JP6875274B6 - Reverse genetics system of pitindevirus and how to use - Google Patents

Description

Cross-reference to related applications This application claims the interests of US Provisional Application No. 62 / 053,443 (filed September 22, 2014) and is incorporated herein by reference.
Government funding

The present invention was made with government support under AI083409, contributed by the National Institutes of Health. Government has specific rights to the invention.
Sequence listing

The application has a size of 45 KB and is electronically available to the U.S. Patent and Trademark Office via EFS-Web as an ASCII text file entitled "2015-09-22 Sequence Listing_ST25.txt" prepared on September 22, 2015. Contains the submitted sequence listing. By electronic application of the sequence listing, the sequence listing electronically submitted is a paper copy required by 37 CFR §1.821 (c) and a CRF required by §1.821 (e). Acts as both. The information contained in the sequence listing is incorporated herein by reference.

The arenavirus family includes a group of two segmented, enveloped RNA viruses with genomes encoding a total of four genes in opposite directions (Buchmeier et al., 2007, p. 1791-). 1827. In Knipe DM, Howley PM (ed.), Fields Vilogy, 5th ed. Lippincott Williams & Wilkins, Philadelphia, PA). The Z protein produced from the large (L) genomic segment is a small RING domain containing a matrix protein that mediates viral budding and also regulates viral RNA synthesis. The large L protein (about 200 kDa), which is also encoded in the L segment, is an RNA-dependent RNA polymerase (RdRp) protein required for viral RNA synthesis. The glycoprotein (GPC) encoded by the small (S) segment is processed into a stable signal peptide (SSP), receptor-bound G1 protein, and transmembrane G2 protein after translation. The S-segment nucleoprotein (NP) capsidates viral genomic RNA and is required for viral RNA synthesis and also suppresses the host's congenital immune response.

Arenavirus is a zoonotic RNA virus whose main natural host is rodents (see McLay et al., 2014, J Gen Virus 95 (Pt 1): 1-15 for an overview). .. Humans are infected with the arenavirus by direct contact with rodent excrement from damaged areas of the skin, eating food contaminated with rodent excrement, or inhaling dirty aerosols. there is a possibility. Only a few arenaviruses can cause human disease (see McLay et al., 2013, Antiviral Res 97: 81-92 for an overview). For example, lymphocytic choriomyelitis virus (LCMV) can cause diseases of the central nervous system, while Lassa virus (LASV) and some other arenaviruses are terminal shock and It can cause hemorrhagic fever, which can potentially lead to death. The options for treating these viral infections are limited. The only available antiviral drug (ribavirin) has some beneficial effects, but it has many side effects, and the symptoms are similar to influenza and are insidious, so the disease is often false. Despite being diagnosed with, it must be administered immediately after infection.
Due to the high containment requirements (BSL-4) for handling pathogenic arenaviruses and the costs associated with handling non-human primates, only limited vaccine studies have been conducted. There are currently no vaccines for these pathogenic arenaviruses, except for Candid # 1, which is not FDA approved but is available only for off-label use against the funin virus that causes Argentine hemorrhagic fever. Several safe and convenient systems (such as the pitindevirus model system) have been developed for studying arenavirus replication and etiology in conventional BSL-2 laboratories (Lan et al., 2009, J Virus 83: 6357-6362, Liang et al., 2009, Ann NY Acad Sci 1171 Suppl 1: E65-74, Kumar et al., 2012, Virology 433: 97-103, Wang et al., 2012. Virus 86: 9794-9801, McLay et al., 2013, J Virus 87: 6635-6634). Pitindevirus (PICV) was isolated from Colombian rice rats. Although pitindevirus does not cause disease in humans, it can cause symptoms such as hemorrhagic fever in guinea pigs, making it an ideal surrogate model for studying arenavirus-induced hemorrhagic fever. Serological evidence suggests a very low serological prevalence in humans (82 humans who are alive or working, closely related to the environment of infected rodents). Two of them and six of the 13 laboratory workers showed anti-PICV seropositive, but no obvious illness) (Trapido et al., 1971, Am J Trop Med Hyg 20:631). -641, Buchmeier et al., 1974, Infect Immun 9: 821-823). Thus, in the general human population, is there little pre-existing immunity to PICV, as opposed to LCMV, a very typical arenavirus with a serological prevalence of 2-5% in humans? , Or does not exist.

Buchmeier et al. , 2007, p. 1791-1827. In Knipe DM, Howley PM (ed.), Fields Technology, 5th ed. Lippincott Williams & Wilkins, Philadelphia, PA McLay et al. , 2014, J Gen Virol 95 (Pt 1): 1-15 McLay et al. , 2013, Antiviral Res 97: 81-92 Lan et al. , 2009, J Virol 83: 6357-6362 Liang et al. , 2009, Ann NY Acad Sci 1171 Suppl 1: E65-74 Kumar et al. , 2012, Virology 433: 97-103 Wang et al. , 2012, J Virol 86: 9794-9801 McLay et al. , 2013, J Virol 87: 6635-6634 Trapido et al. , 1971, Am J Trop Med Hyg 20: 631-641 Buchmeier et al. , 1974, Infect Immun 9: 821-823

Genetically modified pitindeviruses are provided herein. In one embodiment, the virus comprises three ambisense genomic segments. The first genomic segment contains a coding region encoding the Z protein and a coding region encoding the LRdRp protein. The second genomic segment contains a coding region encoding a nucleoprotein (NP) and a first restriction enzyme site. The third genomic segment contains a coding region encoding a glycoprotein and a second restriction enzyme site. In one embodiment, the NP protein comprises an amino acid sequence having at least 80% identity in SEQ ID NO: 3. In one embodiment, the nuclear protein comprises at least one mutation that reduces the exoribonuclease activity of the nuclear protein, which mutation is aspartic acid at about amino acid 380, glutamic acid at about amino acid 382, aspartic acid at about amino acid 525, about. Selected from histidine at amino acid 520 and aspartic acid at approximately amino acid 457, aspartic acid, glutamic acid, or histidine has been replaced with any other amino acid. In one embodiment, the glycoprotein comprises at least one mutation that alters the activity of the glycoprotein, the mutation being selected from asparagine at about amino acid 20 and about asparagine at amino acid 404, where asparagine is at any other amino acid. It has been replaced. D, E, or H has been replaced with any other amino acid.

In one embodiment, the second genomic segment comprises a plurality of cloning sites and the first restriction enzyme site is part of the plurality of cloning sites. The second genomic segment may further include a coding region encoding a first protein inserted into the first restriction enzyme cleavage site. In one embodiment, the third genomic segment comprises a plurality of cloning sites and the second restriction enzyme site is part of the plurality of cloning sites. In one embodiment, the third genomic segment may further comprise a coding region encoding a second protein inserted at the first restriction enzyme cleavage site. In one embodiment, the second genomic segment further comprises a coding region encoding a first protein inserted into the first restriction enzyme cleavage site, and the third genomic segment is the first It further comprises a coding region encoding a second protein inserted into the restriction enzyme cleavage site. In one embodiment, the first protein and the second protein are selected from antigens and detectable markers. In one embodiment, the antigen is a protein expressed by a viral, prokaryotic, or eukaryotic pathogen. The first protein and the second protein may be the same or different.

Aggregates of vectors are also provided herein. In one embodiment, the vector is a plasmid. In one embodiment, the aggregate is a first vector encoding a first genomic segment comprising a coding region encoding a Z protein and a coding region encoding an LRdRp protein, wherein the first genomic segment is described above. Is an antigenomic first vector and a second vector encoding a second genomic segment containing a coding region encoding a nuclear protein (NP) and a first restriction enzyme site. The second genomic segment is an anti-genomic second vector and a third vector encoding a third genomic segment containing a coding region encoding a glycoprotein and a second restriction enzyme site. The third genomic segment contains a third vector that is anti-genomic. In one embodiment, the NP protein comprises an amino acid sequence having at least 80% identity in SEQ ID NO: 3.

In one embodiment, the second genomic segment comprises a plurality of cloning sites and the first restriction enzyme site is part of the plurality of cloning sites. The second genomic segment may further include a coding region encoding a first protein inserted into the first restriction enzyme cleavage site. In one embodiment, the third genomic segment comprises a plurality of cloning sites and the second restriction enzyme site is part of the plurality of cloning sites. In one embodiment, the third genomic segment may further comprise a coding region encoding a second protein inserted at the first restriction enzyme cleavage site. In one embodiment, the second genomic segment further comprises a coding region encoding a first protein inserted into the first restriction enzyme cleavage site, and the third genomic segment is the first It further comprises a coding region encoding a second protein inserted into the restriction enzyme cleavage site. In one embodiment, the first protein and the second protein are selected from antigens and detectable markers. In one embodiment, the antigen is a protein expressed by a viral, prokaryotic, or eukaryotic pathogen. The first protein and the second protein may be the same or different.

Methods are also provided. In one embodiment, the method comprises making the genetically modified pitindevirus described herein. The method involves introducing an aggregate of vectors described herein into cells and incubating the cells in a medium under conditions suitable for expression in viral particles. It involves packaging the first, second, and third genomic segments within the viral particles. The method may also include isolating infectious viral particles from the medium.

A reverse genetics system for producing a genetically modified pitindevirus, wherein the system comprises three vectors, is also provided herein. The first vector encodes a first genomic segment containing a coding region encoding a Z protein and a coding region encoding an LRdRp protein, the first genomic segment being antigenomic and a second vector. Encodes a second genomic segment containing a coding region encoding a nuclear protein (NP) and a first restriction enzyme site, the second genomic segment being antigenomic and the third vector , Encoding a third genomic segment containing a coding region encoding a glycoprotein and a second limiting enzyme site, the third genomic segment being antigenomic. In one embodiment, the NP protein comprises an amino acid sequence having at least 80% identity in SEQ ID NO: 3.

In one embodiment, the method is conditions suitable for introducing the three vectors of the genomic segments described herein into the cell and for transcription of the three genomic segments and expression of the coding region of each genomic segment. Includes using a reverse genetics system that involves incubating the cells in. In one embodiment, the method also comprises isolating infectious viral particles made from cells, each infectious viral particle comprising the three genomic segments described above. In one embodiment, introduction involves transfecting cells with the three genomic segments described above. In one embodiment, introduction involves contacting the cell with an infectious viral particle containing the three genomic segments described above. In one embodiment, the cells are ex vivo, such as vertebrate cells.

In one embodiment, the vertebrate cell may be a mammalian cell such as a human cell, or the vertebrate cell may be a tricellular cell such as a chicken embryo fibroblast.

In one embodiment, the method comprises producing an immune response in the subject. The method comprises administering to the subject the infectious viral particles described herein, wherein the second genomic segment comprises a coding region encoding a first antigen and a third. The genomic segment further comprises a coding region encoding a second antigen. In one embodiment, the cells are ex vivo, such as vertebrate cells. In one embodiment, the vertebrate cell may be a mammalian cell such as a human cell, or the vertebrate cell may be a bird cell. The immune response may include a humoral immune response, a cell-mediated immune response, or a combination thereof. In one embodiment, the antigen is a viral pathogen, a prokaryotic cell pathogen, or a protein expressed by a eukaryotic cell pathogen, or a fragment thereof. Subjects may or are at risk of being exposed to viral, prokaryotic, or eukaryotic pathogens. In one embodiment, administration comprises administering at least two populations of infectious viral particles, each population of infectious viral particles encoding a different antigen.

Infectious viral particles described herein, and compositions comprising the infectious viral particles described herein, are also provided herein.
The present invention provides, for example, the following items.
(Item 1)
Three ambisensical genomic segments,
The first genomic segment contains a coding region encoding the Z protein and a coding region encoding the LRdRp protein.
The second genomic segment contains a coding region encoding a nucleoprotein (NP) and a first restriction enzyme site, and the third genomic segment contains a coding region encoding a glycoprotein and a second restriction enzyme site. Including and
The NP protein is a genetically modified pitindevirus comprising the genomic segment, comprising an amino acid sequence having at least 80% identity in SEQ ID NO: 3.
(Item 2)
The virus according to item 1, wherein the second genomic segment contains a plurality of cloning sites, and the first restriction enzyme site is a part of the plurality of cloning sites.
(Item 3)
The virus according to item 1, wherein the third genome segment contains a plurality of cloning sites, and the second restriction enzyme site is a part of the plurality of cloning sites.
(Item 4)
The virus according to item 1, wherein the second genomic segment further comprises a coding region encoding a first protein inserted into the first restriction enzyme cleavage site.
(Item 5)
The virus of item 1, wherein the third genomic segment further comprises a coding region encoding a second protein inserted into the first restriction enzyme cleavage site.
(Item 6)
The second genomic segment further comprises a coding region encoding a first protein inserted into the first restriction enzyme cleavage site, and the third genomic segment is the first.
Further contains a coding region encoding a second protein inserted into the restriction enzyme cleavage site of
The virus according to item 1.
(Item 7)
The first and second proteins are selected from antigens and detectable markers.
The virus according to item 4, 5, or 6.
(Item 8)
Item 7. The virus according to item 7, wherein the antigen is a protein expressed by a viral pathogen, a prokaryotic pathogen, or a eukaryotic pathogen.
(Item 9)
The virus according to item 6, wherein the first protein and the second protein are different.
(Item 10)
The virus according to item 6, wherein the first protein and the second protein are the same.
(Item 11)
The nuclear protein comprises at least one mutation that reduces the exoribonuclease activity of the nuclear protein, the mutation being in aspartic acid at about amino acid 380, glutamic acid at about amino acid 382, aspartic acid at about amino acid 525, about amino acid 520. The virus of item 1, wherein the aspartic acid, glutamic acid, or histidine is replaced with any other amino acid, selected from histidine, and aspartic acid at approximately amino acid 457.
(Item 12)
The glycoprotein comprises at least one mutation that alters the activity of the glycoprotein.
The virus of item 1, wherein the mutation is selected from asparagine at approximately amino acid 20 and asparagine at approximately amino acid 404, wherein the asparagine is replaced with any other amino acid.
(Item 13)
An infectious viral particle comprising the three genomic segments according to item 1.
(Item 14)
A composition comprising the isolated infectious virus particles according to item 13.
(Item 15)
The first vector encoding a first genomic segment comprising a coding region encoding a Z protein and a coding region encoding an LRdRp protein, wherein the first genomic segment is antigenomic. Vector,
A second vector encoding a second genomic segment comprising a coding region encoding a nuclear protein (NP) and a first restriction enzyme site, wherein the second genomic segment is antigenomic. 2 vectors, and a third vector encoding a third genomic segment containing a coding region encoding a glycoprotein and a second restriction enzyme site, wherein the third genomic segment is antigenomic. The third vector
Including
The NP protein is a collection of vectors containing an amino acid sequence having at least 80% identity in SEQ ID NO: 3.
(Item 16)
The aggregate according to item 15, wherein the vector is a plasmid.
(Item 17)
The aggregate according to item 15, wherein the plasmid further comprises a T7 promoter.
(Item 18)
The aggregate according to item 15, wherein the second genomic segment comprises a plurality of cloning sites, and the first restriction enzyme site is a part of the plurality of cloning sites.
(Item 19)
The aggregate according to item 15, wherein the third genomic segment comprises a plurality of cloning sites, and the second restriction enzyme site is a part of the plurality of cloning sites.
(Item 20)
The aggregate according to item 15, wherein the second genomic segment further comprises a coding region encoding a first protein inserted into the first restriction enzyme cleavage site.
(Item 21)
The aggregate according to item 15, wherein the third genomic segment further comprises a coding region encoding a second protein inserted into the first restriction enzyme cleavage site.
(Item 22)
The second genomic segment further comprises a coding region encoding a first protein inserted into the first restriction enzyme cleavage site, and the third genomic segment is the first.
Further contains a coding region encoding a second protein inserted into the restriction enzyme cleavage site of
The aggregate according to item 15.
(Item 23)
The first and second proteins are selected from antigens and detectable markers.
The aggregate according to item 20, 21, or 22.
(Item 24)
The aggregate according to item 23, wherein the antigen is a protein expressed by a viral pathogen, a prokaryotic cell pathogen, or a eukaryotic cell pathogen, or a fragment thereof.
(Item 25)
The aggregate according to item 22, wherein the first protein and the second protein are different.
(Item 26)
The aggregate according to item 22, wherein the first protein and the second protein are the same.
(Item 27)
To a collection of vectors according to item 15 is introduced into a cell, and said cells, and that the said first incubated in a medium at conditions suitable for expression, second, and third genomic segment A method for making a genetically modified pitindevirus, which comprises packaging.
(Item 28)
27. The method of item 27, further comprising isolating infectious virus particles from the medium.
(Item 29)
27. The method of item 27, wherein the cells express T7 polymerase.
(Item 30)
Item 27, an isolated infectious virus particle.
(Item 31)
A composition comprising the isolated infectious virus particles according to item 30.
(Item 32)
A reverse genetics system for producing a genetically modified pitindevirus containing three vectors.
The first vector encodes a first genomic segment containing a coding region encoding a Z protein and a coding region encoding an LRdRp protein, the first genomic segment being antigenomic, said first. Vector The second vector encodes a second genomic segment containing a coding region encoding a nuclear protein (NP) and a first restriction enzyme site, said second genomic segment being antigenomic. Vector of 2
The third vector encodes a third genomic segment containing a coding region encoding a glycoprotein and a second restriction enzyme site, wherein the third genomic segment is antigenomic. Including
The reverse genetics system, wherein the NP protein comprises an amino acid sequence having at least 80% identity in SEQ ID NO: 3.
(Item 33)
The reverse genetics system according to item 32, wherein each plasmid contains a T7 promoter.
(Item 34)
Introducing the three vectors of the genomic segment according to item 27 into the cell,
A method of using a reverse genetics system, which comprises incubating the cells under conditions suitable for transcription of the three genomic segments and expression of the coding region of each genomic segment.
(Item 35)
34. The method of item 34, further comprising isolating infectious viral particles produced from the cells, wherein each infectious viral particle comprises the three genomic segments.
(Item 36)
34. The method of item 34, wherein the introduction comprises transfecting the cells with the three genomic segments.
(Item 37)
It involves causing the infectious viral particles containing the three genomic segments is contacted with the cells The method of claim 34, wherein said introducing.
(Item 38)
34. The method of item 34, wherein the cells are ex vivo.
(Item 39)
34. The method of item 34, wherein the cell is a vertebrate cell.
(Item 40)
39. The method of item 39, wherein the vertebrate cell is a mammalian cell.
(Item 41)
40. The method of item 40, wherein the mammalian cell is a human cell.
(Item 42)
39. The method of item 39, wherein the vertebrate cell is a bird cell.
(Item 43)
42. The method of item 42, wherein the avian cells are avian embryo fibroblasts.
(Item 44)
Including administering to the subject the infectious virus particles according to item 13 or 30.
The second genomic segment further comprises a coding region encoding a first antigen inserted into the first restriction enzyme cleavage site, and the third genomic segment further contains the first restriction enzyme cleavage site. A method of producing an immune response in a subject that further comprises a coding region encoding a second antigen inserted into the site.
(Item 45)
44. The method of item 44, wherein the subject is a vertebrate.
(Item 46)
45. The method of item 45, wherein the vertebrate is a mammal.
(Item 47)
46. The method of item 46, wherein the mammal is a human.
(Item 48)
44. The method of item 44, wherein the vertebrate is a bird.
(Item 49)
44. The method of item 44, wherein the immune response comprises a humoral immune response.
(Item 50)
44. The method of item 44, wherein the immune response comprises a cell-mediated immune response.
(Item 51)
The antigen is a viral pathogen, a prokaryotic cell pathogen, or a protein expressed by a eukaryotic cell pathogen, or a fragment thereof, and the subject is exposed to the viral pathogen, the prokaryotic cell pathogen, or the eukaryotic cell pathogen. 44. The method of item 44, which has a risk of being virus.
(Item 52)
44. The method of item 44, wherein the administration comprises administering a population of at least two infectious virus particles, wherein each population of infectious virus particles encodes a different antigen.

