JP5492696B2 - Determination method of DNA methylation degree by single molecule fluorescence analysis - Google Patents

Description

  The present invention relates to a method for determining the degree of methylation of DNA by single molecule fluorescence analysis.

  Epigenetics represented by methylation modification and histone modification of genomic DNA are known to be important for cell development, differentiation, and reprogramming. In many eukaryotes, including humans, genomic DNA methylation is added to the cytosine bases of the “CpG sequence”, followed by a cytosine base followed by a guanine base. “CpG sequences” that undergo methylation are scattered in many regions of the genome, but there are regions in which “CpG sequences” appear exceptionally frequently, and these regions are called “CpG islands”. . “CpG island” includes a transcription start site and a promoter region. “CpG sequences” are methylated in many regions of the genome, whereas many “CpG islands” remain unmethylated.

  DNA methylation abnormalities have been reported to be involved in various diseases, and cancer cells exhibit hypomethylation of the entire genomic DNA and hypermethylation of CpG islands in the promoter region of tumor suppressor genes. Hypomethylation of the entire genomic DNA is involved in carcinogenesis with chromosomal instability, and hypermethylation of CpG islands is involved in carcinogenesis by inactivating tumor suppressor genes.

  Therefore, the quantification of DNA methylation abnormality accumulated in a seemingly normal tissue is expected to be useful for diagnosis of carcinogenic risk, and the importance of DNA methylation analysis is increasing. In clinical application, it is required to quantify the degree of methylation of individual specimens (quantitativeness).

  DNA methylation analysis is roughly divided into analysis of specific genomic regions such as specific CpG islands and genome-wide analysis for examining methylation abnormalities of the entire genome. Various methods have been reported so far for analyzing DNA methylation, and “bisulfite sequencing” and “DNA methylation array” are known as typical methods.

1. Bisulfite Sequencing “Bisulphite Sequencing” means that when single-stranded DNA is treated with sodium bisulfite, unmethylated cytosine reacts and is converted to uracil, but methylated cytosine is not converted. This is a technique for examining methylation sites by analyzing the base sequences before and after treatment using the principle (bisulfite conversion). Since this method involves analysis of the base sequence, it is used not for analyzing the entire genome but for examining the methylation state of a specific DNA region. This method requires bisulfite treatment, primer setting, DNA amplification treatment, sequencing and data analysis, and at least several days, usually about one week, to complete methylation analysis of a specific DNA region It takes a little time. In recent years, this method has been attempted to be used for genome-wide analysis in combination with microarrays and next-generation sequencing methods. However, at present, if this method is used to analyze the entire genome, a great deal of labor and time is required. This method is not suitable for analyzing the entire genome because it requires a large amount of sample. In addition, since there is a DNA region that is difficult to be bisulfite converted in genomic DNA, a measurement result that does not reflect the methylation state of biological DNA may be obtained.

2. DNA methylation array “DNA methylation array” is a technique for examining the degree of DNA methylation using microarray analysis. This method includes the MIAMI method using a methylation sensitive restriction enzyme and the MeDIP method using an anti-methylated cytosine antibody. This method can analyze methylation of the whole genome, but is not a quantitative method. Further, the machine is expensive and the measurement cost (reagent) is expensive.

3. Methods using bisulfite conversion Patent Documents 1 and 2 disclose a method for analyzing methylation of a specific genomic region using bisulfite conversion. Patent Document 1 discloses that after bisulfite conversion of DNA, it is amplified in the presence of labeled dCTP, and the methylation rate is determined by measuring the incorporated labeled dCTP. Patent Document 2 discloses detecting CpG islands in genomic DNA by PCR using a methylation specific primer and an unmethylation specific primer after bisulfite conversion.

4). Method Using Methylated DNA Binding Protein Patent Document 3 discloses a method using methylated DNA binding protein for detection of methylated DNA. Patent Document 3 detects a methylated DNA by preparing a chimeric protein of a DNA-binding domain of methyl-CpG binding protein (MBD) and an Fc fragment of an antibody and specifically using the methylated DNA as an antibody. To disclose.

JP 2005-168486 A Special Table 2002-543852 Special table 2008-521389 gazette

  It is an object of the present invention to provide a method that is superior in quantitativeness, simple, and capable of measurement in a short time as compared with conventional DNA methylation analysis. In particular, an object is to provide a method suitable for the analysis of the entire genome.

  Starting from a new idea of determining the degree of DNA methylation using single-molecule fluorescence analysis, the present inventors have used methylated DNA-binding proteins as fluorescent molecules for causing molecular weight changes. The invention has been completed. That is, the present invention provides the following means.

[1] A method for determining the degree of methylation of the entire genomic DNA by single molecule fluorescence analysis,
(1) a step of fragmenting genomic DNA collected from a subject by restriction enzyme treatment to obtain fragmented genomic DNA;
(2) reacting fragmented genomic DNA with fluorescently labeled methylated DNA binding protein;
(3) measuring the fluorescence intensity of the fluorescent molecules in the reaction solution by single molecule fluorescence analysis, and determining the translational diffusion time of the fluorescent molecules;
(4) A method comprising the step of determining the degree of methylation of the entire genomic DNA from the obtained translational diffusion time.

[2] The method according to [1] above, wherein in the step (4), the degree of methylation is obtained by the following formula 1.
Formula 1: Methylation rate of analyte sample DNA (%) = {(translational diffusion time of analyte sample DNA−0% translational diffusion time of methylated control DNA) / (translational diffusion time of 100% methylated control DNA− 0% methylated control DNA translational diffusion time)} × 100.

  [3] The method according to [1] above, wherein the restriction enzyme in the step (1) is MseI.

  [4] The method according to [1] above, wherein the methylated DNA binding protein in the step (2) is MBD2 (Methyl-CpG binding domain protein 2).

[5] A method for determining the degree of methylation of a specific DNA region by single molecule fluorescence analysis,
(1) performing bisulfite conversion on genomic DNA collected from a subject, converting unmethylated cytosine to uracil, and maintaining methylated cytosine unconverted;
(2) amplifying a specific DNA region known to be methylated in association with a disease to obtain an amplification product;
(3) a step of methylating the CpG sequence of the amplification product;
(4) a step of reacting DNA after methylation treatment with fluorescently labeled methylated DNA binding protein;
(5) measuring the fluorescence intensity of the fluorescent molecules in the reaction solution by single molecule fluorescence analysis, and determining the translational diffusion time of the fluorescent molecules;
(6) A method comprising the step of determining the degree of methylation of a specific DNA region from the obtained translational diffusion time.

  [6] The method according to [5] above, wherein the specific DNA region known to be methylated in connection with a disease is a promoter region of a tumor suppressor gene.

[7] A method for examining the susceptibility of a DNA methylation abnormality-related disease in a subject by single molecule fluorescence analysis,
Determining the degree of methylation of the entire genomic DNA of the subject according to the method described in [1] above;
A method comprising the step of comparing the determined methylation degree of the whole genomic DNA of a subject with the methylation degree of a healthy individual.

