JP5706612B2 - Determination marker, determination method and determination kit for susceptibility to age-related macular degeneration - Google Patents

Description

  The present invention relates to an age-related macular degeneration susceptibility determination marker, an age-related macular degeneration susceptibility determination method and an age-related macular degeneration susceptibility determination kit, and an age-related macular degeneration susceptibility determination kit About.

Age-related Macular Degeneration (AMD) is an age-related ophthalmological disease that causes visual function impairment due to tissue degeneration and angiogenesis in the macular region at the center of the retina in the fundus of the elderly. This is a disease that is increasing in developed countries including Japan. Currently, about 0.9% of the population over 50 years old is considered to be affected, and has attracted attention as a disease in which QOL (Quality of Life) of millions of elderly people is significantly impaired.
However, since treatments for age-related macular degeneration are mainly those after the onset of vision loss, the effects of treatment after the progression of the disease stage are limited.

In recent years, risk factors for the development of age-related macular degeneration include complement factor H (CFH), which is a suppressor of the complement system (see Non-Patent Documents 1 to 3), and the vicinity of the serine protease gene HTRA1 (Non-Patent Documents 4 to 5). The genetic polymorphism (see below) has been identified, suggesting that age-related macular degeneration may be strongly influenced by the genetic background.
However, there are many unclear points regarding the details of the mechanism by which these gene polymorphisms are involved in the development of age-related macular degeneration, and whether it is necessary and sufficient as a molecular target for the diagnosis and treatment of age-related macular degeneration. It is not clear.

Patent Document 1 determines the propensity of a subject who develops age-related macular degeneration in which the presence or absence of a mutation at a polymorphic site of a gene encoding CFH is measured using a single nucleotide polymorphism (SNP). A diagnostic method for doing so is disclosed.
However, even if this method is used, there is a problem in that the establishment and accuracy of determination of susceptibility to age-related macular degeneration disease are not sufficient.

The onset of age-related macular degeneration is not only due to the above-mentioned genetic factors, but also because it is related to diseases such as smoking and eating habits, genetic factors related to many genes and environmental factors It is considered to be a multifactorial disease involving both.
In general, in multifactorial diseases, it is difficult to determine the risk of morbidity from mutations or abnormalities in one gene, so determination by the SNP is insufficient, but by combining a plurality of morbidity risk markers, It is more likely that the difficulty of morbidity can be predicted more accurately.

  In recent years, DNA copy number variation (CNV) in a genomic region (several tens of kilobase pairs or more) shorter than chromosomal DNA duplication or deletion has attracted attention as a new genome analysis marker different from SNP. It is being collected and analyzed for disease relevance of DNA copy number polymorphisms.

In conventional genetic analysis, gene “sequence differences” between individuals represented by SNPs have been well studied. In contrast, a DNA copy number polymorphism is larger in a genomic region having a length ranging from 1 kilobase pair (kbp) to several megabase pairs (Mbp) in comparison with the reference genomic DNA, It means “number difference” of genes whose DNA copy number fluctuates.
In recent years, DNA copy number polymorphism has been found in a much wider region than previously thought, which is 12% or more (about 360 Mbp) of the entire human genome, in addition to the SNPs known so far. It has been shown that the possibility of generating diversity of genomes among new individuals (see Non-Patent Document 6). These DNA copy number polymorphisms include about 3,000 genes including those related to various diseases and drug susceptibility, and not only congenital diseases with so-called chromosomal abnormalities but also lifestyle-related diseases. This indicates that it may contribute widely to individual differences in human traits including common diseases such as autoimmune diseases. DNA copy number polymorphism data is currently disclosed in a public database on the Internet (DataBase of Genomic Variants, http://projects.tcag.ca/variation/).

Even when considering SNP genotyping, if the SNP exists in a genomic region containing a DNA copy number polymorphism, copy number polymorphism analysis is required due to the following problems.
In general, when the genotyping of SNP is analyzed by a method such as TaqMan PCR method or invader method, the ratio of the fluorescence intensity corresponding to each allele at the end point after each reaction reaches a plateau, For each allele, the numbers (three clusters when plotted on the graph) corresponding to three groups of homozygotes (allele ratio 1: 0 or 0: 1) and heterozygotes (allele ratio 1: 1) Aggregated. On the other hand, when SNP genotyping is performed at a certain time before each reaction reaches a plateau, the SNP genotyping in a region not including the DNA copy number polymorphism has a fluorescence intensity corresponding to each allele. Although the ratio is divided into three clusters, there may be cases where the SNP genotyping in a region containing a DNA copy number polymorphism cannot be divided into three clusters (see Non-Patent Document 7).
That is, in a subject in which gene duplication occurs, particularly in a subject in which “allele asymmetry” has occurred as a result of duplication, the fluorescence intensity ratio is different from any of the above three, and the position is different from any of the three clusters. Can be detected. It can be inferred that a subject with “allelic asymmetry” may be a heterozygote having a copy number ratio of both alleles other than 1: 1 (eg, 2: 1, 1: 2, etc.). . However, the total number of copies is unknown only by genotyping analysis of SNP, and the detailed number of both alleles cannot be obtained, so quantitative analysis of copy number polymorphism is required.

  Therefore, when a SNP is contained in a genomic region having a copy number polymorphism, for example, the risk allele: non-risk allele is 2: 1 among the subjects conventionally considered heterozygotes. There is a possibility that there is a disease risk allele: non-risk allele of 1: 2, and there is a possibility that the copy number of the disease risk is actually different. In addition, the SNP genotyping analysis alone cannot distinguish between “allelic symmetry” gene duplication (eg, 2 copies: 2 copies) and heterozygotes without gene duplication (1 copy: 1 copy). Quantification of copy number polymorphisms such as inability to discriminate between homozygotes with duplication (3 copies: 0 copies), homozygotes without gene duplication, homozygotes, and deletions (1 copy: 0 copies) It is necessary to obtain the total number of copies from a statistical analysis.

  The CFH gene and its related gene, CFHR1-CFHR5, are duplicated in the process of evolution to form an RCA (the Regulation of Complement Activation) locus (gene group) covering about 300 kb in the 1q31.3 region of chromosome 1 Although it is known that a DNA copy number polymorphism exists in the 3 ′ region of the CFH gene (see Non-Patent Document 8 and DataBase of Genomic Variants). As for the correlation between these DNA copy number polymorphisms and susceptibility to age-related macular degeneration, analysis has not progressed both in Japan and overseas.

  Therefore, it is possible to predict the onset and progression of age-related macular degeneration with a significant decrease in visual acuity with a high probability, and it is suitable for early prevention of age-related macular degeneration and selection of the optimal drug treatment method for patients who have already developed it. Markers for determining susceptibility to age-related macular degeneration, methods for determining susceptibility to age-related macular degeneration, and susceptibility to age-related macular degeneration At present, it is strongly desired to provide sex determination kits.

Special table 2008-529536

Klein RJ et al. , Science, 2005, 308 (5720), 385-389. Edwards AO et al. , Science, 2005, 308 (5720), 421-424. Haines JL et al. , Science, 2005, 308 (5720), 419-421. Yang Z et al. , Science, 2006, 314 (5801), 992-993. Dewan A et al. , Science, 2006, 314 (5801), 989-92. Redon R et al. , Nature, 2006, 444 (7118), 444-454. Hosono N et al. , Hum Mutat, 2008, 29 (1), 182-189. Alkan C et al. , Nat Genetics, 2009, 41 (10), 1061-1067.

