JPH03502040A - Regulation of GM-CSF gene expression - Google Patents

Abstract

(57) [Summary] This bulletin contains application data before electronic filing, so abstract data is not recorded.

Description

[Detailed description of the invention] Regulation of GM-C8F gene expression This invention utilizes human granulocyte/macrophage colony stimulating factor (GM-C9F). related to regulation of gene expression and abnormalities in cells expressing GM-C9P. This is related to the diagnosis of leukemia and other related diseases.

Human granulocyte/macrophage colony stimulating factor (GM-CSF) is produced in vitro. From normal bone marrow progenitor cells, granulocytes, macrophages, granulocytes/macrophages and It is a 22-kDa glycoprotein that stimulates the production of eosinophil colonies (1). Ma GM-C3F has a direct effect on the function of mature peripheral blood granulocytes (2,3).

The gene encoding human GM-C8F has a chain length of 25-3 kb4.5) , which is located in the basal arm of chromosome 5 in the genetic map (6).

Antigen- or mitogen-activated T cells and T cell lines are exposed to relatively high concentrations of GM. - produces CSF (7.8.9). Interleukin I and tumor necrosis factor ( Other cytokines such as TNF) are associated with GM-CSP genetics in endothelial cells. Activate child expression (lO).

It is also possible to induce primary human stromal cells to produce GM-CSF. (11).

Multiple forms of regulation of GM-C9F production exist at both transcriptional and post-transcriptional levels. It seems possible. The stability of rQRN A in mouse G in macrophages It has been found that the untranslated protein of 3゛ is involved in the induction control of M-C8P12). Sequences located in the dark region were responsible for the instability of GM-CSP mRNA (13 ). The promoter region of hGM-C5F contributes to the T cell-specific expression of this gene. The obtained 650 bp fragment is involved, but in T cells stimulated with PHA/PMA. It has recently been reported that f: (14) is highly active.

The most sophisticated computer analysis of GMCSF genes of mouse and human origin Conserved sequences are found in the promoter region of mRNA and 3' non-cod sequences. (5) and the potential of these regions in regulating the expression of these genes. The importance of this function was demonstrated.

In addition, homology with other zytokines was observed, especially in the promoter regions of these genes. (5, I5.16).

This time, we investigated the sequences within the promoter region of the GMC3F gene, especially those of other cytokines. Sequences common to the GM-C9F gene confer cell specificity or inducibility to the GM-C9F gene. It was found that this is a binding site for nuclear proteins.

Therefore, the first aspect of this invention is to provide a granulocyte/macrophage colony stimulating factor. control the expression of GM-C9F in cells expressing offspring (GM-CSF) or Other hematopoietic cytokines containing CK-1 or CF,2 expressed intracellularly. These methods provide methods for controlling the expression of species within the cell. Binding of the bromocou region of the GMCSF gene and nuclear protein(s) It includes a step of adjusting.

The relationship between the GM-C5F gene promoter region and nuclear protein(s) The step of modulating binding may consist of inducing or promoting such binding, or otherwise for example, preventing or inhibiting such binding. Just to give one example: Regulation of protein(s) binding has affinity for CK-1 or CK-2 Blocking protein binding using specific inhibitors with By using DNA with a suitable sequence that acts as a competitive inhibitor of binding Therefore, it can be done.

A specific embodiment of this invention provides a GM-CSF promoter proximal to the transcription start site. region within the region, more specifically the promoter region of cytokine 1 (GK-1). ) and/or cytokine 2 (CK-2) specific sequences and nuclear proteins (multiple (can also be a number), thereby regulating the area. -As an example The method of this aspect of the invention is herein described as nuclear factor (NF)-GMb. The goal is to induce the creation of complexes. In this way, NF GMbi, tCK-1 and the promoter region spanning the CK-2-specific sequence and GM-C9F-expressing cells. created by interaction with nuclear proteins derived from Then NF-G The Mb complex regulates transcription of this gene. NF-G as described herein Mb is inducible and involves production of GM-CSF mRNA. Furthermore, this compound cells are absent in cell lines that do not express GM-C8F.

This invention also provides information on leukemia and other diseases that appear to be associated with abnormalities in the expression of GM-CSF. and other related diseases. In this aspect of the invention, nuclear proteins ( protein(s) to which these nuclear protein(s) bind. Uniqueness of the promoter region or nuclear protein(s) and promoter – changes by detecting aberrations or anomalies in the nature of connections between regions. An indicator of GM-CSF production is provided. Abnormalities that occur in this regard are proteinaceous for example, a lack of ability to bind to quality DNA(s).

Such abnormalities can be detected using the NA gel migration retardation assay, e.g., as described herein. Alternatively, it can be detected by competitive EL I SA method. Associated with lack of transcriptional activation ability Abnormalities can be detected by using in vitro transcription methods to screen for function.

Additionally, gel migration retardation assays such as those described herein can be used to detect nuclear proteins in the promoter region. Screening for factors that appear to inhibit the binding ability of protein(s) It can be used as

Through extensive research that led to this invention, nuclear proteins derived from GM-CSF expressing cells and GM - GM by synthetic oligonucleotides spanning the CSF promoter conserved region Interaction with cells in which C5F is not produced was measured. As a result of this study, GM-C It has cell specificity and interacts with the DNA fragment derived from the 8F promoter. It has been discovered that there are nuclear proteins that can be induced.

