JP5544534B2 - Recombinant triple scaffold base polypeptide - Google Patents

Abstract

Disclosed is a protein complex that includes triple-helix-coil forming fusion polypeptide chains, each having a scaffold domain and a heterologous domain. Also disclosed are related isolated fusion polypeptide, nucleic acids, vectors, host cells, and preparation methods.

Description

RELATED APPLICATION This application claims priority to US patent application Ser. No. 60 / 750,746, filed Dec. 15, 2005, the contents of which are hereby incorporated by reference.

  The present invention relates to protein complex-based binding reagents with high affinity, low mitogenic activity, and high in vivo stability. The reagent can be multi-valent or multi-specific.

  Protein-based binding reagents have a variety of uses in therapeutic or diagnostic applications. Antibodies have proven to be an excellent paradigm for such reagents. In fact, many monoclonal antibodies (mAbs) have been successfully used for the treatment of cancer, infectious diseases, and inflammatory diseases (Adams et al., Nat. Biotechnol. 2005 Sep; 23 (9): 1147-57). ).

  Both the efficacy and safety of mouse mAbs were enhanced by recombinant DNA techniques such as chimerization and humanization. However, humanization of mouse mAbs using CDR (complementary determining region) grafting often has a lower binding affinity than the mouse counterpart. Antibody affinity is a key factor in the success of antibodies as therapeutic agents. Antibodies with high affinity will be able to effectively compete with the natural ligand for the target receptor, reducing dosage, toxicity, and cost. Affinity also affects the pharmacokinetics of an antibody, such as its distribution and excretion within the target tissue and host blood circulation. What is required for an in vivo effective monoclonal antibody is a strong affinity for the target antigen that does not bind nonspecifically to unrelated proteins. Multimerization of antigen binding sites is seen as an effective means of improving the overall strength of antibody binding to antigen, defined as antibody affinity (functional affinity). (Miller et al., J Immunol 170: 4854-4861, 2003; Rheinnecker et al., J Immunol 157: 2989-2997, 1996; Shopes, J Immunol 148: 2918-2922, 1992; Shuford et al., Science 252: 724-727, 1991; Wolff et al., J Immunol 148: 2469-2474, 1992)). They improve antitumor activity in vivo (Liu et al., Int Immunopharmacol 6: 791-799, 2006; Wolff et al., Cancer Res 53: 2560-2565, 1993). Due to the divalent nature of immunoglobulin G (IgG), conventional and artificial IgG cannot be used to bind to more than two different antigens simultaneously. Thus, multivalent or multispecific protein-based binding reagents are needed.

  In some cases, through manipulating the Fc region, avoiding effector effects such as antibody-dependent cell-mediated disorders (ADCC) and complement-dependent cytotoxicity (CDC) can cause mitogenic side effects. Is necessary to reduce. As an example, murine anti-human CD3 mAb (orthoclone OKT3, muromonab-CD3) is a potent immunosuppressant that targets the T cell receptor (TCR) / CD3 complex on human T cells. During the past 20 years, it has been used to prevent or treat allograft rejection (Cosimi et al., N Engl J Med 305: 308-314, 1981; Group, N Engl J Med 313: 337-342). 1985; Kung et al., Science 206: 347-349, 1979). However, one of the main drawbacks of using this treatment is that TNF-α, which produces a series of deleterious mitogenic effects including influenza-like symptoms, dyspnea, neurological symptoms and acute tubular necrosis, Systemic release of cytokines such as IL-2 and IFN-γ (Abramowicz et al., Transplantation 47: 606-608, 1989; Chatenoud et al., N Engl J Med 320: 1420-1421, 1989; Goldman et al., Transplantation. 50: 158-159, 1990; Toussaint et al., Transplantation 48: 524-526, 1989). The mitogenic activity of OKT3 and other anti-CD3 mAbs is due to extensive TCR / CD3 cross-linking via binding to FcR positive cells (eg monocytes), and recently by modifying binding to FcR Efforts are being made to develop non-mitogenic anti-CD3 antibodies. Thus, protein-based binding reagents with high affinity, low mitogenic activity, and high in vivo stability are needed.

  It is an object of the present invention to provide a protein complex-based binding reagent with high affinity, low mitogenic activity, and high in vivo stability. The reagent can also be multivalent or multispecific.

  Accordingly, one aspect of the present invention includes a first scaffold domain and a first heterologous domain that fuses in-frame to one end of the first scaffold domain. An isolated recombinant protein complex comprising a first fusion polypeptide chain, a second fusion polypeptide chain comprising a second scaffold domain, and a third fusion polypeptide chain comprising a third scaffold domain It has the characteristics. The first, second and third scaffold domains are aligned to form a triple helix coil. The first scaffold domain and the first heterologous domain are fused in-frame and reside in the same peptide chain.

  The heterologous domain can include an enzyme domain or a fluorescent protein sequence. Examples of fluorescent proteins include GFP and dsRed, and variants thereof. Examples of enzyme domains include glutathione S-transferase, luciferase, β-galactosidase, and β-lactamase domains.

  A heterologous domain can include a binding domain that binds to a binding partner (eg, a ligand binding domain, a ligand, a receptor, or a proteoglycan). By “binding partner” is meant any molecule that has a specific, covalent or non-covalent affinity for a portion of a desired compound (eg, protein) of interest. Examples of binding partners include antigen / antibody pairs, protein / inhibitor pairs, receptor / ligand pairs (eg, cell surface or nuclear receptor / ligand pairs), enzyme / substrate pairs (eg, kinase / substrate pairs). ), Lectin / carbohydrate pairs, oligomeric or heterooligomeric protein pairs, DNA binding protein / DNA binding site pairs, and RNA / protein pairs. Examples of binding domains also include affinity tag sequences such as histidine tag, myc tag, or hemagglutin tag.

  The first heterologous domain described above may include one or more complementarity determining regions (CDRs) of an immunoglobulin. Thus, a heterologous domain can include, for example, an antigen binding site of an antibody, such as a VH domain and Fab. In one embodiment, the first heterologous domain includes a sequence of an antigen-binding fragment or single chain antibody, such as those specific for differentiation antigen 3 (CD3) or epidermal growth factor receptor (EGFR). The first polypeptide chain may further comprise a second heterologous domain fused in frame to the other end of the first scaffold domain. Like the first heterologous domain, the second heterologous domain can also include a domain that binds to a binding partner. The first and second heterologous domains may be the same or different from each other. They can bind to the same binding partner or two different binding partners. For example, the first heterologous domain and the second heterologous domain may each contain sequences of a first single-chain antibody and a second single-chain antibody that specifically bind to CD3 and EGFR, respectively. Good.

  In the protein complex described above, the second fusion polypeptide chain is in-frame at the other end of the third heterologous domain, the second scaffold domain, fused in-frame to one end of the second scaffold domain. A fourth heterologous domain fused at, or both domains fused in-frame to the two ends. Similarly, the third fusion polypeptide chain is fused in frame to the fifth heterologous domain fused in-frame to one end of the third scaffold domain, or to the other end of the third scaffold domain. A sixth heterologous domain, or both. Like the first and second heterologous domains described above, each of these four heterologous domains can also include a binding domain that binds to a binding partner. All six heterologous domains may be the same or different from each other. They can thus bind to 1, 2, 3, 4, 5 or 6 binding partners. In other words, the protein complex can be one, two, three, four, five, or hexavalent.

  Each of the three scaffold domains includes one or more triple helix repeats such that the first, second, and third scaffold domains form a triple helix coil, each repeat having the following formula: ( X1-X2-X3) n, wherein X1 is a Gly residue, X2 and X3 are any amino acid residue, preferably an imino acid proline or hydroxyproline, and n is 5 Or a larger number. For example, the first, second, and third scaffold domains can comprise (GPP) 10, or triple helical repeats of one or more human complement C1q, collectin, or collagen polypeptide chains. .

  In one embodiment, the first, second and third fusion polypeptides described above are substantially the same and have a sequence of at least 75% (including any number between, for example, 75% and 100%) of each other. Have identity. A complex formed from three identical fusion polypeptides is a homotrimer. These three fusion polypeptides can be functionally equivalent. “Functionally equivalent” means that a polypeptide derivative of a common polypeptide, such as a protein having one or more point mutations, insertions, deletions, truncations, fusion proteins, or combinations thereof, is a triple helical coil. And substantially retains the activity of a heterologous domain such as binding to a ligand.

  A heterologous polypeptide, nucleic acid, or gene is derived from a different species or, if from the same species, is substantially modified in its original form. Two fusion domains or sequences are heterologous to each other if they are not next to each other in a native protein or nucleic acid. For example, a polypeptide sequence that is not part of native human minicollagen (type XXI), collectin family protein, or complement 1q (C1q) is heterologous to a domain in the human protein.

  The invention also includes (i) a scaffold domain used to form a triple helix coil, and (ii) a first heterologous domain fused in frame to one end of the scaffold domain, or another scaffold domain Also featured are isolated recombinant fusion polypeptides (eg, each of the three fusion polypeptides described above) comprising a second heterologous domain fused in-frame to the ends. The scaffold domain may comprise one or more of the above-described triple helix repeats, such as that of human C1q or a collagen polypeptide chain. The heterologous domain may include one of the binding domains described above and can be obtained by various methods known in the art such as phage display screening.