  An object of the present invention is to solve the above-described problems and achieve the following objects. That is, the present invention is capable of predicting the onset and progression of age-related macular degeneration that causes a significant reduction in visual acuity with high accuracy and probability. A marker for determining susceptibility to age-related macular degeneration, which can be suitably used for selecting a treatment method, and a method for determining susceptibility to age-related macular degeneration, which can easily determine the susceptibility to age-related macular degeneration It is another object of the present invention to provide a kit for determining susceptibility to age-related macular degeneration.

  In order to solve the above-mentioned problems, the present inventors have made extensive studies and as a result, obtained the following findings. That is, by using the CFH gene identified by the nucleotide sequence represented by SEQ ID NO: 1 as a marker and determining the DNA copy number polymorphism of the marker using quantitative PCR, a high probability from the DNA copy number polymorphism In addition, it is possible to determine the difficulty of age-related macular degeneration with accuracy, and further higher accuracy and establishment by combining with the DNA copy number polymorphism and a single nucleotide polymorphism with an amino acid mutation of the CFH gene As a result, the present invention was completed.

The present invention is based on the above findings by the present inventors, and means for solving the above problems are as follows. That is,
<1> A marker for determining susceptibility to age-related macular degeneration, which has the base sequence represented by SEQ ID NO: 1 and is used as a marker for detecting the difficulty of affairs of age-related macular degeneration It is.
TGTCTCAGTGTATTGTTCTGTTGCTGTGCAGCAGGCATACAAATCTGACAATCTCGTAACTATTTGTGCAAGC (SEQ ID NO: 1)
<2> A probe having a fluorescent label complementary to part or all of the CFH gene specified by the base sequence represented by SEQ ID NO: 1 in a DNA-containing sample derived from a subject is represented by the following sequence: The measurement step of measuring the expression of the CFH gene with the fluorescent label after hybridizing to the base sequence represented by No. 1 and the DNA copy number of the CFH gene are determined from the fluorescence intensity measured in the measurement step Aging characterized in that it comprises at least a DNA copy number determination step and a susceptibility determination step of determining the difficulty of age-related macular degeneration from the DNA copy number determined in the DNA copy number determination step This is a method for determining macular degeneration susceptibility.
TGTCTCAGTGTATTGTTCTGTTGCTGTGCAGCAGGCATACAAATCTGACAATCTCGTAACTATTTGTGCAAGC (SEQ ID NO: 1)
<3> The susceptibility determination step is a step of determining by combining the determined DNA copy numbers, and the combination of the DNA copy numbers is (A) 0 copy and 1 copy, (B) 2 copies and 3 A combination with a copy, and (C) one of a combination of 0 to 2 copies and (D) a 3 copy, and in the combination, either (B) or (D) The method for determining susceptibility to age-related macular degeneration according to the above <2>, which is a step of determining susceptibility to age-related macular degeneration.
<4> The measurement step according to <2> to <3>, wherein the measurement step is a step of measuring the expression of the CFH gene by quantitative PCR using the CFH gene specified by the base sequence represented by SEQ ID NO: 1 as a template It is the age-related macular degeneration susceptibility determination method in any one.
<5> The age-related macular degeneration susceptibility determination method according to <4>, wherein quantitative PCR is performed using a primer having a base sequence represented by SEQ ID NO: 2 and SEQ ID NO: 3 below.
TGTCTCAGTGTATTGTTCTGTGCT (SEQ ID NO: 2)
GCTTGCCCAAATAGTTACGAGATT (SEQ ID NO: 3)
<6> Quantitative PCR is quantified using a housekeeping gene as an internal standard, and a DNA copy number determination step compares the fluorescence intensity corresponding to the CFH gene with the fluorescence intensity corresponding to the housekeeping gene, thereby determining the CFH gene. The method for determining susceptibility to age-related macular degeneration according to any one of <4> to <5>, which is a step of determining the DNA copy number.
<7> The age-related macular degeneration susceptibility determination method according to any one of <4> to <6>, wherein the quantitative PCR is performed by a TaqMan method.
<8> The DNA copy number determination step is a step of determining the DNA copy number of the CFH gene from the fluorescence intensity corresponding to the CFH gene at a time point before the fluorescence intensity measured in the measurement step reaches saturation. The age-related macular degeneration susceptibility determination method according to any one of <2> to <7>.
<9> Age-related macular degeneration according to any one of <2> to <8>, wherein the difficulty in determining age-related macular degeneration is determined by further combining single nucleotide polymorphisms in the susceptibility determination step. This is a method for determining susceptibility.
<10> The age-related macular degeneration susceptibility determination method according to <9>, wherein the single nucleotide polymorphism is at least one of rs80000292 (I62V), rs1061170 (Y402H), and rs1410996.
<11> Age-related macular degeneration susceptibility, comprising at least the age-related macular degeneration susceptibility determination marker according to <1>, wherein the susceptibility to age-related macular degeneration is determined. This is a determination kit.
<12> At least a primer having the base sequence represented by the following SEQ ID NO: 2 and the following SEQ ID NO: 3 and a probe having the base sequence represented by the following SEQ ID NO: 4, A kit for determining susceptibility to age-related macular degeneration, characterized by determining difficulty of morbidity.
TGTCTCAGTGTATTGTTCTGTGCT (SEQ ID NO: 2)
GCTTGCCCAAATAGTTACGAGATT (SEQ ID NO: 3)
GTGCAGCAGGCATACAACATGTG (SEQ ID NO: 4)

  According to the present invention, it is possible to solve the above-mentioned problems in the past, achieve the object, and predict the onset and progression of age-related macular degeneration causing significant visual loss with high accuracy and probability, Markers for determining age-related macular degeneration susceptibility, which can be suitably used for early prevention of age-related macular degeneration and selection of the optimal drug treatment method for patients who have already developed, and An age-related macular degeneration susceptibility determination method and an age-related macular degeneration susceptibility determination kit capable of easily determining difficulty can be provided.

FIG. 1 shows a PCR using a primer having a base sequence represented by SEQ ID NO: 2 and a primer having a base sequence represented by SEQ ID NO: 3 in the CFH gene of chromosome 1 and cytoband 1q31.3. It is a figure which shows the position of amplification product of. The position indicated by the arrow is the position of the PCR amplification product. FIG. 2 shows a primer having a base sequence represented by SEQ ID NO: 2 in a sequence corresponding to chr1: 194937326-1949937399 in NCBI Build 36 (hg 18) (chr1: 194022360-19402433 in NCBI Build 35); It is a figure which shows the information of the amplification product of PCR using the primer which has a base sequence represented by sequence number: 3, and its surrounding genome. FIG. 3 shows a primer having a nucleotide sequence represented by SEQ ID NO: 2 in a sequence corresponding to chr1: 194937326-194937399 (in NCBI Build 35, chr1: 194022360-19340433) in NCBI Build 36 (hg 18); It is a figure which shows the information of the amplification product of PCR using the primer which has a base sequence represented by sequence number: 3, and its surrounding genome. FIG. 4 is a diagram showing an amplification product of PCR using a primer having the base sequence represented by SEQ ID NO: 2 and a primer having the base sequence represented by SEQ ID NO: 3. FIG. 5 is a diagram showing the positions in the CFH gene of PCR amplification products using a primer having the base sequence represented by SEQ ID NO: 2 and a primer having the base sequence represented by SEQ ID NO: 3. .