Comparison of promoter regions from numerous cytokine genes revealed that different genes Some homologous sequences that are conserved across species differences between genes have been revealed ( 5.14.15). One decanucleotide sequence (cytokine (CK)-1) 5°GRGRTTYCAY3° (R is A or G, Y is C or T) is human and IL-2, IL-3, GM-CSP and G-CSF genes of both rats and mice. was discovered (Figure 4). Furthermore, it exists in the direction of 3゛ toward this decanucleotide. The second sequence (CK-2) 5'TCAGRTA3' present in both humans and murine GM-C: Conserved in SF and II, -3 genes (Fig. 4). This arrangement No columns were found in human and murine G-CSF or IL-2. Also The CK-1 sequence was derived from the human GM-CSP (14) gene and murine IL-3 (31 ) is repeated further upstream of the gene, but without any externally flanking conserved sequences.

CK-1 and GK to elucidate their role in nuclear protein binding. A 41 bp oligonucleotide probe spanning the -2 sequence was designed.

These two sequences are due to the GM-CSF sequence, which is not conserved in other genes. adjacent to each other.

Two 41b oligonucleotides that span these conserved sequences are specific for A DNA-protein complex was identified. These two complexes (hereinafter NP-GMa and NF　GMb) are involved in heparin-cephalin 0.1-0.3M KCl2 and 0.6M KCl from the loin column, respectively 2, so these two complexes contain two or more different proteins. It seems to be produced by proteinaceous proteins.

The CK-1 sequence explains the coordinated expression of these several genes in activated T cells. (14, +5). However, G-CSF is a professional Despite the fact that the motor contains a copy of CK-1, activated T cells Not expressed (13). Therefore, this sequence alone is effective against GM-C3F or IL-3. It is unlikely that this results in T cell expression. However, the above GM-C9F GK-1 and CK-2 extended conserved sequences found in the gene and IL-3 gene sequences may be involved in T cell expression of these genes. IL-3 and GMC9F are It is noteworthy that Zumi T cell clones are often coordinately expressed upon ConA stimulation. Should (35).

Treatment of U3637 cells with PMA resulted in an increase in GM CSF mRNA and NF-GMb complex concentration increases, but NF-GMa concentration does not increase. stomach. Production of GM-CSF mRNA in U3637 cells treated with PMA The inducibility of the NF-GMb complex that occurs at the same time is Protein(s) may be responsible for GM-CSF gene inducibility It suggests.

The situation observed here is similar to that of proteins that bind to the octamer motif of immunoglobulin genes. This is in line with the facts observed in pacuitans (25, 26). two Proteins, one of which is lymphoid specific, bind to this motif. Li The lymphatic system-specific protein is NF-GMb induced by PMA in U3637 cells. can be induced by ribopolysaccharide (26). human Extracts from the melanoma LiBr cell line contain protein(s) that give rise to NF-GMa. However, PMA treatment of these cells induces NF-GMb. I couldn't induce it. Nuclear proteins prepared from mouse SP2 cell line did not specifically bind to GM-C5F conserved sequences. Therefore, this GM-CS The protein(s) that binds to the P sequence has a restricted cellular distribution. It seems so. This result indicates that the GM-C9P/CAT fusion gene is expressed in activated T cells. Consistent with previous results, it was not expressed in human B lymphoblastoid cell lines. Do (14).

The features of the present invention will be further clarified by the detailed description and drawings below.

Figure 1(a) shows a restriction enzyme map of the promoter region of the human GM-C8F gene. vinegar. Sequences were counted from the transcription start point (+1). S ac Sequence between 1 site -11 and -96 expanded to show conserved sequences among cytokine genes and T Both ATA box sequences are shown (P: PstI, S: 5acl, D: Dde the law of nature. (b) is the conserved GAGATTCCA and TCA, GGTA A 41 bp synthetic oligonucleotide sequence spanning the sequence is shown. Underline the storage area show.

Figure 2 shows nuclear proteins derived from 05637 cells treated with synthetic oligonucleotides and PMA. Shows interaction with protein. (a) Synthetic 41 bp annealed oligonucleotide This is a competitive assay that measures binding specificity to leotide. Radioactively labeled oligonucleotide 0, 2 ng of cleotide, 2μ9 of nuclear protein and 2μ of poly(dI:dC) Mixed with 9. Specific oligonucleotide (GM) (bands 2-5) or nothing Increasing concentrations of the relevant oligonucleotide (X) (bands 7-10) were added. . Bands 1 and 6 are without competitive factor, bands 2 and 7 are with 5 ng of competitive factor, and nds 3 and 8 are 1. ong, bands 4 and 9 are 25ng, bands 5 and 1 0 added 50 ng. a and b represent two specific complexes NF-GMa and NP-GMb is indicated, and F indicates an unbound oligonucleotide. (b) is hepa Separation of U3637 nuclear extract by phosphorus-sepharose. K used for elution The CQ concentration (M) is shown below each course. In bands 1, 3.5 and 7 50mM KCf2 was used for the binding reaction and 200mM for bands 2.4.6 and 8. MK (J! was used.

Figure 3(a) shows nuclear proteins extracted from various cell lines after PMA treatment. The interaction between proteins and synthetic oligonucleotides is shown.

PMA-treated HUT78 cells (2μ9) (band 1), tJ 5637 cells ( 2 μ9) (band 2), SP2 cells (6 gM band 3), LiBr cells (6 gM band 3), Oligonucleotides 0, 2 radioactively labeled extract from 1gX band 4) Used with ng. Band 5 has no protein.

a and b indicate specific complex, F indicates unbound oligonucleotide.