[8] A method for examining the susceptibility of a DNA methylation abnormality-related disease in a subject by single molecule fluorescence analysis,
Determining the degree of methylation of the specific DNA region of the subject according to the method described in [5] above;
A method comprising the step of comparing the determined degree of methylation of a specific DNA region of a subject with the degree of methylation of a healthy individual.

[9] A method for examining the susceptibility of a DNA methylation abnormality-related disease in a subject by single molecule fluorescence analysis,
Determining the degree of methylation of the entire genomic DNA of the subject according to the method described in [1] above;
Determining the degree of methylation of the specific DNA region of the subject according to the method described in [5] above;
The methylation degree determined according to the method described in [1] is compared with the methylation degree of a healthy individual, and the methylation degree determined according to the method described in [5] A method comprising the step of comparing with the degree of conversion.

  [10] The method according to any one of [7] to [9], wherein in the comparison step, there is a significant difference between the methylation degree of the subject and the methylation degree of a healthy individual. A method, further comprising the step of determining that the subject is likely to suffer from a DNA methylation abnormality-related disease when recognized.

  [11] The method according to any one of [7] to [9] above, wherein the DNA methylation abnormality-related disease is cancer.

[12] A method for testing the efficacy of a demethylating agent in a subject,
Administering a demethylating agent to a subject or subject sample;
Determining the degree of methylation of the subject or the whole genomic DNA derived from the subject sample according to the method described in [1] before and after the administration,
A step of determining that the premethylation agent prescription is effective for the subject when the degree of methylation of the genomic DNA of the subject after administration is lower than the degree of methylation of the genomic DNA of the subject before administration. A method comprising the steps of:

[13] A test method for responsiveness of a demethylating agent in a subject,
Determining the degree of methylation of the specific DNA region of the subject according to the method described in [5] above;
A step of determining that the demethylating agent prescription is effective for the subject when the determined degree of methylation of the specific DNA region of the subject is higher than the degree of methylation of the particular DNA region of a healthy individual A method comprising the steps of:

[14] A method for testing the efficacy of a demethylating agent in a subject,
Administering a demethylating agent to a subject or subject sample;
A step of determining the degree of methylation of a subject or a specific DNA region derived from a subject sample according to the method described in [5] before and after the administration; and
When the methylation degree of the specific DNA region of the subject after administration is lower than the methylation degree of the specific DNA region of the subject before administration, it is judged that the premethylation agent prescription is effective for the subject. A method comprising the step of:

  According to the method of the present invention, the methylation degree of DNA can be quantitatively determined. The method of the present invention is simple, can be performed in a short time, and the measurement cost is low. In addition, the method of the present invention is suitable for determining the degree of methylation of the entire genomic DNA.

  The method of the present invention can be applied to the examination of the susceptibility of a DNA methylation abnormality-related disease (for example, cancer) in a subject and the diagnosis of such a disease. In addition, the method of the present invention can be applied to the examination of the responsiveness of the demethylating agent in the subject and the examination of the efficacy (ease of effectiveness) of the demethylating agent.

The schematic diagram which shows an example of the "determination method of the methylation degree of the whole genomic DNA by the single molecule fluorescence analysis method" of this invention. The photograph (Example 1) which shows the electrophoresis result of the genomic DNA processed with the enzyme MseI. The figure which shows the result of the binding inhibition experiment of the genomic DNA using the unlabeled MBD2 and the fluorescence labeled MBD2 (Example 2). The figure which shows the result of the bisulfite sequencing of the CpG island in the promoter region of p15 and p16 genes in 0% methylated control DNA (Example 3). The figure which shows the result of the bisulfite sequencing of the CpG island in the promoter region of p15 and p16 genes in 100% methylated control DNA (Example 3). The figure which shows the translational diffusion time of 0% methylation control DNA, 50% methylation control DNA, and 100% methylation control DNA (Example 3). The figure which shows the methylation rate of the genomic DNA computed according to the method of this invention (Example 4). (Example 4) which shows the result of the methylation array analysis of the genomic DNA by a conventional method. The schematic diagram which shows an example of the "determination method of the methylation degree of the specific DNA area | region by a single molecule fluorescence analysis method" of this invention. The figure which shows the methylation rate of the specific DNA area | region calculated according to the method of this invention (Example 5). The figure which shows the result of the bisulfite sequencing of the specific DNA area | region by a conventional method (Example 5). The figure which shows the methylation rate of the genomic DNA derived from an acute leukemia (AML) patient and a healthy person (Example 6).

  The present invention is described in detail below, but the following description is intended to illustrate the present invention and is not intended to limit the present invention.

1. Method for determining the degree of methylation of the entire genomic DNA The “method for determining the degree of methylation of the entire genomic DNA by single molecule fluorescence analysis” of the present invention is as follows.
(1) a step of fragmenting genomic DNA collected from a subject by restriction enzyme treatment to obtain fragmented genomic DNA;
(2) reacting fragmented genomic DNA with fluorescently labeled methylated DNA binding protein;
(3) measuring the fluorescence intensity of the fluorescent molecules in the reaction solution by single molecule fluorescence analysis, and determining the translational diffusion time of the fluorescent molecules;
(4) A step of determining the degree of methylation of the entire genomic DNA from the obtained translational diffusion time is included.

  An example of the above method is schematically shown in FIG. This will be described below with reference to FIG. In FIG. 1, methylated sites of genomic DNA (gDNA) are indicated by black circles, and unmethylated sites are indicated by white circles. (1) Genomic DNA is fragmented into fragments of various lengths by restriction enzyme MseI treatment (MseI treatment). (2) The fragmented DNA is reacted with a fluorescently labeled methylated DNA binding protein (TAMRA-MBD2). Here, the methylated DNA binding protein (fluorescent molecule) specifically binds to the methylated site of genomic DNA. (3) The fluorescence intensity of the fluorescent molecules in the reaction solution is measured by a single-molecule detection system, and the translational diffusion time of the fluorescent molecules is determined. Here, when a methylated DNA binding protein (fluorescent molecule) binds to a methylated site of methylated DNA, the molecular weight of the fluorescent molecule increases and the translational diffusion time of the fluorescent molecule increases. (4) Based on the obtained translational diffusion time, the methylation rate of genomic DNA is determined.

  In the present specification, “degree of methylation” and “methylation rate” are used synonymously.

  Hereinafter, each process of said (1)-(4) is demonstrated.

(1) Fragmentation Step In the present invention, the subject is an arbitrary organism for which the degree of DNA methylation is to be determined, preferably a mammal, more preferably a human. Collection of genomic DNA from a subject is a known technique from any tissue (for example, blood, oral mucosal cells, urine, affected tissue and surrounding tissues, bone marrow samples, and primary cultured cells of cells collected from the subject). Can be done according to. In the case of a human subject, the tissue is preferably one that can be collected with little pain.

