JPH04190800A - Detection of nucleic acid - Google Patents

Abstract

PURPOSE:To determine a nucleic acid in high sensitivity by reacting a specimen nucleic acid with a probe nucleic acid in a medium, labeling only the formed hybrid, bringing the reaction solution into contact with a nucleic acid adsorbent to adsorb the hybrid and detecting the nucleic acid by taking advantage of the label. CONSTITUTION:In reacting a specimen nucleic acid with a probe nucleic acid, discovering formation of a hybrid of the nucleic acid to be reacted and the probe nucleic acid in the formed reaction mixture and detecting the nucleic acid, the specimen nucleic acid is reacted with the probe nucleic acid, the hybrid formed in the reaction solution obtained by the reaction is labeled, the reaction solution is brought into contact with an adsorbent (e.g. glass) to adsorb nucleic acid, the labeled hybrid in the reaction solution is adsorbed on the adsorbent, separated, the separated labeled hybrid is detected by taking advantage of the label bonded to the hybrid to detect and to determine nucleic acid.

Description

DETAILED DESCRIPTION OF THE INVENTION [Industrial Application Field] The present invention relates to a nucleic acid detection method useful for detecting or quantifying nucleic acids obtained from viruses, microorganisms, animals, plants, etc. with high sensitivity.

[Conventional technology]

As methods for detecting nucleic acids, various hybridization methods using labeled probe nucleic acids capable of forming base pairs with a target nucleic acid (nucleic acid to be detected) are known.

As a typical method, for example, a sample is reacted with a labeled probe nucleic acid in a state immobilized on a filter as a support, a hybrid is formed in a state immobilized on the support, and unreacted labeled probe is removed by washing. A widely used method is to separate and detect the

Analysis using a nucleic acid hybridization reaction using a conventional filter as a support requires a series of operations: fixation of nucleic acids in a sample, prehybridization, hybridization with a labeled probe, washing, and detection. However, since it takes time to obtain some of the analysis results, there is a problem that it is not suitable for routine use in clinical experiments, for example.

In particular, the operations of baking, prehybridization, and washing in the immobilization of nucleic acids are complicated and cause an increase in the time required for analysis.

(Lin et al.: Journal of V
irology, Vol, 55゜509 pages (
]985) ).

In addition, hybrid formation on a filter is performed in a heterogeneous state in solution, either by the reaction between a single-stranded nucleic acid in a solid phase and a single-stranded labeled probe in a liquid phase, so the rate of hybrid formation is slow. It has the problem of being slow. Moreover, the hybridization efficiency is extremely low, and usually only a few percent of the calculated expected value of the added labeled probe is used for hybridization.

Furthermore, nucleic acid analysis methods using this filter as a support have a problem of low sensitivity and accuracy.

In view of the above, recently, attention has been paid to the application of hybridization methods to nucleic acid detection methods in which a sample nucleic acid and a probe are reacted in a solution without immobilizing the nucleic acid.

As a method using such non-fixed state hybridization, US Pat. No. 44,865
No. 39 describes a sandwich hybridization method. In this method, two separate probes are used. One is a detection probe that is labeled and used for detection, and the other is a capture probe that is immobilized on a solid support to separate the target nucleic acid from the reaction mixture. In this method, the reaction between the sample and the detection probe is carried out in a solution in an unimmobilized state, and the resulting reaction mixture is brought into contact with either the capture probe or an immobilized solid support, and the target nucleic acid/probe hybrid is transferred to the solid support. is captured and separated from unreacted detection probes for detection.

Further, British Patent Application Publication No. 2169403 discloses a method using two different probes (a detection probe and a capture probe) coexisting in the same liquid phase. The detection probe is provided with a detectable label, and the capture probe has a portion that has an affinity for the capture means. After hybridization,
The hybrid formed by the capture probe, target nucleic acid, and detection probe is separated from the hybridization solution by utilizing the affinity between the capture probe and the capture means.

(Problem to be Solved by the Invention) Since the method described above uses two probes, namely a labeled probe for detection and a capture probe, both of them are prepared separately and used for capture and detection, respectively. It requires processing to function as such.

It is also possible to consider a method in which a type of probe is prepared and part of it is used for capture and the other part is labeled, but this also inevitably involves the complexity of having to carry out separate processes for capture and labeling.