(Marker for determining susceptibility to age-related macular degeneration)
The marker for determining susceptibility to age-related macular degeneration according to the present invention is a marker used as a marker for detecting difficulty in afflicting age-related macular degeneration, and has a base sequence represented by SEQ ID NO: 1.
The base sequence represented by SEQ ID NO: 1 is the base sequence possessed by the 9th intron of the CFH gene (3 ′ downstream region in the short CFH gene NM_001014975) that is known to be associated with age-related macular degeneration.
5′-TGTCTCAGGTGTATTGTTCTGTTGCTGTGCAGCAGGCATACAAATCTGACAATCTCGTAACTATTTGTGGCAGGC-3 ′ (SEQ ID NO: 1)

The marker for determining susceptibility to age-related macular degeneration may be single-stranded DNA, double-stranded DNA, or RNA transcribed from the DNA. Moreover, the antibody which consists of said DNA and RNA may be sufficient.
The base sequence represented by SEQ ID NO: 1 may be one in which one or several bases are mutated such as deletion, substitution, insertion, etc. 'It may be added to at least one of the ends, but the marker for determining susceptibility to age-related macular degeneration is hybridized with the CFH gene or RNA thereof under stringent conditions. The base sequence itself represented by SEQ ID NO: 1 is more preferable.

  Here, the stringent condition can be determined based on the melting temperature (Tm) of DNA derived from a subject to which the marker for susceptibility to age-related macular degeneration is bound (Berger and Kimmel 1987, Guide to Molecular Cloning Technologies Methods in Enzymology, Vol. 152, Academic Press, San Diego CA). For example, as washing conditions after hybridization, the conditions of “1 × SSC (NaCl, trisodium citrate), 0.1 mass% SDS (sodium dodecyl sulfate), 37 ° C.” can be mentioned. Even if it wash | cleans on the said conditions, the said marker for susceptibility determination of age-related macular degeneration and DNA derived from a subject maintain a hybridized state.

<Manufacturing method>
The method for producing the age-related macular degeneration susceptibility determination marker is not particularly limited and may be appropriately selected depending on the intended purpose. For example, a method of enzymatically directly cutting out a natural gene using a restriction enzyme or the like And a method of amplifying by PCR using a natural gene as a template, a method by gene cloning, a method by chemical synthesis, and the like.

  In the case of the PCR method, primers can be designed so as to sandwich a region containing the base sequence represented by SEQ ID NO: 1, and can be prepared by a known method.

  In the case of the gene cloning method, for example, a normal nucleic acid amplified product is incorporated into a vector selected from a plasmid vector, a phage vector, a plasmid-phage chimeric vector, etc., and prokaryotic microorganisms such as Escherichia coli and Bacillus subtilis, yeasts, etc. A large amount of the base sequence represented by SEQ ID NO: 1 can be prepared by introducing it into any proliferative host selected from eukaryotic microorganisms, animal cells and the like.

  Examples of the chemical synthesis method include a liquid phase method such as triester method and phosphorous acid method, or a solid phase synthesis method using an insoluble carrier. In the case of the chemical synthesis method, using a known automatic synthesizer or the like, a single-stranded base sequence represented by SEQ ID NO: 1 is prepared in large quantities, and then annealed to prepare a double-stranded SEQ ID NO: A base sequence represented by 1 can be prepared.

<Use>
In the present invention, the susceptibility difficulty of age-related macular degeneration is determined by the CFH recognized by the marker for determining susceptibility to age-related macular degeneration in a subject by the marker for determining susceptibility to age-related macular degeneration. It can be determined by the DNA copy number polymorphism of the gene. That is, the DNA copy number polymorphism is 0 to 1 copy for those with low risk of developing age-related macular degeneration, and 2 to 3 copies for those with high risk of age-related macular degeneration. is there. The difficulty of aging macular degeneration can be determined by the difference in the DNA copy number polymorphism.

The determination of the DNA copy number polymorphism and the determination of the difficulty of age-related macular degeneration are preferably performed by the age-related macular degeneration susceptibility determination method of the present invention described later.
As will be described later, since the DNA copy number polymorphism is an analysis value based on a relative ratio with a subject whose DNA copy number polymorphism of the CFH gene is known, 0 to 3 copies represent the analysis value It is shown.

<Application>
The age-related macular degeneration susceptibility determination marker is capable of predicting the onset and progression of age-related macular degeneration, which causes a significant decrease in visual acuity, and is therefore used for determining age-related macular degeneration, a DNA microarray method, It can be suitably used for rapid DNA amplification methods and base sequence analysis methods that do not depend on PCR methods such as PCR methods and invader assays.

(Method for determining susceptibility to age-related macular degeneration)
The age-related macular degeneration susceptibility determination method of the present invention includes at least a measurement step, a DNA copy number determination step, and an susceptibility determination step, and further includes other steps as necessary.

<Measurement process>
In the measurement step, a probe having a fluorescent label complementary to part or all of the CFH gene specified by the base sequence represented by SEQ ID NO: 1 in the subject-containing DNA-containing sample, The step of hybridizing to the CFH gene in the DNA-containing sample and measuring the expression of the CFH gene by the fluorescent label.

-DNA-containing sample-
The DNA-containing sample includes a region having a base sequence represented by SEQ ID NO: 1 derived from a subject.
In the measurement step, the DNA-containing sample may be prepared in advance as DNA, or may be collected from a subject and prepared from DNA.
The DNA-containing sample may be a DNA transcription product instead of DNA, or a mixed solution thereof.

  There is no restriction | limiting in particular as a sample derived from the subject used when collecting the said DNA containing sample from the said subject, According to the objective, it can select suitably, For example, a cell, a structure | tissue, blood, a blood cell component, lymph fluid And hair. These may be used alone or in combination of two or more. Among these, the sample derived from the subject is preferable because blood and blood cell components which are fractions thereof are easy to collect.

The method for extracting DNA from the sample derived from the subject is not particularly limited, and can be appropriately selected from known methods according to the purpose.
Further, the DNA-containing sample may be the extracted DNA itself, or may be an amplification product obtained by previously amplifying the region containing the base sequence represented by SEQ ID NO: 1 by PCR. .

-Probe-
The base sequence of the probe is not particularly limited as long as it is a sequence complementary to any or all of the CFH gene specified by the base sequence represented by SEQ ID NO: 1. However, a sequence complementary to a part of the base sequence represented by SEQ ID NO: 1 is preferable, and a base sequence represented by SEQ ID NO: 4 below is more preferable.
5′-GTGCAGCAGGGCATACAAATCTG-3 ′ (SEQ ID NO: 4)

  There is no restriction | limiting in particular as a fluorescent label of the said probe, According to the objective, it can select suitably, For example, FAM, VIC, Cy3, Cy5, FITC, Texas Red etc. are mentioned. The probe may have a radioactive label instead of the fluorescent label, but a fluorescent label is preferable from the viewpoint of safety.

There is no restriction | limiting in particular as a method to acquire the said probe, According to the objective, it can select suitably, For example, the method of synthesize | combining, the method of using a commercial item, etc. are mentioned.
When using the said commercial item, a TaqMan MGB probe (Copy Number Assays: the product made by Applied Biosystems) etc. can be used, for example.

-Measurement of gene expression-
The method for measuring the expression of the CFH gene specified by the base sequence represented by SEQ ID NO: 1 is not particularly limited and may be appropriately selected depending on the intended purpose. For example, DNA microarray method, PCR ( Polymerase chain reaction) method, invader assay, PCR-RETINA method (refer to Japanese Patent Application Laid-Open No. 2008-263974) and the like. These may be used alone or in combination of two or more.
Among these, the quantitative PCR method (qRT-PCR) is preferable because it can be easily measured, and the real-time PCR method is more preferable.