  The collected genomic DNA is fragmented by restriction enzyme treatment. Any restriction enzyme can be used as long as it is a restriction enzyme that does not cleave DNA methylation site (CpG sequence), that is, a restriction enzyme having a recognition site other than the CpG sequence. The restriction enzyme is preferably MseI or Tru9 I (both have a recognition sequence of TTAA). It has been confirmed in the present invention that a DNA fragment (about 200 to 800 bp) obtained by treatment with these restriction enzymes can provide a stable measurement value (translational diffusion time) of single molecule fluorescence analysis.

  In the fragmentation step, a DNA fragment preferably having a size of about 200 to 800 bp is obtained. The fragmentation size described above exemplifies a preferable range as a size that causes an increase in the molecular weight of the methylated DNA binding protein (fluorescent molecule), and is not limited to such a size.

  A restriction enzyme treatment for obtaining a DNA fragment of a desired size is performed by, for example, reacting 500 ng of genomic DNA with a restriction enzyme at a final concentration of 2.5 U / μl at 37 ° C. for 12 to 15 hours. Can be done. If necessary, processing conditions may be set so that a DNA fragment of a desired size can be obtained.

(2) Reaction step The genomic DNA fragment obtained in the step (1) is reacted with a fluorescently labeled methylated DNA binding protein. Here, a genomic DNA fragment having a methylation site binds to a methylated DNA binding protein, but a genomic DNA fragment not having a methylation site does not bind to the methylated DNA binding protein.

  The methylated DNA-binding protein used here is a protein known to specifically recognize and bind to methylated cytosine of the CpG sequence. In this technical field, MeCP2, MBD1, MBD2 (Methyl- CpG binding domain protein 2), MBD3, MBD4 and the like are known.

  Fluorescent labeling of methylated DNA binding protein can be performed using any commercially available fluorescent substance, and TAMRA or the like can be used as the fluorescent substance. For convenience, TAMRA-labeled MBD2 available from Protein Express Co., Ltd. can be used. Alternatively, TAMRA-labeled MBD2 may be prepared using a protein pinpoint fluorescent labeling kit (Olympus).

  The reaction can be performed by allowing to stand in an appropriate buffer, for example, at 15 to 22 ° C. (room temperature) for 20 minutes. As shown in Example 2 described below, 1 to 50 ng of fragmented genomic DNA can be reacted with 5 nM of fluorescently labeled methylated DNA binding protein. It should be noted that, when comparing the methylation degree of a healthy individual (control) and a subject, it is preferable to adopt the same reaction condition between the two, and the methylation degree of the same subject over time. When examining changes, it is preferable to adopt the same reaction conditions throughout the examination.

(3) Measurement step The fluorescence intensity of the fluorescent molecule in the reaction solution is measured by single molecule fluorescence analysis to determine the translational diffusion time of the fluorescent molecule.

Single molecule fluorescence analysis measures fluctuation motion in the medium of target molecules labeled with fluorescence in a small confocal region (measurement region) of f (10 ^-15 ) L order excited by laser light irradiation. This is a known technique for calculating physical quantities such as the number and size of molecules by analysis using an autocorrelation function (Masataka Kaneshiro, “Single molecule detection by fluorescence correlation spectroscopy”, Protein Nucleic Acid Enzyme, Vol. 44 No.9 (1999) p.1431-1446). In single-molecule fluorescence analysis, the smaller the fluorescent molecule, the faster the fluctuation movement speed, the smaller the translational diffusion time obtained by the analysis, the larger the fluorescent molecule, the slower the fluctuation movement speed, and the larger the translational diffusion time obtained by the analysis .

  The measurement by single molecule fluorescence analysis can be performed by a commercially available single molecule fluorescence analysis system. As in Examples described later, measurement conditions such as laser irradiation conditions can be set as appropriate. For example, the laser irradiation time can be 5 to 15 seconds and the number of irradiation times can be 5 to 15 times. As in the examples described later, the measurement reliability can be improved by performing the measurement a plurality of times by laser irradiation a plurality of times. However, when the irradiation time is lengthened (15 seconds), it is preferable to set the number of irradiations to be small and the laser irradiation time to be about 1 minute 30 seconds in total. As shown in Examples 1 and 5 described later, in the measurement of the degree of methylation of the entire genomic DNA (mixture of DNA fragments of various sizes), more stable data can be obtained by setting a shorter irradiation time (5 seconds). In the measurement of the degree of methylation of a specific DNA region, more stable data can be obtained by increasing the irradiation time (15 seconds).

(4) Quantification process The methylation rate of genomic DNA is determined from the translational diffusion time data obtained in the measurement process.

  Here, in order to determine the methylation rate of genomic DNA from the translational diffusion time, reference DNA samples having various methylation degrees are prepared in advance, the translational diffusion time is obtained for each, and the translational diffusion time and the methylation degree are determined. The correlation is determined beforehand. Preferably, for quantification, a plurality of types of control DNAs having a known methylation degree are prepared, and a calibration curve is prepared. In Example 3 to be described later, three types of calibration curves are prepared by preparing three types of 0% methylated control DNA, 50% methylated control DNA, and 100% methylated control DNA, but the invention is not limited to this.

The translational diffusion time of the sample DNA can be applied to the following equation to determine the percent methylation of the sample DNA:
Formula: methylation rate of sample DNA (%) = {(translational diffusion time of sample DNA-0% translational diffusion time of methylated control DNA) / (translational diffusion time of 100% methylated control DNA-0% methylation control DNA translational diffusion time)} × 100.

2. Method for Determining Degree of Methylation of Specific DNA Region As described in the Background Art section, in addition to hypomethylation of the entire genomic DNA, cancer cells show high methylation of CpG islands in the promoter region of tumor suppressor genes. This hypermethylation is involved in carcinogenesis by inactivating the tumor suppressor gene. Therefore, in addition to determining the degree of methylation of the entire genomic DNA, it is also important to determine the degree of methylation of specific DNA regions that are known to be methylated in connection with disease. Therefore, the present invention provides a “method for determining the degree of methylation of a specific DNA region known to be methylated in connection with a disease by single molecule fluorescence analysis”.

That is, the “method for determining the degree of methylation of a specific DNA region by single molecule fluorescence analysis” of the present invention is:
(1) performing bisulfite conversion on genomic DNA collected from a subject, converting unmethylated cytosine to uracil, and maintaining methylated cytosine unconverted;
(2) amplifying a specific DNA region known to be methylated in association with a disease to obtain an amplification product;
(3) a step of methylating the CpG sequence of the amplification product;
(4) a step of reacting DNA after methylation treatment with fluorescently labeled methylated DNA binding protein;
(5) measuring the fluorescence intensity of the fluorescent molecules in the reaction solution by single molecule fluorescence analysis, and determining the translational diffusion time of the fluorescent molecules;
(6) A step of determining a methylation degree of a specific DNA region from the obtained translational diffusion time is included.