2 Diagram of the reverse genetics system of plasmid PICV (Lan et al., 2009, J Virol 83: 6357-6362). A three-plasmid system for producing infectious PICV-rP18tri-GFP segmented into three. Adaptation of rP18tri-GFP virus. A549 or BHK-21 cells were infected with rP18tri-GFP virus for 24 hours and GFP expression was detected in the infected cells. The virus supernatant was collected and used to infect a fresh culture of BHK-21 cells. Again, GFP expression was detected. Viruses of rP18tri-GFP and rP18tri-RLuc, which are three segmented viruses in BHK-21 cells, at high moi (moi = 0.5) and low moi (moi = 0.01). Proliferation comparison. Generation of three segmented PICVs with influenza HA or NP antigens. Detection of GFP reporter gene product expressed from rP18tri-based vaccine vector and expression of influenza HA or NP protein. The rP18tri-based influenza vaccine confers protective immunity to mice. 1e5: 1 × 10 ⁵ ; 2e4: 2 × 10 ⁴ ; IP: Intraperitoneal. HAI titer induced by rP18tri-based influenza vaccine. HAI titers induced by rP18tri-GFP / HA virus by different vaccination routes. IN: Intranostril; IM: Intramuscular; IP: Intraperitoneal cavity. Protection provided by rP18tri-GFP / HA after different vaccination routes. Analysis of NP-specific CTL response by NP tetramer analysis. The kinetics of CD8 + T cell responses evoked after different vaccination pathways. The vaccine provided long-term immunity and protection. In rP18tri-GFP / HA 1 or 2 months after boost with the vaccine vector, C57BL6 mice were challenged with A / PR / 8 of 10 LD _50. A. HI titers on days 14 and 30 (dpp) after the first dose and on days 30 and 60 (dppb) after booster immunization. B. Viral titer in the lung at 6 dpi. C. Weight loss(%). D. H & E stained lung area. Protection conferred by the first dose of the rP18tri-GFP / HA vaccine vector. A. Neutralizing antibody titers after different doses of rP18tri-GFP / HA vaccination. B. Weight loss(%). C. H & E stained lung area. Plaque size, and expression of HA and NP from rP18tri-HA / NP and rP18tri-NP / HA. T cell and humoral responses elicited by vectors expressing dual antigens (HA and NP). A. An exemplary FACS plot _{for NP 336} tetramer ⁺ CD44 ⁺ CD8 ⁺ T cells in mouse blood 7 days after vaccination. B. ^{Percentage of NP-specific CD8 +} T cells in peripheral blood tested by tetramer staining 7 days after initial dosing and 7 days after booster immunization. C. The HI assay of sera collected at different time points was used to measure the titers of virus neutralizing antibodies. Protection provided by an rP18tri-based vaccine expressing both influenza viruses HA and NP. A. Initial dose of either rP18tri-GFP / GFP, rP18tri-HA / NP or rP18tri-NP / HA-Stained lung portion from animals vaccinated by booster immunization. B. Viral titer in the lung. C. Weight loss (%) after administration of PR8 antigen. A humoral response in C57BL6 and Balb / c mice induced by an rP18tri-based vector vaccine that expresses both H1N1 and H3N2 influenza virus subtype HA proteins. Intramuscular mice were given either rP18tri-GFP / GFP or 10 ⁴ pfu of rP18tri-GFP / HA, rP18tri-GFP / HA3 and rP18tri-HA / HA3 with a two-week period of initial and booster immunization. It was inoculated twice by administration. Serum samples were collected 2 weeks after booster and analyzed for HI titers against PR8 (H1N1) and X31 (H3N2) antigen-administered viruses. Δ represents the HI titer 2 weeks after the initial administration, and ● represents the HI titer 2 weeks after the booster immunization. Left panel: HI titer on C57BL6 mice. Right panel: HI titer in Balb / c mice. Protection against double influenza virus antigen administration. Mice were vaccinated with 10 ⁴ pfu / mL rP18tri-HA / HA3. Viral titers in the lungs were measured 5-6 days after administration of the viral antigen. A. The graph shows the virus titer when antigen is administered by either PR8 or X31 influenza virus. B. Weight loss after challenge with X31 of A / PR / 8 or ¹⁰ 5 pfu of 10 LD _50. C. A / PR / 8 virus 10 LD _50, and ¹⁰ 5 lung recovered after 6 days of challenge with X31 of pfu, portions stained with H & E. The rP18tri vector elicits a stronger CTL response after booster immunization. Recombinant NP RNase mutant virus induced the production of type I IFN in infected cells. (A) Alanine substitution mutations at each of the five catalytic residues abolished the ability of PICV NP to suppress Sendai virus-induced IFNβ activation (Qi et al., 2010, Nature 468: 779-783). ). In 293T cells, with an empty vector or each NP plasmids, introduced LUC plasmid and β galactoside da Zepurasumido towards IFNβ promoter was followed by Sendai virus infection. The LUC activity was measured and normalized to transfection efficiency by β galactoside Dark-peptidase activity. The results shown are the average of three independent experiments. Expression of WT (rP2 and rP18) and mutant PICV NP protein was detected by Western blotting using anti-myc antibody. (B) Recombinant PICV RNase mutant virus produced large amounts of type I IFN during viral infection. A549 cells were either mock-infected or infected with an exemplary recombinant PICV virus with a MOI of 1. Supernatants were collected at 12 hpi and 24 hpi, UV treated to inactivate virus particles and the amount of IFN was measured through an rNDV-GFP based biological assay. An exemplary GFP image (B) and an average GFP value (C) including standard deviations from three independent experiments are shown. NP RNase activity is required for PICV replication in IFN competent cells in vitro and for PICV infection in vivo. (A) Viral growth rate in IFN-deficient tongue and IFN competent A549 cells. Cells were infected with their respective viruses at a MOI of 0.01. At different times after infection, the viral titers of the supernatant were quantified by a plaque assay. The results shown are the average of three independent experiments. (B) Survival rate (left panel) and normalized body weight (right panel) of each recombinant PICV virus-infected guinea pig (n = 6). A statistical analysis of the survival curve was performed using the Logrank (Mantel-Cox) χ ^{2 test using the GraphPad Prism 5 software. ***} , p <0.001. ^** , p <0.01. The body weight of each animal was monitored daily and normalized for day 0. The results shown are average body weight normalized for each group. The PICV NP RNase mutant elicited a strong IFN response, blocking the establishment of viral infection. Guinea pigs were ^{intraperitoneally infected with 1 × 10 4} pfu of each recombinant virus (n = 3 animals per virus group) on days 1 and 3. (A) Viral titers in liver and spleen at 1 and 3 dpi. (B) The amount of type I IFN and selective interferon stimulating gene (ISG) in peritoneal cells on day 1 was measured by quantitative real-time PCR. Primer sequences are provided upon request. Each point represents one animal. Statistical analysis was performed by Student's t-test. Generation of rP18tri expressing double-antigen influenza HA and NP. (A) Schematic of rP18tri vector, rP18tri-P / H, and rP18tri-H / P expressing the double antigens HA and NP of influenza A virus (IAV) A / PR8 in the S1 and S2 segments. IGR: Intergenic region. (B) The rP18tri dual antigen vector expresses both HA and NP, as shown by the Immunofluorescence Assay (IFA). (C) Growth curve analysis of recombinant virus expressing dual antigen in BHK-21 cells. The HA / NP dual antigen expressing the vaccine vector can induce protective immunity in mice. A group of C57BL6 mice (n = 3) was ^{administered a 1 × 10 4} pfu, corresponding rP18tri vector twice, and a 10 × MLD ₅₀ (median lethal dose) mouse-adapted influenza A / PR8 virus was intranasally administered. (IN) Antigen was administered. The body weight (A) and the lung titer (B) of the virus at 3 and 6 dpi are shown. The H1 / H3 dual antigen vector induces a balanced HA neutralizing antibody. (A) Schematic of an rP18tri vector expressing eGFP and H1 HA (rP18tri-G / H1), eGFP and H3 HA (rP18tri-G / H3), and H1 and H3 (rP18tri-H3 / H1). (B) rP18tri-H3 / H1 induces a balanced neutralizing antibody against both H1 and H3 HA subtypes. Groups of C57BL6 (top) and Balb / c mice (bottom) were immunized twice with the rP18tri vector (n ≧ 3), respectively, by the IM pathway. Blood collected 14 days after initial dose and booster immunization was quantified by HAI assay for the amount of neutralizing antibody against A / PR8 (H1N1) and A / x31 (H3N2). Induction of hetero-subtype neutralizing antibody by prime boost method using different HA subtypes. (A) Schematic of an rP18tri vector expressing A / PR8 NP with either H1 HA from A / PR8 (rP18tri-P / H1) or H3 HA from A / x31 (rP18tri-P / H3). .. (B) NP-specific CTL increased during booster immunization. C57BL6 mice were initially administered with rP18tri-P / H1, boosted with rP18tri-P / H3 at 14-day intervals, and boosted again with rP18tri-P / H1. NP-specific effector T cells 7 days after the first dose (dpp), the first booster (dppb), and the second booster (dppb2) were quantified by established NP tetramer analysis. (C) Neutralizing antibodies against A / PR8 (H1), A / x31 (H3), and A / WSN (heterosubtype H1) after initial administration and booster immunization were quantified by HAI assay. The rP18tri vector can elicit both humoral and T cell responses by the oral pathway. A group of BL6 mice was immunized twice with either the rP18tri-G (n = 3) vector or rP18tri-P / H (n = 4) by oral feeding. NP-specific effector T cells (A) and H1-specific neutralizing antibodies (B) at different days after initial dose or booster immunization are shown. dpp: days after initial administration; dpp: days after booster immunization. The inactivated rP18tri vector can elicit both humoral and T cell responses. Twice groups of C57BL6 mice with rP18tri-G vector (n = 3), hydrogen peroxide-inactivated rP18tri-P / H (n = 3), and live rP18tri-P / H (n = 1), respectively. Immunized. NP-specific effector T cells (left panel) and neutralizing antibodies (right) at different days after immunization are shown. dpp: days after initial administration; dpp: days after booster immunization. The rP18tri vector is non-pathogenic in guinea pigs and can protect animals from lethal antigen administration of the WT rP18 virus. (A) rP18tri-G does not cause malignant infections in guinea pigs. A group of Hartley guinea pigs (n = 3) was either mock-infected (PBS) or infected with WT rP18 (1 × 10 ⁴ pfu) or rP18tri-G (1 × 10 ⁶ pfu) by IP route. Body weight was monitored daily and normalized for day 0 (left panel). Rectal temperature is displayed on the right. (B) Guinea pigs immunized with rP18tri-G protected against lethal doses of rP18 antigen administration. A group of guinea pigs (n = 3) was ^{infected with either PBS or rP18tri-G (1 × 10 4} pfu) via the IP route, and 14 days later, 1 × 10 ⁴ pfu of WT rP18 virus was antigen-administered. Shows normalized body weight (left panel) and rectal temperature (right panel). Temperatures above 39.5 ° C. are considered to be exothermic.

A reverse genetics system for producing a genetically modified pitindevirus is provided herein. The genetically modified pitindevirus-based reverse genetics systems described herein have several advantages over other arenavirus systems. Pitindevirus is not known to cause disease in humans, and there is evidence in a laboratory setting that pitindevirus can cause asymptomatic human infections. For example, 46% of laboratory personnel who handle viruses are serum-positive but do not show a definite illness (Buchmeier et al., 2007, Arenaviridae: the viruses and their replication. In: Knipe and Howley (eds), Philadelphia. Virus. 5th ed. Philadelphia, PA: Lippincott Williams & Wilkins.pp. 1791-1827). Buchmeier et al. The modified pitindevirus described herein is further attenuated as compared to the parental virus used in the human infectious disease study reported by. The modified pitindevirus is genetically stable during continuous passage in cell culture. The general human population is not known to be pre-exposed to pitindevirus and lacks existing immunity to this pitindevirus vector, making it an ideal vector for vaccine development. .. As used herein, "genetically modified" and "genetically modified" mean pitindevirus that has been modified and is not found in any natural setting. For example, the genetically modified pitindevirus is a pitindevirus into which an exogenous polynucleotide such as a restriction endonuclease site has been introduced. Another example of a genetically modified pitindevirus is a pitindevirus that has been modified to contain three genomic segments.

The reverse genetics system for this modified pitin devirus comprises two to three genomic segments. The first genomic segment contains two coding regions, one encoding the Z protein and the second encoding the RNA-dependent RNA polymerase (LRdRp). The second genomic segment contains a coding region encoding a nucleoprotein (NP) and may contain at least one restriction enzyme site, such as a plurality of cloning sites. The third genomic segment contains a coding region encoding a glycoprotein and may contain at least one restriction enzyme site, such as a plurality of cloning sites. A "coding region" is a nucleotide sequence that encodes a protein and expresses the encoded protein when placed under the control of an appropriate regulatory sequence. As used herein, the term "protein" broadly means a polymer of two or more amino acids linked by peptide bonds. The term "protein" is covalent or non-covalent as a molecule containing two or more proteins linked by a disulfide bond, an ionic bond, or a hydrophobic interaction, or as a multimer (eg, dimer, tetramer). It also includes a complex of proteins bound by binding. Therefore, the terms "peptide", "oligopeptide" and "polypeptide" are all included in the definition of protein, and these terms are used interchangeably. These terms do not mean a polymer of amino acids of a particular length, and also suggest or distinguish whether the protein was made using recombinant techniques, chemistry or enzymatic synthesis, or is naturally occurring. Should also be understood as not intended.

The Z protein, LRdRp, NP protein, and glycoprotein are encoded by pitindevirus. The Z protein is a small RING domain containing a matrix protein that mediates viral budding and also regulates viral RNA synthesis. An example of the Z protein from pitindevirus is the sequence (SEQ ID NO: 1) available at Genbank Accession No. ABU3990.1.1. The LRdRp protein is an RNA-dependent RNA polymerase required for viral DNA synthesis. An example of an RNAdRp protein from pitindevirus is the sequence (SEQ ID NO: 2) available at Genbank accession number ABU3991.1.1. The NP protein capsidates viral genomic RNA, is required for viral RNA synthesis, and also suppresses the host's congenital immune response. An example of an NP protein from pitindevirus is the sequence (SEQ ID NO: 3) available at Genbank Accession No. ABU39909.1. Glycoproteins are processed into stable signal peptides (SSPs), receptor-bound G1 proteins, and transmembrane G2 proteins after translation. An example of a glycoprotein from pitindevirus is the sequence (SEQ ID NO: 4) available at Genbank Accession No. ABU39908.1.

Other examples of Z proteins, LRdRp proteins, NP proteins, and glycoproteins are proteins that are structurally similar to proteins encoded by pitindevirus, such as SEQ ID NOs: 1, 2, 3, and / or 4. Can be mentioned. The structural similarities of the two polypeptides align the residues of the two polypeptides (eg, the candidate polypeptide and the reference polypeptide described herein) and are identical along the length of these sequences. It can be determined by optimizing the number of amino acids in; aligning the gaps in either or both sequences to optimize the number of identical amino acids (although the amino acids in each sequence are still appropriate). Must be in order). The reference polypeptide may be a polypeptide described herein, such as SEQ ID NO: 1, 2, 3, or 4. The candidate polypeptide is a polypeptide that is compared to the reference polypeptide. Candidate polypeptides can be isolated from animal cells, such as mice, can be made using recombinant techniques, or can be synthesized chemically or enzymatically. Candidate polypeptides may be deduced from the nucleotide sequences present in the pitindevirus genome.

