) and a proteinase (e.g. Proteinase K) and reacted to obtain a virus genom (A) such as human hepatitis C virus genom. When the component A is DNA (B), the component is used as it is and when the component A is RNA (C), the component C is converted into a DNA (D) prior to the following treatment. A liquid containing a primer having the base sequence of formula I, a primer having the base sequence of formula II and Taq polymerase is added to the component A and subjected to the 1st polymerase chain reaction (PCR) to obtain a reaction product (E). The component E is added with the primers of formula III and formula IV, etc., to obtain the 2nd PCR reaction product (F). The component F or the component B is subjected to electrophoresis and the band corresponding to the desired base pair length is examined to detect the objective virus genom.

Description

Detailed Description of the Invention (Industrial Application Field) The present invention relates to a method for extracting the genome of a human infectious virus from a sample derived from a human organism and a method for detecting the virus genome. The present invention relates to an extraction method and a method for detecting the human hepatitis C virus genome extracted by the extraction method.

<Prior art> Human non-A, non-B hepatitis virus is one of the 9 hepatitis viruses caused by blood transfusions.
0-95% of the cases, and treatment methods have not yet been established. Diagnostic methods, treatment methods, and processing agents to render harmless human non-A, non-B hepatitis virus that may be present in blood for transfusion are needed. There is a strong demand for the development of preventive vaccines.

In recent years, research on the human non-A, non-B hepatitis virus itself has progressed, and it has been reported that single-stranded RNA may be involved in infection (Japanese Patent Application Laid-open No. 62-249999 and No. 63-91328). ), and recently, Chiron Corporation of the United States cloned cDNA from the liver of a chimpanzee infected with human non-A, non-B hepatitis virus, and expressed it in Escherichia coli that was inserted into the vector λgt 11. It was found that the product reacts with serum from patients infected with human non-A, non-B hepatitis virus. In the end, this is about 1
It was discovered that this virus is a single-stranded RNA virus with 0,000 nucleotides and is close to the bracken virus.
IICVJ] and approximately 7000 nucleotides of all nucleotides.
The DNA base sequence was published (European Patent Publication No. 31821)
8 Publication). Furthermore, the Chiron company mentioned above used a polypeptide expressed in yeast using a part of this gene as an antigen, and developed a Fi
We are developing a method to measure antibodies in the serum of CV-infected patients. In this measurement method, anti-nc
Since V-antibodies appear, the above measurement method is currently considered to be suitable for the differentiation and diagnosis of viral chronic liver diseases and for screening blood for transfusion.

As HCv was cloned, Polymerase Chain React
on: hereinafter abbreviated as rPcRJ] method has also been used to detect virus genomes [Kaneko et al.
Lancet”335.911i7 (1990)].

The above PCR method uses the target D based on the specificity of the primer.
This is a method that amplifies the NA gene region more than 1 million times (if the viral genome is RNA, it is necessary to convert the RNA to DNA before performing PCR), and the virus genome is 1 copy. In principle, this is a highly sensitive detection method that can amplify. Therefore, the PCR method has been recognized to be useful as a method for detecting the virus itself, or in that it can use a biological sample after infection but before antibody production as a specimen.

However, since the PCR method is a highly sensitive detection method,
The problem is that there are cases where the test results appear to be positive due to contamination. This contamination is caused by the scattering of viral genome-containing substances caused by opening and closing of microtube lids and pipetting operations, and by carryover of amplified target genes that adhere to experimental equipment or the hands or clothes of the person being measured. .

(Problem to be solved by the invention and purpose of the invention) According to conventional techniques, a very simple and highly reliable HCv detection method that uses the PCR method has not yet been established. .

Conventionally, in order to extract and isolate virus genomes, treatment with protein denaturants such as guanidine isothionanate, phenonobelurea, and chloroform, and surfactants such as dodecyl sulfate (IJum) has been carried out; In order to remove the processing agent from the solution layer, the virus genome is precipitated with alcohol, and then dried. These operations are time-consuming and unsuitable for processing a large number of samples, and also increase the probability of contamination. Moreover, when the amount of virus genome is small, the recovery rate of virus genome by alcohol precipitation is low (less than 50%).
However, there is a major problem with the inability to obtain quantitative results at ℃1.

Therefore, the main object of the present invention is to provide a method for extracting viral genomes from biological samples derived from virus-infected patients, especially HCv-infected patients, in a simple manner, within a short time, and without causing contamination. be.