In addition, the formation of a capture probe in the conventional method is generally performed by modifying the nucleotide chain necessary for capture. However, this modification affects hybridization and causes a lack of accuracy. Furthermore, although this modification for capture generally requires the use of a somewhat long probe, the longer the nucleotide button of the probe, the more likely mismatches will occur, making it difficult to detect site-specific displacements that occur in relatively short regions. In some cases,

Furthermore, when the capture probe is immobilized on the capture means by utilizing the affinity between the capture probe and the capture means, such as using a dothion-avidin bond, there are many variations depending on the conditions in the capture reaction. . Moreover, the above 2
In the method using a seed probe, the capture efficiency of a hybrid consisting of a target nucleic acid and a detection probe depends on the binding efficiency of each of the two stages: the binding stage of the hybrid and the capture probe, and the binding stage of the capture probe and the capture means. stipulated. That is, the capture efficiency through these steps is multiplied by their respective binding efficiencies, which inevitably results in lower efficiency than a reaction consisting of a single binding step.

Therefore, even the method using the two types of probes described above is still unsatisfactory in terms of operational complexity and sensitivity.

An object of the present invention is to provide a method for detecting nucleic acids that solves the above-mentioned conventional problems and has extremely simple steps, and furthermore, a method for detecting nucleic acids that is useful for highly sensitive nucleic acid detection or quantitative methods.

[Means to solve the problem]

The nucleic acid detection method of the present invention includes a step of reacting a sample nucleic acid with a probe nucleic acid and detecting the presence or absence of formation of a target nucleic acid/probe nucleic acid hybrid in the resulting reaction mixture, comprising: a. ) a process in which a sample nucleic acid and a probe nucleic acid are reacted in a liquid medium; b) a process in which only the hybrid formed in the reaction solution obtained in step a is labeled; and C) a reaction obtained in step a. a step of bringing the solution into contact with an adsorbent that adsorbs nucleic acids, and separating the labeled hybrid in the reaction solution from the reaction solution by adsorbing it to the adsorbent; d) the labeled hybrid separated in step C; and detecting the hybrid using a label bound to the hybrid.

As the probe nucleic acid (hereinafter simply referred to as probe) to be reacted with the sample nucleic acid in step a of the method of the present invention, any nucleic acid can be used as long as it has a base sequence that can effectively hybridize with the nucleic acid to be detected. .

Since the probe in the present invention is used without being labeled, there is no requirement for labeling the probe. As a result, short nucleotide chains can be used, which are easy to obtain and do not easily cause mismatches, resulting in highly sensitive detection. can be done.

When selecting a probe, in the process described below, the probe constituting one nucleotide strand of the double-stranded portion of the hybrid is used as a primer, and the nucleotide strand is extended from its end using the nucleotide strand of the nucleic acid to be detected as a template. When using a labeling method in which a labeling substance is incorporated into the extending portion of the probe, the nucleotide button of the nucleic acid to be detected that has hybridized with the probe acts as a template during the extension of one end of the brimer. The probe is selected so that it can function as a probe, that is, the nucleotide strand of the nucleic acid to be detected exists in a double-stranded state in the direction in which the end of the probe extends.

Note that, depending on the case, the sample nucleic acid may be used as a primer.

Hybridization between a sample nucleic acid and a probe can be performed according to a conventional method.

The conditions for the hybridization reaction vary depending on the nucleotide chain length and base sequence of the probe used, so the operating conditions for hybridization should be appropriately selected depending on the desired purpose.

This hybridization reaction can be carried out numerically in a hybridization solution containing formamide, a suitable salt, and Denhardt's solution, with the sample nucleic acid and probe in an unimmobilized state, and at controlled temperature.

In the method of the present invention, a sample nucleic acid and a probe are reacted, and the resulting hybrid is selectively labeled during processing.

As a method for this labeling, for example, one of the strands constituting the double-stranded portion of the hybrid is used as a primer,
When extending the end to make the double-stranded part double-stranded,
A method of incorporating a label into the newly synthesized extended portion can be used.

According to this method, since a non-hybridized nucleic acid does not have a portion that functions as a primer for forming a new double-stranded portion and a portion that serves as a template for forming an extended portion, the above-mentioned labeled No double-stranded reaction takes place.

Therefore, even if this labeling reaction is performed in a mixture of non-hybridized nucleic acids and hybrids, only the hybrids can be selectively labeled.

For this labeling, various methods can be used to synthesize a new double-stranded portion using a primer.