Unless otherwise modified herein, pairwise comparative analysis of amino acid sequences is performed by Titiana et al. , (FEMS Microbiol Lett, 174, 247-250 (1999)), and is performed using the Blastp program, which is a Blastp suite-2sequences search algorithm available on the National Center for Biotechnology Information (NCBI) website. be able to. General parameters: Expected threshold = 10, Word size = 3, Short query = On, Scoring parameters: Matrix = BLASTUM62, Gap cost = Existence: 11 Elongation: 1, Composition adjustment = Conditional composition score matrix adjustment, etc. You may use the initial values for all blastp suite-2sequences search parameters. Alternatively, polypeptides may be compared using the BESTFIT algorithm of the GCG package (version 10.2, Madison WI).

In comparing two amino acid sequences, structural similarity may be referred to as% "identity" or% "similarity". "Identity" means the presence of the same amino acid. "Similarity" means not only the presence of the same amino acid, but also the presence of conservative substitutions. Conservative substitutions for amino acids in the polypeptides described herein may be selected from other components of the class to which the amino acids belong. For example, an amino acid belonging to a group of amino acids having a particular size or characteristic (eg, charge, hydrophobicity and hydrophilicity) may be associated with another amino acid without altering the activity of the protein, especially the region of the protein that is not directly related to biological activity. It is known in the technical field of protein biochemistry that it can be replaced. For example, non-polar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan, and tyrosine. Polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine and glutamine. Positively charged (basic) amino acids include arginine, lysine and histidine. Negatively charged (acidic) amino acids include aspartic acid and glutamic acid. Conservative substitutions include, for example, the substitution of Lys with Arg (and vice versa) to maintain a positive charge; the substitution of Glu with Asp (and vice versa); maintaining free-OH. , Replacement of Ser with Thr; and replacement of Gln with Asn, which maintains free-NH2.

By using a readily available algorithm such as ClustalW to identify the storage region of the Z protein, those skilled in the art can use the Z protein set forth in SEQ ID NO: 1 to obtain the Z protein from Lassa virus (O7355.7). It will be appreciated that it can be compared with Z proteins from other arenaviruses such as LCMV Armstrong (AAX49343.1) and funinvirus (NP_899216.1). ClustalW is a multiple sequence alignment program for nucleic acids or proteins that produces multiple sequence alignments of different biologically significant sequences (Larkin et al., 2007, ClustalWand ClustalX version 2, Bioinformatics, 23. (21): 2947-2948). Using this information, one of ordinary skill in the art would be able to quickly make reasonable predictions that certain conservative substitutions for the Z protein, such as SEQ ID NO: 1, do not reduce the activity of the polypeptide. ..

Those skilled in the art have used a readily available algorithm, such as CrystalW, to identify the conserved region of the LRdRp protein, and have used the LRdRp protein set forth in SEQ ID NO: 2 to obtain the LRdRp protein from Lassa virus (AAT49002.1. It will be appreciated that it can be compared with RNAdRp proteins from other arenaviruses such as LCMV Armstrom (AAX49344.1) and funinvirus (NP_899217.1). Using this information, one of ordinary skill in the art can quickly make reasonable predictions that certain conservative substitutions for LRdRp proteins such as SEQ ID NO: 2 will not reduce the activity of the polypeptide. Let's do it.

Those skilled in the art have used a readily available algorithm such as ClustalW to identify the conserved region of the NP protein and used the NP protein set forth in SEQ ID NO: 3 to the Lassa virus (P13699.1), LCMV Armstrong. It will be appreciated that it can be compared with NP proteins from other arenaviruses such as (AAX49342.1) and funinvirus (NP_899219.1). Using this information, one of ordinary skill in the art will be able to quickly make reasonable predictions that certain conservative substitutions for NP proteins such as SEQ ID NO: 3 will not reduce the activity of the polypeptide. ..

Those skilled in the art have used a readily available algorithm, such as CrystalW, to identify the storage regions of glycoproteins, using the glycoproteins set forth in SEQ ID NO: 4, Lassa virus (P08669), LCMV Armstrong (AAX49341). It will be appreciated that it can be compared with glycoproteins from other arenaviruses such as .1) and funinvirus (NP_899218.1). Using this information, one of ordinary skill in the art will be able to quickly make reasonable predictions that certain conservative substitutions for glycoproteins such as SEQ ID NO: 4 will not reduce the activity of the polypeptide. ..

Thus, as used herein, pitindevirus Z protein, LRdRp protein, NP protein, or glycoprotein is at least 50%, at least 55%, at least 60%, at least 65%, at least in the reference amino acid sequence. 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94% , At least 95%, at least 96%, at least 97%, at least 98%, or at least 99% amino acid sequence similarity. Alternatively, as used herein, pitindevirus Z protein, LRdRp protein, NP protein, or glycoprotein is at least 50%, at least 55%, at least 60%, at least 65%, at least in the reference amino acid sequence. 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94% , At least 95%, at least 96%, at least 97%, at least 98%, or at least 99% amino acid sequence identity. Unless otherwise specified, "pitindevirus Z protein", "pitindevirus LRdRp protein", "pitindevirus NP protein", and "pitindevirus glycoprotein" are respectively. It means a protein having at least 80% amino acid identity to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4.

The pitindevirus Z protein, LRdRp protein, NP protein, or glycoprotein, which have structural similarities to the amino acid sequences of SEQ ID NO: 1, 2, 3, or 4, respectively, have biological activity. As used herein, "biological activity" means the activity of a Z protein, LRdRp protein, NP protein, or glycoprotein that produces infectious viral particles. The biological role of each of these proteins in the biosynthesis of infectious viral particles is known, and assays for measuring the biological activity of each protein are also known.

In one embodiment, the NP protein may contain one or more mutations. Mutations in the NP protein continue to maintain the ability to produce infectious virus particles, but can result in NP protein in which cells infected with pitindevirus have a reduced ability to suppress certain cytokine production. .. Pitindevirus, which has a reduced ability to suppress cytokine production, is expected to be useful in improving the immune response to the antigen encoded by the virus. Examples of mutations include aspartic acid at residue 380, glutamic acid at residue 382, aspartic acid at residue 457, aspartic acid at residue 525, and histidine at residue 520. Those skilled in the art will appreciate that the exact location of these mutations may vary between different NP proteins depending on the presence of small insertions or deletions in the NP protein, so the exact location of the mutations is approximate. And you will recognize that it can change with 1, 2, 3, 4, or 5 amino acids.

In one embodiment, the mutation in the NP protein may be a substitution of aspartic acid, glutamic acid, or histidine with any other amino acid at residues 380, 382, 457, 525, and / or 520. In one embodiment, the mutation may be a conservative substitution of aspartic acid, glutamic acid, or histidine at residues 380, 382, 457, 525, and / or 520. In one embodiment, the mutation may be the substitution of aspartic acid, glutamic acid, or histidine with glycine or alanine at residues 380, 382, 457, 525, and / or 520. In one embodiment, the NP protein may contain 1, 2, 3, or 4 mutations of residues 380, 382, 457, 525, or 520, and in one embodiment, the NP protein has 5 residues. May include mutations in all.

In one embodiment, the glycoprotein may contain one or more mutations. Mutations in glycoproteins can result in glycoproteins that reduce viral spread in vivo. Examples of mutations include asparagine at residue 20 and / or asparagine at residue 404. Those skilled in the art will appreciate that the exact location of these mutations can vary between different glycoproteins depending on the presence of small insertions or deletions in the glycoprotein, so the exact location of the mutations is approximate. And you will recognize that it can change with 1, 2, 3, 4, or 5 amino acids.

In one embodiment, the mutation in the glycoprotein may be the substitution of asparagine residues 20 and / or 404 with any other amino acid. In one embodiment, the mutation may be a conservative substitution of asparagine residues 20 and / or 404. In one embodiment, the mutation may be the substitution of asparagine residues 20 and / or 404 with glycine or alanine.

The proteins described herein may also be identified in terms of the polynucleotide encoding the protein. Accordingly, the present disclosure relates to a polynucleotide that encodes a protein described herein or, under standard hybridization conditions, hybridizes to a polynucleotide that encodes a protein described herein, and such poly. A complement of the nucleotide sequence is provided. As used herein, the term "polynucleotide" means a nucleotide of any length in polymer form, either a ribonucleotide or a deoxynucleotide, of double-stranded and single-stranded DNA and RNA. Includes both. Polynucleotides may include nucleotide sequences with different functions, including, for example, coding sequences and non-coding sequences such as regulatory sequences. Polynucleotides can be obtained directly from natural sources or can be prepared using recombination, enzymes, or chemical techniques. Polynucleotides can have a linear or cyclic topology. The polynucleotide can be part or a fragment of a vector, such as an expression or cloning vector. An example of a polynucleotide is a genomic segment.

An example of a nucleotide encoding the Z protein is nucleotide 85-372 of the sequence (SEQ ID NO: 5) available at Genbank Accession No. EF52947.1, and an example of a polynucleotide encoding the LRdRp protein is Genbank. An example of a polynucleotide encoding the NP protein, which is a complement of nucleotides 443 to 7027 of the sequence (SEQ ID NO: 5) available at accession number EF52947.1, is available at Genbank accession number EF527746.1. An example of a polynucleotide that is a complement to nucleotides 1653 to 3338 of the sequence (SEQ ID NO: 6) and encodes a glycoprotein is of the sequence (SEQ ID NO: 6) available at Genbank Accession No. EF52946.1. Nucleotides 52 to 1578. The polynucleotide encoding the Z protein, LRdRp protein, NP protein, or glycoprotein represented by SEQ ID NO: 1, 2, 3, or 4, respectively, is in the nucleotide sequence disclosed in SEQ ID NO: 5 or 6. It should be understood that, without limitation, also includes the class of polynucleotides encoding such proteins as a result of genetic code degradation. For example, the natural nucleotide sequence number: 5 is only a component of the nucleotide sequence category encoding a protein having amino acid sequence number 1 and a protein having amino acid sequence number 2. The category of nucleotide sequences encoding the sequences of selected proteins is large but finite, and the nucleotide sequences of each component of each category can be rapidly measured by those skilled in the art by reference to the standard genetic code. Here, it is known that tribases (codons) of different nucleotides encode the same amino acid.

As used herein, references to the polynucleotides described herein and / or references to nucleic acid sequences of one or more SEQ ID NOs are at least 60%, at least 65% of the identified reference polynucleotide sequence. %, At least 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, It can include polynucleotides having at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity.

In this context, "sequence identity" means identity between two polynucleotide sequences. Sequence identity generally aligns the bases of two polynucleotides (eg, aligning the nucleotide sequence of a candidate sequence with a nucleotide sequence containing, for example, a nucleotide sequence encoding the protein of SEQ ID NO: 1, 2, 3, or 4). And are measured by optimizing the number of identical nucleotides along the length of these sequences; gaps in either or both sequences to optimize the number of shared nucleotides. Align (however, the nucleotides in each sequence must still maintain the proper order). The candidate sequence is a sequence to be compared with a known sequence, eg, a nucleotide sequence containing a suitable nucleotide sequence selected from SEQ ID NO: 5 or 6, etc. For example, the two polynucleotide sequences are described in Tatiana et al. , FEMS Microbiol Lett. , 1999; 174: 247-250, ncbi. nlm. nih. Comparisons can be made using the BLASTn program of the BLAST 2 search algorithm available on the gov / BLAST / worldwide web. Match reward (reward for match) = 1, mismatch penalty = -2, open gap penalty = 5, extension gap penalty = 2, gap x_dropoff = 50, expectation = 10, word size = 11, and filter-on, etc. Initial values for BLAST 2 search parameters may be used.

In one embodiment, the second and / or third genomic segment may each independently contain a "restriction enzyme cleavage site" or a "plurality of cloning sites" having two or more restriction enzyme cleavage sites.

In one embodiment, the second and / or third genomic segment may each independently contain an additional coding region that encodes a protein such as an antigen. Thus, the second genomic segment may include a coding region encoding a nuclear protein and a second coding region encoding an antigen. Similarly, the third genomic segment may include a coding region encoding a glycoprotein and a second coding region encoding an antigen. The second and third genomic segments may encode the same or different antigens. In both the second and third genomic segments, this second coding region may be inserted into existing restriction enzyme cleavage sites, such as restriction enzyme cleavage sites present at multiple cloning sites. The second coding region that may be present in the second and / or third genomic segment is not intended to be limiting.

In one embodiment, the second coding region may encode a protein useful as an antigen capable of eliciting an immune response in a subject. Examples 1, 2, and 3 show the use of influenza nucleoprotein and influenza hemagglutinin as model antigens to show the effects of the reverse genetics system and virus disclosed herein, and thus the same antigens. Gender is not intended to be limiting. Examples of antigens are prokaryotic cells, eukaryotic cells (eg, fungi, yeasts, or protozoa, etc.), or full-length proteins encoded by viruses, or fragments thereof. In one embodiment, the protein may be a protein that is naturally expressed by a pathogen such as a viral pathogen, a prokaryotic pathogen, or a eukaryotic pathogen. Antigen proteins encoded by prokaryotic cells, eukaryotic cells, or viruses are known to those of skill in the art. Another example of an antigen is a protein that contains one or more epitopes upon modification. In one embodiment, the protein may be a protein expressed by tumor cells or is present in the tumor environment.

Examples of prokaryotic pathogens for which antigens are available include Gram-negative and Gram-positive pathogens. Examples of Gram-negative pathogens include enterobacteriaceae such as members of the family Enterobacteriaceae (eg, members of the family Enterobacteriaceae who are members of the E. coli or Salmonella family). Examples of enteric pathogens, a member of the family Enterobacteriaceae, members of the family Vibrionaceae (e.g. Vibrio cholerae and the like), and Campylobacter species (e.g., Campylobacter jejuni, and the like). Examples of preferred members of the family Enterobacteriaceae, for example, E. coli, Shigella species, Salmonella species, Proteus species, Klebsiella species (e.g. Klebsiella pneumoniae), Serratia species, and Yersinia species. Examples of E. coli strains include, for example, E. coli serotypes O1a, O2a, O78, and different O: H serotypes such as O157, 0104, 0111, 026, 0113, 091, K88 +, F4 +, F18ab +, and F18ac +. Hemolytic strains of Escherichia coli, such as intestinal toxinogenic Escherichia coli, and non-hemolytic strains such as 987P, F41, and K99. As used herein, the term "strain" has a different genotype and / or phenotype refers to a member of the microbial species. Other examples of E. coli, foodborne in humans, and Mizunakadachi through of five categories of diarrheal E. coli cause disease: enteropathogenic (EPEC), enterohemorrhagic (EHEC), enterotoxigenic (ETEC), enterohemorrhagic (EIEC), and enterohemorrhagic (EAEC) strains. Other Gram-negative microorganisms include members of the Pasteurella family , preferably Pasteurella species such as P. multocida and Manhemia hemorichica , and members of the Pseudomonas family such as Pseudomonas species including Pseudomonas aeruginosa. Still other gram-negative microorganisms, Bordetella species, Burkholderia species, Chlamydia species, Enterobacter species, Helicobacter (Helobacter) species, Histoplasma Fi Cruccuris (Histophilus) species, Moraxella species, Legionella species, Leptospira (Leptospiria) species, rickettsia species, Treponema (Treponnema) species, Neisseria species, Actinobacillus species, Haemophilus species, Maikobakuteri A (Myxcobacteria) species, Suporokitofaga species, chondroitinase Lactococcus (Chondrococcus) species, site fur moth species, Flexi Acetobacter species, Flavobacterium species , Aeromonas species . Examples of Yersinia species include Yersinia pestis, Y. pestis. pseudotuberculosis, and Y. et al. Enterocolica can be mentioned. Examples of Fusobacterium species belonging to the family Fusobacterium include F. necrophorum (including subspecies F. necrophorum subsp. Necrophorum and F. necrophorum subsp. Funduforme), F. necrophorum. nucleatum, F. nucleatum, F. nucleatum. canifelinum, F. et al. gondiaformans, F.M. Mortiferum, F. et al. naviforme, F.M. necrogenes, F. et al. russi, F.R. ulcerans, as well as F. Variu can be mentioned.

Examples of Gram-positive pathogens include members of the Micrococcus family , including Staphylococcus aureus species such as Staphylococcus aureus. Other gram-positive pathogens include Streptococcus agalactiae, Streptococcus uberis, Streptococcus bovis, Streptococcus equui, Streptococcus zoococcus, Streptococcus zoococcus, etc. Other gram positive microbes that can obtain the antigen, Bacillus species, Clostridium species, Corynebacterium species, Erysipelothrix species, Listeria species, and a mycobacterial species. Other Gram-positive pathogens, Korinebakuteri um family, Enterococcus family, Micrococcus family, mycobacteria family, Nocardia family, and include members of Peputokokkasu family, Actinomyces species, Bifidobacterium species, Enterococcus species, Eubacteria species , Kitokokkasu (Kytococcus) species, lactic acid bacteria species, Micrococcus species, Mobirunkasu species, mycobacterial species, Peptostreptococcus species, and Propionibacterium species, Gardnerella species, mycoplasma, Nocardia (Norcardia) species, Streptomyces species, Borrelia species, and a bacterial species consuming Bacillus species, or the like.