(b) Effect of PMA treatment on the production of NF-GMa and NF-GMb complexes. Show results. Band] is untreated U3637 cells, band 2 is PMA-treated U3 637 cells, band 4 is untreated LiBr cells, band 5 is PMA-treated Li Br cells.

FIG. 4 shows conserved sequences found in the promoter regions of cytokine genes.

All sequences were compared to the human GM-CSF sequence.

Non-conserved bases are shown in lower case. The numbers are relative to the transcription start point (+1) of each gene. Indicated.

Figure 5 shows competing particles for binding with the radiolabeled GM-C8F sequence into which CK-1 has been inserted. Densitometer gel migration retardation assay for different oligonucleotides Indicates can.

Figure 6 shows various oligonucleotides inserted with CK-1 and HUT78 T cell extracts. Figure 2 shows a gel migration retardation assay using cleotide.

Figure 7 shows cloning of either GM-C8F or G-CSF' in pBLcAT2. with a single copy or multiple copies of CK-1 obtained upstream of the cloned tkCAT. This figure shows the transfection of Jurkat cells. Band l is pGCK-1 +PMA, band 2 is pGCK-11 band 3 is pGMCK-1+PMA, band Band 4 is pGMCK-1, band 5 is pG(4)CK-1+PMA, band 6 is pGMCK-1, band 5 is pG(4)CK-1+PMA, band 6 is pGMCK-1 G(4)CK-1, band 7 is pG(5)CK-1+PMA, band 8 is pG( 5) CK-1, band 9 is pBLCAT2, band 10 is 1 unit of CAT enzyme. (,. again (yo,. M symbol. after. inside parentheses. numbers, yotk7'o and -, -. top .

(represents the number of copies of the sequence cloned into).

FIG. 8 shows the identification of the molecular weight of NF-GMa by photocrosslinking reaction.

Course 1 is NF GMa complex, :I-S2 is +200 times excess Nokold G M oligo, course 3 is +200x excess cold x/y oligo. molecular weight standard The information is shown next to the gel.

FIG. 9 shows TNF-a induction of NF-GMa. ) IUVE cells (a) or FLOW cells (b) were grown in the presence of TNF-α for the times indicated in the figure. G NF-GMa in liquid extracts using the M-CSF sequence as a radiolabeled probe was detected. a is NF-GMa, and f is unbound DNA.

Figure 1O shows that CK-1 responds to TNF-α. FLOW cells as described below. Transfected with DNA samples. (1) with no DNA added, (2) and (3) ) is psv2 CAT, (4) and (5)! ;LpBL CK-1 (4), (6) and (7) are pBL CAT2° bands 2.4 and 6 are recovered They were treated with 100 units/RQ of TNF-α for 10 hours before measuring CAT activity.

[Materials and methods] (DNA probe) Two complementary 41 bp oligonucleotides were synthesized with EcoRI ends (first Figure b). Oligonucleotides were added to γ-”P-ATP (Bresa) and polynucleotides, respectively. The end was labeled with nucleotide kinase (Pharmacia). Radioactively labeled o The oligonucleotide was incubated at 100'C for 3 min, 25mM) LisH (J! (pH 7,6 ) and +50+nM NaCtt” and cooled at room temperature for 15 minutes. Upstream annealed. Anneal the unlabeled oligonucleotide as above. to obtain a final concentration of lOng/μQ, which is used as the specific competitor in the binding reaction. and used it.

(Cell line) U5637 is constitutive +: human bladder cancer producing GM-CSF and G-CSF It is a cell line (18). HUT78 is a T lymphoblastoid derived from Sézary syndrome patients. cell line (19). SF310-Ag14 in mouse myeloma cells (20) and LiBr is a human melanoma cell line (21). Jurkat cells are human T It is a lymphoblastoid cell line, and FLOW cells are a primary embryonic fibroblast explant line. , human venous endothelial cells are also primary cultures. GM-CSF mRNA is U36 37 cells and ) (detectable in UT78 cells, but not in LiBr cells and SP2 cells). It cannot be detected in cells.

All cell lines were typically grown in RPMI medium supplemented with 10% fetal calf serum.

Cells are 1×10” cells/chu for non-adherent cell line and adherent cell line respectively. was recovered at 80% confluence and was transferred to Holbo Jl, -12-myristate-13-a It was treated with acetate (PMA) 10 ng/z12 for 6 hours. unprocessed details Cells were grown for the same amount of time as above without the addition of PMA.

(Preparation of nuclear extract) Nuclei were prepared as described by Dignam et al. (22). Same as 0.5MKCC Nuclear proteins were extracted by constant stirring at 4°C for 30 minutes. 2000 After centrifuging at 0 rpm for 30 minutes (Beckman T L' 100.3), remove the supernatant. RoomMKcQ containing TM buffer containing MI buffer: 50mM) Lys HCQ (pH 7,6), 12mM MgCCt, 1mM EDTA, 1mM DTT, 20% glycol Dialysis was performed with Serine X23) for 12 to 16 hours with three changes of dialysate. protein The extract was stored at -70°C. Protein concentrates were tested using the Bio-Rad assay (Bio-Rad assay). (Rad).