  An isolated polypeptide or protein complex refers to a polypeptide or protein complex that is substantially free of naturally associated molecules, ie, it is at least 75% pure (ie, 75% and 100% pure) by dry weight. Including any number in between). Purity can be measured by any suitable standard method, such as column chromatography, polyacrylamide gel electrophoresis, or HPLC analysis. The isolated polypeptide or protein complex of the present invention can be purified from natural sources and can be produced by recombinant DNA techniques.

  The invention is also characterized by an isolated nucleic acid comprising a sequence encoding the fusion polypeptide described above or the complement of that sequence. Nucleic acid refers to a DNA molecule (eg, cDNA or genomic DNA), an RNA molecule (eg, mRNA), or a DNA or RNA analog. DNA or RNA analogs may be synthesized from nucleotide analogs. The nucleic acid molecule may be single-stranded or double-stranded, but preferably is double-stranded DNA. An “isolated nucleic acid” is a nucleic acid whose structure is not identical to the structure of any naturally occurring nucleic acid or the structure of any naturally occurring genomic nucleic acid fragment. Thus, this term includes, for example, (a) a sequence that is part of a naturally occurring genomic DNA molecule, but next to two coding sequences that flank a part of that molecule in the genome that is naturally present in the organism. (B) a nucleic acid that is incorporated into the vector or prokaryotic or eukaryotic genomic DNA in such a way that the resulting molecule is not identical to any naturally occurring vector or genomic DNA, (c) e.g. isolated molecules such as cDNA, genomic fragments, fragments generated by polymerase chain reaction (PCR) or restriction fragments, and (d) recombinant nucleotide sequences that are part of a hybrid gene, ie, a gene encoding a fusion protein, Is included. The nucleic acids described above can be used to express the polypeptides of the present invention. For this purpose, the expression vector can be generated by operably linking the nucleic acid to suitable regulatory sequences.

  A vector refers to a nucleic acid molecule capable of carrying another nucleic acid linked to it. Vectors can be self-replicating or unified with host DNA. Examples of vectors include plasmids, cosmids, or viral vectors. The vector of the present invention contains the nucleic acid in a form suitable for expression of the nucleic acid in a host cell. Preferably, the vector contains one or more regulatory sequences operatively linked to the nucleic acid sequence to be expressed. “Regulatory sequences” include promoters, enhancers, or other expression control elements (eg, polyadenylation signals). Regulatory sequences include not only tissue-specific regulatory and / or inducible sequences, but also those that directly constitutively express nucleotide sequences. The expression vector can be designed according to factors such as selection of a host cell to be transformed, expression level of a desired protein, and the like. The polypeptide of the present invention is produced by introducing the expression vector into a host cell. Host cells containing the nucleic acids described above are also included within the scope of the present invention. As an example, E.I. Coli cells, insect cells (eg, using Drosophila S2 or baculovirus cells), yeast cells, or mammalian cells (eg, mouse myeloma NS0 cells). See, for example, Goeddel, (1990) Gene Expression Technology: Method in Enzymology 185, Academic Press, San Diego, CA.

  In order to produce the fusion polypeptide of the present invention, a host cell is cultured in a medium under conditions that allow expression of the polypeptide encoded by the nucleic acid of the present invention. The peptide can be purified. Alternatively, the nucleic acids of the invention may be copied and translated in vitro, for example using T7 promoter regulatory sequences and T7 polymerase.

  In order to produce the protein complex of the present invention, a host cell containing the first, second and third nucleic acids encoding the first, second and third fusion polypeptides, respectively, described above, is prepared using these three nucleic acids. Culturing in medium and purifying the protein complex from the cultured cells or cell culture medium under conditions that allow expression of the polypeptide encoded by and the formation of a triple helical coil between the expressed polypeptides can do. It is preferred that the host cell is a eukaryotic cell containing an enzymatic activity that hydroxylates a proline residue.

  The details of one or more embodiments of the invention are set forth in the accompanying drawings and the description below. Other features, objects, and features of the invention will be apparent from the description and drawings, and from the claims.

It is a figure which shows the protein complex which has the mini collagen triple helical coil scaffold derived from a human XXI type collagen. The six ends of the triple helix coil are each fused in-frame to six Fv fragments (scFv) having the VL and VH domains of a single chain antibody. Each of (A) a protein complex having a triple helical coil scaffold whose three N-termini are each fused in frame to three single chain antibodies OKT3 (anti-CD3), 528 (anti-EGFR), and erb_scFv (anti-EGFR) The figure which shows a body, (B) It is the photograph which shows the result of the Western blot of this protein complex. Stablely transfected Drosophila S2 cell-derived medium was electrophoresed on SDS-PAGE under non-reducing conditions and then immunoblotted with monoclonal antibody against the C-terminus of type XXI collagen, 3E2. T is a trimer having a disulfide bond between chains, and Mt is a monomer including a trimer having a disulfide bond between chains. FIG. 2 shows a protein complex having a triple helical coil scaffold. The three N-termini of the triple helix coil are fused in-frame to three OKT3 single chain antibodies, and the three C-termini of the triple helix coil are fused in-frame to three 528 single chain antibodies. Each type of antibody is described. (A) Collagen scaffold antibody: scFv-Col (left panel), surfactant protein D (SPD) containing amino terminal scFv, hinge region of human IgG, collagen-like domain (GPP) 10, and carboxyl-terminal NC1 domain of type XXI collagen NSPD-scFv (right panel) containing scFv at the amino terminus and carboxyl terminus of collectin. (B) From left to right: immunoglobulin G (IgG), chimeric (scFv-Fc), and single chain antibody (scFv) and their approximate molecular weights. Gray areas represent VH and VL fragments. Dotted line: Interchain disulfide bond.

  The present invention provides at least the unexpected discovery that a heterologous protein binding domain that fuses in-frame to the scaffold domain of a human triple helix coil retains binding activity and that the resulting fusion polypeptide forms a triple helix coil. Based on part. Shown in FIG. 1 is an example of the protein complex of the present invention. As shown in this figure, the six ends of the triple helix coil protein complex are fused in-frame to six heterologous protein binding domains, ie, Fv fragments of a single chain antibody (scFv).

  The protein complex of the present invention is superior to conventional antibodies. Alternatively, if two or more of the six domains are identical to each other, the protein complex can comprise 2 to 6 binding domains specific for one binding partner (eg, an antigen) compared to this. Conventional antibodies have only two such domains. In other words, unlike conventional antibodies that are only bivalent to the antigen, the protein complex can be 2, 3, 4, 5 or hexavalent. As a result, various affinities higher than those of conventional antibodies can be obtained. Because of its high affinity, less protein complex is required than conventional antibodies, and the incubation period is shortened to achieve the desired goal. For example, as a therapeutic effect, this lowers the cost of treatment and minimizes side effects (eg, undesirable immune reactions). On the other hand, if two or more of the six domains are different from each other, the protein complex of the invention can comprise 2 to 6 binding domains that are specific for 2 to 6 different binding partners. The ability to combine multiple binding partners by consolidating multiple binding partner sites with different specificities into one unit provides for treatment, tissue regeneration, and active protein machinery (eg, multi-subunit enzymes) In this assembly, the desired use at the nanometer level is possible.

  For human in vivo use, the protein complex of the present invention is preferably derived from a human. For example, it includes a humanized single chain antibody sequence fused in-frame to a human-derived helical coil scaffold such as human C1q, collectin family protein, or collagen polypeptide chain. Since human C1q and collagen are both extremely stable in blood, the protein complex is more stable than conventional antibodies.

  Collagen is the most abundant protein present in mammals. It is an extracellular matrix protein that contains the repeat triplet sequence Gly-X1-X2 and the presence of such triplets can fold three collagen polypeptide chains (α chains) into a triple helical structure. The amino acid at position X2 in the triplet sequence Gly-X1-X2 is often proline, which is often 4-hydroxylated by post-translational modification of the collagen polypeptide chain to stabilize the triple helix structure of the collagen. Without proline hydroxylation, the major triple helix structure of collagen becomes thermally unstable at sub-physiological temperatures (Berg and Prockop, Biochem Biophys Res Commun 52: 115-120, 1973; Rosenbloom et al., Arch Biochem Biophys 158: 478-484, 1973). Collagen-like proteins with many collagen-like domains are present in human serum and play a role in the innate immune system in protecting against infectious organisms. These include complement protein C1q, collectin family protein-mannose binding lectin (MBL), surfactant proteins A and D (SP-A and SP-D). A common structural feature among these collagen-like proteins is that the trimeric molecules accumulate or interchain disulfide bridges after the triple-helix of the collagen-like domain is assembled. To take shape. Thus, the functional affinity of the binding domains of these “defense collagen” molecules is greatly improved through multimerization.

