JP4536588B2 - Diagnostic instrument for adult T-cell leukemia - Google Patents

Description

  The present invention relates to a diagnostic instrument used for diagnosis of adult T-cell leukemia, which is a type of leukemia. More specifically, the present invention relates to a diagnostic instrument for diagnosing adult T-cell leukemia by detecting TSLC1 produced in vivo during the pathogenesis of adult T-cell leukemia.

  Adult T-cell leukemia (hereinafter referred to as ATL) is a disease with a poor prognosis accompanied by organ invasion, and is known as a disease that is specifically seen in areas around southern Kyushu. ATL is a leukemia that occurs when T cells become malignant in lymphocytes and abruptly increase in lymph nodes and blood. As a basic disease, ATL is a human T-cell leukemia virus. virus type 1; hereinafter referred to as HTLV-1). This ATL has a long incubation period from the infection to HTLV-1 until the onset, and the treatment has not been completely established.

  Under such circumstances, diagnosis before onset is very important. Known ATL diagnosis methods include cell morphology, cell surface marker search, or the presence or absence of HTLV-1 genome insertion using the Southern method (see Non-Patent Documents 1 and 2). However, these methods are diagnoses after the onset of ATL, and it is impossible to diagnose the pre-stage before the onset.

Shiro Miwa, Nobuo Aoki, Akira Shibata “Hematology” 2nd edition, P1081-1089, Bunkodo “Adult T-cell leukemia / lymphoma”, director of Keiju Hospital, edited by Kenichiro Kinoshita

  An object of the present invention is to provide a diagnostic instrument for diagnosing adult T-cell leukemia that can be effectively used in clinical settings in terms of rapidity and simplicity in view of the above-described actual situation.

  As a result of intensive studies to achieve the above-mentioned object, the present inventors have produced an antibody against TSLC1, more preferably the entire amino acid sequence of TSLC1 protein, or an extracellular domain consisting of amino acid sequences 1 to 373 in the amino acid sequence as an antigen. The present inventors have completed a diagnostic instrument for diagnosing adult T-cell leukemia having the prepared antibody.

That is, the present invention includes the following.
(1) A diagnostic instrument for adult T-cell leukemia having an antibody against TSLC1.
(2) The diagnostic instrument according to (1), wherein the antibody corresponding to TSLC1 is a monoclonal antibody or a polyclonal antibody.
(3) The diagnostic instrument according to (2), wherein the monoclonal antibody or the polyclonal antibody is immobilized on a reaction membrane or insoluble particles.
(4) the antibody hybridoma l-lOC-6G (consignment number: FERM P -20529), 3-10C- 4D ( consignment numbers: FERM P -20.53 thousand) and 4-5F-6F (commissioned Number: The diagnostic instrument according to (1), which is produced by at least one hybridoma selected from the group consisting of FERM P- 20531).

  According to the invention of (2) above, by immobilizing an antibody on a carrier or reaction membrane, TSLC1 in serum can be selectively captured, and the presence or absence of TSLC1 can be more reliably determined.

  By the way, conventionally, as a method for detecting proteins in blood, an immune reaction system using a specific antibody such as an enzyme immunoassay (EIA method), a fluorescent antibody method (FA method), a Western blot method (WB method) or the like is generally used. Used. When these methods are applied to detect the presence and concentration level of TSLC1, an expensive instrument such as an immunoreader or a fluorescence microscope is required for detection, both of which require specialized techniques. . According to the invention of (3) above, it is possible to provide a diagnostic instrument that can be used more quickly and more easily in the clinical field without the need for special equipment when detecting the presence and concentration level of TSLC1. .

  ADVANTAGE OF THE INVENTION According to this invention, the diagnostic instrument which can be used for the diagnosis of adult T cell leukemia can be provided. According to the diagnostic instrument to which the present invention is applied, it is possible to diagnose from the onset stage of adult T-cell leukemia.

  Hereinafter, the present invention will be described in detail.