  In the real-time PCR method, the expression of the CFH gene can be measured by monitoring the fluorescence intensity of the probe. However, the monitoring method is not particularly limited and may be appropriately selected according to the purpose. Examples thereof include an intercalator method, a TaqMan method, a cycling probe method (Molecular Beacon method), and the like. Among these, the TaqMan method and the cycling probe method can obtain extremely high detection specificity by using a probe specific to the target gene CFH gene, and multicolor analysis using a plurality of probes. It is preferable in that it can be performed.

  The probe used in the TaqMan method is an oligonucleotide capable of hybridizing to an amplification region of a target nucleic acid in which both ends of the base sequence represented by SEQ ID NO: 1 are modified with a fluorescent substance and a quenching substance, Although it hybridizes to the CFH gene, it does not emit fluorescence due to the presence of a quenching substance, but emits fluorescence when it is decomposed by the exonuclease activity of DNA polymerase and liberated from the fluorescent substance during the extension reaction. Therefore, the amount of amplification product produced can be monitored by measuring the fluorescence intensity, thereby estimating the original template DNA amount.

The primer sequence used for the quantitative PCR is not particularly limited as long as it can amplify the genomic region containing the base sequence represented by SEQ ID NO: 1, and can be appropriately selected according to the purpose.
The number of bases in the primer sequence is not particularly limited and may be appropriately selected depending on the intended purpose, but is preferably 15 to 30 bases, more preferably 17 to 25 bases, and further 18 to 22 bases. preferable. In addition, when performing multi-PCR using a plurality of probes in a genomic region that is somewhat long, the primer pair is preferably designed so that it can be annealed to the template DNA at an equivalent temperature.

  The method for designing the primer sequence is not particularly limited and may be appropriately selected depending on the intended purpose. For example, Primer Express ver 3.0 software (Applied Biosystems), gene homology search program BLAST, etc. The method of designing using

Among these, the primer sequence includes a primer sequence having a base sequence represented by SEQ ID NO: 2 as a sense primer sequence, and a primer sequence having a base sequence represented by SEQ ID NO: 3 as an antisense primer. It is preferable to use it as an array.
5′-TGTCTCAGGTGTATTGTTCTGTTGCT-3 ′ (SEQ ID NO: 2)
5′-GCTTGCCACAAATAGTTACGAGATT-3 ′ (SEQ ID NO: 3)

The primer consists of a base sequence represented by SEQ ID NO: 2 and a base sequence in which one or several bases of the base sequence represented by SEQ ID NO: 3 are deleted, substituted, or inserted. May be.
There is no restriction | limiting in particular as the acquisition method of the said primer, According to the objective, it can select suitably, For example, the method of synthesize | combining, the method of using a commercial item, etc. are mentioned.

There is no restriction | limiting in particular as a gene used as an internal standard in the said quantitative PCR, Although it can select suitably according to the objective, A housekeeping gene is preferable.
The housekeeping gene is not particularly limited and may be appropriately selected depending on the intended purpose. Examples thereof include a ribonuclease P (Ribonase P RNA: RNasa P) gene, a telomerase reverse subunit (TERT) gene, Examples thereof include 18S ribosomal RNA gene, glyceraldehyde 3-phosphate dehydrogenase (GAPDH) gene, β-actin gene, cyclophilin gene and the like.

  In the quantitative PCR, by using different fluorescent labels for the fluorescent label of the probe for the base sequence represented by SEQ ID NO: 1 and the fluorescent label of the probe for the housekeeping gene, these PCR amplification amounts are distinguished. Can be detected.

<DNA copy number determination step>
The DNA copy number determination step is a step of determining the DNA copy number of the CFH gene from the fluorescence intensity measured in the measurement step.
When the measurement step is performed by quantitative PCR, the fluorescence intensity is determined by determining the DNA copy number of the CFH gene from the fluorescence intensity corresponding to the CFH gene at a time before the fluorescence intensity reaches saturation. It is preferable to do.
Specifically, the fluorescence intensity measured by the probe with respect to the base sequence represented by SEQ ID NO: 1 measured in the measurement step (hereinafter sometimes referred to as “CFH gene fluorescence intensity”) and the house. The number of DNA copies of the CFH gene can be determined by comparing the fluorescence intensity of the probe against the keeping gene (hereinafter sometimes referred to as “internal standard fluorescence intensity”).

  The method for comparing the fluorescence intensities is not particularly limited and can be appropriately selected according to the purpose. For example, one fluorescence intensity is plotted on the vertical axis and the other fluorescence intensity is plotted on the horizontal axis on the graph. And a method in which the CFH gene fluorescence intensity and the internal standard fluorescence intensity are converted into numerical values and compared with these calculated values.

  In the case of the method of plotting on the graph, for subjects with the same ratio of the DNA copy number between the CFH gene fluorescence intensity and the internal standard fluorescence intensity, the plot is concentrated (clustered) in a certain area on the graph, Subjects with different DNA copy number ratios are plotted at different locations on the graph.

  In the case of the method for quantifying the fluorescence intensity, an approximate numerical value is given for a subject having the same DNA copy number of the CFH gene fluorescence intensity and the internal standard fluorescence intensity, and for a subject having a different DNA copy number. Different numbers are given.

Here, the fluorescence intensity in a subject whose DNA sequence number polymorphism of the base sequence represented by SEQ ID NO: 1 is known (hereinafter sometimes referred to as “reference”) and a subject ( Hereinafter, the ratio of the DNA copy number can be quantified by comparing the fluorescence intensity in “sometimes referred to as“ subject ””.
There is no restriction | limiting in particular as DNA used as said reference, According to the objective, it can select suitably, For example, DNA ID number: NA19000 of a Japanese male in an international HapMap project etc. are mentioned.
By specifying the reference DNA copy number by a microarray method other than the TaqMan method, the relative value of the DNA copy number obtained by the TaqMan method can be converted into an absolute value.

  There is no restriction | limiting in particular as said quantification method, According to the objective from the well-known statistical methods, it can select suitably, For example, relative analysis method, a calibration curve method, delta-delta Ct ( ΔΔCt) method (see Legrand-Andreoleti M et al., Pharmacogenetics, 1998, 8 (1), 7-14). Among these, the quantification method is preferable in that ΔΔCt is simple.

An outline of the ΔΔCt method is shown below. In the quantitative PCR method, at the stage where genes are amplified exponentially, the number N of gene molecules is expressed by the following formula 1.
N = N ₀ × (1 + E) ⁿ ... Formula 1
In Formula 1, “N ₀ ” represents the initial number of molecules, “E” represents gene amplification efficiency, and “n” represents the number of PCR cycles.

Here, assuming that the gene amplification efficiency E is the same between the subject CFH gene and the reference CFH gene, the number N of gene molecules in an exponential amplification stage before the gene amplification reaches saturation Is the threshold value, and the point at which the exponential amplification curve intersects the threshold value is the Ct value, the initial concentration of the target gene is expressed as a 2- ^ΔΔCt value. This ΔΔCt is expressed by the following formula 2.
ΔΔCt = (X−Y) − (X′−Y ′) Equation 2
In Formula 2, “X” represents the Ct value of the fluorescence intensity of the reference internal standard, “Y” represents the Ct value of the fluorescence intensity of the CFH gene of the Ct reference, and “X ′” The standard fluorescence intensity Ct value is represented, and “Y ′” represents the CFt gene fluorescence intensity Ct value of the subject.

The method for calculating the 2- ^ΔΔCt value of the subject is not particularly limited and can be appropriately selected according to the purpose. For example, a qualitative factor as to whether or not the subject suffers from age-related macular degeneration, Examples include a method of calculating a correlation with a quantitative factor called DNA copy number polymorphism using an R environment package for analyzing based on the maximum likelihood method.
Specifically, CNV tools (Barnes C et al., Nat Genet) for DNA copy number polymorphism analysis operable in statistical software R (an environment for data analysis based on S language developed at Bell Laboratories) , 2008, 40 (10), 1245-1252). The CNV tools are available in open source (http://cnv-tools.sourceforge.net/CNVtools.html).
Thereby, a test subject's DNA copy number polymorphism can be determined.