A secondary, but extremely important, goal of the present invention is to
The object of the present invention is to provide a simple, rapid, and accurate detection method for detecting a virus genome, particularly the FiCV genome, by performing PCR using an extract obtained by the above extraction method.

(Means and effects for solving the problem and achieving the purpose) As a result of intensive studies on the method of extracting virus genomes from biological samples, the present inventors discovered that biological samples can be extracted using proteases in the presence of a nonionic surfactant. If you process
It was discovered that it can be used as a sample for carrying out the PCR method, thereby solving the problems of the prior art and achieving the above main purpose.

In the extraction method according to the present invention, the biological sample may be serum, plasma, or excised tissue;
Nonionic surfactants such as Nonidet P-40 can be used, and proteinases such as proteinase can be used as proteolytic enzymes.

On the other hand, the above-mentioned incidental object of the present invention is to treat a biological sample with a protease in the presence of a nonionic surfactant, and to remove any viral genomes that may be present in the resulting extract from DNA. 5'-GAGTGCGCCTCAC: ACTTCCT
A primer having a base sequence of TACATCGAACAAGGA-3'' and 5'-ATCCCGCTGATGAAGTTCCAC
A first PCR was performed on the above DNA by adding a reaction solution containing a primer having the nucleotide sequence ATATGGTTC-3' and Taq polymerase, and then 5'-GACGAATTCTTCCTTACATCG.
A primer having a base sequence of AACAAGGG-3', and 5'-4TGC; AATTCTTCCACATGTG
A second PCR is performed by adding a primer having the base sequence CTTCGCCCAG-3' and a reaction solution containing Taq polymerase, and then electrophoresis is performed to detect a predetermined base pair corresponding to the product of the viral genome to be detected. This is achieved by a method for detecting a viral genome, which is characterized by examining whether or not a long band is detected.

The present inventors have carefully studied the reaction conditions, etc., and determined that when using serum or plasma as a biological sample, the amount of the sample should be within 1-20 μm, and when using biological tissue, the amount of the sample should be within 1-20 μm.
If the amount is kept within 0 mg, there is no need for complicated removal treatment of denatured proteins or alcohol precipitation, and there is no need to exchange reaction tubes. Viral genome extraction and reversal from RNA to DNA can be performed in a single reaction tube. photoreaction and PC
It turns out that R can be done.

The detection method according to the present invention is based on the method of Komkuczynski et al. using guanidine inthiocyanate [ABlyjl
C31Biochemistry”+ Vol, 1E
i2. In terms of detection sensitivity, the detection sensitivity is also about 10
It was also found that it was twice as good.

(Examples, etc.) Next, the present invention will be explained in more detail and concretely using Examples, Test Examples, and Comparative Test Examples.

-San 1 Fruit 1st Eye" (Extraction of viral genome from human biological sample) Inject 10 μm of plasma from an HCv-infected patient as a biological sample into a 0.5 ml microtube,
In contrast, 1 μI of lysate [500 mM)'
JS hydroxyaminomethane-hydrochloric acid buffer (pH 8,0
), 250mM potassium chloride, 30ml magnesium chloride, 0.5% Nonidet P-40, 10mg/ml
Add the proteinase K-containing solution and mix. Viral genome extracts were then obtained by incubating at 55°C for 1 hour, followed by 10 minutes at 94°C.

If the plasma, which is a sample of biological origin, is 10 μm or less,
The volume was made to 10 μm by adding a 10-fold dilution of a solution similar to the above lysis solution except that it did not contain Nonidede P-40 and Brotainase K.

In addition, when using tissue as a sample, add 10 μl of a solution similar to the above lysing solution diluted 10 times to 10 mg of tissue, except that it does not contain Nonidet P-40 and protease K. , and the following incubation in the same manner.