  The protein complex or polypeptide of the present invention can be obtained by recombinant techniques. After introduction into the nucleic acid of a suitable host cell encoding the polypeptide of the complex, under conditions that allow expression of the polypeptide encoded by the nucleic acid and formation of a triple helical coil between the polypeptides. The polypeptide can be expressed. In order to promote the formation of a triple helical coil scaffold, it can be co-expressed with host cell prolyl 4-hydroxylase (P4HA), a key enzyme in collagen biosynthesis.

  The heterologous protein domain can include an antibody or fragment thereof (eg, an antigen-binding fragment thereof). The term “antibody” as used herein refers to an immunoglobulin molecule or an immunologically active site thereof, ie, an antigen binding site. It refers to a protein comprising at least one and preferably two heavy (H) chain variable regions (VH) and at least one and preferably two light (L) chain variable regions (VL). . The VH and VL regions are further subdivided into hypervariable regions called “complementary determining regions (“ CDRs ”)” located between more conserved regions called “framework regions” (FR). Also good. Framework regions and CDR ranges are clearly defined (Kabat et al. (1991) Sequences of Proteins of Immunological Interes, Fifth Edition, US Department of Health and Human Services, NIH, which is incorporated herein by reference. Publication No. 91-3242 and Chothia et al. (1987) J. Mol. Biol. 196: 901-917). Each VH and VL consists of 3 CDRs and 4 FRs arranged in the following order from the amino terminus to the carboxy terminus: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. The antibody may further comprise heavy and light chain constant regions, thereby forming heavy and light immunoglobulin chains, respectively. The heavy chain constant region is comprised of three domains, CH1, CH2 and CH3. The light chain constant region is comprised of one domain, CL. The variable regions of the heavy and light chains contain a binding domain that acts with an antigen. The constant region of an antibody typically mediates the binding of the antibody to host tissues or factors including various cells of the immune system (eg, effector cells) and the first component of the classical complement system (C1q).

  As used herein, the term “immunoglobulin” refers to a protein consisting essentially of one or more polypeptides encoded by immunoglobulin genes. Among the recognized human immunoglobulin genes are kappa, lambda, alpha (IgA1 and IgA2), gamma (IgG1, IgG2, IgG3, IgG4), delta, epsilon and mu constant region genes, and the myriad immunoglobulins There are variable region genes. A full-length immunoglobulin “light chain” (approximately 25 KDa or 214 amino acids) is encoded by the NH2-terminal (approximately 110 amino acids) variable region gene and the COOH-terminal kappa or lambda constant region gene. Similarly, a full-length immunoglobulin “heavy chain” (approximately 50 KDa or 446 amino acids) is composed of a variable region gene (approximately 116 amino acids) and one of the other constant region genes described above, such as gamma (approximately Encodes 330 amino acids).

  An “antigen-binding fragment” (or “antibody portion” or “fragment”) of an antibody as used herein is the ability to specifically bind to an antigen, eg, an EGFR or CD3 polypeptide or fragment thereof. Refers to one or more full-length antibody fragments that retain Examples of antibody antigen-binding fragments include, but are not limited to, (i) a Fab fragment, a monovalent fragment consisting of VL, VH, CL and CH1 domains, (ii) an F (ab ′) 2 fragment, in the hinge region A bivalent fragment comprising two Fab fragments linked by a disulfide bridge, (iii) an Fd fragment consisting of the VH and CHI domains, (iv) an Fv fragment consisting of the VL and VH domains of one arm of the antibody, (v) A dAb region consisting of a VH domain (Ward et al. (1987) Nature 341: 544-546), (vi) an isolated complementary determining region (CDR), and (vii) a VL or VH domain. In addition, the two domains of the Fv fragment, VL and VH, are encoded by separate genes, but these can be joined by a synthetic linker using recombinant methods, which bind them to the VL and VH regions. Can be combined into a single protein chain that forms a monovalent molecule (known as single chain Fv (scFv). For example, Bird et al. (1988) Science 242: 423-426, and Huston et al. ( 1988) PROC. Natl. Acad. Sci USA 85: 5879-5883). Such single chain antibodies are also encompassed within the term “antigen-binding fragment” of an antibody. These antibody fragments can be obtained by conventional techniques known to those skilled in the art, and the fragments are selected in the same manner as intact antibodies so that they can be put to practical use.

  Suitable antibodies include monoclonal antibodies. In another embodiment, the antibody may be one produced by recombinant techniques, such as phage display or combinatorial techniques. Phage display and combinatorial techniques for generating antibodies are well known in the art (eg, Ladner et al., US Pat. No. 5,223,409; Kang et al., WO 92/18619; Dower). WO 91/17271 pamphlet; Winter et al., WO 92/20791 pamphlet; Markland et al., WO 92/15679 pamphlet; Breitling et al., WO 93/01288 pamphlet; McCafferty et al., WO92 / 01047 pamphlet; Garrard et al., WO92 / 09690 pamphlet; Ladner et al., WO90 / 02809 pamphlet; Fuchs et al. (1991) Bio / Technology 9: 1370-1372; Hay et al. (1992) Hum Antibod Hybridomas 3: 81-85; Huse et al. (1989) Science 246: 1275-1281; Griffths et al., 1993) EMBO J 12: 725-734; Hawkins et al. (1992) J Mol Biol 226: 889-896; Clackson et al. (1991) Nature 352: 624-628; Gram et al. (1992) PNAS 89: 3576-3580 Garrad et al. (1991) Bio / Technology 9: 1373-1377; see Hoogenboom et al. (1991) Nuc Acid Res 19: 4133-4137, and Barbas et al. (1991) PNAS 88: 7978-7982, all of these The contents of which are incorporated herein by reference).

  In one embodiment, the antibody is a fully human antibody (eg, an antibody made in a mouse that has been genetically engineered to produce antibodies from human immunoglobulin sequences), or a non-human antibody, such as a rodent (mouse). Or rat), goat, primate animal (eg monkey), camel antibody. The non-human antibody is preferably a rodent (mouse or rat antibody). Methods for making rodent antibodies are well known in the art.

  Human monoclonal antibodies can be generated using transgenic mice with human immunoglobulin genes rather than mouse systems. Splenocytes from these transgenic mice immunized with the antigen of interest are used to generate hybridomas that secrete human mAbs with specific affinity for human protein epitopes (see, eg, Wood et al., International Publications). 91/00906 pamphlet; Kucherlapati et al., WO 91/10741 pamphlet; Lonberg et al., WO 92/03918 pamphlet; Kay et al., WO 92/03917 pamphlet; Lonberg, N et al., 1994 Nature 368: 856-859, Green, LL et al., 1994 Nature Genet. 7: 13-21; Morrison et al., 1994 Proc. Natl. Acad. Sci. USA 81: 6851-6855; Bruggeman et al., 1993 Year Immunol 7: 33- 40; see Tuaillon et al., 1993 PNAS 90: 3720-3724; Bruggeman et al., 1991 Eur J Immuno 21: 1323-1326).

  An antibody may be one in which a variable region or part thereof, such as a CDR, has been produced in a non-human organism, such as a rat or mouse. Chimeras, CDR-grafts, and humanized antibodies can be used. Antibodies that are produced in a non-human organism such as a rat or mouse and then modified, for example, in the variable framework or constant region, to reduce antigenicity in humans are within the scope of the invention.

  Chimeric antibodies can be made by recombinant DNA techniques well known in the art. As an example, a gene encoding the Fc constant region of a mouse (or other species) monoclonal antibody molecule is digested with restriction enzymes to remove the region encoding mouse Fc and then the gene encoding the human Fc constant region (Robinson et al., International Patent Application PCT / US86 / 02269; Akira et al., European Patent Application No. 184,187; Taniguchi, M, European Patent Application No. 171,496; Morrison European Patent Application No. 173,494; Neuberger et al., WO 86/01533; Cabilly et al., US Pat. No. 4,816,567; Cabilly et al. European Patent Application No. 125,023. Better et al. (1998 Science 240: 1041-1043); Liu et al. (1987) PNAS 84: 3439-3443; Liu et al., 1987, J. Immunol 139: 3521-3526; Sun et al. (1987) PNAS 84: 214-218; Nishi mura et al., 1987, Canc. Res. 47: 999-1005; Wood et al. (1985) Nature 314: 446-449; and Shaw et al., 1998, J. Natl Cancer Inst. 89: 1553-1559).

  In a humanized or CDR-grafted antibody, the CDRs of at least one or two but usually all three recipients (heavy and / or light immunoglobulin chains) are replaced with donor CDRs. The antibody may be replaced with at least a portion of a non-human CDR, or only some of the CDRs may be replaced with non-human CDRs. It is only necessary to replace the number of CDRs required for binding of the humanized antibody or fragment thereof. Preferably, the donor is a rodent antibody, such as a rat or mouse antibody, and the recipient is a human framework or a human consensus framework. In general, immunoglobulins that provide CDRs are called “donors” and immunoglobulins that provide the framework are called “acceptors”. In one embodiment, the donor immunoglobulin is non-human (eg, a rodent). The acceptor framework is a natural (eg human) framework or a consensus framework, or a sequence that is about 85% or more, preferably 90%, 95%, 99% or more identical. As used herein, a “consensus sequence” refers to a sequence formed from the most frequently occurring amino acids (or nucleotides) in a family of related sequences (eg, Winnaker, From Genes to Clones (Verlagsgesellschaft, Weinheim , Germany 1987). In a family of proteins, each position in the consensus sequence is occupied by the amino acid that occurs most frequently at that position in the family. If two amino acids appear equally frequently, either can be included in the consensus sequence. “Consensus framework” refers to a framework region in a consensus immunoglobulin sequence.