<Susceptibility determination process>
The susceptibility determination step is a step of determining susceptibility of age-related macular degeneration from the DNA copy number determined in the DNA copy number determination step.
The determination of the susceptibility may be performed by determining the number of DNA copies by using one copy alone or by combining two or more copies. This is preferable in that the establishment and accuracy of determination are improved.
The combination of the number of DNA copies is not particularly limited and may be appropriately selected according to the purpose. (A) A combination of 0 and 1 copy, (B) 2 and 3 copies, and Any combination of (C) 0-2 copies and (D) 3 copies is preferred.
In the combination, when it is either (B) or (D), it can be determined that the patient is susceptible to age-related macular degeneration.

  The method for testing whether or not the combination of the DNA copy numbers is effective in determining susceptibility is not particularly limited and can be appropriately selected from known statistical methods according to the purpose. , Chi-square test method, Fisher exact test method, method for calculating odds ratio, method for calculating p-value, and the like. These may be used individually by 1 type, and may use 2 or more types together, but using 2 or more types together is preferable at the point that establishment and precision become high.

<Other processes>
There is no restriction | limiting in particular as said other process, Although it can select suitably according to the objective, The SNP analysis process which analyzes the single nucleotide polymorphism (henceforth "SNP" may be called hereafter) of a CFH gene. It is preferable to contain.
In the susceptibility determination step, in addition to the method of determining by the combination of the DNA copy number, it is preferable in that the determination can be further established and accuracy can be improved by further determining by combining the SNP of the CFH gene. .

There is no restriction | limiting in particular as SNP of the said CFH gene, According to the objective, it can select suitably, For example, SNP shown in the following (1)-(3) etc. are mentioned.
(1) SNP: rs8000029 with an amino acid mutation (I62V) in which the 62nd isoleucine of exon 2 protein is mutated to valine (hereinafter sometimes referred to as “SNP1”).
(2) SNP: rs1061170 (hereinafter sometimes referred to as “SNP2”) with an amino acid mutation (Y402H) in which the protein 402 tyrosine of exon 9 is mutated to histidine.
(3) SNP of intron 14: rs1410996 (hereinafter sometimes referred to as “SNP3”).

  The method for analyzing the SNP is not particularly limited and can be appropriately selected from known methods according to the purpose. For example, Mori K et al. , Invest Ophthalmol Vis Sci, 2007, 48 (11), 5315-5319, and the method described in Japanese translations of PCT publication No. 2008-529536.

<Application>
The age-related macular degeneration susceptibility determination method can be suitably used in the age-related macular degeneration susceptibility determination kit of the present invention described later.
According to the method for determining susceptibility to age-related macular degeneration according to the present invention, the onset and progression of age-related macular degeneration can be predicted. By receiving this, it becomes possible to prevent age-related macular degeneration at an early stage, and for patients who have already developed age-related macular degeneration, it is possible to select an optimal drug treatment method.

(Aged macular degeneration susceptibility determination kit)
The first aspect of the kit for determining susceptibility to age-related macular degeneration according to the present invention includes at least the marker for determining susceptibility to age-related macular degeneration according to the present invention. , Radiolabels, binding agents, internal standard markers, reference genomic DNA, plates, hybridization solutions, containers, other elements such as instructions for use.
As a second aspect of the kit for determining susceptibility to age-related macular degeneration according to the present invention, the kit having the base sequence represented by SEQ ID NO: 2 and the base sequence represented by SEQ ID NO: 3 is used. At least a primer and a probe having the base sequence represented by SEQ ID NO: 4, and if necessary, a fluorescent label, a radioactive label, an internal standard marker, a reference genomic DNA, an enzyme, a PCR buffer, a container, Includes other elements such as instructions for use.
These kits can easily determine the morbidity of age-related macular degeneration using a sample-containing DNA-containing sample.

<First aspect>
There is no restriction | limiting in particular as a form of the age-related macular degeneration susceptibility determination kit of the said 1st aspect, According to the objective, it can select suitably, For example, a DNA microarray, an invader assay, etc. are mentioned.
In the DNA microarray, the age-related macular degeneration susceptibility determination marker and an internal standard marker are aligned on a substrate, and the age-related macular degeneration susceptibility determination marker is included in the DNA-containing sample. It binds to a CFH gene or a transcription product thereof (hereinafter sometimes referred to as “target sample”), and monitors the expression of the CFH gene and the gene expression of an internal standard marker.

There is no restriction | limiting in particular as said board | substrate, According to the objective, it can select suitably from well-known materials, For example, glass, resin, etc. are mentioned.
The age-related macular degeneration susceptibility determination marker is aligned and fixed on the substrate, and this fixed age-related macular degeneration susceptibility determination marker is hybridized with a target sample, Detects target DNA fragments with high sensitivity.

  The detection means for the hybrid formed with the age-related macular degeneration susceptibility determination marker and the target sample is not particularly limited and can be appropriately selected from known means according to the purpose. For example, a method using a fluorescent label or a radioactive label previously bound to a target sample, a method using an intercalator having a fluorogenic group or a conductive group incorporated in the hybrid, and the like can be mentioned.

  The method for producing the DNA microarray is not particularly limited and may be appropriately selected depending on the intended purpose. For example, a method for synthesizing the age-related macular degeneration susceptibility determination marker directly on the substrate surface ( On-chip method), a method of fixing a marker for determining susceptibility to age-related macular degeneration separately prepared on the substrate surface, and the like.

  The on-chip method is not particularly limited and can be appropriately selected depending on the purpose. For example, use of a protective group that is selectively removed by light irradiation, and photolithography technology used for semiconductor production And a method of selectively synthesizing the age-related macular degeneration susceptibility marker in a predetermined region of a minute matrix in combination with a solid phase synthesis technique.

The method for fixing the age-related macular degeneration susceptibility determination marker prepared in advance to the surface of the base material is not particularly limited and can be appropriately selected depending on the purpose. For example, a method using a spotter Etc.
Specifically, first, the marker for determining susceptibility to age-related macular degeneration is prepared on a microplate. Moreover, the binder for the age-related macular degeneration susceptibility determination marker such as poly-1-Lysine and the substrate is coated on the substrate surface. Thereafter, the marker for determining the susceptibility to age-related macular degeneration in the microplate is attached to a pin, and the addition applied to the pin using a spotter or the like on a substrate whose surface is coated with a binder. Spot with age-related macular degeneration susceptibility determination marker in contact. This operation is repeated until all the markers for susceptibility to age-related macular degeneration in the microplate have been spotted to produce a DNA microarray.

The method for hybridizing the DNA microarray and the target sample is not particularly limited and can be appropriately selected according to the purpose. For example, the marker for determining susceptibility to age-related macular degeneration is formed on a substrate. Examples thereof include a method in which a fixed DNA microarray and a DNA fragment derived from a subject labeled with a fluorescent substance are both hybridized in a hybridization solution.
There is no restriction | limiting in particular as said hybridization solution, According to the objective, it can select suitably, For example, formaldehyde, SSC, SDS, EDTA (ethylethylenetetraacetic acid), distilled water, these mixed solutions, etc. are mentioned.
There is no restriction | limiting in particular as a mixing ratio of the said hybridization solution, According to the objective, it can select suitably.