Examples of pathogenic protozoa include intestinal protozoa, genitourinary protozoa, systemic protozoa, and extraintestinal protozoa. As specific examples, for example, Entamoeba histolytica, Giardia lamblia, Cryptosporidium parvum, Cystoisospora belli, Cyclospora cayetanensis, a member of the fine spore insect Gate, Trichomonas parasite, falciparum parasite, Toxoplasma gondii, a member of the subclass Coccidiosis (for example, E. acervulina, E. Neka trix, E. member of Eimeria such as E. tenella), nematodes, trematodes, as well as tapeworms include, but are not limited to.

Examples of viral pathogens include members of the family Rabdovirus (such as vesicular sputitis virus VSV), members of the genus Aftvirus (such as FMDV of mouth- felt virus), members of the genus Pestivirus (such as bovine viral diarrhea virus), and Arteri. A member of the viral family (porcine reproductive / respiratory disorder syndrome virus PRRSV, etc.), coronavirus (porcine epidemic diarrhea virus EPDV, SARS-CoV, MERS-CoV), a member of the genus Trovirus (umatrovirus, etc.), orthomixovirus family member of (influenza virus, etc.), a member of the reovirus family member of (rotavirus, blue tongue disease virus, avian reovirus, etc.), circoviridae, a member of the herpes virus family, a member of the retrovirus family (HIV, FIV , SIV, ALV, BLV, RSV, etc.), a member of the Asfariridae family (African swine fever virus, etc.), the flavivirus genus member (dengue virus, yellow fever virus, etc.), Paramyxoviridae a member of the (Newcastle disease virus and respiratory Instrumental follicles virus RSV, etc.) and members of the genus Arenavirus (LCMV lassavirus (old world) complex, Takaribe virus (new world) complex, etc.), but are not limited thereto. Specific non-limiting examples of members of the genus Arenavirus include lymphocytic choriomyelitis virus, pitindevirus, lassavirus, Mopeaa virus, funin virus, Guanarito virus, lujovirus, Machupovirus, and savia. Viruses and whitewater arenaviruses can be mentioned.

In one embodiment, the protein encoded by the second coding region may be from an influenza virus, such as a nucleoprotein, hemagglutinin, or a portion thereof. The nuclear protein may be any subtype including, but not limited to, A / PR8 NP (eg, Genbank accession number NP_040982.1). Hemagglutinin can be any subtype including, but not limited to, H1 and H3.

The protein encoded by the second coding region may be a protein that results in a humoral immune response, a cell-mediated immune response, or a combination thereof. In one embodiment, the protein encoded by the second coding region of the second and third genomic segments has a length of at least 6 amino acids. The antigen may be heterologous to the cell in which the coding region is expressed. The nucleotide sequence of the second coding region, which is present in the second and third genomic segments and encodes the antigen, can be rapidly determined by one of ordinary skill in the art by reference to a standard genetic code. The nucleotide sequence of the second coding region present in the second and third genomic segments and encoding the antigen may be modified to reflect the codon usage bias of the cells expressing the antigen. The use bias of almost all cells expressed by pitindevirus is known to those of skill in the art.

In one embodiment, the second coding region may encode a protein useful as a detectable marker (eg, a molecule that is easily detected by various methods). Examples include fluorescent polypeptides (eg, green, yellow, blue, or red fluorescent proteins), luciferases, chloramphenicol acetyltransferases, and other molecules detectable by their fluorescence, enzymatic activity, or immune properties. (For example, c-myc, flag, 6xhis, HisGln (HQ) metal-binding peptide, and V5 epitope).

If the second and / or third genomic segment contains a coding region encoding an antigen, the maximum nucleotide size of the coding region should take into account the total size of the second and third genomic segments. Is determined by. The total size of the two genomic segments is 3.4 kilobases (kb) or less, 3.5 kb or less, 3.6 kb or less, 3.7 kb or less, 3.8 kb or less, 3.9 kb or less, 4.0 kb or less, It may be 4.1 kb or less, 4.2 kb or less, 4.3 kb or less, 4.4 kb or less, or 4.5 kb or less.

The pitindevirus is an arenavirus, and one characteristic of the arenavirus is that it has an ambisense genome. As used herein, "ambisensual" means a genomic segment that has both sense and antisense moieties. For example, the first genomic segment of the pitindevirus described herein is ambisense, encoding the Z protein in the sense direction and the LRdRp protein in the antisense direction. Therefore, one of the two coding regions of the first genomic segment is in the sense direction and the other is in the antisense direction. When the second and / or third genomic segment contains a second coding region encoding an antigen, the coding region encoding the antigen is the NP protein of the second genome segment and the sugar of the third genome segment. It is in the antisense direction compared to protein.

Each genomic segment also contains a 5'untranslated region (UTR) and a nucleotide encoding a 3'UTR. These UTRs are located at the ends of each genomic segment. Nucleotides useful as 5'UTRs and 3'UTRs are nucleotides present in the pitindevirus and are readily available to those of skill in the art (eg, Buchmeier et al., 2007, Arenaviridae: the viruses and the replation In: Knipe and Howley (eds), Fields Virus. 5th ed. Philadelphia, PA: Lippincott Williams & Wilkins.pp. 1791-1827). In one embodiment, the genomic segment encoding the Z protein and the LRdRp protein is 5'CGCACCGGGGGAUCCUAGGCAUCUUUGGGGUCACGCUUCAAAUUGUGUCCAAUUGAACCCAGCUCAAGUCCUGGUGUCAAACUGUGGG (SEQ ID NO: 8). In one embodiment, the genome segment encoding the NP protein or glycoprotein, 5'ShijishieishishijijijijieiyushishiyueijijishieiyueishishiyuyuGGACGCGCAUAUUACUUGAUCAAAG (SEQ ID NO: 10) in which 5'UTR sequence and 5'ShijishieishieijiyujijieiyushishiyueijijishijieiyuyushiyueijieiyushieishijishiyujiyueishijiyuyushieishiyuyushiyuyushieishiyujieishiyuCGGAGGAAGUGCAAACAACCCCAAA (SEQ ID NO: 11) a 3'UTR sequence is Including. Modifications within these sequences are possible and the terminal 27-30 nucleotides are highly conserved between genomic segments.

Each genomic segment also has a coding region encoding a Z protein and a coding region encoding an LRdRp protein, between a coding region encoding a nucleoprotein and at least one first restriction enzyme site, and a glycoprotein. It also includes an intergenic region located between the coding region encoding the. Nucleotides useful as intergenic regions are nucleotides present in pitindevirus and are readily available to those of skill in the art. In one embodiment, the IGR sequence of the genomic segment encoding the Z and LRdRp proteins comprises 5'ACCAGGGCCCCUGGGCGCACCCCCCUCCCGGGGGGCGCCCGCCCGGGGGCCCCCGCGCCCAUGGGGGCCGGGUUGUU (SEQ ID NO: 12). In one embodiment, the IGR sequence of the genomic segment encoding the NP protein or glycoprotein comprises 5'GCCCUAGCCUCGACAUGGGCCUCGACGUCACUCCCCAAAUAGGGGAGUGACGUCCGAGGCCUCUCUGGAGACUUGAGUGACU (SEQ ID NO: 13).

In one embodiment, each genomic segment is present within the vector. In one embodiment, the sequence of the genomic segment within the vector is anti-genomic, and in one embodiment, the sequence of the genomic segment within the vector is genomic. As used herein, "anti-genomical" means a genomic segment that encodes a protein in the opposite direction of the viral genome. For example, pitindevirus is an antisense RNA virus. However, each genomic segment is ambisense and encodes proteins in both sense and antisense directions. "Anti-genomic" means the sense direction, while "genomic" means the antisense direction.

A vector is a replicating polynucleotide (eg, a plasmid, phage, or cosmid) such that another polynucleotide binds to it, resulting in replication of the bound polynucleotide. Standard ligation techniques known in the art are used for the construction of vectors containing genomic segments and for the construction of genomic segments, including the insertion of polynucleotides encoding antigens. For example, Sambrook et al, Molecular Cloning: A Laboratory Manual. , Cold Spring Harbor Laboratory Press (1989) or Ausubel, R. et al. M. , Ed. See Current Protocols in Molecular Biology (1994). Vectors can be provided for further cloning (amplification of polynucleotides) (ie, cloning vectors) or for expression of RNA encoded by genomic segments (ie, expression vectors). The term "vector" includes, but is not limited to, a plasmid vector, a viral vector, a cosmid vector, or an artificial chromosome vector. Usually, the vector can replicate in prokaryotic and / or eukaryotic cells. In one embodiment, the vector replicates within prokaryotic cells rather than within eukaryotic cells. In one embodiment, the vector is a plasmid.

The choice of vector depends on various desired properties of the resulting construct, such as selectable markers, vector replication rate and the like. Suitable host cells for cloning or expressing the vectors herein are prokaryotes or eukaryotic cells.

Expression vectors optionally contain regulatory sequences operably linked to genomic segments. The term "operably coupled" means juxtaposing components so that they are in a relationship that causes them to function in the desired manner. A regulatory sequence is "operably linked" when it binds to the genomic segment so that expression of the genomic segment is achieved under conditions compatible with the regulatory sequence. One regulatory sequence is the promoter, which acts as a regulatory signal that binds to RNA polymerase and initiates transcription of downstream (3'direction) genomic segments. The promoter used can be a structural promoter or an inducible promoter. The present invention is not limited to the use of any particular promoter, and a wide variety of promoters are known. In one embodiment, the T7 promoter is used. Another regulatory sequence is a transcription terminator located downstream of the genomic segment. Any transcription terminator that functions to stop transcription of RNA polymerase, which initiates transcription at the promoter, may be used. In one embodiment, if the promoter is a T7 promoter, then a T7 transcription terminator is also used. In one embodiment, a ribozyme is present to assist in the processing of RNA molecules. The ribozyme may be present after the sequence encoding the genomic segment and before the transcription terminator. An example of a ribozyme is the hepatitis Δvirus ribozyme. An example of the hepatitis Δ virus ribozyme is 5'AGCTCTCCCTTAGCCATCCGAGTGGAGACGACGTCCTCCCTTCTGGACGCCCAGGGTCGGACCGGCGAGGGAGGTGGAGATAGCCATACGCCGACCC (SEQ ID NO: 14).

Transcription of genomic segments present within the vector yields RNA molecules. When each of the three genomic segments is present intracellularly, the coding region of the genomic segment is expressed and viral particles containing one copy of each of the genomic segments are produced. The three genomic segments of the reverse genetics system described herein are based on pitindevirus, an arenavirus with a segmented genome of two single-stranded ambisense RNAs. While the ability of a reverse genetics system to replicate and produce an infectious virus usually requires the presence of ambisense RNA in the cell, the genomic segments described herein are this complement (ie, complement). It also includes (body RNA), and the corresponding DNA sequences of the two RNA sequences.

The polynucleotide used to transform the host cell is, if desired, usually one or more that inactivates or detects a compound in the growth medium, or encodes a molecule that is detected by this compound. Contains a marker sequence. For example, inclusion of a marker sequence can result in resistance of the transformed cell to antibiotics, or the marker sequence can confer compound-specific metabolism on the transformed cell. Examples of marker sequences include sequences that confer resistance to kanamycin, ampicillin, chloramphenicol, tetracycline, and neomycin.

Also provided herein are viral particles described herein, or compositions comprising the three genomic segments described herein. Such compositions usually include a pharmaceutically acceptable carrier. As used herein, "pharmaceutically acceptable carriers" include saline, solvents, dispersions, coatings, antibacterial and antifungal agents, isotonic agents and absorptions that are compatible with pharmaceutical administration. Examples include retarders. Additional active compounds can also be incorporated into the composition.

The compositions described herein may be referred to as vaccines. As used herein, the term "vaccine" allows a recipient to initiate an immune response against an antigen encoded by one of the genomic segments described herein upon administration to an animal. Means a composition that increases sex.

The composition may be prepared by a method well known to those skilled in the art of pharmaceuticals. In general, the composition can be formulated to be compatible with the intended route of administration. Administration may be systemic or topical. Examples of routes of administration include parenteral (eg, intravenous, intradermal, subcutaneous, intraperitoneal, intramuscular), transintestinal (eg, oral), and topical (eg, intradermal, inhalation, transmucosal) administration. .. Suitable dosage forms for enteral administration of the compounds of the invention may include tablets, capsules or liquids. Intravenous administration may be mentioned as a suitable dosage form for parenteral administration. Suitable dosage forms for topical administration may include intranasal spray, metered dose inhalers, dry powder inhalation or atomization.

Solutions or suspensions may include the following components: sterile diluents such as water for administration, saline, non-volatile oils, polyethylene glycol, glycerin, propylene glycol, or other synthetic solvents ; benzyl alcohol or methylparaben. Antibacterial agents such as; Antioxidants such as ascorbic acid or sodium hydrogen sulfite; Chelating agents such as ethylenediamine tetraacetic acid; Buffer solutions such as acetate buffer, citrate buffer or phosphate buffer; sodium ion, chloride Solvents such as substance ions, potassium ions, calcium ions, and magnesium ions, and tension regulators such as sodium chloride or dextrose. The pH can be adjusted with an acid or base such as hydrochloric acid or sodium hydroxide. The composition can be sealed in glass or plastic ampoules, disposable syringes or divided dose vials.

The composition can include a sterile aqueous solution (water-soluble) or dispersion, and a sterile powder for instant preparation of the sterile solution or dispersion. For intravenous administration, suitable carriers include saline, bacteriostatic saline, phosphate buffered saline (PBS) and the like. The composition is usually sterile and, if suitable for injection applications, must be fluid to the extent that it facilitates needle passage. The composition must be stable under manufacturing and storage conditions and must be stored overcoming the contaminating effects of microorganisms such as bacteria and fungi. The carrier can be, for example, a solvent or dispersion medium containing water, ethanol, polyols (eg, glycerol, propylene glycol, liquid polyethylene glycol, etc.), and suitable mixtures thereof. Preventing the action of microorganisms can be achieved with various antibacterial and antifungal agents such as parabens, chlorobutanol, phenols, ascorbic acid, thimerosal and the like. In many cases, it is preferable that the composition contains an isotonic agent such as sugar, polyalcohol (mannitol, sorbitol, etc.), sodium chloride. By including an agent that delays absorption in the composition, such as aluminum monostearate and gelatin, the absorption of the injectable composition can be delayed.

Sterilization solutions are prepared by incorporating the required amount of active compound (eg, viral particles described herein) into a suitable solvent with one or a combination of the components listed above, followed by filtration sterilization. can do. The dispersion is usually prepared by incorporating the active compound into a sterile vehicle containing a basic dispersion medium and any other suitable component. For sterile powders for the preparation of sterile injectable solutions, preferred preparation methods include vacuum drying and lyophilization to obtain powders of active ingredients and any additional desired ingredients from pre-sterilized solutions.

Oral compositions usually include an inert diluent or edible carrier. For the purpose of oral therapeutic administration, the active compound can be incorporated with excipients and used in the form of tablets, lozenges, or capsules (eg gelatin capsules). Oral compositions can also be prepared using a fluid carrier for use as a mouthwash. A pharmaceutically compatible binder and / or adjuvant can be included as part of the composition. Tablets, pills, capsules, troches, etc. are any of the following ingredients or compounds with similar properties: binders such as microcrystalline cellulose, tragacant rubber or gelatin; excipients such as starch or lactose, alginic acid, Primogel Or a disintegrant such as corn starch; a lubricant such as magnesium stearate or Sterotes; a lubricant such as colloidal silicon dioxide; a sweetener such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring. Can be contained.

For administration by inhalation, the active compound is delivered in the form of an aerosol spray from a compression vessel or sprayer containing a suitable propellant (eg, a gas such as carbon dioxide), or a nebulizer.

Systemic administration can also be transmucosal or transdermal. For transmucosal or transdermal administration, a penetrant suitable for penetrating the barrier is used in the formulation. Such penetrants are generally known in the art and include, for example, surfactants, bile salts, and fusidic acid derivatives for transmucosal administration. Transmucosal administration can be achieved by using intranasal spray or suppositories. For transdermal administration, the active compound is incorporated into an ointment, wax, gel, or cream commonly known in the art.

The active compound may be prepared using a controlled release formulation such as a carrier, implant or the like that prevents the compound from being rapidly removed from the body. Biodegradable and biocompatible polymers such as ethylene vinyl acetate, polyanhydride, polyglycolic acid, collagen, polyorthoester, and polylactic acid can be used. Such formulations can be prepared using standard techniques. Liposomal suspensions can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art.
Data obtained from cell culture assays and animal studies can be used to formulate a wide range of doses for use in animals. The dose of such compound _{is preferably within the range of circulating concentrations containing ED 50} (therapeutically effective dose in 50% of the population) with little or no toxicity. Depending on the dosage form used and the route of administration used, the dose may vary within this range.

The composition can be administered once to obtain an immune response, or it can be administered one or more times as booster to enhance the immune response and increase the likelihood of immunity to the antigen for a long time. Certain factors, including but not limited to the severity of the illness or disease, previous treatment, overall health and / or age of the subject, and other illnesses present, will effectively treat the subject. You will understand that it can affect the dose and timing required to do so.

