JP2023184046A - Highly sensitive single-cell analysis method with improved cell suspension for cell sorter - Google Patents

Abstract

To provide an apparatus and a method for performing single-cell gene expression analysis at low cost and with high sensitivity.SOLUTION: A single-cell analyze apparatus includes: a cell sorter that includes a channel for the introduction of a suspension including a plurality of cells and a selection device for selecting some of the plurality of cells; and a single-cell analysis device that includes a cell trap section that traps cells and a nucleic acid trap section that traps mRNA derived from the cells. The cell sorter and the single-cell analysis device can be disposed so that cells selected by the cell sorter are trapped by the cell trap section of the single-cell analysis device. The suspension introduced into the channel (a) includes protein but does not substantially have nuclease activity, or (b) does not include protein that includes a component having nuclease activity.SELECTED DRAWING: Figure 2

Description

The present invention relates to a single cell analysis device and a single cell analysis method. Specifically, the present invention relates to a single cell analysis device and a single cell analysis method based on a cell sorter and a single cell analysis device.

Single cell analysis is a technology that detects and quantifies biomolecules in each single cell with high precision. Various techniques have been developed for single cell analysis, but they can be divided into two main types. One is a technique represented by flow cytometry, which obtains information about individual cells through optical measurements of individual cells, and the other is a method of isolating and crushing cells and quantitatively analyzing the internal genes and proteins. be.

The first technology (flow cytometry) is the most mature technology capable of single-cell analysis. With this technology, cells labeled with a fluorescent antibody that selectively binds to the protein on the cell membrane that the user wants to analyze are passed through a flow channel, and the fluorescence generated when each cell is individually irradiated with laser light is measured. It has the function of Users can label multiple types of proteins on cell membranes with fluorophores that have different fluorescence wavelengths, and perform fluorescence measurements on the same cell at multiple wavelengths to determine the purpose of fluorescently labeling on the membrane of a single cell. The amount of membrane proteins present can be measured. Analysis using a flow cytometer has a limitation in that the number of biomolecules that can be quantified and measured on the same cell is limited. Recently, a technique has been developed to alleviate this problem, and a technique capable of measuring dozens of types of fluorescence has been developed (Non-Patent Document 1). However, the number of biomolecules that can be measured simultaneously is still only a few dozen, and since antibodies against biomolecules are used as fluorescent labels, the fluorescence intensity changes depending on the concentration of the fluorescent label (Non-Patent Document 2). There is a problem that quantification becomes unstable when the above biomolecule is unknown.

Various technologies have been proposed and developed for the second technology, but the focus of this invention is single-cell gene analysis, which involves disrupting each single cell and analyzing the mRNA in the eluted cells. This is an expression analysis method. Among these methods, the most basic method is to dispense a single cell into one resin container (tube), perform cell disruption, mRNA extraction, cDNA synthesis, nucleic acid amplification, tag insertion for next-generation DNA sequencer, etc. This is a method of performing NGS analysis (Non-Patent Documents 3 and 4). In addition, it is a method that executes the process of the above reaction up to nucleic acid amplification in a microfluidic device, and it is possible to automatically perform sample preparation from individual cells for up to 96 cells with one chip. It is possible (Non-Patent Document 5). Further, Patent Document 1 discloses a method for performing processes up to cDNA amplification or nucleic acid amplification on a device for a larger number of cells. In this method, a single cell is captured and isolated in a cell capture section, and a nucleic acid capture section placed directly below captures mRNA with tagged DNA immobilized on the surface of a bead or porous material. Insert a different tag for each cell and each mRNA molecule. Furthermore, by reverse transcription on the device, the tag sequence and gene sequence are synthesized as a single cDNA strand, and this cDNA is subjected to nucleic acid amplification and sequence analysis using a next-generation sequencer. The number of individual cDNA molecules can be counted by counting the measured reads for each cell identification tag and molecular identification tag. In particular, this method has high conversion efficiency from mRNA to cDNA, and allows for highly accurate approximate mRNA counting. Furthermore, in Non-Patent Document 3, cells are isolated by encapsulating cells and beads one by one in droplets (emulsions) in oil, and mRNA in individual cells is immobilized on the beads. This method inserts a different tag for each molecule in each cell by capturing it with DNA. The emulsion is then broken, the beads are collected, and reverse transcription, nucleic acid amplification, and tag insertion for next-generation sequencing are performed.