Antibodies that can be used in the present invention The antibodies that can be used in the present invention are not particularly limited as long as they are antibodies that specifically recognize the TSLC1 protein (hereinafter referred to as TSLC1 antibodies). The TSLC1 antibody may be a monoclonal antibody or a polyclonal antibody. The TSLC1 antibody can be prepared using a conventionally known method. The TSLC1 antibody can be produced using the TSLC1 protein as an immunizing antigen or a partial peptide consisting of the entire amino acid sequence of the TSLC1 protein prepared by a recombinant DNA method or chemical synthesis, or the 1st to 373rd amino acid sequence. The amino acid sequence of TSLC1 protein is shown in SEQ ID NO: 1.

  For example, Escherichia coli BL21 transformed with a plasmid (pET28b / TSLC1) into which a gene encoding the first to 373rd amino acids of the amino acid sequence of TSLC1 protein has been incorporated is inoculated into LB medium and cultured at 37 ° C. The culture solution is treated with isopropyl-β-D-thiogatopyranoside to induce TSLC1 production and E. coli is recovered. After crushing the cells with a surfactant or ultrasonic wave, the sediment is collected, and the recombinant TSLC1 protein is separated and purified using a Ni-Sepharose column or the like.

  The 1st to 373rd amino acid sequences of the TSLC1 protein correspond to the extracellular domain of the TSLC1 protein. Therefore, antibodies produced using the 1st to 373rd antigens in the amino acid sequence of the TSLC1 protein can stain cells with fluorescent labels, etc., and can also be used as neutralizing antibodies to neutralize ligand binding There is sex.

  The polyclonal antibody is produced according to a conventional method. For example, for the production of an anti-TSLC1 polyclonal antibody, a rabbit is immunized with an equivalent mixture of purified TSLC1 protein 0.1-5 mg / ml and Freund's complete adjuvant, and after 2 weeks, TSLC1 protein 0.1-5 mg / ml and Freund's incomplete adjuvant are used again. Boost with the equivalent mixture of. Further, after 2 weeks, booster immunization is performed with an equivalent mixture of TSLC1 protein 0.1-5 mg / ml and Freund's incomplete adjuvant, and blood is collected 3-4 days after the final immunization. After serum separation, the serum fraction can be obtained as an anti-TSLC1 polyclonal antibody solution.

  In addition, TSLC1 monoclonal antibody is prepared according to a conventional method, and hybridoma is produced by cell fusion between an antibody-producing cell obtained from a mouse immunized with the separated and purified recombinant TSLC1 protein and a myeloma cell such as P3 (P3x63Ag8.653). The clone can be prepared by selecting a clone that produces an antibody that specifically reacts with TSLC1 from the hybridoma obtained.

As a method for collecting a monoclonal antibody from the obtained hybridoma, a method of culturing cells, an ascites formation method by intraperitoneal inoculation of mice, and the like are generally used. In the cell culture method, the hybridoma is cultured in a mouse cell culture medium such as RPMI-1640 medium containing 10-20% fetal bovine serum, MEM medium, or the like under normal culture conditions (for example, 37 ° C., 5% CO ₂ concentration). Culture for one day and obtain antibody from the culture supernatant. In the ascites formation method, a hybridoma is administered into the abdominal cavity of an animal of the same kind as a mammal derived from myeloma cells, and the hybridoma is proliferated in large quantities. Then, the ascites fluid obtained after 1 to 4 weeks is collected.

  From the ascites fluid obtained in the antibody collection method, an antibody is purified by appropriately selecting a known method such as ammonium sulfate salting-out method, ion exchange chromatography, affinity chromatography, or a combination thereof. For example, the antibody in the obtained antiserum is purified by 45% ammonium sulfate precipitation, and after centrifugation, the obtained precipitate is dissolved in physiological saline, and then in a phosphate buffer (0.1 mole / l, pH 7.0). After dialysis, use a salting-out antibody solution. A solution obtained by adsorbing this salting-out antibody solution to protein A and eluting with a citric acid solution (50 mmole / l, pH 2.0) is a purified monoclonal antibody solution.

  Note that mice and rats are widely used as mammals for immunizing antigens. Any method can be used for immunization as long as it is an existing method, but it is mainly carried out by intravenous injection, subcutaneous injection, intraperitoneal injection or the like. Immunization intervals are not particularly limited, and immunization is performed at intervals of several days to several weeks, preferably at intervals of 4 to 21 days.