Also provided herein are methods of using genomic segments. In one embodiment, the method comprises making infectious viral particles. Such methods include providing cells containing each of the three genomic segments described herein (first genomic segment, second genomic segment, and third genomic segment), and each genome. Culturing cells under conditions suitable for producing full-length genomic RNA molecules of the segment, but is not limited to these. The full-length genomic RNA of each genomic segment is anti-genomic. Making a full-length genomic RNA molecule for each genomic segment results in transcription and translation of each viral gene product, as well as amplification of the viral genome, resulting in the production of infectious progeny viral particles. As used herein, an "infectious viral particle" refers to a three genomic segment by interacting with a suitable eukaryotic cell, such as a mammalian cell (eg, mouse or human cell) or avian cell. Means a viral particle that results in intracellular introduction and transcription of three genomic segments into a cell. The method may also include introducing a vector encoding the three genomic segments into the cell. Infectious virus particles may be isolated and further amplified by releasing them into the supernatant and culturing on cells. The method may include isolating viral particles from cells or a mixture of cells and cell debris. The method may include inactivating the viral particles using standard methods such as hydrogen peroxide treatment. Also provided are infectious or inactivated viral particles containing the three genomic segments described herein.

In one embodiment, the method comprises expression of the antigen in the cell. Such a method includes, but is not limited to, introducing the three genomic segments described herein into cells. In one embodiment, the introduction is by introducing infectious or inactivated viral particles. The second and / or third genomic segment may include a second coding region encoding the antigen. The second and third genomic segments may encode the same antigen, or they may encode different antigens. Two or more types of virus particles may be administered. For example, if each population encodes a different antigen, two populations of viral particles may be administered. In this embodiment, a single dose can result in the expression of multiple antigens in the cell. The cells are suitable eukaryotic cells, such as mammalian cells (eg, mouse or human cells), or avian cells. In one embodiment, the avian cells are avian embryo fibroblasts. The cells may be ex vivo, or in vivo. The three genomic segments may be introduced by contacting the cell with infectious viral particles containing the three genomic segments or by introducing a vector containing the genomic segments into the cell. The method further comprises cells under conditions suitable for expression of coding regions present in three genomic segments, including one or two second coding regions present in the second and / or third genomic segment. Incubates. As used herein, "ex vivo" means cells that have been removed from the body of an animal. Ex vivo cells include, for example, primary cells (cells that have recently been removed from the subject and capable of limited proliferation in tissue medium) and cultured cells (eg, cells that can be cultured in tissue medium for extended periods of time). .. By "in vivo" is meant a cell in the body of a subject.

In one embodiment, the method comprises immunizing an animal. Such methods include, but are not limited to, administering to animals infectious or inactivated viral particles containing the three genomic segments described herein. The second and / or third genomic segment may include a second coding region encoding the antigen. The second and third genomic segments may encode the same antigen, or they may encode different antigens. Two or more types of virus particles may be administered. For example, if each population encodes a different antigen, two populations of viral particles may be administered. In this embodiment, a single dose can result in vaccination of animals against multiple pathogens. The animal may be any animal in need of immunization, including vertebrates such as mammals or birds. Animals include, for example, birds (eg chickens or schimen butterflies), cows (eg bovine species components), goats (eg goats), sheep (such as sheep), pig (porcine) (e.g. pigs (swine), etc.), bison (e.g. buffalo, etc.), companion animals (e.g. cats, dogs, and horses, etc.), the components of the murine (e.g. rat or mouse), guinea pig or human, Can be. In one embodiment, the animal may be an animal at risk of being exposed to an infectious disease such as a disease caused by or associated with a viral pathogen, a prokaryotic pathogen, or a eukaryotic pathogen. In one embodiment, the animal may be an animal that needs to be immunized against an antigen associated with a non-infectious disease such as cancer. For example, the antigen may be an antigen that helps the animal initiate an immune response that targets and removes cancer cells. Immune responses include humoral responses (eg, immune responses include the production of antibodies corresponding to antigens), cellular responses (eg, phagocytes, activation of antigen-specific cytotoxic T lymphocytes, and antigen-responsive cytokines. Release), or a combination thereof.

In another embodiment, the method comprises treating one or more symptoms of a particular condition of the animal. In one embodiment, the condition is caused by a viral or microbial infection. As used herein, the term "infection" means the presence of a virus or microorganism in a subject's body and the proliferation of these. The infection is clinically subclinical or can result in symptoms associated with a disease caused by a virus or microorganism. Infection can be early or late. In another embodiment, the condition is caused by a disease such as cancer. As used herein, the term "disease" is a deviation from the normal structure or function of a part, organ, or system of subject, or a combination thereof, in which a characteristic symptomatology or series of symptoms has developed Or it means all interruptions. The method administers an effective amount of the composition described herein to an animal with or at risk of having a condition or symptoms of the condition, and at least one symptom of the condition. It involves measuring whether a change, preferably a decrease, has occurred.

Treatment of condition-related symptoms can be prophylactic or can be initiated after the condition has progressed. As used herein, the term "symptomatology" means objective evidence in a subject of a condition caused by an infection of a disease. Symptoms associated with the conditions referred to herein, and assessments of such symptoms, are routine and known in the art. Prophylactic treatment, eg, treatment initiated before a subject develops symptoms of a condition, is referred to herein as treatment of a subject who is "at risk" of developing the condition. Thus, administration of the composition can be performed before, during, and after the occurrence of the conditions described herein. Treatment initiated after the condition has progressed can result in a reduction in the severity of the symptoms in one of the conditions, or complete elimination of the symptoms. In this aspect of the invention, the "effective amount" is an amount that is effective in preventing the onset of symptoms of the condition, reducing the severity of the symptoms of the condition, and / or completely eliminating the symptoms.

Kits for immunizing animals are also provided herein. The kit contains the viral particles described herein, which contain coding regions in which the second and / or third genomic segments independently encode antigens, sufficient for at least one immunization. In a suitable packaging material. In one embodiment, the kit may include two or more types of virus particles. For example, the kit may include certain viral particles encoding one or two antigens and a second viral particle encoding one or two other antigens. If desired, other reagents such as buffers and solutions necessary to carry out the present invention are also included. Instructions for using the packaged virus particles are also usually included.

As used herein, the term "packaging material" means one or more physical structures used to contain the contents of a kit. The packaging material is preferably constructed by a known method that provides a sterile, contaminant-free environment. The packaging material has a label indicating usable viral particles for immunization of the animal. In addition, the packaging material contains an instruction manual showing how the materials in the kit are used to immunize the animal. As used herein, the term "package" means a solid matrix or material such as glass, plastic, paper, foil, etc. that is capable of retaining viral particles within the limits of fixation. Thus, for example, the package can be a glass bottle used to contain the appropriate amount of virus particles. The "Instruction Manual for Use" usually includes tangible expressions that describe the amount of virus particles, the route of administration, and the like.

The term "and / or" means one or all of the listed components, or any two or more components listed.

The words "preferably" and "preferably" refer to embodiments of the invention that may provide a particular advantage under certain circumstances. However, under the same or other circumstances, other embodiments may also be preferred. Furthermore, the detailed description of one or more preferred embodiments does not suggest other embodiments that are not useful and is not intended to exclude other embodiments from the scope of the invention.

The term "contains" and its variants have no restrictive meaning where these terms appear in the specification and claims.

Unless otherwise noted, "a," "an," "the," and "at least one" are used interchangeably to mean one or more.

Also herein, a detailed description of the range of numbers by endpoint includes all numbers included within that range (eg, 1-5 are 1, 1.5, 2, 2.75, 3). Including 3.80, 4, 5, etc.).

For any method disclosed herein, including individual steps, these steps may be performed in any feasible order. And, as appropriate, any combination of two or more steps may be carried out at the same time.

The above outline of the present invention is not intended to describe each of the disclosed embodiments or embodiments of the present invention. The following description shows exemplary embodiments in more detail. Guided by a list of examples at several locations throughout the specification, these examples can be used in various combinations. In each case, the cited list serves only as an exemplary group and should not be construed as an exclusive list.

The present invention will be described by the following examples. Specific examples, materials, quantities, and procedures should be understood to be broadly construed in accordance with the spirit and scope of the invention described herein below.
Example 1
Arenavirus-based vaccine vectors carrying influenza virus antigens provide mice with long-term protection against lethal influenza virus antigen administration.

Pitindevirus (PICV) is a non-pathogenic arenavirus that has been used as a model virus for studying viral hemorrhagic fever infections. A reverse genetics system for generating infectious PICV viruses from two plasmids encoding large (L) and small (S) RNA segments of the virus was previously developed (Lan et al., 2009, J Virus). 83: 6357-6362). In the current study, a second generation reverse genetics system was created to generate the infectious recombinant PICV virus from three separate plasmids, called the three segmented PICV system. These recombinant viruses have all of the viral gene products and three viral genomic RNA segments encoding two exogenous genes. This three-segmented PICV system can be used as a novel vaccine vector for delivering hemagglutination (HA) and nucleoprotein (NP) of influenza virus A / PR8 strains. Mice immunized with these recombinant viruses are manifested by high levels of HA neutralizing antibodies and survival of animals surplus by NP-specific cytotoxic T lymphocyte (CTL) response to viral infections. , Protected against the administration of lethal influenza virus antigens. Recombinant PICV viruses segmented into these three do not induce strong anti-PICV vector immunity, making them ideal candidates by first dose-additional immunization vaccination to induce cross-reactive immunity. In summary, new survival vaccine vectors have been developed that can express multiple exogenous antigens, induce potent humoral and cell-mediated immunity in vivo, and induce little anti-vector immunity. There is.
Introduction

We have developed the only available reverse genetics system for transfecting plasmids into appropriate mammalian cells to generate infectious PICV virus (Lan et al., 2009, J Virus 83: 6357-). 6362). This system consists of modified bacteriophage T7 regulatory (promoter / terminator) signal sequences located upstream and downstream of the PICV genome sequence and two plasmids for generating full-length genome L and S RNA from the hepatitis Δribozyme sequence, respectively. It is composed. Upon transfection into the renal epithelial cells of baby hamsters structurally expressing bacteriophage T7 RNA polymerase (BSRT7-5: known as BHK-T7), the L and S RNA segments of PICV were generated. From these, all PICV viral gene products, including L polymerase and NP nuclear protein, are transcribed and translated to amplify the viral genome and produce infectious progeny viral particles. The infectious PICV virus is released into the supernatant, isolated, and further amplified by culturing in African green monkey epithelial (Vero) cells.

A second generation reverse genetics system has been developed for the production of infectious recombinant PICV virus from three separate plasmids, called the three segmented PICV system as described herein. These recombinant viruses have all of the viral gene products and three viral genomic RNA segments encoding two exogenous genes. This three-segmented PICV system can be used as a novel vaccine vector for delivering other viral antigens such as the viral antigens of influenza virus. To briefly summarize, three segmented PICV viruses have been produced that express blood cell aggregation (HA) or nuclear protein (NP) of influenza virus A / PR8 strains, and these three segmented PICVs. Vaccine vectors cause little anti-PICV vector immunization in immunized mice and are potently humoral, with strong production of influenza-specific neutralizing antibodies and strong influenza-specific cytotoxic T lymphocyte (CTL) responses. And can induce cell-mediated immunization, which makes this vector an ideal candidate for a first-dose-neutralizing immunization strategy to induce long-term cross-reactive immunization. Therefore, this novel PICV-based vaccine vector developed by us described herein is safe, induces a potent and durable cellular and humoral immune response, and is pre-immunized. It also meets all the criteria needed for an ideal viral vector, such as lack of anti-vector immunity.
Materials and methods

Construction of a plasmid encoding a modified pitindevirus P18S RNA segment with multiple cloning sites (MCS) that replace either the GPC or NP gene.

A reverse genetics system for PICV was previously developed by transfecting two plasmids encoding the L and S RNA segments in the antigenome (ag) sense direction into BHK-T7 cells (Fig. 1). (Lan et al., 2009, J Virol 83: 6357-6362). Multiple cloning sites for open reading frames (ORFs) of either viral glycoprotein (GPC) or nucleoprotein (NP) genes within the SagRNA-encoding plasmid using the overlap polymerase chain reaction (PCR) method. Replaced with (MCS). The P18S-GPC / MCS and P18S-MCS / NP of the obtained plasmids (FIG. 2A) are restrictions introduced into these plasmids for convenience of cloning of foreign genes (eg, reporter genes and / or viral antigens). It contains an MCS having an enzyme sequence (Nhe I-Mfe I-Acc65I-Kpn I-EcoR V-Xho I-Sph I).

Subcloning of the GFP reporter gene, influenza HA or NP gene into the P18S-GPC / MCS vector. Using PCR, the green fluorescent protein (GFP) reporter gene from the A / PR8 (H1N1) strain and the influenza HA or NP gene were placed in the vector P18S-GFP / MCS between the Nhe I and Xho I sites, respectively. Subcloned into. The amino acid sequence of A / PR8 hemagglutinin can be found at Genbank accession number NC_002017.1, and the amino acid sequence of A / PR8 nucleoprotein can be found at Genbank accession number NC_002019.1. The recombinant plasmid construct was confirmed by DNA sequencing. The resulting plasmids (FIG. 5) are called P18S-GPC / GFP, P18S-GPC / H1, and P18S-GPC / NP, respectively.
Recovery of recombinant pitindevirus segmented into three expressing GFP, influenza HA or NP.

BSRT7-5 (known as BHK-T7) cells with three plasmids expressing the full-length P18 LagRNA segment, P18S segment with MCS instead of GPC (P18S-MCS / NP), and P18S. Recombinant virus was recovered from the plasmid by transfecting the segments with GFP, HA, or NP instead of NP (P18S-GPC / GFP, P18S-GPC / N1, or P18S-GPC / NP) (FIGS. 2B and FIG. 5). The procedure for generating recombinant PICV is substantially the same as that described above (FIG. 1B) (Lan et al., 2009, J Virol 83: 6357-6362). Briefly, BHK-T7 cells were grown to 80% confluence, the cells were washed 4 hours prior to transfection and incubated in antibiotic-free medium. For transfection, each plasmid (2 ug) was diluted to 250 uL Opti-MEM and incubated at room temperature for 15 minutes. An equal volume of Opti-MEM containing 10 uL of lipofectamine (Invitrogen, Life technologies) was added and the mixture was incubated at room temperature for 20 minutes. After incubation, cells were plasmid transfected and after 4 hours the medium was replaced again to remove lipofectamine. Forty-eight hours after transfection, cell supernatants were collected for plaque assay. Viruses grown from individual plaques were used to prepare stocks grown on BHK-21 cells and stored at -80 ° C.
Detection of influenza antigen expression in cells infected with recombinant PICV vector segmented into three.

BHK-21 cells grown on a cover glass are infected with wild-type pitindevirus (PICV) or recombinant PICV virus expressing either influenza HA (rPICV-HA) or NP gene (rPICV-NP). It was. Twenty-four hours after viral infection, cells were fixed with 4% paraformaldehyde for 15 minutes at room temperature, followed by washing three times with phosphate buffered saline (PBS). The cells were then incubated for 12 minutes in 0.1% Triton X-100, followed by a primary antibody (mouse anti-NP influenza A) for 1 hour. The cells were then washed and incubated with a secondary antibody (anti-mouse alexa flow-647) at room temperature for 1 hour.
Immunization and antigen administration of mice.

6-8 week old female C57BL / 6 mice were obtained from Charles River Laboratories and housed for at least 1 week for environmental acclimatization. Mice were placed in a microisolator cage at an animal facility equipped with BSL-2. Mice were injected with 100,000 pfu of rPICV virus with a total volume of 100 uL by the intraperitoneal route. Fourteen days after the last booster, _{the influenza A / PR8 strain conditioned to 10LD 50} (10,000 pfu) mice was nasally antigenically administered to the mice.
Analysis of virus-specific CTL by tetramer staining.

Unicellular splenocytes were obtained and red blood cells (RBC) were lysed using ACK cytolysis buffer. The splenocytes were then washed twice with FACS buffer (PBS + 2% FBS). 1 hour at room _{temperature, NP 366-374} epitope ASNENMETM (SEQ ID NO: 7) CD8-PerCP-Cy5.5 including, were stained cells (1 × 10 ⁵⁾ by CD3-APC and H-2Db-PE tetramers .. After incubation, cells were washed 3 times with FACS buffer and labeled cells were analyzed by flow cytometry. FACS data was analyzed using FloJo software.
Hemagglutination inhibition assay.

Blood was collected 14 days after each immunization and serum was collected. Non-specific inhibitors were removed from the serum by overnight treatment with 5 volumes of receptor-destroying enzyme (Sigma), followed by incubation at 56 ° C. for 45 minutes to inactivate the enzyme and serum. Each serum sample was then serially diluted in 25 uL PBS and then mixed with an equal volume of PBS containing 4 HA units of A / PR8. After incubation at room temperature for 15 minutes, 0.5% turkey RBC (50 μL) was added and the mixture was incubated at 4 ° C. for 1 hour prior to aggregation evaluation. Titers were recorded as the reciprocal of the last dilution that inhibited aggregation.
Measurement of viral titers in the lungs.

To assess influenza A / PR8 replication in mice, lungs were collected, weighed and homogenized in L15 medium 6 days after antigen administration. Tissue homogenates were centrifuged at 10,000 rpm for 10 minutes and the virus was titrated in a 12-well plate on a single layer of Madein-Darby canine kidney (MDCK) cells.
Result 1. Generation of recombinant pitindevirus segmented into three that express the GFP reporter gene.

The three-segmented arenavirus system was first reported by de la Torre group for LCMV (Emonet et al., 2009, Proc Natl Acad Sci USA 106: 3473-3478). The company produced an infectious recombinant LCMV that packages three RNA segments, one of which is a full-length L segment and two of which is an S segment lacking either GPC or NP. We have previously developed a reverse genetics system for pitindevirus (PICV) (Lan et al., 2009, J Virus 83: 6357-6362). PICV is a prototype arenavirus that is non-pathogenic in humans. This system is composed of two plasmids that express the L and S segments of PICV when transfected into BSRT7-5 (known as BHKT7) cells (FIG. 1).