(Gel migration delay assay) For the binding reaction, 0.1 to 1 of radiolabeled fragments (5 to 10,000 cpm), Ong was mixed with nuclear extract 1-3μ9 in a final volume of 20μQ solution (25mM Tris HC). l2 (pH 7,6), 6, 25mM MgCQt, 0.5mM EDTA.

0.5mM DTT, 10% glycerin and 80mM to 200mM KCQ (containing). Poly(di:dC) 0.5-3μ9 was used in all reactions. It was used as a heterocompetitor. Specific competitors for each reaction as reported in individual experiments was added. Reactions were separated in low ionic strength buffers by 5% polyacrylamide gels. analyzed (24). Pre-electrophores the gel for 2 hours at 20V/cm and at this same voltage. Electrophoresis was performed for 1 to 2 hours. Following electrophoresis, the gel is dried - overnight or for 1-2 hours. Autoradiography was performed for 1 day.

Coupling reactions with synthetic oligonucleotides were performed as described above. The delay pattern is 1 Using 1% polyacrylamide gel, 0°5 XTBE (1,0x TBE is 50 Analyzed in mM Tris/borate (pH 8.3, 1mM EDTA).

(Heparin-Sepharose column chromatography) Heparin-Sepharose (Pharmacia) l rtt (l column with 100mM KCC-containing TM buffer Equilibrated with containing M, l). Crude nuclear extract from PMA-treated U3637 cells 6 The column was loaded with this same buffer. After thoroughly washing with TM, 1, Combined proteins were added to 200.300 and 600 mM KCQ TMII buffer solution. The eluate was eluted step by step with each salt concentration. The protein concentration was evaluated by the Pio-Rad assay. these The fractions were tested for binding activity to synthetic oligonucleotides.

(Transfection of Jurkat cells) Before transfection, -Cut cells were passaged for several days and cultured in RPMI medium supplemented with IO% bovine fetal serum. The cells were grown to a density of XL0' cells/cells. Harvest cells and electroporate Buffer (20mM HEPES (J) H7,6), I 57mM NaCl2. Wash twice with 5mM KCQ, 0.1% glucose) and electroporate. Therefore, the cells were resuspended at a density of 1 x 10' cells/Kg. 2XIO’ cell a Mix the recoat with 1.5μ9 of DNA and 10% fetal bovine serum for 15 minutes on water. I left it for a while. Electroporation is 270V.

This was done with a Piorad Sheen Pulsar set to 960 μF.

The cuvette was left on ice for an additional 10 minutes, then RP supplemented with lO% fetal bovine serum. Transfer to a T25 flask containing MI medium 8JIQ and incubate for 40-48 hours before harvesting. Incubated. Cells were treated with PMA (20 μg/J) for 16 h before harvest for stimulation. 'IC) and PHA (2 μg/village).

Cells were collected by centrifugation, washed with PBS, and the cytoplasmic extract was extracted using the method of Gorman et al. 36). Measure the protein concentration and measure the protein concentration for each measurement. CAT assay was performed on all extracts using 25μ9.

[Results nuclear proteins (conserved cytokine-specific sequences bind nuclear proteins) and the sequence 5'GAGATTCCAC3° (Figure 1b). Two complementary oligonucleotides spanning the sequence (both 41 bp in length) was synthesized. with extracts from PMA-stimulated HUT78 or U3637 cells. Two specific delayed complexes were generated (Fig. 2a, labeled a and b). these The complexes are called nuclear protein (NF)GMa and NF-aMb. . These two complexes are composed of unlabeled annealed oligonucleotides (second a Figure, bands 1 to 5) were able to compete completely with 50 ng, but the same concentration of unrelated oligonucleotide (Figure 2a, bands 6-10) or poly(dl:DC) It does not compete with 3μ9 (not shown). Move the gel higher or Other delayed complexes that move closer to the isolated DNA are not always consistently observed. and cannot compete with increasing concentrations of specific competitor (Fig. 2a). in binding reactions This non-specific interaction became more pronounced when the salt concentration was increased from 80 to 200 mM. specific interaction is enhanced by approximately 3 times (results not shown) . Therefore, subsequent binding reactions were carried out in 200mM KCC.

The two retarded complexes can be multimers of the same protein or two different proteins. could be obtained from any of the interactions. The extract from U3637 cells was Fractionation was performed using a Palin-Sepharose column. O, IM, 0.2M, 0.3M and Proteins eluting from the column with 0.6 MKCQ were tested in a migration retardation assay (see Figure 2b). The protein that brings about the NF-GMa complex is 0.1-0.3M KC The protein eluted from the column at 0.6 M K resulting in NF-GMb eluted with CQ (Figure 2b, bands 5.6 and 7.8). This means these This suggests that two different proteins are involved in this complex.

(Cell-specific interaction with conserved cytokine sequences) U5637, HUT7 B, Pattern of delayed bands obtained with extracts prepared from LiBr and SP2 cell lines. Compare turns. All extracts were treated with 10 ng/zI2 of PMA for 6 hours. prepared from cells. Two specific delay bands NF-GMa and NF-GM b shows U3637 cells treated with PMA and HUT78 with radiolabeled oligonucleotides (Fig. 3a, bands 1 and 2) were obtained using HU T78 cell extracts always contain 3-4 proteins containing both of these complexes. It was produced at twice the concentration. Extracts from the SP2 cell line did not produce any specific complexes. was not observed, but produced a blurred delay band shifting upwards of NF-GMa ( Figure 3a, band 3). This interaction is enhanced by increasing the poly(dl:dC) concentration. be competed with.