International publication WO2016/125251 A

S. P. Perfetto, et al., Nature Review Immunology, Vol. 4, pp. 648-655, 2004 S. Yamamoto et al., Drug metabolism and Pharmacokinetics, Volume 35, Pages 207-213, 2020 F. Tang et al., Nature Methods, Vol. 6, pp. 377-382, 2009 S. Islam et al., Genome Res, Vol. 21, pp. 1160-1167, 2011 D. Ramskold et al., Nat Biotechnol, Vol. 30, No. 8, pp. 777-782, 2012

Analysis of the cancer microenvironment is attracting attention in cancer research, particularly in clinical research on personalized medicine methods. This cancer microenvironment is composed of cancer cells, normal cells, and various immune cells, and for the purpose of functional analysis of these cells, a single Cell analysis is attracting attention. When applying single cell analysis to analyze such microenvironments, the problem arises that if flow cytometry alone is used, a sufficient number of biomolecules cannot be measured, and cells cannot be classified with sufficient resolution. On the other hand, when using only single cell analysis (gene expression analysis in a single cell), it is necessary to analyze a large number of cells (e.g., several thousand to 10,000 cells) existing in the cancer microenvironment, which requires high accuracy. In order to maintain this sensitivity, it costs several hundred to several thousand yen per cell, and the cost of reagents per analysis or test becomes too high, at several million yen or more. Therefore, in order to obtain useful biological information while suppressing costs, it is necessary to use a cell sorter using the principles of flow cytometry to collect target cells (e.g., whole T cells, CD8+ T cells alone, CD4+ T cells alone, myeloid cells, etc.). An effective method is to perform single-cell gene expression analysis after sorting all cell lines, macrophages alone, neutrophils alone, dendritic cells alone, etc.). In particular, in order to perform low-cost and highly sensitive single-cell gene expression analysis, it was thought that it would be effective to combine a cell sorter with a single-cell analysis device as described in Patent Document 1.

Conventionally, when performing this combination, operations including manual operations as shown in the flowchart of FIG. 1 have been required. That is, in order to introduce cells into a cell sorter, after blocking Fc receptors, target cells are labeled with a fluorescent antibody (Figure 1: Step 1), and excess antibody is washed away (Figure 1: Step 2). Next, the cells of interest are sorted using a cell sorter and collected (sorted) into a tube (Figure 1: Step 3). Next, centrifuge and exchange the buffer. After counting the number of cells, add an appropriate amount of buffer to achieve the desired cell concentration and resuspend (Figure 1: Step 4). Finally, dispense the cell suspension containing the appropriate number of cells onto the chip in the single cell analysis device (Figure 1: Step 5), completing preparations for operation on the device. A potential issue here is that when measuring the cell concentration after centrifugation in Step 4, there are at least 20,000 cells (e.g., 10 ⁶ cells/mL, 20 μL, or 5 × 10 ⁵ cells/mL, 40 μL). etc.) must be collected in the tube. If the number of cells is even smaller than this, the process of preparing a cell suspension with an appropriate concentration after centrifugation in Step 4 will prevent cell loss (non-specific adsorption of cells to plasticware (tubes and pipette tips), and (associated with removal of the supernatant) becomes serious, making it difficult to prepare a cell suspension with an appropriate concentration. Therefore, although it depends on the percentage of target cells to be sorted out of the analyzed cells, Step 3 often requires more than an hour for cell collection (sorting). The problem is that the longer it takes from the collection of a clinical sample to the reverse transcription reaction in a single cell analysis device, the more the amount of mRNA in cells changes (down-regulates) over time. Furthermore, the centrifugation and suspension operations after buffer exchange in Step 4 apply physical stress to the cells, so the physical stress in this step may further change (down-regulate) the amount of mRNA in the cells. There are also issues with a high risk of cell membrane breakdown (dead cells).

If dead cells are mixed in at this step, they will be dispensed into a single cell analysis device and analyzed, resulting in an increase in the background level due to the diffusion of mRNA from the dead cells into the solvent solution. , analysis occurs as an abnormal value on the data, which has a negative impact on single cell analysis data.

In order to solve the above problems, the present inventor attempted to directly capture and analyze cells output from the cell sorter with the single cell analysis device by incorporating a single cell analysis device into the cell sorter device. Due to this configuration, if a component of the protein contained in the cell suspension used in the cell sorter has nuclease activity (particularly RNase activity), analysis using a single cell analysis device may be adversely affected. We recognized new challenges and also tried to solve them. In this way, the present invention combines a cell sorter and a single cell analysis device as described in Patent Document 1, and solves the problems caused by the combination, thereby sorting a small percentage of cell groups with high precision and high resolution, Enables gene expression analysis at the single cell level.

One aspect of the present invention is a single cell analysis device, comprising:
a cell sorter equipped with a channel for introducing a suspension containing a plurality of cells and a selection device for selecting a part of the plurality of cells;
A single cell analysis device equipped with a cell trapping section that captures cells and a nucleic acid capturing section that captures mRNA derived from the cells,
The cell sorter and the single cell analysis device may be arranged so that the cells selected by the cell sorter are captured by the cell trapping section of the single cell analysis device,
The suspension introduced into the flow path is
(a) contains a protein, but the suspension has substantially no nuclease activity, or (b) does not contain a protein containing a component with nuclease activity;
The present invention relates to a single cell analysis device characterized by:

Another aspect of the invention is a single cell analysis method, comprising:
Introducing a suspension containing a plurality of cells into a flow path of a cell sorter and selecting a part of the plurality of cells;
capturing the selected cells in the cell capturing section of a single cell analysis device that includes a cell capturing section that captures cells and a nucleic acid capturing section that captures mRNA derived from the cells;
eluting mRNA from the captured cells and capturing it in the nucleic acid capture unit,
The suspension introduced into the flow path is
(a) contains a protein, but the suspension has substantially no nuclease activity, or (b) does not contain a protein containing a component with nuclease activity;
The present invention relates to a single cell analysis method characterized by the following.