In the current study, a second generation consisting of three plasmids that make up two different S RNA segments, one with a GPC deletion and the other with an S segment containing a deletion of the NP gene. A PICV reverse genetics system (FIG. 2) has been generated. Instead of the deleted viral gene, we inserted multiple cloning sites (MCS) (Fig. 2A). We then subcloned the GFP reporter gene at the location of the deleted GPC within the P18 S2 segment using the Nhe I / Kpn I site within the MCS, one viral on the full-length P18 L segment. The plasmids encoding the Z and L genes and two other S1 and S2 plasmids expressing either the viral GFP gene alone or both the NP and GFP reporter genes (ie, P18 S1-MCS and P18 S2-). An infectious virus was generated from the supernatant of BSRT7-5 cells transfected with three plasmids of GFP) (Fig. 2B). Storage virus was prepared from plaque-purified virus. All plaques appear green under fluorescence microscopy, indicating successful recovery of the rP18tri-GFP virus. In addition to Vero cells (data not shown), rP18tri-GFP virus infection expresses GFP in other tolerated cells such as BHK-21 and A549 (Fig. 3), a fresh culture of BHK-21 target cells. When infecting the virus, more infectious progeny virus expressing GFP was released (Fig. 3). This indicates the stability and integrity of the rP18tri-GFP virus in cell culture. Over time studies showed that when GFP was strongly expressed 12 hours after infection and the concentration of rP18tri-GFP virus in the supernatant increased sharply at about 16 hp, the complete life cycle of rP18tri-GFP was about 16 hours. It was shown that (Fig. 4). In preliminary experiments, it was discovered that the PICV-tri-GFP viral vector was able to infect chicken embryo fibroblasts (CEF cell lines) in cell culture (data not shown).

Two and three segmented PICV viral replications were compared by performing growth curve analysis of rP2, rP18, and rP18tri-GFP on BHK-21 with a multiplicity of infection (moi) of 0.01. did. As expected, the known virulent rP18 virus propagated slightly faster and better than rP2 with a virus titer of about 0.5 log. The three-segmented rP18tri-GFP virus propagated at a rate similar to that of the rP2 and rP18 viruses, despite virus titers about 1 to 1.5 log lower (FIG. 4). In summary, the three-segmented PICV virus appears to have a slower growth rate and a lower titer than the two-segmented rP2 and rP18 PICV viruses.

In order to measure the stability of rP18tri-GFP virus, that is, by in vitro culture of rP18tri-GFP virus, the GFP gene has been lost by genome recombination, and the reversion variant of the wild-type virus segmented into two. To test whether or not to select, rP18tri-GFP was continuously passaged in BHK-21 cell culture medium and plaque assays were performed at various passages to show the expression of GFP in each plaque. investigated. At any passage tested (up to 23 passages), all plaques still exhibited high GFP reporter gene concentrations, which means that even after extensive passage of the GFP reporter gene in cell culture medium. It suggests that it can be maintained stably within infectious virus particles.
2. Generation of recombinant pitindevirus segmented into three that express influenza virus antigens.

The HA and NP genes of the influenza virus A / PR8 / H1N1 strain were molecularly cloned into the MSC of the P18 S2 plasmid, respectively (Fig. 5). To generate the rP18tri-GFP / HA and rP18tri-GFP / NP viruses, respectively, the resulting P18 S2-HA and P18 S2-NP were placed separately in BHK-T7 cells with full-length P18L and P18S1-GFP. Transfected.

All infected cells (ie, plaques) were green under fluorescence microscopy because the recombinant virus had the GFP reporter gene on the P18S2-GFP segment (FIG. 6). Furthermore, 24 hours after infection (hpi), expression of HA and NP proteins was detected in Vero cells by immunofluorescence assay using specific anti-HA and anti-NP antibodies (Fig. 6). Taken together, we created a three-segmented virus that, upon cell infection, produced different exogenous genes, including the GFP reporter gene and two different influenza viral antigens (HA and NP). It was shown that it can be expressed.
3. 3. The rP18tri-based influenza vaccine induces protective immunity in mice.

Previous studies in our laboratory have shown that infection of mice by different routes with high doses of PICV does not cause disease because PICV is removed by 4 days after infection (dpi). (Data not shown). Here, we tested whether the rP18tri-based vaccine vector could induce protective immunity in mice. C57BL6 mice can be mock-infected or low doses (50 pfu) of A / PR8 intranasally or intraperitoneally with 1 × 10 ⁵ pfu of rP18tri-GFP, rP18tri-GFP / HA, and rP18tri-GFP / NP viruses, respectively. Infected by route. On days 14 and 28, mice were boost immunized twice with the same dose of the same virus. Blood samples were collected at different times after initial administration and after booster immunization for titration of neutralizing antibodies. Fourteen days after the second booster, mice were antigenized with a known lethal dose of A / PR8 (10xMLD50) and body weight and symptoms were monitored until day 21. All antigen-treated animals previously immunized with PBS or rP18tri-GFP died by 7 dpi, but all mice vaccinated with rP18tri-GFP / HA were completely infected with the lethal influenza virus. Was protected by. Two of the three mice vaccinated with rP18tri-GFP / NP survived (Fig. 7). For vaccination with rP18tri-GFP / HA, the antigen-treated mice maintained their body weight, while the two surviving mice in the rP18tri-GFP / NP group showed slight weight loss in the early stages but recovered rapidly. (Data not shown). Consistent with mortality data, mice vaccinated with HA or NP had minimal lung pathological changes at 3 dpi compared to mice vaccinated with PBS or vector alone. Similarly, the viral titer in the lung at 3 dpi also correlated with defense. When animals were vaccinated with mock or only the rP18tri-GFP vector, the A / PR8 virus replicated very much in the lungs of mice at 3 dpi. In contrast, no viral titers were detected in the rP18tri-GFP / HA vaccinated group, and the viral titers were significantly reduced in the rP18tri-GFP / NP group.

Taken together, these results suggest that rP18tri-based vaccine vectors can induce protective immunity from lethal influenza virus infection in mice. Consistent with previous influenza vaccine studies, HA vaccination can provide complete protection against disease resulting from the influenza virus, but NP vaccination usually reduces the severity of the disease and is in vivo. Provides partial protection by controlling influenza replication.
4. The rP18tri-GFP / HA vaccine induces high neutralizing antibody titers in mice.

Hemagglutination inhibition (HAI) in peripheral blood collected from vaccinated mice at different time points (14 days after the first dose, 7 and 14 days after the first booster, and 14 days after the second booster). ) The titer was measured (Fig. 8). As expected, HAI titers from the rP18tri-GFP and rP18tri-GFP / NP groups did not exceed background concentrations, as neither GFP nor NP was expected to induce HA-specific neutralizing antibodies. In contrast, the HAI titer from the rP18tri-GFP / HA vaccinated group reached a concentration of 40 14 days after the first dose and was substantially increased after the second dose (FIG. 8). This suggests that the rP18tri-GFP / HA vaccine can induce high concentrations of neutralizing antibody titers in vivo. Because a threshold HAI titer of ≧ 40 is used as a measure of success, ie, a 50% reduction in influenza risk (antibody retention titer) (Reber et al., 2013, Expert Rev Vaccines 12: 519-536). , HAI data suggest that a single dose of rP18tri-GFP / HA may be sufficient to confer protection.

HAI titers produced by different vaccination routes were compared (Fig. 9). RP18tri-GFP / HA in mice with a single initial dose and a single booster immunization via the intraperitoneal (ip), intramuscular (im), or intranasal (in) route. Was vaccinated. Overall, relatively high HAI titers elicited significant levels of humoral responses in all three pathways of immunization. However, i. m and i. The HAI titer of serum in the p-injection route is i. It seems to be relatively higher than the titer of group n. Regardless of this result, these HAI titers were high enough to provide complete protection against lethal antigen administration of the PR8 influenza virus. As shown in FIG. 10, no significant weight loss was observed in the vaccinated animals.
5. The rP18tri-GFP / NP vaccine induces a strong CTL response in mice.

NP is an intracellular viral protein and is known to induce a CD8 + T cell response to the virus. Whether the rP18tri-GFP / NP vaccine can induce a CTL response can be determined by NP-specific tetramer analysis of spleen cells and PBMC at different times after the initial intraperitoneal administration of rP18tri-GFP / NP and booster immunization. Investigated by doing. As shown in FIG. 11 (top), NP-specific CD8 + and CD44 + T cells are rP18tri-GFP to the extent (if not high) comparable to low-dose PR8 infection, even 7 days after initial administration. / NP was detected in the vaccinated group. The number of cells increased further 7 days after booster immunization and was still present 14 days after booster immunization (center of FIG. 11). We have discovered the effect of different seeding pathways on the CTL response. As shown in FIG. 12, i. m. And i. p. Both routes are i. n. It induced a stronger CTL response than the route infection. Taken together, our data show that rP18tri-based vectors can induce a strong CTL response in vivo, and that the intramuscular and intraperitoneal pathways are better than the intranasal pathway in inducing a strong CTL response. Shown. i. Since the m pathway elicited optimal humoral and T cell responses, later experiments were performed with i. This was performed following immunization via the m-path.
6. Can rP18tri-based vaccines provoke long-term effective immunity?

The rP18tri-GFP / HA vaccine vector was evaluated for its potential to induce long-term immunity. C57BL6 mice were immunized twice at 4-week intervals, and a lethal dose of A / PR / 8 (H1N1) virus was antigen-administered either 4 or 8 weeks after the second immunization. Serum samples analyzed for HAI 14 and 30 days after initial administration and 30 and 60 days after booster immunization showed strong neutralizing antibody titers (FIG. 13A). The antigen-treated virus A / PR / 8 replicated well in the lungs of mock-vaccinated mice, but in the lungs of the antigen-treated vaccinated mice 4 weeks after vaccination, the detectable viral titer was I couldn't see it. However, significantly lower viral titers were observed in the lungs of immunized mice administered antigen 8 weeks after vaccination (Fig. 13B). As shown in FIG. 13C, complete protection was observed as no significant weight loss was observed in rP18tri-GFP / HA immunized mice antigen-administered either 4 or 8 weeks after vaccination. Consistently, no significant pathological changes were seen in the lungs of immunized mice (Fig. 13D). Overall, the level of immunity and defense was comparable to that seen two weeks after immunization.
A single immunization with rP18tri-GFP / HA induced protection against lethal H1N1 antigen administration.

C57BL6 mice were immunized with rP18triGFP-HA by the intramuscular route. Surprisingly, a single dose of rP18tri-GFP / HA induced complete protection against lethal infection with the mouse-compatible A / PR / 8 (H1N1) virus. As shown in FIG. 14B, rP18tri-GFP vaccinated control mice continued to lose weight after antigen administration until euthanasia was required. The results also indicate ^that the rP18tri-GFP / HA vector 10 3 pfu immunization once by administering minimum amount is elicited potent hemagglutination inhibition (HI) Ab response, sufficient to confer protection It was also shown that it was (Fig. 14A). Histological analysis of lung cross-sections performed for 5-6 days after antigen administration revealed a marked reduction in inflammation in rP18tri-GFP / HA vaccinated mice, although rP18tri-GFP vaccinated mice did. Extensive inoculation of inflammatory cells into the lung, pulmonary congestion, and intra-alveolar edema were shown (Fig. 14C).
Generation and characterization of rP18tri-based viruses expressing dual influenza virus protein antigens

In order to obtain rP18tri-based vectors expressing influenza HA and NP, or HA1 and HA3, DNA encoding each influenza virus gene was appropriately inserted into plasmid vectors P18S-GPC / MCS and P18S-MCS / NP. .. HA1, NP and HA3 amplified by RT-PCR were cloned, and the sequence of each clone was confirmed. The resulting plasmids were designed as P18S-GPC / HA1, P18S-NP1 / NP and P18S-HA3 / NP. Next, the recombinant virus expressing the dual antigens (influenza HA1 and NP1) was simultaneously transfected with three plasmids expressing the full-length P18 LagRNA segment, P18S-GPC / HA1 and P18S-NP1 / NP. Rescue. At the same time, a similar recombinant virus segmented into three, including the swap influenza gene, was also generated by transfection at the same time as the full-length P18 LagRNA segment, P18S-GPC / NP 1 and P18S-HA1 / NP. Similarly, recombinant viruses expressing dual antigens (influenza HA1 and HA3) were produced by simultaneously transfecting three plasmids expressing the full-length P18 LagRNA segment, P18S-GPC / HA1 and P18S-HA3 / NP. Rescue.

Interestingly, rP18tri-HA / NP had a lower titer than rP18tri-NP / HA and formed smaller plaques in Vero cells (Fig. 15A). However, the expression level of influenza virus protein antigen was higher in rP18tri-HA / NP than in rP18tri-NP / HA (Fig. 15B).
An rP18tri-based vector encoding multiple influenza virus protein antigens (HA and NP) induced both humoral and T cell responses in immunized mice.

Vector RP18tri based encoding both influenza virus HA and ^NP, in 10 4 pfu / mL mice either were immunized in rP18tri-HA / NP or rP18tri-NP / HA vectors, strong humoral and T We succeeded in inducing a cellular response. Mouse peripheral blood and spleen were used to monitor the level of T cell response to the _{immune-dominant NP 336 epitope using the MHC class I tetramer.} Anti-NP-specific CD8 + T cells were detected in the peripheral blood and splenocytes of immunized mice. Seven days after immunization, the proportion of NP-specific T cells increased significantly in mice (Fig. 16A). Tetramer-positive CD8 + T cells peaked 7 days after booster immunization and remained at rest until 14 days after booster immunization (Fig. 16B). Both vaccine candidates also elicited a strong humoral response as assessed by hemagglutination inhibitory titers in sera collected 14 days after initial administration and 14 days after additional administration. The HI titer increased after boost immunization in rP18tri-HA / HA-immunized mice, but such an increase was not observed in rP18tri-NP / HA-immunized mice (FIG. 16C).

Taken together, the rtriP18-HA / NP vaccine elicited a stronger immune response compared to the rP18tri-NP / HA vaccine. Higher levels of rP18tri-HA / NP immune response may be due to higher expression levels of influenza virus antigens (Fig. 15B). However, both the vector vaccines rP18tri-HA / NP and rP18tri-NP / HA provided complete protection against lethal antigen administration of the A / PR / 8 influenza virus. No symptoms were observed in immunized mice. As shown in FIG. 17A, no significant changes in tissue structure were detected in the lungs of mice immunized with any of the vaccine candidates. In contrast, infiltration of inflammatory cells was observed in the lungs of mice vaccinated with rP18tri-GFP. Viral titers in the lungs were analyzed and antigen-administered virus replication was measured 3 and 6 days after infection. Mice vaccinated with mock showed high viral titers, while mice vaccinated with rP18tri-HA / NP and rP18tri-NP / HA showed no detectable titers on day 6 and 3 mice in each group. ^{One of the mice showed titers of 3 × 10 3} pfu / mL and 5 × 10 ³ pfu / mL, respectively, 3 days after infection (FIG. 17B). No weight loss was observed in mice vaccinated with any of the vaccine candidates (Fig. 17C).
The rP18tri-based vector encoding multiple influenza antigens (HA1 and HA3) induced protection against dual antigen administration.

Different groups of C57BL6 female mice were shunted into rtriP18-based vectors (rP18tri-HA1) encoding only H1 subtype HA, or ritriP18-based vectors (rP18tri-HA3) encoding only H3 subtype HA. Immunization was performed by two doses of any of the rtriP18-based vector (rP18tri-HA1 / HA3) vaccines encoding both subtype and H3 subtype HA. The results show that the first administration of the rtriP18-based vector encoding HA1 and HA3 induces an antibody response against both the encoded influenza viral antigens, as evidenced by the strong HI titers against PR8 and X31. I showed that I did. The second dose of vaccine further enhanced the antibody response. Interestingly, the HI titers induced for PR8 (H1) and X31 (H3) by rP18tri encoding both HA1 and HA3 are HI induced by the rtriP18-based vector encoding only HA1 or HA3. Corresponds to the titer (Fig. 18A). Similar results were obtained in Balb / c mice (Fig. 18B). Mice immunized with an rP18tri-based vector (rP18tri-HA1 / HA3) encoding both HA1 and HA3 upon administration of a lethal dose of PR8 (H1N1) or X31 (H3N2) virus antigen to both virus antigens. It was defended against. The protective effect of rP18tri-HA1 / HA3, which prevents the replication of the antigen-administered virus, was evaluated 5 days after the virus antigen administration. A virus antigen administered PR8 (H1N1) and X31 (H3N2) is a in the lungs of mice mock vaccination replicated well on average titer of each 10 ⁵ and ¹⁰ 4 pfu / mL. Immunization of rP18tri-HA1 / HA3 was performed in mice administered with both viral antigens, as no weight loss was observed and no detectable viral titer was observed in the lungs of any of the immunized mice. Was defended (Figs. 19A and B).
The rP18tri-based influenza vaccine did not induce anti-vector immunity.