  An example of the above method is schematically shown in FIG. 9 (see Example 5 described later). This will be described below with reference to FIG. In FIG. 9, methylated sites of genomic DNA (gDNA) are indicated by black circles, and unmethylated sites are indicated by white circles. (1) Bisulfite conversion is performed on genomic DNA (Bisulfite modification). By bisulfite conversion, only unmethylated cytosine is converted to uracil, and methylated cytosine remains unconverted. Since uracil is read as thymine in sequencing, uracil is indicated by “T” in FIG. (2) Amplify the promoter region (300 bp) of the human p16 / INK4a gene by PCR. It is known that the CpG site in the promoter region of the human p16 / INK4a gene is hypermethylated in tumor cells. As shown in FIG. 9, since the methylation modification of the CpG site is lost by PCR, the CpG site of the amplification product is not methylated. (3) The PCR amplification product is treated with an enzyme M.SssI that specifically methylates the CpG sequence to methylate the CpG sequence of the PCR amplification product. (4) The methylated DNA is reacted with a fluorescently labeled methylated DNA binding protein (TAMRA-MBD2). Here, the methylated DNA binding protein (fluorescent molecule) specifically binds to the methylation site of DNA. (5) The fluorescence intensity of the fluorescent molecules in the reaction solution is measured by a single-molecule detection system, and the translational diffusion time of the fluorescent molecules is determined. Here, when a methylated DNA binding protein (fluorescent molecule) binds to a methylated site of DNA, the molecular weight of the fluorescent molecule increases and the translational diffusion time of the fluorescent molecule increases. (6) The DNA methylation rate is determined based on the obtained translational diffusion time.

  Hereinafter, each process of said (1)-(6) is demonstrated.

  The bisulfite conversion of (1) can be performed according to a known method using a commercially available kit such as EpiTect Bisulfite Kit (Qiagen).

In the step (2), “a specific DNA region known to be methylated in association with a disease” is, for example, a DNA region (CpG island) that is specifically hypermethylated in association with cancer. And more specifically,
a) Tumor suppressor gene promoter region (for example, p16, p15, p53, CDH1, MLH1, RB, BRCA1, TSLC1, RUNX3 gene promoter region);
b) a cell cycle checkpoint gene;
c) Apoptosis-related genes and the like.

  The above-mentioned specific DNA region can be amplified by a PCR reaction using a known primer or an appropriately designed primer. In this step, the CpG site of the template DNA to be amplified is methylated, but the CpG site of the product obtained by amplification is not methylated.

  The methylation treatment in (3) can be performed with CpG methyltransferase, for example, M.SssI, which is an enzyme that methylates a CpG sequence. The methylation treatment can be performed, for example, by reacting at a temperature of 30 ° C. for 1 to 4 hours using CpG methyltransferase at a concentration of 0.2 U / μl. In the step (1), unmethylated cytosine is converted to uracil, and methylated cytosine is maintained unconverted. Therefore, the site methylated in this step is the methylated site of the original genomic DNA. The same.

  The reaction step of (4), the measurement step of (5), and the quantification step of (6) are described in steps (2) to (4) of the above-mentioned “method for determining the degree of methylation of the entire genomic DNA”, respectively. Can be referred to.

3. As described in the Background Art section, hypomethylation of the entire genomic DNA is involved in carcinogenesis by making the chromosome unstable, and hypermethylation of CpG islands inactivates tumor suppressor genes. It is known to be involved in carcinogenesis.

  Therefore, according to the method of the present invention, the methylation rate of DNA (entire genomic DNA or the above-mentioned specific DNA region) is determined, and whether or not the subject is susceptible to a DNA methylation abnormality-related disease based on this methylation rate ( Risk). That is, according to the method of the present invention, data relating to a DNA methylation abnormality-related disease in a subject can be obtained.

That is, the “method for testing the susceptibility of a DNA methylation abnormality-related disease” according to the present invention includes:
Determining the degree of methylation of the entire genomic DNA of the subject according to the “method for determining the degree of methylation of the whole genomic DNA” of the present invention;
Comparing the determined degree of methylation of the entire genomic DNA of the subject with the degree of methylation of the healthy individual, wherein the determined degree of methylation of the entire genomic DNA of the subject is a healthy individual. When the degree of methylation is significantly lower than that of the subject, the subject is likely to suffer from a DNA methylation abnormality related disease.

In addition, the “method for testing the susceptibility to diseases associated with abnormal DNA methylation” of the present invention includes:
Determining the methylation degree of the specific DNA region of the subject according to the “method for determining the methylation degree of the specific DNA region” of the present invention;
Comparing the determined degree of methylation of the specific DNA region of the subject with the degree of methylation of the healthy individual, wherein the determined degree of methylation of the specific DNA region of the subject is a healthy individual If the degree of methylation is significantly higher than that of the subject, the subject is prone to DNA methylation abnormality-related diseases.

Furthermore, the “method for testing the susceptibility to diseases associated with abnormal DNA methylation” of the present invention includes:
Determining the degree of methylation of the entire genomic DNA of the subject according to the “method for determining the degree of methylation of the whole genomic DNA” of the present invention;
Determining the methylation degree of the specific DNA region of the subject according to the “method for determining the methylation degree of the specific DNA region” of the present invention;
Comparing the determined degree of methylation of the entire genomic DNA with the degree of methylation of a healthy individual, and comparing the degree of methylation of the determined specific DNA region with the degree of methylation of a healthy individual, Thus, the determined methylation degree of the entire genomic DNA is significantly lower than that of a healthy individual, and the determined methylation degree of a specific DNA region is compared with that of a healthy individual. If the subject is significantly higher, the subject is likely to have a DNA methylation abnormality-related disease.

  “DNA methylation abnormality-related disease” means any disease known to be associated with DNA methylation abnormality, and any disease and CpG known to be associated with hypomethylation of genomic DNA. Includes any disease known to be associated with island hypermethylation.

  Disorders associated with abnormal DNA methylation are cancers (including both carcinomas and sarcomas), such as breast cancer, stomach cancer, colon cancer, prostate cancer, bladder cancer, glioma, leukemia, lymphoma, myeloma, myelodysplasia. Syndrome, oral cancer and the like.

  In this technical field, many relations between DNA methylation abnormality and cancer have been reported. For example, hypomethylation of genomic DNA and various cancers including lymphoma, hypermethylation of promoter region of p15 gene And the relationship between leukemia and hypermethylation of the promoter region of p16 gene and breast cancer, stomach cancer, colon cancer, prostate cancer, bladder cancer, glioma, lymphoma, tumor suppressor microRNA (non-coding RNA) (miR-124, miR-203, miR-34b) promoter region methylation abnormalities are known.

  In the examination method of the present invention, a sample may be selected according to the cancer to be examined. For example, in the case of leukemia examination, peripheral blood can be used as a sample, in the case of solid cancer examination, peripheral blood, or The affected tissue and surrounding tissues can be used as samples, urine can be used as a sample for bladder cancer, and bone marrow can be used as a sample for myelodysplastic syndrome and myeloma .