If the target sample and the marker for determining susceptibility to age-related macular degeneration are complementary DNAs by the hybridization, both can take a double helix structure and bind to each other.
On the other hand, if the two are not complementary strands, they will not bind, and the DNA-containing sample labeled with a fluorescent substance will remain in the hybridization solution as it is, or part of it will bind to the binding agent coated on the substrate. It may remain.

  It is preferable to wash the DNA-containing sample labeled with a fluorescent substance that has not hybridized and remains on the substrate. There is no restriction | limiting in particular as the said washing | cleaning method, According to the objective, it can select suitably, For example, the method etc. which put the said board | substrate in a water tank etc. as it is, etc. are mentioned. Thereby, the DNA containing sample which is not couple | bonded with the marker for the said age-related macular degeneration susceptibility determination is excluded.

  The method for detecting a target sample bound to the age-related macular degeneration susceptibility determination marker is not particularly limited and may be appropriately selected depending on the intended purpose. For example, fluorescence labeled on the target sample Examples include a method in which a substance is excited by light energy from a predetermined light source, and light emitted from the fluorescent substance is detected by a photosensor such as a CCD.

  By comparing the fluorescence intensity by hybridization with the age-related macular degeneration susceptibility marker and the target sample, and the fluorescence intensity of the internal standard marker and the DNA fragment derived from the subject, CFH in the subject By determining the DNA copy number polymorphism of the gene, it is possible to determine the difficulty of suffering from age-related macular degeneration.

<Second aspect>
The kit for determining susceptibility to age-related macular degeneration according to the second aspect can determine the difficulty of afflicting age-related macular degeneration by a PCR method, an invader assay, or the like.

In the kit for determining susceptibility to age-related macular degeneration according to the second aspect, the primer and the probe may be in a dry state or in a solution state. When the primer and the probe are in a solution state, the solution is not particularly limited and may be appropriately selected depending on the intended purpose. Examples thereof include water and ethanol.
The primer and the probe can be appropriately used at the desired concentration with the solution at the time of use.
There is no restriction | limiting in particular as the density | concentration of the said primer and probe, According to reaction conditions etc., it can select suitably.
The probe preferably has a fluorescent label or a radioactive label, and a probe having a fluorescent label is preferable in terms of high safety.

  The PCR method and the invader assay are characterized in that the probe is bound to a target sample, the target sample is amplified, and the expression of the CFH gene is monitored based on the intensity of the label. At this time, it is preferable to simultaneously monitor the gene expression of the internal standard marker.

  A method for using the kit for determining susceptibility to age-related macular degeneration according to the second aspect is not particularly limited and may be appropriately selected depending on the purpose. It is preferable to use a susceptibility determination method.

<Application>
The age-related macular degeneration susceptibility determination kit can be suitably used as a diagnostic kit for predicting the onset and progression of age-related macular degeneration.
This enables early prevention of age-related macular degeneration by taking ophthalmic examinations more frequently for people at high risk of onset, and for patients who have already developed age-related macular degeneration. This makes it possible to select an optimal drug treatment method.

  EXAMPLES The present invention will be specifically described below with reference to examples of the present invention, but the present invention is not limited to these examples.

(Example 1)
<DNA copy number polymorphism analysis method>
<< DNA collection process >>
Under the approval of Saitama Medical University Ethics Committee, 195 men and women with age-related macular degeneration (hereinafter referred to as “AMD affected group”) who visited Saitama Medical University Hospital Ophthalmology Blood was collected from 130 male and female non-affected individuals (hereinafter sometimes referred to as “control group”), and DNA samples were purified using Wizard Genomic DNA Purification Kit (Promega).

<< Measurement process >>
For the analysis of DNA copy number polymorphism (hereinafter, sometimes referred to as “CNV”), TaqMan (registered trademark) Copy Number Assays (manufactured by Applied Biosystems Co., Ltd.) is customized according to the method described on the Internet homepage of the distributor. What was produced by -made was used.
The TaqMan MGB probe (Copy Number Assays: Applied Biosystems) for the CFH gene of chromosome 1 and cytoband 1q31.3 (RefSeq database ID: NM_00186) is fluorescently labeled at the 5 ′ end with FAM, and is an internal standard. RNase P (Ribonuclease P RNA component H1 (H1RNA) gene (RPPH1) on chromosome 14, cytoband 14q11.2) gene used as the RNase P (Copy Number Assemblies manufactured by Copy Number Assays: 5 manufactured by Copy Number Assays) Since it is fluorescently labeled, it is possible to distinguish and detect the PCR amplification amount.

TaqMan MGB probes and PCR primers specific for the CFH gene were optimized for quantitative PCR using Primer Express ver 3.0 software (Applied Biosystems) and gene homology search program BLAST. The one was designed on the 9th intron of the CFH gene (3 ′ downstream region in the short CFH gene NM_001014975). The TaqMan MGB probe has a base sequence represented by SEQ ID NO: 4 below, and the PCR primer has a base sequence represented by SEQ ID NO: 2 and SEQ ID NO: 3 below.
[Sense primer]
5′-TGTCTCAGGTGTATTGTTCTGTTGCT-3 ′ (SEQ ID NO: 2)
[Antisense primer]
5′-GCTTGCCACAAATAGTTACGAGATT-3 ′ (SEQ ID NO: 3)
[probe]
5′-GTGCAGCAGGGCATACAAATCTG-3 ′ (SEQ ID NO: 4)

The base sequence of the CFH gene amplified by the PCR primer is the base sequence represented by SEQ ID NO: 1, and the length of the PCR amplification product is 74 base pairs (bp).
Further, the TaqMan MGB probe position of the PCR primer and the region sandwiched between the PCR primer and the genomic data version is NCBI Build 36 (hg 18) in chr1: 194937326-1994937399 (in NCBI Build 35, chr1: 193402360-19340433) Correspondingly, as shown below.
[Amplification product]
5′-TGTCTCAGGTGTATTGTTCTGTGTGCT gtgcaggcaggcatacaataattct acAATCTCGTAACTATTTGTGGCAGGC-3 ′ (SEQ ID NO: 1)
In the base sequence represented by SEQ ID NO: 1, the capital letters indicate PCR primer sites, and the underlined portions indicate sites equivalent to the TaqMan MGB probe for analysis.

  PCR was performed using a 384 well plate by 7900HT Fast Real-time PCR System (Applied Biosystems). The reaction system in one reaction is as shown in Table 1, and the experiment was repeated three times for each sample. The PCR temperature protocol is as shown in Table 2.

<< DNA copy number determination process >>
The CFH gene expression level was determined using the ΔΔCt method from the relative value with the RNase P gene expression level co-amplified in the same reaction system as an internal standard.
Further, as a reference DNA having a known DNA copy number of the CFH gene, DNA ID number NA19000 of a Japanese male in the international HapMap project was used.
In the stage where the gene is amplified exponentially, the number N of gene molecules is expressed by the following formula 1.
N = N ₀ × (1 + E) ⁿ ... Formula 1
In Formula 1, “N ₀ ” represents the initial number of molecules, “E” represents gene amplification efficiency, and “n” represents the number of PCR cycles.

Assuming that the gene amplification efficiency E is the same for the CFH gene and the RNase P gene, the initial concentration of the CFH gene uses a Ct value that is a point where an amplification curve intersects with a certain threshold in the exponential amplification stage. 2− ^ΔΔCt value, and ΔΔCt is expressed by the following equation 2.
ΔΔCt = (X−Y) − (X′−Y ′) Equation 2
In Formula 2, “X” represents the Ct value of the fluorescence intensity of the RNase P gene in the reference DNA, “Y” represents the Ct value of the fluorescence intensity of the CFH gene in the reference DNA, and “X ′” represents The Ct value of the fluorescence intensity of the RNase P gene in the control group or the AMD affected group is represented, and “Y ′” represents the Ct value of the fluorescence intensity of the CFH gene in the control group or the AMD affected group.