! (conversion from RNA to DNA and amplification of DNA by PCB method) As in Example 1, if the virus genome is RNA
If so, it is necessary to convert the RNA into DNA before performing PCR. In this case, first, 11 μl of the virus genome extract obtained in Example 1 was mixed with a reaction solution containing 20 pM of each primer (see below) and 14 units of reverse transcriptase [50 mM T'Js hydroxyaminomethane-hydrochloric acid buffer]. solution (pH 8,0), 25mM potassium chloride,
3mM magnesium chloride, 250μ each, 4 types of deoxyribonucleotides (dATP, dDTF', dC
TP, dTTP), 2.5mM dithiothreitol,
Add 14 μl of 40 units RNasjn and incubate at 42°
Complementary DNA by incubation for 1 hour at C.
A was synthesized. A reaction solution containing 5 units of Taq polymerase [50 mM trishydroxyamine methane] was added to this mixed solution containing the above RNA and complementary DNA.
- Hydrochloric acid buffer (pH 8,0), 50mM potassium chloride,
The first cycle consisted of 20 cycles of 30 seconds at 94°C, 1 minute at 55°C, and 1 minute at 72°C. The second PCR was performed. After that, further
Transfer 10 μm of the first PCR solution to another 0.5 ml microtube and add the reaction solution containing 20 pM of each primer (see below) and 5 units of Taq polymerase [10 mM trishydroxyaminemethane-hydrochloric acid buffer (pH 8)]. ,0), 50n+M potassium chloride, 1.5
mM magnesium chloride, 200 μM each of 4 deoxyribonucleotides (dATP, dDTP.

dCTP, dTTP) of 190 μm was added, and a second PCB was performed using the same system as the first PCR and for 30 cycles.

Next, after electrophoresis, the sample was stained with ethidium bromide, and it was confirmed that a band with a predetermined base pair length corresponding to the HCV genome product was present.

In the detection of the HcV, a part of the H(, Y cDNA sequence (Japanese Patent Application No. 1-344878) shown in FIG. 1 and cloned by the present inventors was used as a primer. That is, The first PCH contains the sequence 5'-GAGTGCGCCTCACACTTC:CT, which is the sequence from the 22nd to the 52nd in ■ in Figure 1.
The sequence TACATCGAACAAGGA-3' and the sequence 5'-ATCCCGCTGATGAAGTTCCAC from the 174th to the 20404th sequence.
ATATGGTTC-3'' sequence is used, and for the second P'OR, 5 in ■ in Figure 1 is used.
5'-GACGAATTCTTCCTTACATCG, which is the sequence from position 37 to position 57, which has an EcoR1 recognition site on the ' side.
The sequence AACAAGGG~3' and the 5'-human TGGAATTCTTCCACATGTGCT, which is the sequence from position 174 to position 19494, which similarly has an EcoRI recognition site on the 5'' side.
One having the sequence TCGCCAG-3' was used. The base pair length corresponding to the HCV genome product is approximately 180 bp.

Trial JL Example (Setting the concentration range of proteinase K necessary for extraction of the virus genome) In order to determine the concentration range of proteinase necessary for the extraction of the virus genome, the concentration range of proteinase K in 1 μl of the lysate described in Example 1 was determined. The concentration of was varied. still,
The sample contained the same 1 (plasma volume 10μm derived from a CV hepatitis patient).
Viral genome products were detected by PCR using the following methods and as described in Example 2. The results were as shown in FIG.

When the concentration of proteinase is within the range of 0-10 mg/ml, the band of the HCV genome product of interest is in the range of 2.5-10 mg/ml, as shown by lane numbers 5 to 12 in the electrophoresis pattern of Figure 1. is detected,
It was found that the target band could be sufficiently detected if the proteinase concentration was 5 mg/ml or higher.

Comparison of detection sensitivity between the method of the present invention and conventional method 1
"Stry", Vol, 162. pages 15
6-159° (1987)], viral genome products were detected by PCR using the method shown in Example 2 using plasma from HCV patients as a sample.

Figure 3 shows a comparison of the viral genome extracted by both methods and the detection by PCR. When the detection operation was carried out using 10 μm of plasma from the same patient, the band of the HCV genome product of interest was detected only in the case of the method of the present invention. When extraction is performed by the method of Komkuczynski et al., a plasma volume of about 10 (lμl or more) is required, so it has been revealed that the method of the present invention is about lθ times superior in detection sensitivity.

Figures 4A and 4B show a comparison of the results obtained by PCR of viral genomes extracted from the plasma of the same 12 patients using both methods. Figure 4A shows the case according to the method of the present invention, using 10 μm as the patient plasma volume, and Figure 4B shows the case according to the method of Humkuczynski et al., using 100 μm as the patient plasma volume, and viral genome were extracted, and both were extracted using a PC as described in Example 2.
This is the result detected by R. In addition, when plasma from the same patient is used as a sample, the same number is used.