  In Example 6 described later, the relationship between genomic DNA hypomethylation and acute leukemia is shown. Therefore, by determining the degree of DNA methylation according to the method of the present invention, it is possible to examine the susceptibility to cancer.

  The “degree of methylation of healthy individuals” that serves as a criterion for determining whether or not a disease related to DNA methylation abnormality is likely to occur is the degree of methylation of healthy individuals of multiple individuals (for example, about 30 or more). Can be determined by calculating an average value. The methylation degree of a healthy individual can be determined in advance as a reference value.

  In the present invention, comparison between a subject and a healthy individual can be performed by examining whether or not the difference in methylation degree between the two is significant by a statistical method such as t-test or ROC analysis. it can.

  Thus, the method of the present invention is useful for diagnosis of cancer risk.

4). Method for testing responsiveness and efficacy of demethylating agent 4-1. First aspect: A demethylating agent is administered to a subject (any organism including human) or a sample derived from the subject, and before and after the administration, the above-described “1. Determination method of methylation degree of whole genomic DNA” The methylation rate of the entire genomic DNA is determined according to the above, and based on the change in the methylation rate, whether or not the demethylating agent prescription is effective for the subject, that is, the efficacy (effectiveness of the demethylating agent in the subject). Ease).

That is, the “method for testing the efficacy of the demethylating agent” of the present invention is:
Administering a demethylating agent to a subject or subject sample;
Before and after administration, determining the degree of methylation of the whole genomic DNA derived from the subject or the subject sample according to the “method for determining the degree of methylation of the whole genomic DNA” of the present invention;
A step of determining that the premethylation agent prescription is effective for the subject when the degree of methylation of the genomic DNA of the subject after administration is lower than the degree of methylation of the genomic DNA of the subject before administration. including.

  As the demethylating agent, a known demethylating agent used for treatment, such as 5-azacytidine, can be used in the dosage and administration used for treatment.

  In this test, a demethylating agent is administered to either the subject or the subject sample. When administered to a subject, it can be administered according to a known administration mode of a demethylating agent, and in the case of 5-azacytidine (trade name Vidaza, Pharmion), it can be administered by subcutaneous injection. When administered to a subject, the demethylating agent may be administered once, or may be administered multiple times after a predetermined period (for example, every other month). . As the subject sample, any cell (eg, affected cell) collected from the subject or a cell obtained by transferring a cell (eg, affected cell) collected from the subject to the culture system (primary culture system) can be used. . When administered to a subject cell, the demethylating agent is administered by repeating a cycle of culturing the subject cell in the presence of the demethylating agent, for example, for 3 to 5 days, once to several times. be able to.

  In this test method, the degree of methylation of the entire genomic DNA is determined before and after the administration of the demethylating agent, but multiple times over a predetermined period after administration (for example, one week when administered to a subject) The degree of methylation may be determined every time and when administered to a subject sample (for example, every day), and the degree of methylation of the entire genomic DNA may be monitored. In addition, when the demethylating agent is administered multiple times, the methylation degree may be determined before and after each administration, or methylation is performed for each before the first administration and after the last administration. The degree may be determined.

  Comparison between before administration and after administration can be performed by examining whether or not the difference in the degree of methylation between the two is significant by a statistical method such as t-test or ANOVA.

  When a demethylating agent was administered to a human subject sample that actually had hypomethylation of the entire genomic DNA, it was found that the demethylating agent prescription was effective, and the further genomic DNA It has been confirmed that crystallization is observed. This result is due to the fact that the sample is hypomethylated as a whole of the genomic DNA, but the specific DNA region is hypermethylated, so that the hypermethylated portion of the specific DNA region is demethylated. I think that.

  With this test method, it is possible to test the efficacy (ease of efficacy) of the demethylating agent for each patient, and even if the patient develops drug resistance to the demethylating agent, the decision is made to quickly switch to a different prescription. can do.

4-2. Second aspect In another aspect, the methylation rate of the specific DNA region is determined according to the above-mentioned "2. Determination method of the degree of methylation of the specific DNA region", and demethylation is performed for the subject based on the methylation rate. Whether the prescription of the agent is effective, that is, the responsiveness of the demethylating agent in the subject can be examined.

That is, the “method for examining the responsiveness of the demethylating agent” of the present invention is as follows.
Determining the methylation degree of the specific DNA region of the subject according to the “method for determining the methylation degree of the specific DNA region” of the present invention;
A step of determining that the demethylating agent prescription is effective for the subject when the determined degree of methylation of the specific DNA region of the subject is higher than the degree of methylation of the particular DNA region of a healthy individual including.

  Comparison between the subject and a healthy individual can be performed by examining whether or not the difference in the degree of methylation between the two is significant by a statistical method such as t-test or ROC analysis. The “methylation degree of healthy individuals” is as described above.

  By this test method, it is possible to test in advance so as not to prescribe a demethylating agent to a patient whose hypermethylation has not occurred in a specific DNA region.

4-3. Third aspect In yet another aspect, a demethylating agent is administered to a subject (any organism including a human) or a sample derived from the subject, and before and after the administration, The methylation rate of a specific DNA region is determined according to the method for determining the degree of methylation of a region. Based on the change in the methylation rate, whether or not the demethylating agent prescription is effective for the subject, that is, in the subject The efficacy (ease of effectiveness) of the demethylating agent can be investigated.

That is, the “method for testing the efficacy of the demethylating agent” of the present invention is:
Administering a demethylating agent to a subject or subject sample;
Before and after the administration, determining the methylation degree of the specific DNA region derived from the subject or the subject sample according to the “method for determining the methylation degree of the specific DNA region” of the present invention;
When the methylation degree of the specific DNA region of the subject after administration is lower than the methylation degree of the specific DNA region of the subject before administration, it is judged that the premethylation agent prescription is effective for the subject. The process of carrying out is included.

  This aspect can be performed by replacing the “determination of the degree of methylation of the entire genomic DNA” in the first aspect with “determination of the degree of methylation of a specific DNA region”.

5. Advantages of the present invention Although “bisulfite sequencing”, which is a typical conventional method, is not suitable for the analysis of whole genomic DNA, “DNA methylation array” is not suitable for quantitative analysis of the whole genomic DNA. In contrast, the method of the present invention is superior in that the degree of methylation of the entire genomic DNA can be quantitatively determined.

  In addition, the method of the present invention is a simple method that can be measured in a short time, for example, about 30 minutes for DNA collection and extraction, about 12 hours for DNA fragmentation, reaction with fluorescent molecules, The measurement takes about 30 minutes and can be measured in a shorter time than the conventional method.

  In addition, the method of the present invention can be measured with a smaller amount of sample (for example, 500 ng genomic DNA as a starting material) than the conventional method.

  Further, the method of the present invention is cheaper in measurement cost than the conventional method. Specifically, the required reagent TAMRA-MBD2 (200,000 yen) can measure 300 samples, so it costs about 600 yen per sample.