For example, dAPT, d required for extension of one end of the brimer.
A nucleotide such as CTP, dGTP, or dTTP is reacted with a hybrid to be labeled in the presence of an enzyme for forming a nucleotide chain, and a labeled nucleotide is used as one or more of the nucleotides used at that time to form a new hybrid. A method of incorporating a label into a nucleotide component can be used.

The labeled nucleotides include those labeled with radioactive isotopes that are generally used for labeling nucleotides, such as biotin, dinitrophenyl nucleotide derivatives, and enzymes necessary to induce fluorescence, luminescence, or color development. Those labeled with non-radioactive labeling substances such as radioactive materials and compounds can be used.

Enzymes for forming nucleotide chains include Escherichia coli DNA polymerase, Klenow fragment of DNA polymerase,
Various DNA polymerases such as T4 DNA polymerase, reverse transcriptase, etc. can be used.

Labeling in the present invention is carried out by appropriately diluting the reaction solution obtained in step a, adding each component for labeling to this, and dissolving or dispersing each component in a solvent. be able to.

Next, in step C, the labeled nucleic acid to be detected/probe hybrid is separated from the reaction solution subjected to the labeling treatment, thereby separating it from at least the unreacted label.

This separation involves bringing the labeled reaction mixture into contact with a solid adsorbent that selectively adsorbs 1l of DNA, and washing the unreacted label remaining in the solution and the solid adsorbent to which the labeled hybrid has been adsorbed. This can be carried out by separation by solid-liquid separation operations such as centrifugation, filtration, etc. The solid adsorbent for adsorbing nucleic acids used in this separation operation is a particle having a highly polarized surface, such as particles made of glass, polyamide, polyimide, and the like.

Using a solid adsorbent with labeled hybrids adsorbed,
Detection of labeled hybrids can be performed (step d
). At this time, the labeled hybrid may be washed if necessary, and the labeled hybrid may be further separated from the solid adsorbent, and the labeled hybrid may be detected by a method depending on the label used.

In addition, in the method of the present invention, in order to ensure that the length of the double-stranded part newly synthesized by extension of the end of the nucleic acid that becomes the primer in the above-mentioned labeling operation is sufficiently long,
By considering the combination of probes for the nucleic acid to be detected and using them, it is possible to increase the amount of label uptake during labeling, and even when using non-radioactive labels, the low sensitivity can be compensated for by the large amount of uptake. Katesa,
Highly sensitive detection becomes possible.

In the detection of this labeled VibWat, the nucleic acid to be detected can be quantified by quantitatively analyzing the amount of label possessed by the formed hybrid.

〔Example〕

Example 1 A 41-mer oligonucleotide having the following DNA base sequence constituting a part of plasmid 'pUC19 was synthesized using a DNA synthesizer (ABI, Model 381A).

5° 3゛GAT
CGCCCTTC:CCAACAGTTGCGCAGC
Using a portion of the CTGAATGGCGAATG compound, 7
When its purity was checked by electrophoresis on a 15% polyacrylamide gel containing M urea, it was determined to have a purity of 90% or more, so this compound was used directly without purification.

On the other hand, plasmid pBR322 (sample A) and plasmid pUc19 (sample B) were prepared as sample nucleic acids, and these samples were subjected to E c o RI (TOY
(manufactured by OBO), the resulting digested product is heat-treated to convert the single-stranded DNA into single strands, and the reaction products containing two types of single-stranded DNA obtained from each sample are individually separated. The following operations were performed using

Put 20 μg of the reaction product containing single-stranded DNA and the previously prepared probe (1.0 μg) into a test tube, and add 10
× Annealing solution [1× Annealing solution: 60mM
MgCl2.100mM T containing 60mM β-mercaptoethanol and 500mM NaCl
ri 5-HCI (pH 8,0)] was added thereto, and distilled water was further added so that the total thickness was 100 μ.

The resulting mixed solution was heated to 65° C. over 10 minutes, and then the temperature was gradually lowered to room temperature over about 1 hour.

Next, add 1 part of the 10x annealing solution to the obtained reaction solution.
oμu, 1mM dATP 10μff, 1mM
dCTP 10μl and 1mM dGTP 10μl
After adding p32-TTPlooCi, the total volume was adjusted to 200μ with distilled water to prepare a solution for labeling.