The 2- ^ΔΔCt value of the sample is statistically determined using CNV tools (see Barnes C et al., Nat Genet, 2008, 40 (10), 1245-1252) for DNA copy number ^polymorphism analysis included in the statistical software R. Analysis was performed, and the number of DNA copies was determined as one of 0 copy, 1 copy, 2 copies, and 3 copies.

<< Susceptibility determination process >>
In the AMD affected group and the control group, grouping was performed based on differences in DNA copy number polymorphism, and correlation analysis with difficulty of age-related macular degeneration was performed by chi-square test. In addition, a significant difference test was performed using an odds ratio (hereinafter sometimes referred to as “OR”) and a p-value.

<Result>
Table 3 shows the number distribution of each DNA copy number (hereinafter sometimes referred to as “CN”) in the total number of persons suffering from AMD and the control group. Table 4 shows the number distribution. Tables 5 and 6 show the results of a significant difference test between the AMD affected group and the control group when grouping was performed based on the number of DNA copies.
When the number of DNA copies is 0 and 1 copy, hereinafter “Group A”, when the number of DNA copies is 2 and 3 copies, hereinafter “Group B” and the number of DNA copies is 0 to 2 copies. The case of copying is hereinafter referred to as “group C”, and the case of 3 DNA copies is hereinafter referred to as “group C”.

By the chi-square test, a significant difference was observed in the CN value distribution between the AMD affected group and the control group.
Chi-square value = 19.741
Degrees of freedom = 3
p value = 1.921 × 10 ⁻⁴

p value = 8.847 × 10 ⁻⁴
OR = 3.219909 (95% confidence interval 1.541794 to 6.987238)

p value = 6.213 × 10 ⁻⁵
OR = 2.616746 (95% confidence interval 1.606671-4.288098)

From Table 5, the incidence of age-related macular degeneration in the grouping of DNA copy number 0 and 1 copy (Group A) and DNA copy number 2 and 3 copies (Group B), The correlation with the DNA copy number was significant, and in the AMD affected group, the odds ratio (OR) in group B was expected to be about 3.2 times (95% confidence interval 1.5 to 7.0). .
From Table 6, the age of macular degeneration and the DNA copy number in the grouping of the DNA copy number from 0 to 2 copies (Group C) and the DNA copy number from 3 copies (Group D) The odds ratio (OR) with a DNA copy number of 3 was expected to be about 2.6 times (95% confidence interval 1.6 to 4.3) in the AMD affected group. .
From these results, it was found that the combination of groups A and B was preferable in terms of odds ratio, and the combination of groups C and D was preferable in terms of p value.

(Example 2)
In Example 2, correlation analysis of the difficulty of AMD was performed by combining groups A and B in Example 1 and analysis using SNP of the CFH gene.

<SNP analysis method>
Mori K et al. , Invest Ophthalmol Vis Sci, 2007, 48 (11), 5315-5319, the three types of SNPs of the CFH gene whose correlation with AMD susceptibility has been clarified, TaqMan SNP Genotyping Assays The genotype was determined using Systems). The three types of SNPs of the CFH gene are as shown in the following (1) to (3).
(1) SNP: rs8000029 with an amino acid mutation (I62V) in which the 62nd isoleucine of exon 2 protein is mutated to valine (hereinafter sometimes referred to as “SNP1”).
(2) SNP: rs1061170 (hereinafter sometimes referred to as “SNP2”) with an amino acid mutation (Y402H) in which the protein 402 tyrosine of exon 9 is mutated to histidine.
(3) SNP of intron 14: rs1410996 (hereinafter sometimes referred to as “SNP3”).

<Result>
The risk alleles of SNP1, SNP2, and SNP3 are as shown in Table 7. In addition, the distribution of the number of genotypes of SNP1, SNP2, and SNP3 in the total number of persons affected with AMD and the control group, and analysis of these results in a contingency table with a recessive genetic model (SNP Alyze (registered trademark): Dynacom Corporation) Table 7 shows the results of the production.

-Determination of AMD susceptibility by combination of recessive inheritance of SNP1 and CNV (groups A and B)-
Correlation of difficulty of age-related macular degeneration by chi-square test among 8 groups using AMD affected group and control group, recessive inheritance 1 and 2 of SNP1 and groups A and B in Example 1 Analysis was performed. Moreover, the significant difference test by odds ratio and p value was performed. The results are shown in Table 8. The odds ratio is set to 1 for the group with the lowest risk (the group with recessive gene 1 and CN values 0 and 1 in Table 8).

Chi-square value = 33.01
Degrees of freedom = 3
p value = 3.206 × 10 ⁻⁷

-AMD susceptibility determination by combination of recessive inheritance of SNP2 and CNV (groups A and B)-
Correlation of difficulty in affairs of age-related macular degeneration by chi-square test among 8 groups using AMD affected group and control group, recessive inheritance 1 and 2 of SNP2, and groups A and B in Example 1 Analysis was performed. Moreover, the significant difference test by odds ratio and p value was performed. The results are shown in Table 9. The odds ratio is set to 1 for the group with the lowest risk (the group with recessive gene 2 and CN values 0 and 1 in Table 9).

Chi-square value = 13.956
Degrees of freedom = 3
p value = 2.966 × 10 ⁻³

-Determination of AMD susceptibility by combination of recessive inheritance of SNP3 and CNV (groups A and B)-
Correlation of the difficulty of age-related macular degeneration by chi-square test among 8 groups using AMD affected group and control group, recessive inheritance 1 and 2 of SNP3, and groups A and B in Example 1 Analysis was performed. Moreover, the significant difference test by odds ratio and p value was performed. The results are shown in Table 10. The odds ratio is 1 for the group with the lowest risk (the group with the recessive gene 1 and CN values 0 and 1 in Table 10).

Chi-square value = 27.868
Degrees of freedom = 3
p value = 3.871 × 10 ⁻⁶

(Example 3)
In Example 3, the group C and D in Example 1 were combined with the analysis using the SNP of the CFH gene to perform a correlation analysis of the difficulty of suffering from AMD. The SNP analysis method was performed in the same manner as in Example 2.

-Determination of AMD susceptibility by combination of recessive inheritance of SNP1 and CNV (groups C and D)-
Correlation of difficulty in affairs of age-related macular degeneration by chi-square test among 8 groups using AMD affected group and control group, recessive inheritance 1 and 2 of SNP1, and groups C and D in Example 1 Analysis was performed. Moreover, the significant difference test by odds ratio and p value was performed. The results are shown in Table 11. The odds ratio is 1 for the group with the lowest risk (the group with the recessive gene 1 and CN values 0, 1, and 2 in Table 11).

Chi-square value = 38.46
Degrees of freedom = 3
p value = 2.261 × 10 ⁻⁸

-Determination of AMD susceptibility by combination of recessive inheritance of SNP2 and CNV (groups C and D)-
Correlation of difficulty in affairs of age-related macular degeneration by chi-square test among 8 groups using AMD affected group and control group, recessive inheritance 1 and 2 of SNP2, and groups C and D in Example 1 Analysis was performed. Moreover, the significant difference test by odds ratio and p value was performed. The results are shown in Table 12. The odds ratio is set to 1 for the group with the lowest risk (the group with recessive gene 2 and CN values 0, 1 and 2 in Table 12).