  Further, in the above-described method, in order to confirm the immune response level of an animal such as an immunized mouse and to select a target hybridoma from cells after cell fusion treatment, the antibody titer in the blood of the immunized animal, or an antibody The antibody titer in the culture supernatant of the producer cell is measured. Examples of antibody detection methods include known techniques such as RIA (radioimmunoassay) and ELISA (enzyme-linked immunosorbent assay).

Diagnostic instrument comprising antibody A diagnostic instrument according to the present invention comprises an anti-TSLC1 monoclonal antibody or an anti-TSLC1 polyclonal antibody (hereinafter collectively referred to as an anti-TSLC1 antibody) prepared as described above, and contains TSLC1 protein contained in a specimen. Measure. As a method for easily and rapidly measuring TSLC1 protein, immunochromatography or particle immunoaggregation can be used. For example, in the immunochromatography method, nitrocellulose is preferably used as the reaction membrane for immobilizing the anti-TSLC1 antibody, but the type and material of the membrane are not limited as long as the carrier has an ability to adsorb proteins. Furthermore, a reaction membrane that does not have an adsorbing ability as it is can be used as a reaction membrane by introducing an amino group or a carboxyl group and chemically binding an anti-TSLC1 antibody. It is also possible to encapsulate antibody-bound particles adsorbed or reacted with fine particles such as latex in a reaction membrane.

  Further, the anti-TSLC1 antibody is preferably solid-phased linearly on the reaction membrane at a concentration of 0.1 to 5 mg / ml. After immobilization, it is also effective to suppress side reactions by soaking in bovine serum albumin or skim milk aqueous solution and blocking. As the labeling substance, colloidal gold particles are generally used, and colored latex particles may be used. In the case of colloidal gold particles, the particle size is preferably 20 to 100 nm, and for colored latex particles, a particle size of 0.05 to 0.5 μm is suitably used. Anti-TSLC1 antibody was adsorbed to these particles at a concentration of 10 to 1000 μg / ml in carbonate buffer (pH 9.0) and used. Furthermore, it is also possible to use an enzyme-labeled antibody with alkaline phosphatase or the like instead of the colored particles.

  As shown in FIG. 1, the diagnostic instrument includes a reaction membrane 1 cut into a rectangular shape, and a housing 2 that exposes one end and a middle portion of the reaction membrane 1 in the longitudinal direction. The casing 2 is formed with a sample dropping opening 3 that exposes one end of the reaction film 1 in the longitudinal direction. In addition, a determination unit 4 that exposes a midway portion of the reaction film 1 in the longitudinal direction is formed in the housing 2.

  A filter paper containing a labeled antibody is affixed to a portion of the reaction membrane 1 that is located in the sample dropping opening 3. Further, a water-absorbing filter paper is attached to one main surface of the reaction membrane following the filter paper containing the labeled antibody. The filter paper and water-absorbing filter paper containing these labeled antibodies are not shown in FIG. On the other hand, in the portion exposed from the determination unit 4 in the reaction film 1, a detection unit 5 is formed in which the anti-TSLC1 antibody is applied in a line shape in a direction orthogonal to the longitudinal direction of the reaction film 1.

  When the TSLC1 protein is detected using the thus configured diagnostic instrument, first, a sample to which an anticoagulant or the like is added is prepared. Here, serum or plasma is used as the specimen. Examples of the anticoagulant added to the specimen include heparin and EDTA, but are not limited thereto. Next, the specimen is dropped onto the reaction film 1 from the sample dropping opening 3. The specimen develops on the reaction membrane 1 and first reacts with the labeled antibody. Furthermore, it reacts with the anti-TSLC1 antibody part (detection part 5) in the central part of the reaction membrane 1 and moves to the absorption filter paper part, and the reaction is completed after 5 to 30 minutes.

  If TSLC1 protein is present in the sample, first, a complex with the labeled antibody is formed and captured by the detection unit 5 in the middle of the reaction membrane 1. The captured complex accumulates in the capture portion and takes on the color of the labeling substance, and the presence of TSLC1 protein can be confirmed visually. For example, in the case of colloidal gold label, a reddish purple line corresponding to the shape of the detection unit 5 appears. If the TSLC1 protein is not present in the sample, it does not form a complex with the labeled antibody and does not react with the antibody on the reaction membrane 1, so that there is no change in the membrane surface after the reaction.