Extracts from PMA-treated LiBr cells contained GM-CSF-specific oligonucleotides. It combined with tide to produce NF-GMa, but not NF-GMb. LiB The amount of N'F-GMa produced by extracts from r cells was determined by HUT78 or U was always approximately 3-fold lower than the amount seen in 3637 cells (Fig. 3a, band 4).

(NF-G Ma and NF GMb DNA-protein complex production effect of PMA stimulation on) PMA treatment induces protein production involved in two cytokine-specific complexes In order to examine whether or not U3637 and Li Extracts were prepared from the Br cell line. From the delay patterns obtained with these extracts , proteins involved in the NP-G\1b complex were induced 5 to 10 times in U3637 cells. (Fig. 3b, compare bands 1 and 2). LiBr cells This induction was not observed, and no change was observed in the NF GMa concentration. (Figure 3b, bands 3 and 4).

(Confirmation of nuclear protein binding site) As explained above, the GK-1 sequence is conserved across many cytokines; This is particularly noticeable in IL-3, G-C8F and IL-5 (see Table 1). on the other hand, CK-2 is present only in GM-C9F and IL-3.

Table 1 CK-1 arrangement hGM (+) GAGATTCCAChGM (2) G gGAT T aCA g 7/l0mGM GAGATTCCAC10 /10hlL-3GAG gTTccA t 8/l.

m1L-3 (1) GAG gTTccA t 8/l0m1L-3 (2) GAGATTCCAC10/10hlL-2G gGATT tCA C8/l0m1L-2G gGATT tCAC8/10h-G GA GATTCCAC10/10m-G GAGATTCCcc 9/1 (1hlL-5aAGATTCt tC7/10hlL-6aAG tT TCCA a 6/10h-IFN (R) GAG tTTCCt t 7/10hlL-4(R) GA aATT aCAC8/l 0 common array -GRdanNeeNdanN’N Numerous cytokine gene regions to identify precise binding sites for nuclear proteins Assemble double-stranded oligonucleotides spanning CK-1 and adjacent DNA from (see Table 2) and used for competitive testing. 35-45 base pair saw 7N et al. The oligonucleotides are completely different from the CK-1 sequence except for 10 base pairs. is noteworthy. The exceptions are GM-C9F and TL-3, in which cK-2 sequences are present as well.

Table 2 Ωb CKI CK2 Ω CK2 Insert GK-1 and oligonucleotides based on the f2GM-C5F sequence at 32p. Radiolabeled nuclear protein (HUT7) from cells producing NF-GMa One specific retardation band was obtained by gel migration retardation assay mixed with 8 T cell extracts). (See Figure 6). Binding of oligonucleotides shown in Table 2 We considered the degree of competition. The gel was subjected to a densitometer scan and Percent competition was calculated from the results. Figure 5 is a graph of the densitometer scan. In addition to cold jGM-C3F oligonucleotides, IL-3, G-C8F and IL-5-derived oligos into which the GK-1 region has been inserted It can be seen that there is also effective competition for binding by oligonucleotides. child On the contrary, oligonucleotides that do not have CK-1 or CK-1-like sequence (X) Oligonucleotides containing only tide or CK-2 do not compete. versus Although a slight decrease in binding was observed in the assay, the oligonucleotide with the CK-1 region inserted It was smaller and less consistent than the competition for Otido.

These results are due to the unique protein that NF GMa binds to the CK-1 motif. It shows that it is of good quality.

(Transfer characteristics of CKi) To determine the functional significance of the CK-1 sequence, we performed transient transfection experiments. -Performed with cut cells. p with either single or multiple copies of the CK-1 sequence. GM-C8F of the demidine kinase (tk) gene in BLCAT (37) or A plasmid was assembled from the upstream of "G-C9I" (Fig. 7).The GM-C8F sequence was f2NF Contains the CK-2 sequence necessary for GMb binding. these pluses Mido was transfected into Jurkat cells by electroporation. .

Cell extracts were assayed for CAT activity 48 hours post-transduction (36).

GM-C8F or cloned upstream of the tk promoter in either direction. A single copy of the CK-1 sequence, G-C8P or G-C8P, both enhance transcription by 2-3 times. (Figure 7). In the case of multiple copies, both sequences are derived from the tk promoter. There appeared to be an additive effect of enhancing transcription by a factor of 5-IO (Figure 7). Transf The target cells were collected using phorbol myristate acetate (P) for 12 hours. Treatment with MA) and phytohemagglutinin (PHA) enhances transcription by approximately 30%. occurred. Vector pBLCAT2 did not respond to PMA/PHA stimulation. child These results suggest that CK-1 and its binding protein NF-GMa play a positive role in transcription. It was found that it acts as a regulatory factor.

This substance has the characteristics of a transcription enhancer sequence, and has the characteristics of a transcription enhancer sequence. direction is also functional, and multiple copies function in an additive manner.

(Identification of protein(s) involved in NP GMa complex) NF - to identify the protein(s) that lead to the production of the GMa complex; The UV-crosslinking method of Wu et al. (38) was used with a modification. (, -C9F A 40 bp fragment of DNA containing the CK-1 sequence was transformed into “P- Labeled with dATP and promodeoquinuridine (BUdR). scale up Incubating the probe with crude nuclear extracts from H1JT78 cells in a combined binding reaction (see Materials and Methods). Substitution of T residue by BUdR is NF-〇M did not interfere with the production of a-complex. The NF-GMa complex was coated with standard polyacrylic Excise the amide from the migration-retarded gel, illuminate the gel with ultraviolet light, and autoradiograph. I went to Gel sections were incubated in SDS loading buffer and 10% SDS Electrophoresis was performed on Laemuri gel.