From these results, both methods detected the target PCR product band in the same patient plasma used in lane number 1.3.4.5.7 of the electrophoresis pattern, and the viral genome was extracted by the method of the present invention. However, it has become clear that detection with the same or higher reliability than conventional methods is possible.

(Effects of the Invention) According to the virus genome extraction method of the present invention, there is no need for denatured protein removal treatment or alcohol precipitation treatment. Therefore, when detecting a virus genome from a sample of biological origin, starting with the reaction of the sample with a protease and a nonionic surfactant, a reverse transcription reaction from viral RNA to DNA is performed as necessary. The processes up to and including polymerase chain reaction (PCR) processing can be performed continuously in only one reaction tube, which simplifies the operation and greatly reduces the probability of contamination. I can do it.

In the case of the present invention, the time required to extract the virus genome is shortened to less than 2 hours, which is less than half the time of the conventional method. When detecting FiCV as a genome product, it took two days according to the conventional method, but using the method of the present invention, it can be done within 8 hours. Automation or semi-automation is possible.

[Brief explanation of the drawing]

Figure 1 shows a part of the cDNA sequence of the human hepatitis C virus (CV) cloned by the present inventors (Japanese Patent Application No.
344878), and Figure 2 shows the detection of viral genome products as described in Example 2 using plasma from patients with HCY hepatitis in order to examine the concentration of proteinase required for the extraction of viral genomes. This figure shows the results of Pct? Figures 4A and 4B are reproductions of electrophoretic patterns showing the results of detection of viral genome products and comparison of detection sensitivities using the method of the present invention and the method of Komkuczynski et al. using guanidine inthiocyanate. [”Analytlcal B Io
chem 1stry”, Vol, 1 [iL pa
ges 15B-159° (1987)] to human C
The method of the present invention is applied to plasma derived from patients with hepatitis virus to extract the virus genome, however, the amount of plasma used is 1/10 in the case of the method of the present invention, and then the virus genome product is extracted as described in Example 2. This is a drawing showing the results of detection, and is a reproduction of each electrophoresis pattern. 1: Infant mass marker 27I (321〈 6・o, 01・
・7: 0.04
・・８・ 0.16
,. 9: 0.63
. 10: 2.5
,. 11: 5.0 ・ 12: 1013: Labor 5f Mar Sword - 1: 3 Quantity Mar 10,000 - Top A Figure 4B Figure 1 234567891011T2 1-12: Serum on hard body

Claims (7)

[Claims] (1) A method for extracting a virus genome from a sample derived from a human organism, which is characterized by treating the biological sample with a protease in the presence of a nonionic surfactant. (2) The method for extracting a virus genome from a human biological sample according to claim (1), wherein the biological sample is selected from serum, plasma, and excised tissue. (3) Claim (1) or (2), characterized in that the nonionic surfactant is Nonidet P40, the protease is proteinase K, and the viral genome is the human hepatitis C virus genome. Viral genome extraction method from human biological samples described in . (4) Treat a biological sample with a protease in the presence of a nonionic surfactant, and if the virus genome that may be present in the resulting extract is DNA, If it is RNA, convert it to DNA and then convert it to 5'-GAGTGCGCCTCACACTTCCTTA
A primer having a base sequence of CATCGAACAAGGA-3', and 5'-ATCCCGCTGATGAAGTTCCACA
A first polymerase chain reaction (
PCR), then 5'-GACGAATTCTTCCTTACATCGA
A primer having a base sequence of ACAAGGG-3', and 5'-ATGGAATTCTTCCACATGTGCT
A second polymerase chain reaction (PCR) is performed by adding a primer having the nucleotide sequence TCGCCAG-3' and a reaction solution containing Taq polymerase, and then electrophoresis is performed to detect the product corresponding to the viral genome to be detected. 1. A method for detecting a virus genome, the method comprising determining whether a band with a predetermined base pair length is detected. (5) The method for detecting a virus genome according to claim (4), wherein the biological sample is selected from serum, plasma, and excised tissue. (6) Claim (4) or (5), characterized in that the nonionic surfactant is Nonidet P40, the protease is proteinase K, and the viral genome is the human hepatitis C virus genome. Viral genome detection method described in . (7) When serum or plasma is used as a biological sample, the amount of the sample is kept within 1-20 μl, and when biological tissue is used, the volume of the sample is kept within 10 mg. 5) or the method for detecting a virus genome according to (6).