  Antibodies can be humanized by methods well known in the art. Humanized antibodies can be generated by replacing sequences of the Fv variable region that are not directly involved in antigen binding with corresponding sequences from the human Fv variable region. General methods for generating humanized antibodies are described in Morrison, SL, 1985, Science 229: 1202-1207, Oi et al., 1986, BioTechniques 4: 214, and Queen et al., US Pat. No. 5,585,089. US Pat. No. 5,693,761 and US Pat. No. 5,693,762, the contents of all of which are incorporated herein by reference. These methods include isolating, manipulating, and expressing a nucleic acid sequence encoding all or part of an immunoglobulin Fv variable region from at least one heavy or light chain. Such nucleic acid sources are well known to those of skill in the art and can be obtained, for example, from hybridomas that produce antibodies to the polypeptide of interest or a fragment thereof. Thus, recombinant DNA encoding a humanized antibody or fragment thereof can be cloned into an appropriate expression vector.

  Humanized antibodies in which specific amino acids are substituted, deleted or added can also be fused to a scaffold. Preferred humanized antibodies have amino acid substitutions in the framework regions, for example for the purpose of improving binding to the antigen. For example, a humanized antibody comprises a framework residue that is identical to another amino acid other than a donor framework residue or a recipient framework residue. To generate such antibodies, selected few humanized immunoglobulin chain acceptor framework residues can be replaced with corresponding donor amino acids. Preferred arrangements of substituents include arrangements in which amino acid residues are adjacent to or can act on CDRs. Criteria for selecting amino acids from donors are described in US Pat. No. 5,585,089, the contents of which are hereby incorporated by reference. Other techniques for humanized antibodies are described in Padlan et al., EP 519596.

  The present invention also includes a nucleic acid encoding a fusion polypeptide that forms a protein complex of the present invention. The nucleic acid can be selected from a phage display library or isolated (by RT-PCR) from a cell line that expresses a suitable antibody or antibody derivative as described above. The nucleic acid may be functionally ligated to an expression vector. Cells transformed with nucleic acids or vectors can be used to make the fusion polypeptides or protein complexes of the invention. Cells useful for making antibodies include insect cells and mammalian cells (eg, CHO or lymphocytes).

  The protein complexes of the invention can be conjugated to therapeutic moieties such as cytotoxins, therapeutic agents or radioactive ions. A cytotoxin or cytotoxic agent includes any agent that is detrimental to cells. Examples include taxol, cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin, etoposide, tenoposide, vincristine, vinblastine, colchicine, doxorubicin, daunorubicin, dihydroxyanthracindione, mitoxantrone, amitinomycin Mycin D, 1-dehydrotestosterone, glucocorticoid, procaine, tetracaine, lidocaine, propranolol, puromycin, maytansinoids such as maytansinol (see US Pat. No. 5,208,020) ), CC-1065 (see US Pat. No. 5,475,092, US Pat. No. 5,585,499, US Pat. No. 5,846,545) ) And analogs or homologues thereof. The therapeutic agents include, but are not limited to, antimetabolites (eg, methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-fluorouracil decarbazine), alkylating agents (eg, mechlorethamine, thioepachlorambucil (thioepa chlorambucil). ), CC-1065, melphalan, carmustine (BSNU) and lomustine (CCNU), cyclothosphamide, busulfan, dibromomannitol, streptozotocin, mitomycin C, and cisdichlorodiamineplatinum (II) (DDP) (cisplatin) ), Anthracyclines (eg, daunorubicin (formerly daunomycin) and doxorubicin), antibiotics (eg, dactinomycin, (formerly actinomycin), bleomycin, mitramycin and Anthramycin (AMC)), and anti-mitotic agents (eg, vincristine, vinblastine, and taxol and maytansinoids) include. Radioactive ions include, but are not limited to, iodine, include yttrium and praseodymium.

  Conjugates can be used to modify a given biological response, and the drug moiety should not be construed as limited to classic chemotherapeutic drugs. For example, the drug component can be a protein or polypeptide with the desired biological activity. Examples of such proteins include abrin, ricin A, toxins such as Pseudomonas aeruginosa exotoxin or diphtheria toxin, tumor necrosis factor, α-interferon, β-interferon, nerve growth factor, platelet derived growth factor, tissue plasminol A protein such as a gene activator or, for example, lymphokines, interleukin-1 (“IL-1”), interleukin-2 (“IL-2”), interleukin-6 (“IL-6”), granulocytes Biological response modifiers such as macrophage colony stimulating factor ("GM-CSF"), granulocyte colony stimulating factor ("G-CSF") or other growth factors are included.

  The above protein complexes and conjugates based on the specificity of the heterologous binding domain can be used to treat a variety of diseases including cancer, inflammatory diseases, metabolic diseases, fibrotic diseases, and cardiovascular diseases. . Thus, the present invention is characterized by a method for treating such diseases, for example, by administering an effective amount of the protein complex of the present invention to a subject in need thereof. The subject to be treated can be identified as having or at risk of acquiring a condition characterized by the disease. This method can be performed alone or in combination with other drugs or therapies.

  Due to its multispecificity, the protein complex of the present invention can be used to cross-link molecules or cells that are not originally linked to each other. This feature is particularly useful for cell-based therapy. In one example, one heterologous domain in a protein complex can activate a cytotoxic cell (eg, a cytotoxic T cell) by specifically binding to an effector antigen on a cytotoxic cell, while simultaneously Other heterologous domains specifically bind to the target antigen on the pathogenic or malignant cell to be destroyed. In this way, the protein complex can treat diseases caused by pathogenic or malignant cells.

  Activation of cytotoxic T cells can occur through the binding of CD3 antigen as an effector antigen on the surface of cytotoxic T cells by the protein complex of the present invention. Other lymphoid cell-associated effector antigens include human CD16 antigen, NKG2D antigen, NKp46 antigen, CD2 antigen, CD28 antigen, CD25 antigen, CD64 antigen, and CD89 antigen. Binding to these effector antigens results in activation of effector cells such as monocytes, neutrophil granulocytes and dendritic cells. Thus, these activated cells exert a cytotoxic or apoptotic effect on the target cells.

  A target antigen is an antigen that is uniquely expressed on a target cell associated with a disease state, but is not expressed in a healthy state, expressed at a low level, or non-accessible. is there. Examples of such target antigens associated with malignant cells include EpCAM, CCR5, CD19, HER-2neu, HER-3, HER-4, EGFR, PSMA, CEA, MUC-1 (mucin), MUC2, MUC3, MUC4, MUC5. sub. AC, MUC5. sub. B, MUC7, beta. hCG, Lewis-Y, CD20, CD33, CD30, Ganglioside GD3, 9-O-acetyl-GD3, GM2, Globo H, Fucosyl GM1, Poly SA, GD2, Carboanhydrase IX (MN / CA IX) , D44v6, Sonic hedgehog (Shh), Wue-1, plasma cell antigen, (membrane-bound) IgE, melanoma chondroitin sulfate proteoglycan (MCSP), CCR8, TNF-alpha precursor, STEAP, mesothelin, A33 antigen , Prostate stem cell antigen (PSCA), Ly-6; desmoglein 4, E-cadherin neoepitope, fetal acetylcholine receptor, CD25, CA19-9 marker, CA-125 marker and Muellerian tube inhibitor (MIS) receptor type II, s Examples include Tn (silylated Tn antigen; TAG-72), FAP (fibroblast activation antigen), endosialin, EGFRvIII, LG, SAS and CD63.

  The term “treating” is used to cure, alleviate, reduce, or repair a disease, symptom of the disease, a secondary medical condition due to the disease, or a predisposition to the disease. It is defined as administering a composition to a subject with the aim of remedy, preventing or ameliorate. An “effective amount” is the amount of the composition that can produce a medically desirable result, eg, as described above, in a subject to be treated.

  In one in vivo approach, a therapeutic composition (eg, a composition comprising a protein complex of the invention) is administered to a subject. Usually, the complex is suspended in a pharmaceutically acceptable carrier (eg, saline) and is administered orally or by intravenous injection, or subcutaneous, intramuscular, intrathecal, intraperitoneal, intrarectal. Injected or injected into the vagina, nasal cavity, stomach, trachea or lung.