A single protein with a molecular weight of 43 kD was identified on the protein gel (see Figure 8). ). Addition of a 50-fold molar excess of CK-1 competitor to the binding reaction inhibits this protein. The band disappeared, but the same amount of irrelevant N A fragment was included as a competitor. This 43kD protein was present in the reaction with the 43kD protein (Figure 8).

(NF in leukemia GMa and NF-GMb) Acute myeloid leukemia (AM L) or other forms of leukemia by conventional methods from peripheral blood mononuclear cells prepared from persons with leukemia. Nuclear proteins were extracted. All samples tested were >80% leukemic blasts It had

Standard gel transfer using GM-C9F 40 bp fragment of DNA as radiolabel. The presence of NF-GMa and NF-GMb was measured by the kinetic delay method (substances and (described in the Methods section). A large number of purified lymphocytes, including neutrophils and monocytes A normal sample was tested similarly. The results are summarized in Tables 3 and 4.

NF-GMa protein is present in most leukemic or normal cells tested. Ru. This finding is consistent with previous findings in which NF-GMa was present in most cell lines in culture. matches well. On the other hand, NP-GMb was tested in all cases with one exception. Not present in all normal cells.

One normal lymphocyte sample contained low concentrations of NF-GMb.

Of the 24 AML samples tested, 8 (i.e. 33% of the samples) were NF-G Mb It contained. Among the 11 samples from other leukemias tested, only one Only T-cell acute lymphocytic leukemia contained NF-GMb.

If induction of NF-GMb is required for GM-C9F expression as proposed, acute The presence of NF-GMb in 30% of myeloid leukemias indicates that GM-C is present in these cells. Expression of 8F can be brought about. Recently, Northern blotting of mRNA Of the 22 AML samples analyzed for GM-CSF expression, half of them It was found that it contained 8F mRNA. On the other hand, some cases of chronic myeloid leukemia (GML) or GM-CSF for analysis of acute lymphocytic leukemia (ALL) samples. could not demonstrate mRAN (39). NF-G in some cases of AML This finding regarding Mb correlates with the synthetic ability of these cells to synthesize GM-C8F. It is possible. Therefore, we decided to screen for the presence of NF-GMb. Therefore, it is important to diagnose a subset of AML patients (i.e., those who express GM-C8F). It is possible to

Table 3 NF in leukemia cells GMa and NF-GMb Disease name Number of samples Number of existing GMa GMb AML 24 23 8 Eosinophilic leukemia -AAL: Acute lymphocytic leukemia CML: Chronic myeloid leukemia CLL: Chronic lymphocytic leukemia CGL: Chronic granulocytic leukemia NHL: Non-Hodgkin lymphoma Table 4 NF in normal blood cells Presence of GMa and NF-GMb Cell type Number of existing G M a G M b Neutrophil (10) O-monocyte (2) 1) - To T cell blasts 2) -* Represents the number of different samples tested.

**Normal T cells (endothelial cells and fibroblasts) that proliferated once in the presence of PI-IA (Induction of NF GMa) Treatment of endothelial cells or fibroblasts with TNF-α This results in induction of GM-C9F and G-CSF mRNA (IO). induction The mechanism was found to be at the transcriptional level (40). NF-GMa and NF-G Since Mb may be involved in G-C8F transcription, TNF-α of these proteins Analyze the reaction to the treatment. Human Maro Vein Endothelial (HUVE) Cells and Candylus Fibroblasts (FLOW) are both low-grade NF-GMa and barely detectable. Contains a certain amount of Nl-GMb. 100 ng/xc for any cell type G-C3F 40bp sequence of NF-GMa by treatment with TNF-α 93 and b). This increase is time dependent and 6 The maximum concentration is reached with time treatment and decreases to almost the standard concentration by 24 hours. NF- No consistent change was observed for 0M441 degrees (results not shown).

When transfected into FLOW cells, induction of NF-GMa is dependent on TNF-α. This can be correlated with the ability of existing GK-1 sequences to direct transcription. tk promo (, -C9F　4 copies upstream of the CK-1 sequence and the CAT reporter The plasmid containing the gene remains in high water for only 10-12 hours after TNF-α treatment of cells. It was transcribed in a similar manner (Fig. 10).

Therefore, in certain cell types, NF GMa is dependent on TNF-α under certain conditions. It is an inducible protein that may be involved in GM-CSP induction.

Those skilled in the art will be able to draw upon the invention reported herein to Changes and modifications other than the content may be readily made. The spirit and scope of this invention It is understood that all such changes and modifications contained in Should.

[References] 1. Metcalfe, Dl., Beckley, CG1., Johnson, G.R., Nicola, N. ,A., ,Badass, M.A., ,Lopez, A.F., ,Williamson, D.J., ,U. Ong, G. G., Clark, S. C., & Wamp, E. A. (1986). , Blood, vol. 67, pp. 37-45.

2. Badas, M., He0., Nifra, N.1., Metcalfe, D.L. (1983), Journal of Immunology, Vol. 130, pp. 795-79.

3. Lovetz, A.F., Williamson, D.J., Gamble, J.

R., Bekley, C.G., Berland, J., M., Klebanov, S.J. Waltersdorf, A1 Woni/G, G1, Clark, S C1 Badass, M, A , (1986), Journal of Clinical Research/＼Stigenjon , vol. 78, pp. 1220-1228.