A recognized weakness of living viral vectors is anti-vector immunity, which reduces the immune response induced by the same vector and eliminates its use in first-dose-additional immunization vaccination methods. In a normal population, PICV has little or no pre-immunity (Trapido et al., 1971, Am J Trop Med Hyg 20: 631-641). We measured the effect of anti-vector immunization on the PICV vector by measuring antibody levels and CTL response levels with initial dose-boost immunization of the same vector. Surprisingly, no evidence of anti-vector immunity to the rPICVtri vector was found. As shown in FIG. 8, booster immunization with the same vector substantially further increased the HAI titer, which means that the HA-specific humoral response is humoral in the second and even after the third booster. It suggests that it increased the sexual response. Similar results were observed for the CTL response. In both spleen and PBMC, NP-specific CD8 and CD44 T cells increased after booster immunization (Fig. 20). Taken together, our data suggest that the rPICV vector does not induce strong anti-vector immunity and therefore can be used repeatedly in first-dose-boost immunization vaccine methods.
wrap up

A novel PICV reverse genetics system has been developed to generate a recombinant PICV virus segmented into three, which can encode up to two exogenous genes of interest. These rP18tri-based recombinant viruses can express the influenza HA and / or NP gene along with the GFP reporter gene in target cells. When tested in mice, the rP18tri-GFP / HA virus can induce high concentrations of HA-specific neutralizing antibodies, while rP18tri-GFP / NP can induce a strong NP-specific CTL response. In addition, rP18tri-based vectors expressing the dual influenza viral antigens HA and NP induce both humoral and T cell responses that provide complete protection in immunized mice for the administration of lethal antigens of A / PR8. I succeeded in doing it. More importantly, a triP18-based vector expressing HA of two different influenza virus subtypes, PR8 (H1N1) and X31 (H3N2), provides protection against both viral antigen administration, which means that It demonstrates the strength and flexibility of these novel vaccine vectors against pathogenic influenza viruses. There is no existing immunity to the PICV vector, and animals immunized with the three segmented PICV virus produce very little anti-PICV vector immunization, requiring a first dose-additional immunization vaccination method. It is also important to note that during repeated vaccinations in some cases, these animals provide an ideal vector vaccine platform for inducing strong, long-lasting cross-reactive immunity.
Example 2
The biological role of NP exoribonucleases in in vitro and in vivo arenavirus infections.

Although arenavirus NP RNase activity is important in type I interferon (IFN) inhibition, its biological role has not been well characterized. Recombinant pitindeviruses with RNase-catalyzed mutations induce high levels of IFN to proliferate inadequately in IFN-competent cells, and when infected with guinea pigs, they replicate productively in a strong stimulated IFN response. It was not possible and a wild-type reconstituted mutant was produced. Therefore, NPRNase activity is essential for IFN suppression and establishment of productive replication in the early stages of arenavirus infection.

. Arenaviruses, including some hemorrhagic fever (HF) induced agents (e.g. Lassa virus -LASV), prophylactic or therapeutic hand stage is limited (McLay et al, 2013, Antiviral Res 97: 81-92, McLay et al., 2014, J Gen Virus 95: 1-15). The etiology of arenaviruses is associated with high viremia and general immunosuppression, and this mechanism is poorly understood. Viral NPs have been shown to be able to effectively mediate the suppression of type I IFN by their exoribonuclease (RNase) function (Jiang et al., 2013, J Biol Chem 288: 16949-16959, Martinez- Sobrido et al., 2007, J Virus 81: 12696-12703, Martinez-Sobrido et al., 2006, J Virus 80: 9192-9199, Qi et al., 2010, Nature 468: 779-783, Hastie , 2011, Proc Nature Acad Sci USA 108: 2396-2401, Hastie et al., 2012, PLos ONE 7: e44211). However, the role of NPRNase activity, which mediates host immunosuppression in vivo, has not been fully characterized. In this study, pitine virus (PICV) infection in guinea pigs was treated as a surrogate model of arenavirus hemorrhagic fever (HF) (Aronson et al., 1994, Am J Pathol 145: 228-235, Lan et al., 2009. , J Virus 83: 6357-6362) to determine the role and properties of NP RNase in viral infections and IFN responses in the host. According to the luciferase (LUC) reporter assay, one alanine substitution at each of the RNase catalytic residues (D380A, E382A, D525A, H520A, and D457A) is the ability of NP to suppress Sendai virus-induced IFNβ activation. (Fig. 21A), which strengthens our previous observations with LASV NP (Qi et al., 2010, Nature 468: 779-783). Using the rP18 PICV reverse genetics system we developed (Lan et al., 2009, J Virus 83: 6357-6362), we generate recombinant viruses with individual RNase mutations identified by sequencing. I succeeded in doing so. Five RNase mutations were used to infect human airway epithelial A549 cells at MOI = 1 with WT rP18, which causes toxic infections in guinea pigs, and PICV rP2, which causes non-toxic infections. The rNDV-GFP biological assay quantified the production of type I IFN at 12 hpi and 24 hpi (Park et al., 2003, J Virol 77: 1501-1511). Both rP2 and rP18 produced low levels of IFN, similar to mock infections, as indicated by high levels of GFP expression (FIG. 21B). This is not surprising, as the NP proteins of both strains encode functional RNase domains, and it seems that there is no difference in their ability to suppress IFN production (Lan et al., 2008, Arch Virol). 153: 1241-1250). In contrast, the RNase mutant produced more IFN, as indicated by the significantly reduced expression of GFP (Fig. 21B). Therefore, NP RNase activity is required to effectively inhibit type I IFN in virus-infected cells.

At moi = 0.01, the viral growth rate was measured in IFN-deficient Vero cells and IFN Competent A549 cells. Despite about 0.5~1log lower than WT RP18, all five mutants replicated well in Vero cells, reaching ¹⁰ 6 pfu / mL in 48 hpi (Fig. 22A, left). In clear contrast, these RNase mutant viruses grew very little in A549 cells (Fig. 22A, right). Our results suggest that NP RNase activity is not essential for the basic viral life cycle, but is required for productive viral replication in IFN competent cells, which is LASV II. Consistent with recently published data on multiple variants (D389A / G392A) (Carnec et al., 2011, J Virus 85: 12093-12097).

^１ 動物が終末点に到達した際、または感染後１８日目における安楽死の時に収集した血液中でのウイルス力価。
^２ 動物が終末点に到達した際、または感染後１８日目における安楽死の時に動物から単離したウイルスの配列。
^３ ｒＰ２に感染した群の動物は６匹全て、感染後１８日目において、検出可能なウイルス血症が存在せずに生き残った。
^４ ＮＤ、プラークアッセイにより検出不可能 To compare viral pathogenicity in vivo, each virus 1x10 ⁴ pfu was intraperitoneally infected in 6 Hartley non-intimate guinea pigs as described above (Lan et al., 2009, J Virus 83). : 6357-6362, Kumar et al., 2012, Virology 433: 97-103, McLay et al., 2013, J Virus 87: 6635-6634). All procedures were approved by the University of Minnesota Animal Care and Use Committee (IACUC). Animals are monitored daily for 18 days for weight and signs of illness, and at a predetermined end point (dying, such as rectal temperature below 38 ° C with weight loss of more than 30% compared to the nomogram, or continued weight loss. ) Was euthanized. As expected, the rP2-infected animals survived and cleared the virus, but the rP18-infected animals developed fever early, indicating that significant weight loss began at 7 dpi and reached the end point by 13 dpi (13 dpi). 22B). The RNase mutant virus caused the consequences of various diseases (Fig. 22B and Table 1). All animals infected with the E382A mutant virus survived without any evidence of weight loss, while animals infected with each of the three other mutant viruses (D525A, H520A, and D457A) were debilitated to varying degrees. Was seen (Fig. 22B). However, most animals infected with D380A died from the infection some time after rP18. To determine if a WT return mutant had occurred, the degree of viremia was measured at the endpoint and the virus was sequenced (Table 1). As expected, all dying animals were associated with high viremia, but all surviving animals had very low viral infections that were undetectable. Without exception, viruses isolated from mutant-infected animals were restored to the WT NP sequence (Table 1). This is very unlikely to occur with PCR contamination or sequencing errors, as viruses isolated from animals infected with other mutant viruses performed at the same time still contained the expected mutations (data). Is not shown). Therefore, we believe that the phenotype of the disease is caused by the WT virus, which contains the WT reversion mutant, and the severity of the disease is measured by how quickly the reversion mutation occurs in vivo (18). Animals that survived on day were found to carry a small amount of the WT virus). Our results strongly suggest an essential role of NPRNase activity in in vivo arenavirus infection.

¹ Viral titer in blood collected when the animal reaches the terminal point or at the time of euthanasia 18 days after infection.
² Sequence of virus isolated from the animal when it reaches the terminal point or at the time of euthanasia 18 days after infection.
^{All 6 animals in the 3} rP2-infected group survived in the absence of detectable viremia 18 days after infection.
⁴ ND, undetectable by plaque assay

To investigate the role of RNase in early viral infections in infected animals and the host innate immune response, viral spread was monitored and the original antiviral genes at 1 dpi and 3 dpi were quantified. On day 1, a small amount of virus was detected in the liver and spleen of animals infected with rP18, and in the livers of some animals infected with rP2 and RNase mutant viruses (FIG. 23A). ). On day 3, both rP18 and rP2 were replicated relatively abundantly in both the liver and spleen. In contrast, the RNase mutant virus disappeared from the liver and appeared to be detected in very small amounts in only a few spleens (Fig. 23A). Representative innate immune response genes in abdominal cells on day 1, IFN-α1, IFN-β1, ISG15, IRF7, RIG-I, and MDA5 were quantified by quantitative real-time PCR (FIG. 23B). ). These genes are highly activated by RNase mutant viruses rather than WT viruses (rP2 and rP18), which requires NP RNase for in vivo in vivo immunosuppression induced by arenaviruses. It is shown that.

In summary, our study using recombinant PICV RNase variants not only confirmed the important role of NP RNase in the suppression of type I IFN and viral replication in vivo, but also in early congenital immunosuppression. It also provided conclusive evidence of an important role and allowed the establishment of proliferative infections in vivo. Considering that the mechanism of IFN suppression dependent on NP RNase is conserved among arenaviruses (Jiang et al., 2013, J Biol Chem 288: 16949-16959), our results show that other arenavirus pathogens. It can also be applied to suggest that NPRNase is an ideal target for the development of antivirals.
Example 3
The arenavirus vaccine vector delivers two antigens and immunizes against each antigen.
1. 1. Generation of a live rP18tri vaccine vector expressing the dual influenza antibodies HA and NP.

Example 1 uses a replicative, three-segmented rPICV system (rP18tri) and this rP18tri vector to produce either influenza HA (abbreviated as H) or NP antigen (P). It was disclosed that it was expressed and that the vector induced a strong antibody and CTL response in mice. To determine if both HA and NP genes could be delivered using a single rP18tri virion particle, S1 and S2 viral genomic RNA segments were generated and encoded for influenza HA and NP genes, respectively. By using different combinations of plasmids in the transfection reaction, we succeeded in producing the live vaccine vectors rP18tri-P / H and rP18tri-H / P. They encode the HA and NP genes on different S segments, as shown in FIG. 24A. As a control vector, an rP18tri vector (rP18tri-G / G) encoding the eGFP reporter gene in both the S1 and S2 segments was also generated. To measure antigen expression, vero cells were infected with rP18tri-G / G, rP18tri-P / H, and rP18tri-H / P, respectively. At 24 hp i, the expression of HA and NP in cells was investigated by IFA using mouse anti-HA and anti-NP antibody, respectively, and then detected using PE-conjugated anti-mouse antibody. Expression of both HA and NP proteins was detected in cells infected with rP18tri-P / H and rP18tri-H / P, but not in cells infected with vector control rP18tri-G / G. The fact that the number of cells expressing HA and NP by rP18tri-H / P infection is smaller than that by rP18tri-P / H infection is due to the low viral titer used in the infection (Fig. 24B). A later virus growth analysis of BHK-21 cells with a moi of 0.01 showed that rP18tri-P / H and rP18tri-H / P replicated at similar kinetics and were more than vector control rP18tri-G / G. It suggests that it is <0.5 log lower (Fig. 24C).
2. The HA / NP dual antigen vaccine vector can induce protective immunity in mice.

To test the protective immunity of live rP18tri-P / H and rP18tri-H / P vectors in vivo, we tested a group of mice (n ≧ 3) with ^{a 1x10 4} pfu rP18tri-G / G control vector. , RP18tri-P / H, or rP18tri-H / P was infected by the IM route, boosted with the same vector 14 days later, and a lethal dose of mouse-compatible A / PR8 influenza virus (10) 14 days after vaccination. × MLD ₅₀ ) was administered as an antigen. All mice immunized with the control vector were infected and died by day 6, but all mice that received rP18tri-P / H or rP18tri-H / P were antigen-treated without any signs of disease or weight loss. Survived from (Fig. 25A). RP18tri-P / H or rP18tri-H / compared to control vector-immunized mice with ^{high viral titers (2-10 × 10 5} pfu / g) in the lungs at 3 and 6 dpi. P-immunized mice (n = 3 in each group) did not find any virus detectable at 6 dpi, and only one of the three had a relatively small amount of virus at 3 dpi (<5 ×). 10 ³ pfu / g) (Fig. 25B). Our data suggest that dual antigens expressing viral vectors can induce protective immunity conferred by HA-specific neutralizing antibodies that are potent against influenza virus.
3. 3. The HI / H3 dual antigen vector induces a balanced HA neutralizing antibody.

Two different HA subtypes were used to determine if neutralizing antibodies could be induced with the same efficiency. To this end, we cloned the H3 HA gene for A / x31 (H3N2 subtype of influenza virus) into the S2 segment and transfused it into the full-length L segment and the S1 segment encoding the H1 HA of A / PR8. Upon ejection, a live rP18tri-H3 / H1 vector could be generated (FIG. 26A). As a control, an rP18tri vector encoding either eGFP on the S2 segment and either H1 or H3 on the S1 segment, called rP18tri-G / H1 or rP18tri-G / H3, respectively, was also generated (FIG. 26A). To test these immunogenicities, a group of C57BL6 mice (n = 3 per group) were first dosed and boosted with 3 vectors, respectively, at 14-day intervals via the IM route. Blood collected 14 days after initial administration and booster immunization was measured for the amount of neutralizing antibody against A / PR8 / H1N1 and A / x31 / H3N2 (FIG. 26B, top). The rP18tri vectors encoding a single HA subtype, rP18tri-G / H1 and rP18tri-G / H3, each induced a potent homosubtype neutralizing antibody that increased with administration of booster immunity, but first dose. Alternatively, no detectable amount of cross-reactive antibody was induced after booster immunization. The rP18tri-HI / H3 dual antigen vector induced both H1 and H3 neutralizing antibodies that were increased upon booster immunization, and the concentration of each neutralizing antibody was the antibody induced by the corresponding single antigen vector. Corresponding to titer (Fig. 26B, top surface). Similar findings were made from Balb / c mice (FIG. 26B, bottom surface). Taken together, our data strongly suggest that the HI / H3 dual antigen vector induces balanced neutralizing antibodies against both antigens in mice. In other words, there is no preference (bias) in producing neutralizing antibodies against one or the other HA antigens.
4. Induction of hetero-subtype neutralizing antibodies by initial administration and booster immunization using different HA subtypes.

Recent studies have shown that a wide range of neutralizing antibodies can be produced by initial administration-boosting immunization or serial infection (Wei et al., 2010, Science 329: 1060-1664, Wei). et al., 2012, Sci Transl Med 4: 147ra114, Miller et al., 2013, Sci Transl Med 5: 198ra107, Vaccine et al., 2011, J Exp Med 208: 181-193, Krammer et al., 2012. J Vaccine 86: 10302-10307, Miller et al., 2013, J Infect Dis 207: 98-105, Margine et al., 2013, J Vaccine 87: 4728-4737). Since the rP18tri vector increases the immune response during booster administration, it was tested whether cross-reactive immunity could be induced using the initial dose-boost immunization method with different HA subtypes. For this purpose, live rP18tri-P / H1 and rP18tri-P / H3 vectors were generated. Each of these is a conserved viral protein (see Genbank accession number NP_040982.1) that is known to elicit a T cell response with either H1 (A / PR8) or H3 (x31) HA. / PR8 NP is coded respectively (Fig. 27A). Mice were first dosed with rP18tri-P / H1 at 14-day intervals, boosted with rP18tri-P / H3, and boosted with rP18tri-P / H1 again. As expected, NP-specific CTL was detected after the first dose (7 dpp), increased significantly during the booster (7 dppb), and remained high (3-5%) even after the second booster. Was maintained in (Fig. 27B). Blood was collected 14 days after each administration and the concentrations of neutralizing antibodies against A / PR8, A / x31, and A / WSN were investigated. Neutralizing antibodies specific for homologous viruses A / PR8 (H1) and A / 31 (H3) were highly induced when exposed to the same HA antigen and were not normally enhanced by booster immunization of heterologous HA. .. On the other hand, the neutralizing antibody against the heterosubtype virus A / WSN (H1) was stably increased at the time of booster immunization (Fig. 27C). These immunized mice showed a significant improvement in survival after administration of the lethal antigen of heterosubvirus A / WSN (Fig. 27D). Taken together, our data show that cross-reactive neutralizing antibodies can be induced by initial administration-boost immunization with a heterologous HA subtype using the rP18tri vector, cross-protection against heterosubinfluenza virus antigen administration. It suggests that it can cause.
5. The rP18tri vector can elicit both humoral and T cell responses by the oral pathway.