  The required dosage will depend on the choice of route of administration, the nature of the dosage form, the nature of the subject's disease, the subject's size, weight, surface area, age and gender, other drugs being administered, and the judgment of the attending physician. A suitable dose is in the range of 0.01 to 100.0 mg / kg. The required increase or decrease in dosage is anticipated taking into account the type of composition available and the different efficiencies of the various routes of administration. For example, it can be expected that oral administration will require higher doses than administration by intravenous injection. The extent of these dose increases and decreases can be adjusted and optimized by standard empirical routines as is well understood in the art. Encapsulating the composition in a suitable delivery medium (eg, polymeric microparticles or implantable device) can improve delivery efficiency, particularly in oral delivery.

  Also included within the scope of the present invention are pharmaceutical compositions comprising a pharmaceutically acceptable carrier and an effective amount of a protein complex of the present invention. The pharmaceutical composition can be used to treat the diseases described above. Pharmaceutically acceptable carriers include solvents, dispersion media, coatings, antibacterial and antifungal agents, and isotonic and absorption delaying agents. The pharmaceutical composition can be formed into dosage forms suitable for different administration routes using conventional methods.

  The effectiveness of the composition of the present invention can be evaluated both in vitro and in vivo. For in vivo testing, the composition can be injected into an animal (eg, a mouse model) and then examined for its therapeutic effect. Based on the results, an appropriate dose range and administration route can be determined.

  The following specific examples are merely illustrative and should not be construed as limiting the invention in any manner other than this disclosure. Without being detailed, it is believed that those skilled in the art can make maximum use of the present invention based on the description herein. All publications cited herein are hereby incorporated by reference in their entirety.

Example 1
The M13 phage display library was screened to identify human single chain variable fragments (scFv) that specifically bind to EGFR. A number of clones were identified. After confirmation by Western blotting and ELISA, one clone, erb_scFv, was selected for further experiments. CDNA encoding erb_scFv was obtained by standard methods and then ligated into an expression vector. Shown below is the polypeptide sequence of erb_scFv (SEQ ID NO: 1) and the nucleotide sequence encoding it (SEQ ID NO: 2).

SEQ ID NO: 1
MetAlaGluValGlnLeuLeuGluSerGlyGlyGlyLeuValGlnProGlyGlySerLeuArgLeuSerCysAlaAlaSerGlyPheThrPheSerSerTyrAlaMetSerTrpValArgGlnAlaProGlyLysGlyLeuGluTrpValSerAspIleGlyAlaSerGlySerAlaThrSerTyrAlaAspSerValLysGlyArgPheThrIleSerArgAspAsnSerLysAsnThrLeuTyrLeuGlnMetAsnSerLeuArgAlaGluAspThrAlaValTyrTyrCysAlaLysSerThrThrThrPheAspTyrTrpGlyGlnGlyThrLeuValThrValSerSerGlyGlyGlyGlySerGlyGlyGlyGlySerGlyGlyGlyGlySerThrAspIleGlnMetThrGlnSerProSerSerLeuSerAlaSerValGlyAspArgValThrIleThrCysArgAlaSerGlnSerIleSerSerTyrLeuAsnTrpTyrGlnGlnLysProGlyLysAlaProLysLeuLeuIleTyrAspAlaSerAlaLeuGlnSerGlyValProSerArgPheSerGlySerGlySerGlyThrAspPheThrLeuThrIleSerSerLeuGlnProGluAspPheAlaThrTyrTyrCysGlnGlnTyrAlaAspTyrProThrThrPheGlyGlnGlyThrLysValGluIleLysArg

SEQ ID NO: 2
ATGGCCGAGGTGCAGCTGTTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTTAGCAGCTATGCCATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCAGATATTGGTGCTTCTGGTTCTGCTACATCTTACGCAGACTCCGTGAAGGGCCGGTTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCCGTATATTACTGTGCGAAATCTACTACTACTTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCGAGCGGTGGAGGCGGTTCAGGCGGAGGTGGCAGCGGCGGTGGCGGGTCGACGGACATCCAGATGACCCAGTCTCCATCCTCCCTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGCCGGGCAAGTCAGAGCATTAGCAGCTATTTAAATTGGTATCAGCAGAAACCAGGGAAAGCCCCTAAGCTCCTGATCTATGATGCATCCGCTTTGCAAAGTGGGGTCCCATCAAGGTTCAGTGGCAGTGGATCTGGGACAGATTTCACTCTCACCATCAGCAGTCTGCAACCTGAAGATTTTGCAACTTACTACTGTCAACAGTATGCTGATTATCCTACTACGTTCGGCCAAGGGACCAAGGTGGAAATCAAACGG

  The expression vector was then expressed in the insect cell line Drosophila S2. Anti-EGFR erb_scFv was purified and subjected to Western blot analysis and ELISA to confirm its specificity for EGFR.

  RT-PCR was performed to obtain cDNA encoding the heavy chain variable region (VH) and light chain variable region (VL) of the anti-CD3 monoclonal antibody OKT3 from the hybridoma cell line. Subsequently, the two cDNAs were ligated to produce a fusion sequence encoding the OKT3 VH-VL fusion protein. Shown below is the polypeptide sequence of this fusion protein (SEQ ID NO: 3) and the cDNA sequence encoding it (SEQ ID NO: 4).

SEQ ID NO: 3
ValGlnLeuGlnGlnSerGlyAlaGluLeuAlaArgProGlyAlaSerValLysMetSerCysLysAlaSerGlyTyrThrPheThrArgTyrThrMetHisTrpValLysGlnArgProGlyGlnGlyLeuGluTrpIleGlyTyrIleAsnProSerArgGlyTyrThrAsnTyrAsnGlnLysPheLysAspLysAlaThrLeuThrThrAspLysSerSerSerThrAlaTyrMetGlnLeuSerSerLeuThrSerGluAspSerAlaValTyrTyrCysAlaArgTyrTyrAspAspHisTyrCysLeuAspTyrTrpGlyGlnGlyThrThrValThrValSerSerGlyGlyGlyGlySerGlyGlyGlyGlySerGlyGlyGlyGlySerAspIleValLeuThrGlnSerProAlaIleMetSerAlaSerProGlyGluLysValThrMetThrCysSerAlaSerSerSerValSerTyrMetAsnTrpTyrGlnGlnLysSerGlyThrSerProLysArgTrpIleTyrAspThrSerLysLeuAlaSerGlyValProAlaHisPheArgGlySerGlySerGlyThrSerTyrSerLeuThrIleSerGlyMetGluAlaGluAspAlaAlaThrTyrTyrCysGlnGlnTrpSerSerAsnProPheThrPheGlySerGlyThrLysLeuGluLeuLysArg

SEQ ID NO: 4
GTCCAGCTGCAGCAGTCAGGGGCTGAACTGGCAAGACCTGGGGCCTCAGTGAAGATGTCCTGCAAGGCTTCTGGCTACACCTTTACTAGGTACACGATGCACTGGGTAAAACAGAGGCCTGGACAGGGTCTGGAATGGATTGGATACATTAATCCTAGCCGTGGTTATACTAATTACAATCAGAAGTTCAAGGACAAGGCCACATTGACTACAGACAAATCCTCCAGCACAGCCTACATGCAACTGAGCAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGCAAGATATTATGATGATCATTACTGCCTTGACTACTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGTGGAGGCGGTTCAGGCGGAGGTGGCTCTGGCGGTGGCGGATCGGACATTGTGCTAACCCAGTCTCCAGCAATCATGTCTGCATCTCCAGGGGAGAAGGTCACCATGACCTGCAGTGCCAGCTCAAGTGTAAGTTACATGAACTGGTACCAGCAGAAGTCAGGCACCTCCCCCAAAAGATGGATTTATGACACATCCAAACTGGCTTCTGGAGTCCCTGCTCACTTCAGGGGCAGTGGGTCTGGGACCTCTTACTCTCTCACAATCAGCGGCATGGAGGCTGAAGATGCTGCCACTTATTACTGCCAGCAGTGGAGTAGTAACCCATTCACGTTCGGCTCGGGGACCAAGCTGGAGCTGAAACGA

  The same procedure was followed to obtain a cDNA encoding the VH and VL of anti-EGFR monoclonal antibody 528 and a fusion sequence encoding the VH-VL fusion protein of anti-EGFR528. The 528 monoclonal antibody binds to EGFR on cell membranes, such as cell membranes such as human epidermoid carcinoma A431 cells. The polypeptide sequence (SEQ ID NO: 5) of this 528 single chain antibody and the sequence of the cDNA encoding it (SEQ ID NO: 6) are shown below.