4, Hübner-1K8, Isobe, Ml, Claus, C, M,, Gold, D, W., Kaufmann, S.E., Gasson, C6 (1985), Saye 230, pp. 1282-1285.

5. Miyatake, So, Otsuka, T3, Yokota, T1, Lee, R1, Arai, K 1, (1985), EMBO Journal, Vol. 4, pp. 2561-2568.

6. Le Beau, M.M., Westprczuk, C.A., Diaz, M.

0, Cason, R.A., , Lorey, J.D., , Gasson, J.

C3, Gold, D. W., Shah, C. J., (1986), Science. Volume 231, pages 984-987.

7. Rimalge, A1, Young, D.C., Griffin, J.D. (1987 ), Blood, vol. 69, pp. 1409-1413.

8, Wong, G C9, Reichik, J Sl, Temple, P, A, Wilke Ns, K. M., Leary, A. C., Luxembourg, D.

R3, Jones, S B9, Brown, E Lo, Kay, R, M,, All, E.C., Shoemaker, C8.Gold, D.W., Kaufman, R.J. , Huick, R.M., Wamp, E.A., Clark, S.C., (1985 ), Science, vol. 228, pp. 810-815.

9. Cheno, 1. S, Y., Huang, S. G., Gold, D. W., (198 3rd year), Proceedings of the National Academy of Sci. Sciences of the USA, Vol. 80, pp. 7006-7009.

10, Munker, R3, Gasson, J8, Ogawa, M8, Keffler, H, P , (1986), Nature (London), vol. 323, pp. 79-82.

11. Clark, S.C., Cason, R.1. (1987), Signs, 23. Volume 6, pages 1266-1237.

12. Torrens, B1, Marmod, J. J., Vassaly, B9, (1987 ), Cell, vol. 48, pp. 671-679.

H, Shaw, G2, Cason, R3, (1986), Cell, vol. 46, 659- 667 pages.

14, Chan 1.1. Y,, Slamon, D, J,, Naimah, S, D,, Go Lud, DWl, Gasson, J.C., (1986), Proceedings. of the National Academy of Sciences of the USA, Volume 83, pages 8669-8673.

15, Stanley, Eo, Metcalf, Dl, Sobieszczuk, P1 Gough, N. M., Dunn, A.R., (1985), EMBO Journal, Vol. 4, 25. pp. 69-2573.

16. Tucha, Ml., Kajiro, Yl., Nagata, Sl. (1987), Europe. Journal of Biochemistry, Vol. 165, pp. 7-12.

17, Maniatis, T1, Fritsch, E, F., Samplezuk, Jl. (19 Fl! 2nd year), Molecular Cloning A Laboratory Manual, Cold Spring Harbor-0】8. Huerte, Ko, Platzer, El, Le. , B8, Gavrilove, J.L., , Ray, El., Martelsmann, R9., Moore. , M.A.S. (1985), Proceedings of the National ・Academy of Sciences of the USA, Volume 82, 1529-1 530 pages.

19. Gadder, A.F., Kearney, D.N.l., Pan, P.A., Russell, E. ,in, ,Jaffe, E.S., ,Schechter, G.P., ,Gassion 1. J,G , (198-0), Blood, vol. 55, pp. 408-417.

20, Sharman, Ml., Wilde, C.D., Cora-1G1, (1978) ), Nature (London), vol. 276, pp. 269-270.

21. Asano, So., Rigler, (1981), Cancer Research, 41. Vol., pp. 1199-1204.

22, Dignam, J.D., Lepowitz, R.M., Radar, R1G1, (1983), Nucleitsk Acids Research, Vol. 11, 1475-14. 89 pages.

23. Jones, K.A., Yamamoto, K.R., Tujan, R1. (198 5), Cell, vol. 42, pp. 559-572.

24, Sen, Ro, Baltimore, Dl, (1986), Cell, vol. 46, 705. ~716 pages.

35, Land fee, No, Cabura, J B9, Soz car, P, W, (19 1986), Nature (London), vol. 323, pp. 548-551.

26, Stout, L, M,, Sink, Hl, Sen, R2, Wirth, To, -sha P.A., Baltimore, D.L. (1986), Nature (London). , vol. 323, pp. 640-643.

27. Royer, H. D., Reinhartz, E. L. (1987), Bron. Academics of the Nanoyonal Academy of Sciences ・The USA, Vol. 84, pp. 323-336.

28, Maniais, T1, Guttborn, Sl, Fischer, J.

A4, (1,987), Science, vol. 236, pp. 1237-1245.

29, Gutdborn, Sl, Burstein, Hl, Maniais, T1, (19 1986), Cell, vol. 45, pp. 601-610.

30, Twin, K1, Mania Nice, T6, (1986), Cell, vol. 45, 6 Pages 11-618.

31. Campbell, H.D., Immer, So., Fang, M.C., Young, T. , G., (1985), European Journal of Biochemistry -, vol. 150, pp. 297-304.

32, Holbrook, N. J7, Smith, K.A., Fornes, A.

Jl,Comeen,C,M,,Wiscocil,R,L,,Tarabtree,G,C , (1984), Proceedings of the National Academy of Sciences of the USA, Vol. 81, pp. 1634-1638.