  On the other hand, the diagnostic instrument according to the present invention is not limited to the configuration shown in FIG. 1, and may be a diagnostic instrument that measures the TSLC1 protein by applying the particle immunoagglutination method. In this case, the diagnostic instrument is composed of a solution containing insoluble particles in which an anti-TSLC1 antibody is immobilized. As the insoluble particles, white latex particles can be used. In this case, it is preferable to use homogeneous white latex particles having a diameter of 0.05 to 0.5 μm.

  When immobilizing the anti-TSLC1 antibody on the white latex particles, for example, the white latex particles are suspended in 0.2 M aminomethylpropanol-hydrochloric acid buffer (pH 8.0) to a concentration of 0.5 to 5%, and the anti-TSLC1 antibody is immobilized. The TSLC1 antibody is adjusted to a protein concentration of 0.05-5 mg / mL and reacted with an equal amount of 0.5-5% latex suspension at 37 ° C. for 1 hour. Then, centrifuge at 4000G for 20 minutes, and wash twice with 0.2M aminomethylpropanol-hydrochloric acid buffer (pH 8.0). Finally, 1% normal rabbit serum is added and suspended in 0.2 M aminomethylpropanol-hydrochloric acid buffer (pH 8.0) so that the latex particles have a concentration of 0.1 to 0.5%. In this way, a solution containing white latex particles in which an anti-TSLC1 antibody is immobilized can be prepared.

  When measuring the TSLC1 protein in a sample using the prepared solution, first, spread 2-3 drops of the prepared sample on a glass plate for reaction, and drop about 1 drop of the solution there. To do. Thereafter, for example, the reaction liquid on the glass plate is gently stirred by rotating the glass plate itself while inclining. Thereafter, the presence or absence of aggregation in the reaction solution is confirmed. If TSLC1 protein is present in the sample, an agglomerate is formed, otherwise it does not change.

  As described above, according to the diagnostic instrument of the present invention, the presence or absence of the TSLC1 protein in the sample can be determined easily and quickly. Therefore, the medical staff can use the diagnostic instrument according to the present invention to quickly and reliably diagnose adult T-cell leukemia in a clinical setting.

  EXAMPLES Hereinafter, although this invention is demonstrated in detail using an Example, the technical scope of this invention is not limited to a following example.

[Example 1] Preparation of TSLC1 protein solution for antigen First, TSLC1 was prepared by a plasmid (pET28b / TSLC1) incorporating a gene encoding the amino acid sequence from the 1st to the 373rd amino acid sequence of the TSLC1 protein by a recombinant DNA method. ) Was adjusted as follows.

  Amplification of TSLC1cDNA with pETNdeITSLC1 primer (gccatatgcagaatctgtttacgaaacac: SEQ ID NO: 2) and pETTSLC1XhoI primer (gcctcgagatccactgccctgatcgagcc: SEQ ID NO: 3), treatment with NdeI and XhoI restriction enzymes in pET-28b (+) N Inserted into the site.

  Next, E. coli BL21 was transformed with pET28b / TSLC1, inoculated into 10 mL of LB medium, and cultured overnight at 37 ° C. Inoculate 500 mL of LB medium, incubate at 25 ° C for several hours, induce the production of TSLC1 partial protein by treatment with isopropyl-β-D-thiogalactopyranoside at 600 nm absorbance around 0.5, and further culture overnight Thereafter, the cells were collected by centrifugation. After sonication treatment, the cells were suspended in 8M urea and gently stirred at 4 ° C. for 6 to 8 hours. The supernatant is collected by centrifugation, applied to a chelating Sepharose Ni column (Pharmacia), phosphate buffered saline (pH 7.5) containing 5 mM imidazole-8M urea, and phosphate buffered saline containing 100 mM imidazole (pH 7.5). The column was washed with pH 7.5) and eluted with phosphate buffered saline (pH 7.5) containing 700 mM imidazole. The eluted TSLC1 protein fraction was dialyzed into phosphate buffered saline (pH 7.5) containing 4M urea. The urea concentration in the dialysate was gradually lowered to finally 0, to obtain a TSLC1 protein solution.