SEQ ID NO: 5
ValLysLeuGlnGluSerGlySerGluMetAlaArgProGlyAlaSerValLysLeuProCysLysAlaSerGlyAspThrPheThrSerTyrTrpMetHisTrpValLysGlnArgHisGlyHisGlyProGluTrpIleGlyAsnIleTyrProGlySerGlyGlyThrAsnTyrAlaGluLysPheLysAsnLysValThrLeuThrValAspArgSerSerArgThrValTyrMetHisLeuSerArgLeuThrSerGluAspPheAlaValTyrTyrCysThrArgSerGlyGlyProTyrPhePheAspTyrTrpGlyGlnGlyThrThrValThrValSerSerGlyGlyGlyGlySerGlyGlyGlyGlySerGlyGlyGlyGlySerMetThrGlnThrProLeuSerLeuProValSerLeuGlyAspGlnAlaSerIleSerCysArgSerSerGlnAsnIleValHisAsnAsnGlyIleThrTyrLeuGluTrpTyrLeuGlnArgProGlyGlnSerProLysLeuLeuIleTyrLysValSerAspArgPheSerGlyValProAspArgPheSerGlySerGlySerGlyThrAspPheThrLeuLysIleSerArgValGluAlaGluAspLeuGlyIleTyrTyrCysPheGlnGlySerHisHisProProThrPheGlyGlyGlyThrLysLeuGlu

SEQ ID NO: 6
GTCAAGCTGCAGGAGTCAGGGTCTGAGATGGCGAGGCCTGGAGCTTCAGTGAAGCTGCCCTGCAAGGCTTCTGGCGACACATTCACCAGTTACTGGATGCACTGGGTGAAGCAGAGGCATGGACATGGCCCTGAGTGGATCGGAAATATTTATCCAGGTAGTGGTGGTACTAACTACGCTGAGAAGTTCAAGAACAAGGTCACTCTGACTGTAGACAGGTCCTCCCGCACAGTCTACATGCACCTCAGCAGGCTGACATCTGAGGACTTTGCGGTCTATTATTGTACAAGATCGGGGGGTCCCTACTTCTTTGACTACTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGTGGAGGCGGTTCAGGCGGAGGTGGCTCTGGCGGTGGCGGATCGATGACCCAAACTCCACTCTCCCTGCCTGTCAGTCTTGGAGATCAAGCCTCCATCTCTTGCAGATCTAGTCAGAACATTGTACATAATAATGGAATCACCTATTTAGAATGGTACCTGCAAAGGCCAGGCCAGTCTCCAAAGCTCCTGATCTACAAAGTTTCCGACCGATTTTCTGGGGTCCCAGACAGGTTCAGTGGCAGTGGATCAGGGACAGATTTCACACTCAAGATCAGCAGAGTAGAGGCTGAGGATCTGGGAATTTATTACTGCTTTCAAGGTTCACATCATCCTCCCACGTTCGGCGGGGGGACCAAGCTGGAA

  The above-mentioned cDNAs encoding anti-EGFR scFv03, OKT3VH-VL, and anti-EGFR 528VH-VL were respectively inserted into cDNAs of type XXI human minicollagen containing a short hinge sequence at the 5 ′ end and a histidine tag sequence at the 3 ′ end. Fused with a frame. Shown below are the XXI human minicollagen polypeptide and cDNA sequences (SEQ ID NOs: 7 and 8, respectively).

SEQ ID NO: 7
GlyGlyArgGluProLysSerCysAspLysThrHisThrCysProProCysProArgSerIleProGlyProProGlyProIleGlyProGluGlyProArgGlyLeuProGlyLeuProGlyArgAspGlyValProGlyLeuValGlyValProGlyArgProGlyValArgGlyLeuLysGlyLeuProGlyArgAsnGlyGluLysGlySerGlnGlyPheGlyTyrProGlyGluGlnGlyProProGlyProProGlyProGluGlyProProGlyIleSerLysGluGlyProProGlyAspProGlyLeuProGlyLysAspGlyAspHisGlyLysProGlyIleGlnGlyGlnProGlyProProGlyIleCysAspProSerLeuCysPheSerValIleAlaArgArgAspProPheArgLysGlyProAsnTyrSerLeuAspAspSerSerHisHisHisHisHisHisSerSerGly
(Note: Pro is proline or hydroxyproline)

SEQ ID NO: 8
GGCGGCCGCGAGCCCAAATCTTGTGACAAAACTCACACATGCCCACCGTGCCCAAGATCTATTCCTGGGCCACCTGGTCCGATAGGCCCAGAGGGTCCCAGAGGATTACCTGGTTTGCCAGGAAGAGATGGTGTTCCTGGATTAGTGGGTGTCCCTGGACGTCCAGGTGTCAGAGGATTAAAAGGCCTACCAGGAAGAAATGGGGAAAAAGGGAGCCAAGGGTTTGGGTATCCTGGAGAACAAGGTCCTCCTGGTCCCCCAGGTCCAGAGGGCCCTCCTGGAATAAGCAAAGAAGGTCCTCCAGGAGACCCAGGTCTCCCTGGCAAAGATGGAGACCATGGAAAACCTGGAATCCAAGGGCAACCAGGCCCCCCAGGCATCTGCGACCCATCACTATGTTTTAGTGTAATTGCCAGAAGAGATCCGTTCAGAAAAGGACCAAACTATAGTCTAGACGACAGCAGCCATCATCACCATCACCATAGCAGCGGC

  The resulting three expression vectors were co-transfected into Drosophila S2 cells. The cells were cultured in the presence of blasticidin, and cells resistant to blasticidin were selected. Cell culture supernatants were collected and then screened by Western blot and ELISA for antibody activity against EGFR and CD3. It was discovered that some clone cells stably expressed a triple helix complex. These triple helical complexes, similar to type XXI human minicollagen, were resistant to heat and pepsin. More importantly, they bound specifically to both EGFR and CD3.

Example 2
In this example, three fusion polypeptides, OKT3_scFv-Col, erb_scFv-Col, and erb_NSPD-scFv were generated.

Selection of phage library An erb phagemid containing the epidermal growth factor receptor extracellular domain (EGFR-ECD) binding variable fragment (scFv) was transformed into a human single-fold scFv phage display library (Tomlinson I + J; IM Tomlinson and G. Winter). Isolated by screening the MRC Laboratory of Molecular Biology, Cambridge, UK, which was more kindly provided. Selection using an immunotube (Maxisorp; Nunc, Roskilde, Denmark) coated with 10 μg of the purified extracellular domain of the EGF receptor (EGFR-ECD; Research Diagnostics, Inc.) went. Blocking, panning, washing, elution, and reamplification of the eluted phage were performed according to the manufacturer's protocol.

Construction of Recombinant Plasmid cDNA encoding erb scFv was amplified from erb phagemid by PCR. A sequence encoding murine IgG2a anti-CD3 mAb OKT3 (Ortho Pharmaceutical Corporation) was obtained from the reverse transcription product of OKT3 hybridoma (ATCC, CRL-8001). Based on the published nucleotide sequence, OKT3 mAb VL and VH cDNA were obtained by RT-PCR. Fusion of erb and OKT3 scFv PCR was generated by linking the VL and VH chains with a glycine linker (GGGS) 3.

  To generate scFv-Col, the coding region of scFv-Col includes an EPKSCDKTHTCPPCPRSIP (which includes an N-terminal scFv nucleotide sequence and human IgG hinge region, collagen-like domain (underlined) and NC1 domain of type XXI collagen ( GPP) 10 GICDPSLCFSVIA-RRDPFRKGPNNY and the C-terminal synthetic collagen scaffold gene encoding the peptide sequence. Shown below are the synthetic collagen scaffold polypeptides and cDNA sequences (SEQ ID NOs: 9 and 10, respectively).

SEQ ID NO: 9
SEQ ID NO: 9:
GluProLysSerCysAspLysThrHisThrCysProProCysProArgSerIleProGlyProProGlyProProGlyProProGlyProProGlyProProGlyProProGlyProProGlyProProGlyProProGlyProProGlyIleCysAspProSerLeuCheARAProLyC

SEQ ID NO: 10
GAGCCCAAATCTTGTGACAAAACTCACACATGCCCACCGTGCCCAAGATCTATTCCTGGGCCACCTGGTCCCCCAGGTCCTCCAGGACCCCCAGGGCCCCCAGGCCCCCCCGGGCCGCCTGGACCCCCAGGGCCACCAGGCCCCCCAGGCATCTGCGACCCATCACTATGTTTTAGTGTAATTGCCAGAAGAGATCCGTAT

  This synthetic sequence (SEQ ID NO: 10) was generated by overlap PCR, and the PCR product flanking next to the NotI and XhoI sites was cloned into the expression vector pSecTag2 / Hygro (Invitrogen) at that site. Subsequently, the scFv of erb and OKT3 were cloned in-frame into the C-terminal collagen scaffold-containing construct described above at the AscI and NotI sites to create expression constructs of erb_scFv-Col and OKT3_scFv-Col, respectively.

  Next, erb_NSPD-scFv was produced. The NSPD-scFv coding region included the N-terminal 254 amino acids of human surfactant protein D (SPD), a member of the collectin family, and the C-terminal scFv. Shown below are the N-terminal 254 amino acids of the human surfactant protein D polypeptide and its cDNA sequence (SEQ ID NOs: 11 and 12, respectively).