33, Fuse, A1, Menta, T1, Yasumitsu, Hl, Comma, N1, Hasegawa, H8, Taniguchi, T1, (1984), Nucleitsk Acids Research, Volume 12, pages 9323-9331.

34, Nagata, Sl, Tsucha, Ml, Asano, Sl, Yamamoto, Ol, Hirata, T8, Kubota, N1, Oeda, H6, Nomura, Hl, Yamazaki, To, (19 (1986), EMBO-Journal, Vol. 5, pp. 575-581.

35, Kelso, A1, Metcalf, Dl, (1985), Experimenta. Le Hematology, vol. 13, pp. 7-15.

36, Gorman, C.M., Moffalto, L.F., Howard, B.)(,,( 1,982), Molecular and Cellular Biology, 2@, 1. Pages 044-1051.

37゜Rukov, B1, Shtsk, G1, (1987), Nukleitsk Ant. Research, vol. 15, p. 5490.

38, Wu, C1, Wilson, Sl, Walker, Bo, David, T1, Be Isley, T1, Zimarino, Ul, Ueda, Hl, (1987), Scien. 234, pp. 1247-1253.

39, Young, D.C., Wagner-1K0, Griffin, J.D., (1987 ), Journal of Clinical Investigation, Vol. 79, 10 Pages 0-106.

40, Schielentag, H3, Marmode, J, J, Montesano, R8, Ba Saari, Pl, (1987), EMBO-Journal, Vol. 6, 2261-2. 265 pages.

D -603 -457 -327 -210 -11 +52-96, -75 -23 -11 crossings 5’　MTTCTGATAAGGGCCAGGAGATTCCACAGTTCA GGTAGTTG3'31GAcTATTcccGGTcc:TCTAAGGT GTCAAGTCCATCAACTTAASIFtc, 2σ.

-411--1---- FtG, 2b.

EtG, Jσ.

PMA −+ −+ a---m"-・ Ftc;, Jb.

hlL-3f1'>7" et al., Tλ Akuko) GGAG gTTCCAt-G-TCAGcTAhG(SF　　　　　　　　　　　　　　　 cGAGATTccAhiaTTtcαcaAFIG, 4゜ 45-m m + NF-GMa Fig, 8° TNF/HUVE Kasun’eichi Time - 3624 I-m- , /'/G, 9σ TNF/FLOW first fertilizer Tokitoshi 1 -3624 One --- FtG, 9b.

Hands -・.

Auxiliary equipment translation submission form (Article 184-8 of the Patent Act) ■Display of patent application PCT/AU88100370 2. Name of the invention Regulation of GM-CSF gene expression 3. Patent applicant Name: Amrad Corporation Limited 4, Agent Address: 2-1-61 Twin 21M, Chuo District, Osaka City, Osaka Prefecture, 540 M)Dta Phone number (06) 949-1261 -603 -457 -327 -210 -11 Ten Party Day 5’ AATTCTGATAAGGG CCAGGAGATTCCACAGTT CAGGTAGTTG3'31GACTATTCCCGGTCCTCTAA(i GTGTCAAGTCCATCAACTTAA51F/c;, 1 PMA -+ -Ya Φ No.-j”L hIL-3C'f'>7L), made by Tosho, mark AGgTTCCAt-G-T CAGaTAF/G, 4° Gubi Kataka-GM-G-IL-3Ftc;,6゜ Ftc, 7° Fu;, 8゜ TNF/)4UVE ha! ! ? − RG,,9σ TNF/FLOW l::g3 release Haruma -3624 Submission of translation of written amendment (Article 184-7, Paragraph 1 of the Patent Act) March 29, 1990 Heavy enclosure

Claims (8)

[Claims] (1) Cells expressing granulocyte/macrophage colony stimulating factor (GM-CSP) control the expression of GM-CSF in cells, or contain CK-1 or CK-2. Expression of other hematopoietic cytokines in cells that express those cytokines A method for controlling the promoter region of the GM-CSF gene and its details. A method comprising a step of regulating binding to nuclear protein(s) within the vesicle. (2) The regulatory step involves the interaction between the promoter region and the nuclear protein(s). 2. The method of claim 1, comprising inducing or promoting binding. (3) The regulatory step involves the interaction between the promoter region and the nuclear protein(s). 2. The method of claim 1, comprising preventing or inhibiting binding. (4) The regulatory step is cytokine-1 in the promoter region of the GM-CSF gene ( CK-1) and/or cytokine-2 (CK-2) specific sequences. Claims involving the regulation of binding between a nuclear protein(s) and a nuclear protein(s) The method described in Section 1. (5) Regulatory steps span CK-1 and/or CK-2 specific sequences NF-GMa and 5. The method according to claim 4, comprising inducing the production of NF-GMb complexes and/or NF-GMb complexes. (6) Uniqueness of nuclear protein(s) in GM-CSF expressing cells; the promoter region of the GM-CSF gene in cells of an aberration or anomaly in the properties of the binding between the region and the nuclear protein(s) Diagnosis of diseases associated with abnormalities related to GM-CSF expression, including the detection step of Cutting method. (7) NF-GMa and/or NF-GMb in cell samples collected from patients The expression of GM-CSF includes a nuclear protein(s) detection step. How to diagnose related diseases. (8) Screening the effect of candidate substances on nuclear extracts using gel migration delay measurement method Generating GM-CSF in cells expressing GM-CSF, including the steps of control the binding of the child promoter region to the nuclear protein(s). A method for measuring active substances.