  Furthermore, whereas the conventional “methylation array” uses bisulfite conversion for pretreatment, the method of the present invention can determine the degree of methylation of the entire genomic DNA without using bisulfite conversion. Therefore, it is excellent in that a genome-wide analysis result reflecting the methylation state of biological DNA can be obtained (see Example 4 described later).

  Regarding the determination of the degree of methylation of a specific DNA region, the method of the present invention can determine the degree of methylation with an accuracy comparable to that of the conventional method by a simpler method than the conventional method “bisulfite sequencing”. (See Example 5 described later).

Example 1: Experiment on fragmentation treatment Extraction of genomic DNA Genomic extraction was performed from a sample obtained by suspending a cultured cell (1 × 10 ⁷ cell) in 350 μl of a culture solution using a fully automatic genome extraction robot (Magtration System 6GC: Precision System Science).

2. Pretreatment of genomic DNA (fragmentation of genomic DNA)
As shown in Table 1 below, enzymes MseI (NEB) (2.5 U / μl) and BSA (bovine serum albumin, 100 μg / ml) that specifically recognize and cleave the TTAA sequence in the extracted genomic DNA (500 ng) ) Was added and treated overnight at 37 ° C.

  A part of the genomic DNA after the enzyme treatment was run on an agarose gel. The result is shown in FIG. FIG. 2a shows the experimental results of untreated genomic DNA, lane 1 shows untreated genomic DNA, and lane 2 shows marker DNA. FIG. 2b shows the experimental results of genomic DNA after MseI enzyme treatment, lane 1 shows genomic DNA after MseI enzyme treatment, and lane 2 shows marker DNA. From FIG. 2, it was confirmed that the genomic DNA was fragmented at 200-1000 bp.

  The genomic DNA after the enzyme treatment was purified using a purification column (QIAquick PCR Purification Kit: QIAGEN).

3. Reaction of genomic DNA after pretreatment with fluorescently labeled MBD2 As shown in Table 2 below, 5x binding buffer (50 mM Tris-HCl, 70 mM KCl, 1 mM EDTA, 0.007% 2-ME, 0.2 mg / ml BSA, 4 % Glycerol), fragmented genomic DNA (1ng-50ng) and fluorescent (TAMRA) -labeled MBD2 (5nM) were mixed and allowed to react at room temperature for 20 minutes.

4). FCS measurement Reaction solution, laser light of wavelength 543nm, output 100μW, single-molecule fluorescence analysis system MF20 (Olympus Co., Ltd.) under the conditions of irradiation time 15 seconds and irradiation frequency 5 times or irradiation time 5 seconds and irradiation frequency 15 times The translational diffusion time was determined by FCS (Fluorescence correlation spectroscopy) measurement.

5. Results Similar experiments were performed with genomic DNA pretreated (fragmented) and untreated, and the values of translational diffusion time (Diff. Time) and chi-square coefficient (Chi2) were determined. Table 4 shows. The amount of genomic DNA reacted with fluorescently labeled MBD2 was 1 ng, 10 ng, or 20 ng.

  When genomic DNA fragmented with MseI enzyme was used, the translational diffusion time was stable and the chi-square coefficient was small in the measurement of 15 times with laser irradiation for 5 seconds. Moreover, the average value of the translational diffusion time increased depending on the concentration of DNA. On the other hand, the translational diffusion time of untreated genomic DNA varied greatly in 15 measurements, and the chi-square coefficient also showed an abnormal value. Therefore, there was no change in translational diffusion time depending on the DNA concentration. From this, it can be seen that if the size of the DNA binding to MBD2 is too large, the sensitivity of the FCS measurement deteriorates, and it is important to adjust the size of the DNA. As a method for fragmenting DNA, there is fragmentation by an ultrasonic crusher in addition to the method using MseI restriction enzyme used in the present invention. However, it is difficult to adjust the DNA size uniformly between samples because the output adjustment of the ultrasonic wave differs depending on the ultrasonic crusher to be used or the examination of conditions such as crushing time is necessary. Therefore, it is suitable to fragment genomic DNA with MseI for pretreatment when the binding of crude genomic DNA and protein is used for FCS measurement.

  In addition, laser irradiation conditions were examined under two conditions (irradiation time 15 seconds / irradiation frequency 5 times or irradiation time 5 seconds / irradiation frequency 15 times), but the irradiation time was longer than the conditions used in general FCS measurement. It was found that better results can be obtained by shortening.

Example 2: Competition experiment using unlabeled MBD2 protein Experimental Method After the genomic DNA was pretreated (fragmented) and purified in the same manner as in Example 1, the unlabeled MBD2 protein was added to the reaction system of Example 1 at a high concentration (see Table 5 below). 500 nM) and allowed to react at room temperature for 20 minutes.

  The reaction solution was subjected to FCS measurement with a single-molecule fluorescence analysis system MF20 (manufactured by Olympus Corporation) under the conditions of a laser beam with a wavelength of 543 nm and an output of 100 μW for an irradiation time of 5 seconds and a number of irradiations of 15 times to determine the translational diffusion time.

2. Results FIG. 3 shows the translational diffusion time in a binding inhibition experiment between genomic DNA and fluorescently labeled MBD2 using unlabeled MBD2. In FIG. 3, the case where unlabeled MBD2 is added is represented by “WT-MBD2 +”, and the case where unlabeled MBD2 is not added is represented by “WT-MBD2 −”. By adding a high concentration of unlabeled MBD2, the binding between fragmented genomic DNA and fluorescently labeled MBD2 is inhibited, and the translational diffusion time is shortened. That is, it can be said that the binding between the fragmented genomic DNA and the fluorescently labeled MBD2 is specific.

  FIG. 3 shows the translational diffusion time of the product reacted with 5 nM fluorescently labeled MBD2 by changing the fragmented genomic DNA (gDNA) concentration from 1 ng to 50 ng. Compared to the case of fluorescently labeled MBD2 alone (in the case of 0 ng of gDNA in FIG. 3), the translational diffusion time was increased when reacted with genomic DNA, confirming that MBD2 protein and genomic DNA were bound. Moreover, the translational diffusion time increased depending on the concentration of genomic DNA.

Example 3: Preparation of calibration curve for determination of methylation degree 1.0 Preparation of 0% methylated control DNA Using 10 ng of human-derived control genomic DNA (REPLI-Human Control Kit: QIAGEN), REPLI-g Mini Whole genome amplification reaction (Whole Genome Amplification) was performed using Kit (QIAGEN).

  0.5 μl was taken from the primary WGA product (total vol. = 50 μl), and the above Whole Genome Amplification was performed again (nested whole genome amplification).

  It was confirmed by bisulfite sequence that all cytosines at the CpG site were not methylated (FIG. 4). When genomic DNA is amplified by Phi29 DNA polymerase, cytosine methylation in the template DNA is not inherited. Therefore, the DNA methylation rate after WGA is 0%.