SEQ ID NO: 11
MetLeuLeuPheLeuLeuSerAlaLeuValLeuLeuThrGlnProLeuGlyTyrLeuGluAlaGluMetLysThrTyrSerHisArgThrMetProSerAlaCysThrLeuValMetCysSerSerValGluSerGlyLeuProGlyArgAspGlyArgAspGlyArgGluGlyProArgGlyGluLysGlyAspProGlyLeuProGlyAlaAlaGlyGlnAlaGlyMetProGlyGlnAlaGlyProValGlyProLysGlyAspAsnGlySerValGlyGluProGlyProLysGlyAspThrGlyProSerGlyProProGlyProProGlyValProGlyProAlaGlyArgGluGlyProLeuGlyLysGlnGlyAsnIleGlyProGlnGlyLysProGlyProLysGlyGluAlaGlyProLysGlyGluValGlyAlaProGlyMetGlnGlySerAlaGlyAlaArgGlyLeuAlaGlyProLysGlyGluArgGlyValProGlyGluArgGlyValProGlyAsnThrGlyAlaAlaGlySerAlaGlyAlaMetGlyProGlnGlySerProGlyAlaArgGlyProProGlyLeuLysGlyAspLysGlyIleProGlyAspLysGlyAlaLysGlyGluSerGlyLeuProAspValAlaSerLeuArgGlnGlnValGluAlaLeuGlnGlyGlnValGlnHisLeuGlnAlaAlaPheSerGlnTyrLysLysValGluLeuPhe

SEQ ID NO: 12
ATGCTGCTCTTCCTCCTCTCTGCACTGGTCCTGCTCACACAGCCCCTGGGCTACCTGGAAGCAGAAATGAAGACCTACTCCCACAGAACAATGCCCAGTGCTTGCACCCTGGTCATGTGTAGCTCAGTGGAGAGTGGCCTGCCTGGTCGCGATGGACGGGATGGGAGAGAGGGCCCTCGGGGCGAGAAGGGGGACCCAGGTTTGCCAGGAGCTGCAGGGCAAGCAGGGATGCCTGGACAAGCTGGCCCAGTTGGGCCCAAAGGGGACAATGGCTCTGTTGGAGAACCTGGACCAAAGGGAGACACTGGGCCAAGTGGACCTCCAGGACCTCCCGGTGTGCCTGGTCCAGCTGGAAGAGAAGGTCCCCTGGGGAAGCAGGGGAACATAGGACCTCAGGGCAAGCCAGGCCCAAAAGGAGAAGCTGGGCCCAAAGGAGAAGTAGGTGCCCCAGGCATGCAGGGCTCGGCAGGGGCAAGAGGCCTCGCAGGCCCTAAGGGAGAGCGAGGTGTCCCTGGTGAGCGTGGAGTCCCTGGAAACACAGGGGCAGCAGGGTCTGCTGGAGCCATGGGTCCCCAGGGAAGTCCAGGTGCCAGGGGACCCCCGGGATTGAAGGGGGACAAAGGCATTCCTGGAGACAAAGGAGCAAAGGGAGAAAGTGGGCTTCCAGATGTTGCTTCTCTGAGGCAGCAGGTTGAGGCCTTACAGGGACAAGTACAGCACCTCCAGGCTGCTTTCTCTCAGTATAAGAAAGTTGAGCTCTTC

  The N-terminal SPD cDNA was cloned into the expression vector, pSecTag2 / Hygro (Invitrogen) with NheI and AscI sites. Subsequently, the erb scFv was cloned in-frame into the N-terminal SPD-containing construct described above at the AscI and XhoI sites to create an expression construct for erb_NSPD-scFv.

  The erb_scFv-Col, erb_NSPD-scFv, and OKT3_scFv-Col open reading frames encode an N-terminal leader sequence and a C-terminal myc epitope / polyhistidine tag used for secretion, detection and purification. An array was included. The table below summarizes the various recombinant proteins / antibodies encoded by the expression constructs described above.

Antibody Expression and Purification To make recombinant protein complexes / antibodies, the above constructs were introduced into mouse myeloma NS0 cells using Effectene (Qiagen) according to the manufacturer's instructions. After selection with hygromycin (400 μg / ml) for 4 weeks, each stable clone was first seeded at a density of 2 × with HyQCDM4NS0 (Hyclone), a known medium containing 2% fetal calf serum in a shake flask. Cultured as 10 @ 5 cells / ml. The culture was performed at 37 ° C. for 5 days at 150 rpm. Daily addition of sodium ascorbate (80 μg / ml) to the medium so that the cells can retain an expression construct encoding a protein comprising the antibody domain described above and a collagen scaffold domain or collagen scaffold antibody (CSA). It was.

  To purify erb_scFv, erb_scFv-Fc, erb_scFv-Col, or OKT3_scFv-Col protein or protein complex, approximately 2 L of each filtered medium was equilibrated with 50 mM Tris HCl buffer at pH 8.0 at a flow rate of 60 ml / hour. The gel was applied to a T gel column (1.5 × 8 cm, Pierce). After washing with the same buffer, the recombinant protein or protein complex was eluted with 50 mM sodium acetate buffer at pH 4.0. Their UV absorbance was measured at 280 nm, and the peak fraction was ZnSO4 charged chelating Sepharose high trap column (ZnSO4) equilibrated with 50 mM Tris HCl buffer containing 0.5 M NaCl at pH 8.0 at a flow rate of 60 ml / hour. -charged chelating Sepharose HighTrap column) (bed volume 1-ml, GE Healthcare). The column was first washed with 20 mM imidazole and the bound protein or protein complex was eluted with 0.25 M imidazole in the same buffer. The final preparation was dialyzed against 50 mM Hepes buffer at pH 7.0.

  Next, SDS-PAGE was performed with either a 10% NuPAGE bis-Tris polyacrylamide gel using MOPS or a 7% SDS / Tris acetate polyacrylamide gel using sodium acetate as the running buffer (Invitrogen). Subsequently, the protein was stained with Coomassie Brilliant Blue R-250. The concentration of the protein band was quantified by performing densitometry using ChemiImager 5500 (Alpha Innotech, San Leandro, CA) and the software Alpha EaseFC (v4.0; Alpha Innotech).

  To examine the triple helix properties, purified erb_scFv-Col (1 mg / ml) was incubated at 37 ° C. for 1 hour in the absence or presence of 10 mM DTT. An aliquot of the DDT treated sample was further reacted with 50 mM N-ethyl-maleimide (NEM) at ambient temperature for 30 minutes to completely block free sulfhydryl groups and trimer rearrangement. Equal amounts of protein from each sample were electrophoresed on a 7% SDS / Tris acetate polyacrylamide gel with sodium acetate as the running buffer. The gel was stained with Coomassie blue. Purified CSA was found to be a homotrimer or an interchain disulfide bond hexamer that can dissociate into two trimers under mild reducing conditions.

  The thermal stability of the trimer structure of erb_scFv-Col was investigated. Purified erb_scFv-Col in 50 mM Tris-HCl (pH 8.0) containing 2 M urea was treated at room temperature in the absence or presence of 10 mM Tris (2-carboxyethyl) phosphine (TCEP). The reduced sample was then alkylated with 50 mM NEM at ambient temperature. Prior to mixing the SDS loading buffer, each sample containing an equal amount of protein was heated at 35, 45, 55, 65, 75, and 85 ° C. for 10 minutes. The sample was electrophoresed on a 10% SDS / bis-Tris polyacrylamide gel using MOPS buffer under non-reducing conditions. The gel was stained with Coomassie blue. As a result, it was shown that the erb_scFv-Col trimer has high thermal stability. In practice, after treatment at 65 ° C. for 10 minutes, more than 50% of the trimer remained. It was also found that the trimeric structure of the collagen-like domain of erb_scFv-Col is prolyl hydroxylated.

Binding studies Binding kinetics of various types of erb antibodies to EGFR-ECD in running buffer HBS-EP (10 mM HEPES, pH 7.4, 150 mM NaCl, 3 mM EDTA, 0.005% surfactant P20). And BIAcore X biosensor (BIACORE, Inc., Uppsala, Sweden). Briefly, EGFR-ECD was immobilized on a Cl sensor chip by amine coupling until the response unit (RU) reached about 1700, and the antibody purified at various concentrations was injected at a flow rate of 10 μl / min. The surface was regenerated by injecting 5 μl of 10 mM glycine-HCl at pH 3.5. Sensorgrams at each concentration were obtained and evaluated using the program, BIA Evaluation 3.2. The binding data was fitted with a 1: 1 Langmuir binding model and an affinity constant KD, defined as the ratio of dissociation rate (kdiss) / association rate (kass), was calculated. The results are shown in Table 2 below.

  As shown in Table 2, the binding affinity of erb_scFv_Col to EGFR-ECD was about 20 and 1000 times stronger than the bivalent (erb_scFv-Fc) and monovalent (erb_scFv) mAb counterparts, respectively.