Five units of Klenow fragment (manufactured by TOYOBO) were added to this labeling solution, and the mixture was reacted for 1 hour under water cooling.

After the reaction was completed, unreacted p32-TTp in the reaction solution and the formed hybrid were separated using GENECLEANT' (810101) as follows.

GENE (:LEAN silica matrix (5 μk)
200 μl of the reaction solution was added, stirred well, kept in water for 10 minutes, centrifuged for 5 seconds, and the supernatant was removed to obtain a pellet of silica matrix/hybrid bond.

At that time, unreacted p32-TTp was separated from the hybrid bound to the silica matrix together with the supernatant.

After washing the resulting pellet three times with the GENECLEAN separation solution, the pellet was placed in a scintillation counter and its radiation was measured.

As a result, the sample from pUc19 was 107-1108C
The scintillation counter value of the sample from pBR322 without any sample was twice that of the so-called pack ground, and there was a significant difference between the two.

Comparative Example 1 Nucleic acid was detected by a conventional method using a detection probe and a capture probe as follows, and the detection sensitivity was compared with Example 1.

Using a DNA synthesizer (ABI, Model 381A), two types of 41mer oligonucleotides 8 and B were synthesized to be used as a detection probe and a capture probe, respectively, having the following DNA base sequences constituting a part of plasmid pUc19.

A: 5゛ 3゜GAT
CGCC:CTT(:CCAACAGTTGCGCAG
CCTGAATGGCGAATGB: 5' 3゜GCG
GTGGTTTTTTTTGTTTGCAAGC:AGC
Using a part of the AGATTA(:GC:GCAGA compound), its purity was examined by electrophoresis on a 15% polyacrylamide gel containing 7M urea, and it was determined to have a purity of 90% or more. The composite was used directly in the sheath.

Oligonucleotide B used as a capture probe is
In order to function as a capture probe, a relay (Ri
ly) [DNA 5 (4).

333p-337p (1986)] using terminal transferase (Promega, Bi
Biotin is bonded to the 3° end using
Bio11-dUTP (manufactured by Hecester Research Lahore Laboratories (BRL)) as dUTP was bound to form a capture probe.

On the other hand, plasmid ρBR322 (sample A) and plasmid pLIc19 (sample B) were prepared as sample nucleic acids,
These samples were subjected to E c o RI (TO
(manufactured by YOBO), the resulting digest was heat-treated to convert double-stranded DNA into single-stranded DNA, and the reaction products containing two types of single-stranded DNA obtained from each sample were individually separated. The following operations were performed using

20 μg of the reaction product containing one vA DNA and oligonucleotide A (1
.

The resulting mixed solution was heated to 65° C. over 10 minutes, and then the temperature was gradually lowered to room temperature over about 1 hour.

Next, add 10× annealing solution 10× to the obtained reaction solution.
μ2.1mM dATP 10μl, 1mM d
After adding 10μm of CTP and 10μk of 1mM dGTP, P32-TTPlooCi was added and the total volume was adjusted to 200μ2 with distilled water to prepare a solution for labeling.

Five units of Klenow fragment (manufactured by TOYOBO) were added to this labeling solution, and the mixture was reacted for 1 hour under water cooling.

After the reaction, add the previously prepared capture probe (1.0 μg
) was added, and the mixed solution was heated to 65° C. for 10 minutes, and then the temperature was gradually lowered to room temperature over about 1 hour.

After the annealing reaction of the capture probe, unreacted p32-”
In order to remove rTp, gel particles (about 5 mm in diameter) that had been subjected to the following treatment were mixed in this solution. Gel particles are made by cutting agarose gel into pieces, the surface of which is activated with cyanogen bromide and then combined with avidin. These gel particles were mixed with the previous solution for 20 minutes. At this time, the biotin bound to the 3' end of the capture probe specifically binds to avidin on the surface of the Kel particle.

Thereafter, it was briefly centrifuged and the supernatant was discarded. After washing twice with TE buffer, the intensity of the precipitate was measured using a scintillation counter, and the sample from pUC19 was 1106.
The intensity of the sample from pBR322 remained less than twice that of the background, showing a significant difference.

Example 2 A 4 1 mer oligonucleotide having the following DNA base sequence constituting a part of plasmid pUc19 was synthesized using a DNA synthesizer (ABI, Model 381A).