Chi-square value = 19.139
Degrees of freedom = 3
p value = 2.559 × 10 ⁻⁴

-Determination of AMD susceptibility by combination of recessive inheritance of SNP3 and CNV (groups C and D)-
Correlation of difficulty in age-related macular degeneration by chi-square test among 8 groups using AMD affected group and control group, recessive inheritance 1 and 2 of SNP3, and groups C and D in Example 1 Analysis was performed. Moreover, the significant difference test by odds ratio and p value was performed. The results are shown in Table 13. The odds ratio is set to 1 for the group with the lowest risk (the group with recessive gene 1 and CN values 0, 1, and 2 in Table 13).

Chi-square value = 34.67
Degrees of freedom = 3
p value = 1.433 × 10 ⁻⁷

  Compared with Example 1 compared with the case of judging only with the combination of CNV, in Examples 2 and 3 judged by the combination of genotypes of SNP1, SNP2, and SNP3 and CNV, the difficulty of AMD susceptibility It was possible to determine with a higher probability. Moreover, it turned out that it is preferable that the combination of SNP and CNV combines the recessive inheritance of SNP and the groups C and D of CNV.

(Comparative Example 1)
About SNP1, SNP2, and SNP3 in Example 2, the correlation analysis of the difficulty of age-related macular degeneration by the Fisher exact test was performed for each SNP alone. Moreover, the significant difference test by odds ratio and p value was performed. The results are shown in Table 14. In Table 14, for SNP1 and SNP3, the percentage of recessive inheritance 2 (risk allele is homozygous) in each group is shown. For SNP2, the percentage of recessive inheritance 1 (risk alleles homozygous and heterozygous) in each group is shown.

  From Table 14, SNP alone had a low probability of determining AMD susceptibility compared to Examples 1 and 2.

  Based on these results, the determination of susceptibility to age-related macular degeneration by the DNA copy number polymorphism of the present invention compared to the conventional technique that focuses on mutations in one gene or SNP markers based on linkage disequilibrium is more accurate. And it is highly established and considered to be excellent in diagnosing diseases.

Since the marker for determining susceptibility to age-related macular degeneration of the present invention can predict the onset and progression of age-related macular degeneration that causes a significant reduction in visual acuity, a DNA array used for determining age-related macular degeneration It can be suitably used for base sequence analysis, PCR method or rapid DNA amplification method (invader assay) not using PCR method.
In addition, the age-related macular degeneration susceptibility determination method and age-related macular degeneration susceptibility determination kit of the present invention can predict the onset and progression of age-related macular degeneration, thereby reducing the risk of onset. For those with high age, more frequent ophthalmic examinations can prevent early age-related macular degeneration, and for patients who have already developed age-related macular degeneration, it is necessary to select the optimal drug treatment method. It can be suitably used. As a result, maintenance of the visual function and improvement of QOL of the elderly, as well as reduction of medical costs for the elderly, are expected, and profits are expected to be returned to society as a whole.

Claims (15)

A marker for determining susceptibility to age-related macular degeneration, which has the base sequence represented by SEQ ID NO: 1, and is used as a marker for detecting the difficulty of aging macular degeneration.
TGTCTCAGTGTATTGTTCTGTTGCTGTGCAGCAGGCATACAAATCTGACAATCTCGTAACTATTTGTGCAAGC (SEQ ID NO: 1) The marker for determining susceptibility to age-related macular degeneration according to claim 1, which is used as a marker for detecting difficulty in afflicting age-related macular degeneration in Japanese. A probe having a fluorescent label complementary to any part or all of the base sequence represented by SEQ ID NO: 1 below, a base sequence represented by SEQ ID NO: 1 in a DNA-containing sample derived from a subject A measurement step of measuring the expression of the CFH gene in the sample by the fluorescent label;
A DNA copy number determination step for determining the DNA copy number of the CFH gene from the fluorescence intensity measured in the measurement step;
An susceptibility determination assisting step for assisting in determining the difficulty of age-related macular degeneration from the DNA copy number determined in the DNA copy number determining step;
A method for assisting the determination of susceptibility to age-related macular degeneration, comprising at least
TGTCTCAGTGTATTGTTCTGTTGCTGTGCAGCAGGCATACAAATCTGACAATCTCGTAACTATTTGTGCAAGC (SEQ ID NO: 1) The susceptibility determination assisting step is a step of assisting the determination by combining the determined DNA copy number, and the combination of the DNA copy number includes (A) 0 copy and 1 copy, (B) 2 copy and 3 A combination with a copy, and (C) one of a combination of 0 to 2 copies and (D) a 3 copy, and in the combination, either (B) or (D) The method for assisting determination of susceptibility to age-related macular degeneration according to claim 3, wherein the method is a step of susceptibility to age-related macular degeneration. The measurement step is a step of measuring the expression of the CFH gene by quantitative PCR using the base sequence represented by SEQ ID NO: 1 in the DNA-containing sample derived from the subject as a template. A method for assisting in the determination of susceptibility to age-related macular degeneration. The method for assisting the determination of susceptibility to age-related macular degeneration according to claim 5, wherein quantitative PCR is performed using primers having the nucleotide sequences represented by SEQ ID NO: 2 and SEQ ID NO: 3.
TGTCTCAGTGTATTGTTCTGTGCT (SEQ ID NO: 2)
GCTTGCCCAAATAGTTACGAGATT (SEQ ID NO: 3) Quantitative PCR is quantified using housekeeping genes as internal standards,
The DNA copy number determination step is a step of determining the DNA copy number of the CFH gene by comparing the fluorescence intensity corresponding to the CFH gene and the fluorescence intensity corresponding to the housekeeping gene. A method for assisting determination of susceptibility to age-related macular degeneration according to any one of the above. The method for assisting determination of susceptibility to age-related macular degeneration according to any one of claims 5 to 7, wherein the quantitative PCR is performed by a TaqMan method. The DNA copy number determination step is a step of determining the DNA copy number of the CFH gene from the fluorescence intensity corresponding to the CFH gene at a time point before the fluorescence intensity measured in the measurement step reaches saturation. A method for assisting determination of susceptibility to age-related macular degeneration according to any one of the above. The susceptibility of age-related macular degeneration according to any one of claims 3 to 9, wherein in the susceptibility determination assisting step, the single nucleotide polymorphism is further combined to assist in determining the difficulty of age-related macular degeneration. A method to assist in the determination of The method for assisting the determination of susceptibility to age-related macular degeneration according to claim 10, wherein the single nucleotide polymorphism is at least one of rs80000292 (I62V), rs1061170 (Y402H), and rs14109996. The determination of susceptibility to age-related macular degeneration according to any one of claims 3 to 11, wherein the susceptibility determination assisting step is a step of assisting in determining the difficulty of suffering from age-related macular degeneration in Japanese. How to assist. A kit for determining susceptibility to age-related macular degeneration, comprising at least the marker for determining susceptibility to age-related macular degeneration according to claim 1, wherein the susceptibility to age-related macular degeneration is determined. It includes at least a primer having the base sequence represented by the following SEQ ID NO: 2 and the following SEQ ID NO: 3 and a probe having the base sequence represented by the following SEQ ID NO: 4, and is difficult to suffer from age-related macular degeneration A kit for determining susceptibility to age-related macular degeneration.
TGTCTCAGTGTATTGTTCTGTGCT (SEQ ID NO: 2)
GCTTGCCCAAATAGTTACGAGATT (SEQ ID NO: 3)
GTGCAGCAGGCATACAACATGTG (SEQ ID NO: 4) The kit for determining susceptibility to age-related macular degeneration according to any one of claims 13 to 14, wherein the susceptibility to affliction of Japanese age-related macular degeneration is determined.