  FIG. 4 shows the results of bisulfite sequencing of CpG islands in the p15 and p16 gene promoter regions in 0% methylated control DNA. A circle indicates one CpG site. In the 0% methylated control DNA, all CpG sites analyzed by the sequence within the promoter region of the p15 and p16 genes were demethylated (open circles).

2. Preparation of 100% methylated control DNA As shown in Table 6 below, the nested WGA product (500 ng) was reacted with SssI enzyme (NEB) at 30 ° C. for 4 hours.

  Protein was removed using a purification column (QIAquick PCR Purification Kit: QIAGEN).

  It was confirmed by bisulfite sequence that all cytosines at the CpG site were methylated (FIG. 5). The SssI enzyme specifically recognizes and methylates cytosine at the CpG site. Therefore, the DNA methylation rate after the SssI enzyme treatment is 100%.

  FIG. 5 shows the results of bisulfite sequencing of CpG islands in the p15 and p16 gene promoter regions in 100% methylated control DNA. A circle indicates one CpG site. In the 100% methylated control DNA, all CpG sites analyzed by the sequence within the promoter region of the p15 and p16 genes were methylated (filled circles).

3. Preparation of calibration curve using sample with known methylation rate As shown in Table 7 below, 0% methylated control DNA, 100% methylated control DNA and 50% methylated as in the reaction system in the method of Example 1 Each of the control DNAs (samples obtained by mixing equal amounts of 0% methylated control DNA and 100% methylated control DNA) was allowed to react with fluorescently labeled MBD2 at room temperature for 20 minutes.

  The reaction solution was subjected to FCS measurement with a single-molecule fluorescence analysis system MF20 (manufactured by Olympus Corporation) under the conditions of a laser beam with a wavelength of 543 nm and an output of 100 μW for an irradiation time of 5 seconds and a number of irradiations of 15 times to determine the translational diffusion time.

4). Results FIG. 6 shows the translational diffusion times (Diff. Time) of 0% methylated control DNA, 50% methylated control DNA, and 100% methylated control DNA. The methylation rate can be obtained by substituting the value of translational diffusion time in genomic DNA whose methylation rate is unknown into the following equation.

  Formula: methylation rate of sample DNA (%) = {(translational diffusion time of sample DNA-0% translational diffusion time of methylated control DNA) / (translational diffusion time of 100% methylated control DNA-0% methylation control DNA translational diffusion time)} × 100.

In the above formula, the methylation rate is represented by a value in the range of 0 to 100, but may be represented by a value in the range of 0.00 to 1.00 by the following formula 2.
Formula 2: (Translational diffusion time of sample DNA—0% translational diffusion time of methylated control DNA) / (Translational diffusion time of 100% methylated control DNA—Translational diffusion time of methylated control DNA)

Example 4: Comparison of the method for determining the degree of methylation of genomic DNA using FCS measurement according to the present invention and the conventional method for methylation analysis (exhaustive genomic DNA methylation analysis using a methylation array) Calculation of genome-wide DNA methylation rate in cell lines treated with demethylating agent using FCS measurement
1 × 10 ⁶ cells / ml of U937 strain cells were cultured for 72 hours in the presence or absence of a demethylating agent (3 μM 5-azacytidine or 5 μM decitabine). Thereafter, the cells were recovered, genomic DNA (500 ng) was extracted in the same manner as in Example 1, pretreated with MseI enzyme (fragmentation), and column purified.

  In the same manner as in Example 1 (Table 2), fragmented genomic DNA (10 ng) and fluorescently labeled MBD2 were mixed and allowed to react at room temperature for 20 minutes. The reaction solution was subjected to FCS measurement with a single-molecule fluorescence analysis system MF20 (manufactured by Olympus Corporation) under the conditions of a laser beam with a wavelength of 543 nm and an output of 100 μW for an irradiation time of 5 seconds and a number of irradiations of 15 times to determine the translational diffusion time.

2. Analysis of genome-wide DNA methylation patterns in cell lines treated with demethylating agents using methylation arrays
1 × 10 ⁶ cells / ml of U937 strain cells were cultured for 72 hours in the presence or absence of a demethylating agent (3 μM 5-azacytidine or 5 μM decitabine). Thereafter, the cells were collected, and genomic DNA was extracted in the same manner as in Example 1.

  The DNA methylation patterns of demethylated and untreated samples were analyzed comprehensively (27,578 CpG sites) using a methylation array (HumanMethylation27 BeadChip, Illumina).

3. Results FIG. 7 shows the methylation rate calculated from the diffusion translation time of genomic DNA derived from U937 strain cells in the culture conditions in the presence and absence of a demethylating agent. FIG. 8 shows the result (heat map) of methylation array analysis of genomic DNA derived from U937 strain cells under the same culture conditions. 7 and 8, “U937_Mock” indicates a cell that was not treated with a demethylating agent, “U937_5AzaC” indicates a demethylating agent 5-azacytidine-treated cell, and “U937_DAC” indicates a demethylating agent. Decitabine treated cells are shown. From the results of FCS measurement, the genomic DNA of U937 cell line was about 85% methylation without treatment, about 15% with 5-azacytidine (5AzaC) and about 5% with decitabine (DAC) It can be confirmed that the methylation rate is reduced by the influence of the demethylating agent. In addition, in the comprehensive genome methylation analysis using the conventional methylation array, the methylation pattern was similarly changed (demethylation) due to the influence of the demethylating agent, and similar results were obtained. It will be.

  Comparing the present invention, which yields similar results in the analysis of genome-wide DNA methylation patterns, and the conventional methylation array, the present invention provides results that are simpler and less expensive than methylation arrays. Can be obtained. In addition, in the methylation array, a chemical treatment step called bisulfite conversion is included in the pretreatment, which may cause a bias in the result obtained by the conversion efficiency. However, the present invention is advantageous in that it uses crude genomic DNA as a material. .

Example 5: Comparison of methylation degree determination method for specific DNA region using FCS measurement according to the present invention and methylation analysis by conventional method (methylation analysis by bisulfite sequencing) Calculation of DNA methylation rate in specific CpG island in cell line treated with demethylating agent using FCS measurement FIG. 9 shows the procedure of the experimental method of this example and the outline of the product.

(1) 1 × 10 ⁶ cell / ml U937 strain cells were cultured for 72 hours in the presence or absence of a demethylating agent (3 μM 5-azacytidine or 5 μM decitabine). Thereafter, the cells were collected, and genomic DNA (gDNA) was extracted in the same manner as in Example 1.

(2) Genomic DNA was subjected to column purification in the same manner as in Example 1, followed by bisulfite conversion using EpiTect Bisulfite Kit (Qiagen).

(3) PCR amplification was performed using specific primers for the promoter region of the human p16INK4a gene (CDKN2A).

Forward primer: GAGGAGGGGTTGGTTGGTTATTAGAG (SEQ ID NO: 1)
Reverse primer: TACCTAATTCCAATTCCCCTACAAAC (SEQ ID NO: 2)
(4) The product after bisulfite conversion was reacted with SssI enzyme (NEB) at 30 ° C. for 4 hours.