5° 3”T to G
C:GCC:TTCCCAACAGTTGCGCAG
When a part of the CC:TGAATGGCGAATG compound was examined for purity by electrophoresis on a 15% polyacrylamide gel containing 1M urea, it was determined to have a purity of 90% or more. It was used directly without generation.

' On the other hand, plasmid pBR322 (
Prepare sample A) and plasmid pUc19 (sample B), and incubate these samples with EcoRl (TOYO
(manufactured by BO), the resulting digested product was heat-treated to make the two-stranded MDNA into a single-stranded DNA, and the two-stranded MDNA obtained from each sample was
The following operations were performed using individual reaction products containing single-stranded DNA of each species.

Put 1.0 μg of the reaction product containing single-stranded DNA and 100 ng of the previously prepared probe into a test tube, and add 10×
Annealing solution [1x Annealing solution: 60mM
foamM Tr containing MgCl2.60mM β-mercaptoethanol and 500mM NaCl
10 μl of 5-HCl (pH 8,0)] was added, and distilled water was further added to the mixture to give a total volume of 70 μl.

The resulting mixed solution was heated to 65° C. over 10 minutes, and then the temperature was gradually lowered to room temperature over about 1 hour.

Next, 5μl of 1mM dATP, 1mM dGTP
5μ42. ．． 1mM dCTP 5μj2.1m
M dTTP 1μfi, 0.4m M hythionated UTP 8μ, 10x annealing solution 7μ
After adding and mixing 2 and 40 μk of distilled water, 10 units of Klenow fragment was further added, and the mixture was reacted at 37° C. for 1 hour to perform labeling.

After the reaction is complete, fine polyamide powder (particle size: approx. 100
The unreacted biotinylated UTP in the reaction solution and the hybrid formed were separated using .mu.m) as follows.

1.0 mg of polyamide was added to 200 μm of the reaction solution, stirred well, kept in water for 10 minutes, centrifuged for 5 seconds, and the supernatant was removed to obtain a pellet of polyamide/hybrid conjugate.

In this case, unreacted biotinated UTP was separated from the hybrid bound to the polyamide together with the supernatant.

The polyamide pellets were washed three times.

Next, after drying the precipitate, bovine serum albumin (S
After blocking was carried out in a conventional manner using a streptavidin-alkaline phosphatase solution (manufactured by BRL), the mixture was reacted at 37°C.

After 30 minutes, aspirate the liquid and discard it again.
．． 1M Tris-MCI (1)89.5)-0,1M NaCl-50NaC
After washing with 1-5O solution, 200 μm of a mixture of 30 μ2 of BCIP solution (manufactured by BRL), 44 μ° C. of NBT solution (manufactured by BRL), and 10 mJ2 of buffer solution was added, and a reaction was performed at room temperature for 30 minutes.

As a result, a strong bluish-purple color was obtained from the sample from pUc19, but no such color was observed from the sample from PBR322.

〔Effect of the invention〕

As described above, conventionally it was necessary to prepare probes for capture and for labeling, but according to the present invention, in order to incorporate the label only into hybridized probes, the complicated process and two types of probes are required. There is no longer a need to prepare nine probes. In particular, in separating unreacted labeled substances and labeled hybrids to be detected that coexist in the same liquid phase, nucleic acids containing hybrids can be selectively adsorbed to a solid adsorbent and separated from the liquid phase. , effectively separates unreacted labels and hybrids remaining in the liquid phase,
In addition, since the hybrid can be recovered at a high recovery rate, detection sensitivity and accuracy in quantitative determination can be improved.

Claims (1)

[Scope of Claims] 1) A nucleic acid detection method comprising a step of reacting a sample nucleic acid and a probe nucleic acid and detecting the presence or absence of formation of a target nucleic acid/probe nucleic acid hybrid in the resulting reaction mixture, comprising: a) a step of reacting a sample nucleic acid and a probe nucleic acid in a liquid medium; b) a step of labeling only the hybrid formed in the reaction solution obtained in step a; and c) a step of labeling the reaction solution obtained in step b. a step in which the labeled hybrid in the reaction solution is separated from the reaction solution by contacting with an adsorbent that adsorbs nucleic acids and adsorbing the labeled hybrid in the reaction solution to the adsorbent; d) the labeled hybrid separated in step c. A method for detecting a nucleic acid, comprising the step of detecting using a label bound to the hybrid. 2) The method for detecting nucleic acids according to claim 1, wherein the adsorbent is glass, polyamide, or polyimide.