Stability and Pharmacokinetic Assay In the serum stability assay, the stability of various forms of erb antibody, erb_scFv_Col, erb_scFv-Fc or erb_scFv was measured by incubating with human serum at 37 ° C. The amount of active anti-EGFR remaining after each incubation period was measured by quantitative ELISA. ELISA consists of recombinant EGFR-ECD (as capture reagent) and anti-c-myc mAb (9E10, Sigma Chemical) followed by HRP-conjugated affinity purified polyclonal goat anti-mouse IgG and chemiluminescent substrate (Pierce Biotechnology ( Pierce Biotechnology, Inc.)). In the pharmacokinetic assay, the clearance of erb_scFv-Col was analyzed using 3 BALB / c nude mice. Briefly, after pre-bleed, each mouse was subcutaneously injected (sc) with 25 μg (2 mg / kg body weight) of erb_scFv-Col. During the subsequent 70 hours, blood samples were collected periodically and their erb_scFv-Col content assessed by ELISA. The protein was found to be very stable.

T cell proliferation assay and mixed lymphocyte reaction (MLR)
A 5-bromo-2′-deoxyuridine (BrdU) cell proliferation assay was performed. Briefly, black peripheral wells in the presence of OKT3 (eBioscience, Inc.) or OLT3_scFv-Col in which human peripheral blood mononuclear cells (PBMC) were serially diluted 10-fold at 37 ° C. for 66 hours. Plated in 100 μl RPMI-1640 medium containing 10% FBS added to flat bottom tissue culture plates at 2 × 10 5 cells / well. The cells were then pulsed with 10 μM BrdU for 5 hours. After removing the medium, cells were fixed and DNA was denatured in one step with FixDenat. The cells were then incubated with peroxidase labeled anti-BrdU antibody (anti-BrdU POD, Fag fragment) for 1.5 hours at room temperature. Chemiluminescence detection and quantification were performed using a microplate luminometer (Hidex, CHAMELEON detection platform, Finland).

  T cell proliferation and immunosuppression in the unidirectional mixed lymphocyte reaction was evaluated as follows. Human PBMCs were collected from 2 healthy donors (stimulation and response). Stimulatory or responder cells are added to complete medium (10% human AB serum, 2 mM glutamine, 50 nM 2-mercaptoethanol, and 100 units / ml penicillin and streptomycin, respectively, in humidified air containing 5% CO 2 at 37 ° C. RPMI 1640) was treated with 25 μg / ml mitomycin C (Sigma-Aldrich) for 30 minutes and then washed three times in RPMI 1640 medium. Responder cells were mixed alone or with mitomycin C-treated stimulator cells or mitomycin C responder cells and cultured as 2 × 10 5 cells / well in 200 μl complete medium. After plating the responder cells, purified OKT3_scFv-Col or OKT3 was quickly added to the culture at different concentrations. After 5 days, cultured cells were pulsed with 10 μM BrdU and harvested 24 hours later. A cell proliferation assay was then performed as described above.

  OKT3_scFv-Col was found to be more effective in immunosuppressing T cell proliferation and exhibit negligible mitogenic activity in stimulating T cell proliferation.

Cytokine measurement Human PBMCs were plated in 0.1 ml RPMI-1640 medium containing 10% FBS to 2 × 10 5 cells / well in the presence of OKT3 or OKT3_scFv-Col diluted 10-fold at 37 ° C. The supernatant was collected at each time point, and a number of cytokines were measured using a human cytokine immunoassay kit (EBioscience). As a result, it was shown that administration of OKT3_scFv_Col produces negligible cytokine release compared to mouse OKT3 mAb.

Antibody Displacement Assay All procedures described below were performed at 4 ° C. Human T cells were suspended in FCM buffer (phosphate buffered saline containing 2% FBS and 0.1% sodium azide) at a density of 1 × 10 6 cells / ml. The cells were treated with mouse total IgG (2 μg / ml, Jackson ImmunoResearch Laboratories) for 30 minutes and then incubated with serially diluted OKT3_scFv-Col or OKT3 antibody for 1 hour. A fixed, saturated amount (determined by flow cytometry) of FITC conjugate OKT3 (0.25 μg / ml, purchased from eBioscience) was added directly. After 1 hour incubation, the cells were washed with FCM buffer, and immunoluminescence analysis was performed by flow cytometry using FACScan (Becton Dickinson, San Jose, Calif.). The data was expressed as percent inhibition of maximum fluorescence intensity, defined as the mean fluorescence intensity obtained by staining T cells with OKT3-FITC in the absence of blocking antibody.

  As a result, it was found that OKT3_scFv_Col binds to human CD3 + T cells more strongly than natural mouse OKT3 mAb.

  The protein concentration was measured by Bradford assay (Pearce Biotechnology, Coomassie plus reagent) using human IgG as a standard. For amino acid analysis, purified erb_scFv-Col was dialyzed against 50 mM acetic acid, hydrolyzed in 6N HCl at 110 ° C. for 24 hours, and amino acid analysis was performed on a Waters PicoTag® system.

  These results indicate that the collagen scaffold antibody is an ideal structure for therapeutic antibody design in both anti-tumor and immunomodulatory applications.

  All features disclosed in this specification can be combined in any combination. Each feature disclosed in this specification may be replaced by another feature serving the same, equivalent, or similar purpose. Thus, unless expressly stated otherwise, each feature disclosed is only an example of a generic series of equivalent or similar features.

  From the above description, those skilled in the art can easily identify the main features of the present invention, and variously modify the present invention to suit various uses and conditions without departing from the spirit and scope thereof. And can be modified. Accordingly, other embodiments are also within the scope of the following claims.

Claims (17)

A trimeric protein complex comprising three polypeptides,
Each polypeptide is
(A) a triple helical coil scaffold domain,
(I) SEQ ID NO: 7, or a sequence encoding a protein in which one or several amino acids are mutated, inserted, deleted or cleaved in the protein encoded by SEQ ID NO: 7, or
(Ii) SEQ ID NO: 9 or a sequence encoding a protein in which one or several amino acids are mutated, inserted, deleted or cleaved in the protein encoded by SEQ ID NO: 9
A triple helical coil scaffolding domain,
(B) a first heterologous domain fused in frame to one end of the scaffold domain (the first heterologous domain is (i) SEQ ID NO: 3 or one in the protein encoded by SEQ ID NO: 3 or A sequence encoding a protein in which several amino acids are mutated, inserted, deleted or truncated, or (ii) SEQ ID NO: 4 or a protein encoded by SEQ ID NO: 4 , wherein one or several amino acids are , insertion, a first antibody domain comprising a sequence encoded by a nucleic acid comprising a sequence encoding a deletion or cleaved protein), and (c) fused in-frame to another end of the scaffold domain An optional second heterologous domain wherein the second heterologous domain is a second antibody domain, a ligand binding domain, a ligand, a receptor Or a binding domain selected from the group consisting of chromatography, and proteoglycan, or a fluorescent protein or an enzymatic domain)
Consists of
A trimeric protein complex in which the triple helical coil scaffold domains of the three polypeptides act together to form a trimeric protein complex. 2. The protein complex of claim 1, wherein the first antibody domain is fused in-frame to the amino terminus of the scaffold domain. The protein complex according to claim 1 or 2 , wherein the first antibody domain is fused in-frame to the carboxyl terminus of the scaffold domain. The protein complex according to any one of claims 1 to 3 , wherein the second antibody domain comprises a single-chain antibody. The protein complex according to any one of claims 1 to 4 , wherein each polypeptide has a second heterologous domain consisting of a second antibody domain. 6. The protein complex of claim 5 , wherein the second antibody domain comprises a single chain antibody that specifically binds to an epidermal growth factor receptor (EGFR). The second antibody domain is
(I) SEQ ID NO: 1,
(Ii) SEQ ID NO: 5,
(Iii) a sequence encoded by a nucleic acid comprising SEQ ID NO: 2, or (iv) a sequence encoded by a nucleic acid comprising SEQ ID NO: 6,
The protein complex according to claim 6 , comprising: The protein complex according to any one of claims 1 to 3 , wherein at least one of the polypeptides has a second heterologous domain consisting of an enzyme domain or a fluorescent protein. The protein complex according to any one of claims 1 to 8 , wherein the three polypeptides are substantially the same. An isolated nucleic acid comprising a sequence encoding a polypeptide according to any one of claims 1-9. An expression vector comprising the nucleic acid according to claim 10 . A host cell comprising the nucleic acid according to claim 10 or the expression vector according to claim 11 . 13. A host cell according to claim 12 , wherein the cell is a mammalian or insect cell. 14. The host cell according to claim 13 , wherein the mammalian cell is a mouse myeloma NS0 cell. A pharmaceutical composition comprising the protein complex according to any one of claims 1 to 9 . A method for producing a trimeric protein complex according to claim 1,
A first nucleic acid encoding a first polypeptide chain comprising a first triple helix scaffold domain and a first heterologous domain fused to one end of the first scaffold domain; and a second triple helix scaffold domain A host cell comprising: a second nucleic acid encoding a second polypeptide chain comprising a third polypeptide chain comprising a third polypeptide chain comprising a third triple helix scaffold domain; Culturing in a medium under conditions that allow expression of a polypeptide encoded by two nucleic acids and formation of a triple helical coil between them, and purifying the protein complex from the cultured cells or cell culture medium Including methods. 17. The method of claim 16 , wherein the host cell is a eukaryotic cell comprising an enzymatic activity that hydroxylates a proline residue.

Images