[Example 2] Preparation of TSLC1 monoclonal antibody
The TSLC1 monoclonal antibody was prepared using the TSLC1 protein solution prepared in Example 1 as an antigen. The mice were injected intraperitoneally with TSLC1 protein solution and boosted at 2-week intervals. Two to three days after the final immunization, spleen cells and myeloma cells P3 (P3x63Ag8.653) were fused. In order to select a target hybridoma from the cells after cell fusion treatment, antibody-producing cells were selected by ELISA (enzyme linked immunoassay). From these cells, 1-10C-6G, 3-10C-4D and 4-5F-6F were obtained as clones having high anti-TSLC1 antibody production ability. The hybridomas 1-10C-6G, 3-10C-4D, and 4-5F-6F that were acquired are the National Institute of Advanced Industrial Science and Technology, Patent Biological Deposit Center (1-1-1 Higashi, Tsukuba City, Ibaraki Prefecture, 305-8566) in 2005 May 9, dated to 6), each consignment number: FERM P -20529, consignment number: FERM P -20530 and consignment number: was deposited as FERM P -20531.

[Example 3] Preparation of diagnostic instrument Culture supernatant obtained from anti-TSLC1 monoclonal antibody (from clones No. 1-10C-6G and 4-5F-6F) -producing hybridomas or ascites fluid was added to a phosphate buffer ( After dialysis to 0.1 mo1e / 1, pH 7.0), it was adsorbed to protein A and eluted with a citric acid solution (50 mmole / l, pH 2.0) to obtain a purified antibody solution.

  Of these, using an anti-TSLC1 antibody (clone No. 1-10C-6G) 1 mg / ml, a line was drawn in the direction perpendicular to the longitudinal direction at the approximate center of one main surface of the nitrocellulose membrane cut into a rectangular shape, After drying, it was immersed in a 1% skim milk solution for blocking. After drying, the antibody-coated surface was attached to the mount.

  Next, 100 ml of a gold colloid solution with a particle size of 50 nm is prepared with carbonate buffer to a final O.45 mM (pH 9.0), and anti-TSLC1 antibody (clone No. 4-5F-6F) (0.1 mg / ml) 6 ml Was added dropwise with gentle stirring. The mixture was reacted at room temperature for 30 minutes, and bovine serum albumin was added to a concentration of O.1%. Further, the mixture was stirred at room temperature for 20 minutes, and centrifuged at 6000 G for 30 minutes to collect the precipitate. This prepared a labeled antibody obtained by immobilizing anti-TSLC1 antibody (clone No. 4-5F-6F) on a gold colloid. Next, this precipitate was suspended in 5% sucrose solution supplemented with 2% bovine serum albumin to make 50 ml. The resulting solution was infiltrated into glass fiber filter paper and then dried. After drying, it was cut to a width of 1 cm and pasted so as to overlap the lower end side of one main surface of the nitrocellulose membrane.

  Further, a water-absorbing filter paper (which may be a general thick filter paper) was attached so as to overlap the upper end side of one main surface of the nitrocellulose membrane. These were cut to an appropriate width to obtain inspection sticks. This inspection stick was put into a case having an opening at the sample dripping opening and the determination portion to obtain a diagnostic instrument.

  In Example 3, a diagnostic instrument using clone No. 1-10C-6G as the anti-TSLC1 antibody and labeled antibody applied to the nitrocellulose membrane, and clone No. 4 as the anti-TSLC1 antibody and labeled antibody applied to the nitrocellulose membrane. Diagnostic instrument using -5F-6F and diagnostic instrument using No.4-5F-6F as anti-TSLC1 antibody applied to nitrocellulose membrane and clone No.1-10C-6G as labeled antibody Each was produced similarly.

Example 4
Using the four types of diagnostic instruments prepared in Example 3, detection of TSLC1 protein prepared from recombinant Escherichia coli (pET28b / TSLC1) was attempted. The results are shown in Table 1. As can be seen from Table 1, it was confirmed that in all the diagnostic instruments prepared in Example 3, only TSLC1 could be specifically detected, and it did not react with the vector plasmid, buffer solution or mouse serum.