(5) The product was subjected to agarose gel electrophoresis, and the target band (300 bp) was cut out and purified.

(6) In the same manner as in Example 1 (Table 2), DNA (10 ng) obtained by the above operation and fluorescently labeled MBD2 were mixed and allowed to react at room temperature for 20 minutes. The reaction solution was subjected to FCS measurement with a single-molecule fluorescence analysis system MF20 (manufactured by Olympus Corporation) under the conditions of irradiation with a laser beam having a wavelength of 543 nm and an output of 100 μW for 15 seconds and the number of irradiations of 5 times, and the translational diffusion time was determined.

2. Analysis of methylation by bisulfite sequencing PCR amplification was performed using the above bisulfite-converted DNA as a template and the above-described specific primer for the promoter region of the p16 gene. The PCR product was electrophoretically separated on a 1.5% agarose gel, extracted from the gel, and then subcloned into the pGEM T-Easy vector. The cloning vector was transformed into E. coli DH5α strain for cloning. Plasmid extraction was performed from each of the 5 colonies, and the sequence was determined with M13 sequence primer.

3. Results FIG. 10 shows the translational diffusion time (Diff.time) of the p16INK4a gene promoter region DNA of the U937 cell line under the culture conditions in the presence and absence of the demethylating agent. In FIG. 10, “TAMRA-MBD2” indicates fluorescently labeled MBD2 (ie, DNA 0 ng), “0% Methyl” indicates 0% methylated control DNA, and “100% Methyl” indicates 100% methylated control. DNA indicates “U937_Mock” indicates a cell sample not treated with a demethylating agent, “U937_5AzaC” indicates a demethylating agent 5-azacytidine treated cell sample, and “U937_DAC” indicates a demethylating agent. A decitabine treated cell sample is shown. It can be seen that the translational diffusion time is shortened by the treatment with the demethylating agent, and the methylation rate of the CpG site in the p16INK4a gene promoter region is reduced. FIG. 11 shows the result of analyzing the product sequence after bisulfite conversion of the promoter region according to the conventional method. In FIG. 11, “U937 Mock” indicates a cell that was not treated with a demethylating agent, “U937 5AzaC” indicates a cell that is treated with a demethylating agent 5-azacytidine, and “U937 DAC” indicates a demethylated agent. The agent decitabine treated cells are shown. As shown in FIG. 11, it is demethylated (white circle) due to the influence of a demethylating agent (5AzaC or DAC). In addition to analyzing genome-wide methylation patterns, the present invention can extract a specific DNA region and analyze the methylation rate. These results are the bilateral analysis method for methylation analysis of a specific region. Results similar to fight sequencing are obtained. In addition, the bisulfite sequencing takes about a week until results are obtained, whereas the present invention can be shortened to two days.

  The laser irradiation conditions were examined under two conditions (irradiation time 15 seconds / irradiation frequency 5 times or irradiation time 5 seconds / irradiation frequency 15 times), but in FCS measurement using DNA limited to a specific region, irradiation time 15 Good results were obtained under conditions of 2 seconds and 5 irradiations.

Example 6: Comparison of methylation rate in genomic DNA derived from peripheral blood of acute leukemia (AML) patients and genomic DNA derived from peripheral blood of healthy individuals Experimental Method Genomic DNA was extracted from peripheral blood of acute leukemia (AML) patients or peripheral blood of healthy individuals using a fully automatic genome extraction robot (Magtration System 6GC: Precision System Science) in the same manner as in Example 1. Pretreatment with enzyme (fragmentation) and column purification were performed.

  In the same manner as in Example 1 (Table 2), fragmented genomic DNA (10 ng) and fluorescently labeled MBD2 were mixed and allowed to react at room temperature for 20 minutes. The reaction solution was subjected to FCS measurement with a single-molecule fluorescence analysis system MF20 (manufactured by Olympus Corporation) under the conditions of a laser beam with a wavelength of 543 nm and an output of 100 μW for an irradiation time of 5 seconds and a number of irradiations of 15 times to determine the translational diffusion time.

2. Results FIG. 12 shows the methylation rate in genomic DNA from acute leukemia (AML) patients and healthy individuals. In FIG. 12, the methylation rate is significantly reduced in the genomic DNA of patients with acute leukemia compared to normal subjects (Normal). In the genomic DNA of cancer cells, a phenomenon is known that causes hypermethylation and genome-wide hypomethylation of CpG islands in promoter regions such as tumor suppressor genes. Hypermethylation of CpG islands is due to transcriptional inactivation of specific factors, and genome-wide hypomethylation is due to genomic instability. Also in this example, the genomic DNA of acute leukemia patients is hypomethylated, and it has been demonstrated that the detection of genome-wide hypomethylation according to the present invention can be clinically applied as a diagnostic marker.

Claims (6)

A method for determining the degree of methylation of whole genomic DNA by single molecule fluorescence analysis,
(1) a step of fragmenting genomic DNA collected from a subject by restriction enzyme treatment to obtain fragmented genomic DNA;
(2) reacting fragmented genomic DNA with fluorescently labeled methylated DNA binding protein;
(3) measuring the fluorescence intensity of the fluorescent molecules in the reaction solution by single molecule fluorescence analysis, and determining the translational diffusion time of the fluorescent molecules;
(4) A method comprising the step of determining the degree of methylation of the entire genomic DNA from the obtained translational diffusion time. The method according to claim 1, wherein in the step (4), the degree of methylation is obtained by the following formula 1.
Formula 1: Methylation rate of analyte sample DNA (%) = {(translational diffusion time of analyte sample DNA−0% translational diffusion time of methylated control DNA) / (translational diffusion time of 100% methylated control DNA− 0% methylated control DNA translational diffusion time)} × 100.   The method according to claim 1, wherein the restriction enzyme in the step (1) is MseI.   The method according to claim 1, wherein the methylated DNA binding protein in the step (2) is MBD2 (Methyl-CpG binding domain protein 2). A method for determining the degree of methylation of a specific DNA region by single molecule fluorescence analysis,
(1) performing bisulfite conversion on genomic DNA collected from a subject, converting unmethylated cytosine to uracil, and maintaining methylated cytosine unconverted;
(2) amplifying a specific DNA region known to be methylated in association with a disease to obtain an amplification product;
(3) a step of methylating the CpG sequence of the amplification product;
(4) a step of reacting DNA after methylation treatment with fluorescently labeled methylated DNA binding protein;
(5) measuring the fluorescence intensity of the fluorescent molecules in the reaction solution by single molecule fluorescence analysis, and determining the translational diffusion time of the fluorescent molecules;
(6) A method comprising the step of determining the degree of methylation of a specific DNA region from the obtained translational diffusion time.   6. The method according to claim 5, wherein the specific DNA region known to be methylated in connection with a disease is a promoter region of a tumor suppressor gene.

Images