To determine if the rP18tri vector can be conveniently administered by the oral route ^{, 1x10 4} pfu rP18tri-G vector (n = 3) or rP18tri-P / in C57BL6 mice by oral feeding. H (n = 4) was immunized and 42 days later, boost immunization was performed using the same vector. NP tetramer-positive effector T cells (CD8 ⁺ CD44 ^high ) 7 days after initial administration and booster immunization were measured by established NP tetramer analysis. Seven days after the first dose, two of the three test mice immunized with rP18tri-P / H had NP ⁺ CD8 ⁺ CD44 ^high cells (1.24% and 0.55%), which Was clearly higher than the background levels (0.13% and 0.09%) found in vector-immunized mice. NP-specific effector cells increased significantly in the range of 5.7 to 7.1% in all four immunized mice 7 days after boost immunization (Fig. 28A). A similar pattern was observed with neutralizing antibodies. Two of the four immunized mice exhibited a positive HAI titer (HAI = 20) 14 days after the first dose. Forty-two days after the first dose, all four mice exhibited an average HAI titer of 40. After booster immunization, the HAI titer increased significantly in all 4 mice in the range 80-160 (Fig. 28B). Taken together, our data strongly suggest that the rP18tri vector can induce both high levels of humoral and T cell responses by the oral route after booster immunization.
6. The inactivated rP18tri vector can elicit both humoral and T cell responses.

It was measured whether the inactivated rP18tri vector could induce vaccine immunity. Mice were immunized with live vaccine vectors or hydrogen peroxide-treated rP18tri-P / H vaccine vectors (ie, inactivated vaccine vectors) by two doses at 34-day intervals. Immediately after the initial administration (7 days after the initial administration, 7 dpp), neither neutralizing antibody nor NP-specific T cells were detected. However, high concentrations of NP-specific effector T cells were detected after booster administration of the inactivated vaccine vector (7 days after booster immunization, 7 dpib) (FIG. 29, left). At 34 days after the first dose (34 dpp), low concentrations of neutralizing antibody were detected in all three mice (HAI = 20), and the inactivated vaccine vector was administered after booster immunization (14 days after booster immunization, 14 dppb). , 40-80 markedly increased (Fig. 29, right). It is noteworthy that the levels of T cell and humoral response induced by the chemically inert rP18tri-P / H vaccine vector are significantly lower than those induced by the live vaccine vector. However, the fact that inactivated rP18tri-P / H can still induce both humoral and T cell responses after booster immunization means that as a vaccine platform, this viral vector is a live and inactivated vaccine. It suggests that both are flexible.
7. In the guinea pig model, the rP18tri vector induces protective immunity against the virulent P18 virus.

The WT P18 virus is obtained after continuous passage of pitindevirus (PICV) in guinea pigs and causes diseases such as hemorrhagic fever in animals. The WT P18 virus has been used as a safe surrogate model for studying the etiology of Lassa fever virus infection in humans (Jahling et al., 1981, Infect Immun 32: 872-880, Aronson et al., 1994. , Am J Pathol 145: 228-235, Liang et al., 2009, Ann NY Acad Sci 1171 Suppl 1: E65-74). Compared to the WT P18 virus, the rP18tri vector segmented into three grows in vitro by at least 1 log less. We also measured the pathogenic potential of the rP18tri-G vector in guinea pigs. ^{Guinea pigs infected with the 1x10 4} pfu rP18 virus started fever early, lost abrupt weight 7 days after infection, and reached the end point by day 14 (Fig. 30A). In contrast, ^{guinea pigs infected with 1 × 10 6} pfu rP18tri-G (100 times higher titer than rP18 control) showed similar weight gain to mock-infected animals and experienced fever for more than a day. Did not (Fig. 30A).

It was measured whether this non-pathogenic rP18tri vector could induce protective immunity against lethal rP18 antigen administration in guinea pigs. Guinea pigs were injected with either phosphate buffered saline (PBS) as a mock infection or ^{1x10 4} pfu rP18tri-G via the IP route, and 14 days later, a lethal dose of rP18 virus was antigen-administered. PBS-immunized guinea pigs (n = 3) quickly fevered and lost significant weight, with all animals reaching a predetermined end point by day 11 (FIG. 30B). In contrast, rP18tri-G immunized guinea pigs (n = 3) had no measurable weight loss and were completely protected (Fig. 30B). Defensive immunity to PICV appears to be mediated by a T cell response, as neutralizing antibodies do not grow upon antigen administration. Previous studies, different arenaviruses, e.g. LCMV and PICV, Lassa and motor Pay A virus, cross protection between Junin and Tacaribe complex virus, as well, that the non-pathogenic arenavirus were investigated as live vaccine It is shown (Olschlager et al., 2013, PLoS Pathog 9: e1003212). We present that the rP18tri vector, which integrates a protective T cell epitope into a PICV protein, can induce cross-protivative immunity against other arenavirus pathogens. Due to its ability to encode up to two additional antigens, the rP18tri vector can be developed as a dual (or triple) vaccine vector against both arenavirus pathogens and other desired pathogens (s). it can.

Taken together, we have developed a novel pitine devirus (PICV) -based live viral vector rP18tri that has three RNA segments and encodes two exogenous protein antigens. The viral vector was attenuated in vitro and in vivo. By using influenza HA as a model antigen, rP18tri-G / H can induce long-term protective immunity in mice. The rP18tri vector is capable of inducing a strong humoral response in mice and guinea pigs and high levels of virus-specific effector T cells. The antibody and T cell responses induced by the rP18tri vector were significantly increased by booster vaccination and were at high levels even after 4 applications. This is a unique feature of this live viral vector, ideal for first-dose-boost immunization vaccination. The vector may be administered by various routes such as intramuscular (IM), intraperitoneal (IP), intranasal (IN), and oral. Initial administration and booster immunization with different HA proteins from different influenza virus strains induced heterosubtype immunity. Therefore, there is the potential to develop a universal influenza vaccine. The chemically inactivated rP18tri-P / H induced both humoral and CTL responses after booster immunization. Since the rP18tri vector induced protective immunity against the virulent rP18 virus, it is possible to develop a cross-reactive vaccine against other pathogenic arenaviruses such as Lassa fever virus and a double (triple) vaccine against a combination of other pathogens. There is sex.

All patents, patent applications and public relations cited herein, as well as the submission of nucleotide sequences in electronically available materials such as Genbank and RefSeq, and amino acid sequences in SwissProt, PIR, PRF, PDB, etc. Submissions, as well as translations from the annotated code regions in Genbank and RefSeq), are incorporated as a reference in their entirety. Auxiliary materials referred to in the public relations (auxiliary tables, auxiliary diagrams, auxiliary materials and methods, and / or auxiliary experimental data) are also incorporated as a reference in their entirety. In the event of any conflict between the disclosure of this application and the disclosure of any document incorporated herein by reference, the disclosure of this application shall prevail. The detailed description and examples described above are provided solely for clarity of understanding. Unnecessary limitations should not be interpreted from these. The present invention is not limited to the exact details shown and described, and variations that are apparent to those skilled in the art are included in the present invention as defined by the claims.

Unless otherwise specified, all numbers used in the present specification and claims to represent the amount of constituents, molecular weight, etc. are understood to be modified by the term "about" in all cases. It should be. Therefore, unless otherwise stated contrary to these, the numerical parameters described in the specification and claims are estimates that may vary depending on the desired properties pursued by the present invention. .. Not as an attempt to limit the application of the doctrine of equivalents to the claims, to say the least, each numerical parameter is at least in terms of the number of significant figures reported, and the usual fractional calculation. It should be interpreted by applying the technology.

Although the range and parameters of numbers that describe the broad scope of the invention are approximate, the numbers described in the particular examples are reported as accurately as possible. However, all numbers inherently contain the range inevitably obtained from the standard deviation found in each test measurement.

All titles are for the convenience of the reader and should not be used to limit the meaning of the text following the title unless such provisions are made.

Claims (53)

Three ambisensical genomic segments,
The first genomic segment contains a coding region encoding the Z protein and a coding region encoding the LRdRp protein.
The second genomic segment contains a coding region encoding a nucleoprotein (NP) and a first restriction enzyme site, and the third genomic segment contains a coding region encoding a glycoprotein and a second restriction enzyme site. Including,
A genetically modified pitindevirus containing the genomic segment. The virus according to claim 1, wherein the second genomic segment contains a plurality of cloning sites, and the first restriction enzyme site is a part of the plurality of cloning sites. The virus according to claim 1, wherein the third genome segment contains a plurality of cloning sites, and the second restriction enzyme site is a part of the plurality of cloning sites. The virus according to claim 1, wherein the second genomic segment further comprises a coding region encoding a first protein inserted into the first restriction enzyme cleavage site. The virus according to claim 1, wherein the third genomic segment further comprises a coding region encoding a second protein inserted into the second restriction enzyme cleavage site. The second genomic segment further comprises a coding region encoding a first protein inserted into the first restriction enzyme cleavage site, and the third genomic segment is located at the second restriction enzyme cleavage site. The virus according to claim 1, further comprising a coding region encoding a second protein to be inserted. The virus according to claim 4, 5, or 6, wherein the first and second proteins are selected from antigens and detectable markers. The virus according to claim 7, wherein the antigen is a protein expressed by a viral pathogen, a prokaryotic cell pathogen, or a eukaryotic cell pathogen. The virus according to claim 6, wherein the first protein and the second protein are different. The virus according to claim 6, wherein the first protein and the second protein are the same. The nuclear protein comprises at least one mutation that reduces the exoribonuclease activity of the nuclear protein, the mutation being aspartic acid in amino acid 380 of SEQ ID NO: 3, glutamic acid in amino acid 382 of SEQ ID NO: 3, amino acid of SEQ ID NO: 3. The first aspect of claim 1, wherein the aspartic acid, glutamic acid, or histidine is selected from aspartic acid in 525, histidine in amino acid 520 of SEQ ID NO: 3, and aspartic acid in amino acid 457 of SEQ ID NO: 3, and the aspartic acid, glutamic acid, or histidine is replaced with alanine. Virus. An infectious viral particle comprising the three genomic segments of claim 1. A composition comprising the isolated infectious virus particles according to claim 12. The first vector encoding a first genomic segment comprising a coding region encoding a Z protein and a coding region encoding an LRdRp protein, wherein the first genomic segment is antigenomic. Vector,
A second vector encoding a second genomic segment comprising a coding region encoding a nuclear protein (NP) and a first restriction enzyme site, wherein the second genomic segment is antigenomic. 2 vectors, and a third vector encoding a third genomic segment containing a coding region encoding a glycoprotein and a second restriction enzyme site, wherein the third genomic segment is antigenomic. Containing the third vector,
A collection of vectors. The aggregate according to claim 14, wherein the vector is a plasmid. The aggregate according to claim 14, wherein the plasmid further comprises a T7 promoter. The aggregate according to claim 14, wherein the second genomic segment comprises a plurality of cloning sites, and the first restriction enzyme site is a part of the plurality of cloning sites. The aggregate according to claim 14, wherein the third genomic segment comprises a plurality of cloning sites, and the second restriction enzyme site is a part of the plurality of cloning sites. The aggregate according to claim 14, wherein the second genomic segment further comprises a coding region encoding a first protein inserted into the first restriction enzyme cleavage site. The aggregate according to claim 14, wherein the third genomic segment further comprises a coding region encoding a second protein inserted into the second restriction enzyme cleavage site. The second genomic segment further comprises a coding region encoding a first protein inserted into the first restriction enzyme cleavage site, and the third genomic segment is located at the second restriction enzyme cleavage site. The aggregate according to claim 14, further comprising a coding region encoding a second protein to be inserted. The aggregate according to claim 19, 20, or 21, wherein the first and second proteins are selected from antigens and detectable markers. 22. The aggregate according to claim 22, wherein the antigen is a protein expressed by a viral pathogen, a prokaryotic cell pathogen, or a eukaryotic cell pathogen, or a fragment thereof. The aggregate according to claim 21, wherein the first protein and the second protein are different. The aggregate according to claim 21, wherein the first protein and the second protein are the same. Introducing the assembly of the vector according to claim 14 into a cell, and incubating the cell in a medium under conditions suitable for expression, and the first, second, and third genomes. A method for making a genetically modified pitindevirus, which comprises packaging a segment. 26. The method of claim 26, further comprising isolating infectious virus particles from the medium. 26. The method of claim 26, wherein the cells express T7 polymerase. A reverse genetics system for producing a genetically modified pitindevirus containing three vectors.
The first vector encodes a first genomic segment comprising a coding region encoding a Z protein and a coding region encoding an LRdRp protein, said first genomic segment being antigenomic. Vector The second vector encodes a second genomic segment containing a coding region encoding a nuclear protein (NP) and a first restriction enzyme site, said second genomic segment being antigenomic. Vector 2 The third vector encodes a third genomic segment containing a coding region encoding a glycoprotein and a second restriction enzyme site, the third genomic segment being antigenomic. Includes the vector of
The reverse genetics system. The reverse genetics system according to claim 29, wherein each plasmid contains a T7 promoter. And introducing said three vectors genome segments according to the cell of the ex vivo to claim 2 9,
A method of using a reverse genetics system, which comprises incubating ex vivo cells under conditions suitable for transcription of the three genomic segments and expression of the coding region of each genomic segment. 31. The method of claim 31, further comprising isolating infectious virus particles produced from the cells, wherein each infectious virus particle comprises the three genomic segments. 31. The method of claim 31, wherein the introduction comprises transfecting the cells with the three genomic segments. 31. The method of claim 31, wherein the introduction comprises contacting the cell with infectious viral particles comprising the three genomic segments. 31. The method of claim 31, wherein the cell is a vertebrate cell. 35. The method of claim 35, wherein the vertebrate cell is a mammalian cell. 36. The method of claim 36, wherein the mammalian cell is a human cell. 35. The method of claim 35, wherein the vertebrate cell is a bird cell. 38. The method of claim 38, wherein the avian cells are avian embryo fibroblasts. Contains the infectious virus particles of claim 12.
The second genomic segment further comprises a coding region encoding a first antigen inserted into the first restriction enzyme cleavage site, and the third genomic segment further contains the second restriction enzyme cleavage site. A composition for producing an immune response in a subject that further comprises a coding region encoding a second antigen inserted into the site. The composition according to claim 40, wherein the subject is a vertebrate. The composition of claim 41, wherein the vertebrate is a mammal. 42. The composition of claim 42, wherein the mammal is a human. The composition of claim 40, wherein the vertebrate is a bird. The composition of claim 40, wherein the immune response comprises a humoral immune response. The composition of claim 40, wherein the immune response comprises a cell-mediated immune response. The antigen is a viral pathogen, a prokaryotic cell pathogen, or a protein expressed by a eukaryotic cell pathogen, or a fragment thereof, and the subject is exposed to the viral pathogen, the prokaryotic cell pathogen, or the eukaryotic cell pathogen. The composition according to claim 40, which has a risk of being affected. Includes at least two populations of infectious virus particles according to claim 12.
The second genomic segment further comprises a coding region encoding a first antigen inserted into the first restriction enzyme cleavage site, and the third genomic segment further contains the second restriction enzyme cleavage site. It further comprises a coding region encoding a second antigen inserted into the site, including
Each population of infectious viral particles encodes a different antigen,
A combination for producing an immune response in a subject. The viral pathogen is selected from the group consisting of a member of the genus Aphthovirus, a member of the genus Pestivirus, a member of the family Orthomyxoviridae, a coronavirus, a member of the family Orthomyxoviridae, a member of the family Asfaridae, and a member of the family Paramyxoviridae. The virus according to claim 8, the aggregate according to claim 23, or the composition according to claim 47. A member of the genus Aftvirus is the mouth-foot epidemic virus FMDV, a member of the genus Pestivirus is the bovine viral diarrhea virus, and a member of the family Arterivirus is the porcine breeding / respiratory disorder syndrome virus PRRSV. The coronavirus is selected from the pig epidemic diarrhea viruses EPDV, SARS-CoV, and MERS-CoV, the member of the orthomixovirus family is the influenza virus, and the member of the Asfariridae family is the African pig cholera virus. The virus according to claim 49, the aggregate according to claim 49, or the composition according to claim 49, wherein the member of the paramyxovirus family is a Newcastle disease virus. The prokaryotic cell pathogen is a Gram-negative pathogen or a Gram-positive pathogen.
The gram-negative pathogens are Enterobacteriaceae, Campylobacter, Pasteurellaceae, Bacillus, Seratia, Bordetella, Enterobacter, Leptospila, Actinovacilus, Haemophilus, and Aeromonas. Selected from the group consisting of
Alternatively, the Gram-positive pathogen is selected from the group consisting of members of the family Micrococcus, members of the family Deinococcus, and Clostridium species.
The virus according to claim 8, the aggregate according to claim 23, or the composition according to claim 47. The prokaryotic cell pathogen is a Gram-negative pathogen or a Gram-positive pathogen.
A member of the Enterobacteriaceae family is selected from Escherichia coli, Salmonella, Klebshella and Enterobactor species, the Campylobacter species is Campylobacter jejuni, and members of the Pasteurella family are P. multocida and Manhemia hemorichica. A member of the family Enterobacteriaceae is selected from F. coli. necrophorum, F. et al. necrophorum subsp. necrophorum, and F. Selected from nucleatum,
Alternatively, a member of the Micrococcus family is Staphylococcus aureus, and a member of the Deinococcus family is selected from Streptococcus agalactiae, Streptococcus uberis, Streptococcus bovis, and Streptococcus qui.
The virus according to claim 51, the aggregate according to claim 51, or the composition according to claim 51. The prokaryotic cell pathogen is a Gram-negative pathogen or a Gram-positive pathogen.
The Klebsiella species is a pneumonia rod.
The virus according to claim 52, the aggregate according to claim 52, or the composition according to claim 52.

Images