判定：+ 陽性、- 陰性
*1：リン酸緩衝食塩液（pH7.2）
*2：プラスミド（pET28b）含有大腸菌（BL21）培養抽出物 1mg/mL
*3：プラスミド（pET28b）含有大腸菌（BL21）培養抽出物 キレートカラム吸着溶離物 1mg/mL
*4：正常マウス IgG 1mg/mL
*5：TSLC1 2μg/mL

Judgment: + positive,-negative
* 1: Phosphate buffered saline (pH 7.2)
* 2: Plasmid (pET28b) -containing Escherichia coli (BL21) culture extract 1 mg / mL
* 3: Escherichia coli (BL21) culture extract containing plasmid (pET28b) Chelate column adsorption eluate 1mg / mL
* 4: Normal mouse IgG 1mg / mL
* 5: TSLC1 2μg / mL

Example 5
Using the diagnostic instrument prepared in Example 3, the presence or absence of TSLC1 in the serum of ATL patients was measured. As comparative controls, healthy subjects and HTLV-1 carrier serum before onset were also measured. As a result, as shown in Table 2, healthy subjects were negative, but HTLV-1 carriers and ATL patients were positive for TSLC1 protein. The inspection results are shown in FIG.

Example 6
In Example 6, the presence of TSLC1 protein was examined by Western blotting using the serum used in Example 5.

  That is, 5 μL of each serum and 45 μL of PBS were mixed, and further 50 μL of SDS-PAGE sample buffer was added, followed by boiling at 100 ° C. for 10 minutes. After cooling, it was subjected to 10% SDS-PAGE and electrophoresis was performed at 20 to 40 mA for about 2 hours. After electrophoresis, it was transferred to a PVDF membrane at 170 mA and 5 V for 2 hours. A 1% skim milk aqueous solution was added to the transferred film, and blocking was performed for 30 minutes. Next, it was washed with 20 mM Tris-HCl (pH 7.5) -150 mM NaCl-0.05% Tween 20 (hereinafter abbreviated as T-TBS) and purified monoclonal antibody was added to T-TBS containing 0.1% skim milk at a rate of 1 mg / 50 mL. Added, soaked membrane and allowed to sensitize for 3 hours. Further, after washing with T-TBS several times, anti-mouse antibody alkaline phosphatase labeled antibody was added to T-TBS containing 0.1% skim milk at a ratio of 50 μL / 50 mL and sensitized for 1 hour. After washing, a color former was added, allowed to stand for several minutes and then developed to examine the presence or absence of reaction.

  The results are shown in FIG. As can be seen from FIG. 3, the TSLC1 protein that is 44 Kdalton was present in the serum that showed a positive reaction with the test device prepared in Example 3. From this result, it was proved that the diagnostic instrument produced in Example 3 was suitable for pre-onset diagnosis of adult T cell leukemia.

It is a top view which shows an example of the diagnostic instrument to which this invention is applied. It is a photograph which shows the result of having detected TSLC1 protein contained in serum with the diagnostic instrument to which this invention is applied. It is a photograph which shows the result of having detected TSLC1 protein contained in serum by the Western blotting method.

Explanation of symbols

DESCRIPTION OF SYMBOLS 1 ... Reaction film, 2 ... Housing | casing, 3 ... Sample dripping opening part, 4 ... Determination part, 5 ... Detection part

Claims (4)

HTLV-1 carrier or adult T cell obtained by immobilizing a monoclonal antibody or a polyclonal antibody produced using an extracellular domain consisting of the amino acid sequence 1 to 373 of TSLC1 as an antigen and the labeled antibody to a reaction membrane or an insoluble particle A diagnostic instrument for adult T-cell leukemia in leukemia patients . The diagnostic instrument according to claim 1, wherein the monoclonal antibody or polyclonal antibody is linearly immobilized on a nitrocellulose reaction membrane at a concentration of 0.1 to 5 mg / ml. The labeled antibody is one selected from the group consisting of gold colloid particles having a particle size of 20 to 100 nm and colored latex particles having a particle size of 0.05 to 0.5 μm, and the monoclonal antibody or polyclonal antibody is added at a concentration of 10 to 1000 μg / ml. The diagnostic instrument according to claim 1, which is attached. The above monoclonal antibodies or polyclonal antibodies are hybridomas 1-10C-6G (Accession Number: FERM-P-20529), 3-10C-4D (Accession Number: FERM-P-20530) and 4-5F-6F (Accession Number: The diagnostic instrument according to claim 1, which is produced by at least one hybridoma selected from the group consisting of FERM-P-20531).

Images