The present invention provides a single cell analysis device and a single cell analysis method. The apparatus and method according to the present invention enable gene expression analysis at the single cell level by selecting a small proportion of cell groups with high accuracy and high resolution, and are useful for gene expression analysis, cell function analysis, and biological analysis. It is useful in fields such as tissue analysis methods, disease diagnosis, and drug discovery.

1 is a flowchart of a conventional method for performing gene expression analysis of a single cell using a cell sorter and a single cell analysis device. An example of the internal configuration of a cell sorter when a cell sorter and a single cell analysis device are directly connected is shown. It is a graph showing changes in reverse transcription efficiency depending on the FBS concentration contained in the cell suspension. After adding sheath liquid and culture medium (RPMI + 1% FBS) at a mixing ratio of 0 to 100% to the reverse transcription reaction solution of a certain amount of RNA molecules, the amount of cDNA synthesized by the reverse transcription reaction was investigated by qPCR quantification. This is a graph showing. Another example of the internal configuration of the cell sorter when the cell sorter and single cell analysis device are directly connected is shown. Another example of the internal configuration of the cell sorter when the cell sorter and single cell analysis device are directly connected is shown. 1 is a graph showing the results of single cell-derived gene expression analysis performed using the single cell analysis device and single cell analysis method of the example.

In one aspect, the present invention is a single cell analysis device, comprising:
a cell sorter equipped with a channel for introducing a suspension containing a plurality of cells and a selection device for selecting a part of the plurality of cells;
A single cell analysis device equipped with a cell trapping section that captures cells and a nucleic acid capturing section that captures mRNA derived from the cells,
The cell sorter and the single cell analysis device may be arranged so that the cells selected by the cell sorter are captured by the cell trapping section of the single cell analysis device,
The suspension introduced into the flow path is
(a) contains a protein, but the suspension has substantially no nuclease activity, or (b) does not contain a protein containing a component with nuclease activity;
A single cell analysis device is provided.

In another aspect, the invention provides a method for single cell analysis, comprising:
Introducing a suspension containing a plurality of cells into a flow path of a cell sorter and selecting a part of the plurality of cells;
capturing the selected cells in the cell capturing section of a single cell analysis device that includes a cell capturing section that captures cells and a nucleic acid capturing section that captures mRNA derived from the cells;
eluting mRNA from the captured cells and capturing it in the nucleic acid capture unit,
The suspension introduced into the flow path is
(a) contains a protein, but the suspension has substantially no nuclease activity, or (b) does not contain a protein containing a component with nuclease activity;
Provided is a single cell analysis method characterized by the following.

The single cell analysis device and the single cell analysis method (hereinafter also referred to as the present single cell analysis device and the present single cell analysis method) according to the present invention use a so-called cell sorter and a single cell analysis device. By incorporating a single cell analysis device into the device, cells output from the cell sorter can be sorted directly with the device. Therefore, the present single cell analysis device has a configuration in which the cell sorter and the single cell analysis device can be arranged so that the cells selected by the cell sorter are captured in the cell trapping section of the single cell analysis device. do. In this specification, this type of connection is referred to as a direct connection. For example, the cell sorter and the single cell analysis device can be moved by placing the single cell analysis device directly below the cell sorter, or by moving one or both of the cell sorter and the single cell analysis device using a moving mechanism (e.g., a movable stage). Can be connected directly. In a preferred embodiment, the selected cells are directly captured in the cell capture portion of the single cell analysis device without any other processing (eg, centrifugation, cell resuspension, etc.).

In this way, by incorporating a single cell analysis device into a cell sorter and sorting cells, the number of cells required for analysis is reduced, the time required for cell sorting is shortened, and the centrifugation process after sorting is reduced.・By omitting buffer exchange and cell resuspension (pipetting) operations, it is possible to prevent a decrease in mRNA expression level due to cell damage.

The cell sorter and single cell analysis device used in the present single cell analysis apparatus and the present single cell analysis method may be cell sorters and single cell analysis devices conventionally used in this technical field, and are not particularly limited. It's not a thing.

FIG. 2 shows an example of the internal configuration of a cell sorter when the cell sorter and a single cell analysis device are directly connected. There are two types of cell sorters: sense-in-chip type and jet-in-air type. These methods differ in the cell measurement position due to laser irradiation. In other words, with the sense-in chip, a laser is irradiated inside a transparent container called a chip or cuvette, and the fluorescence from the cells is measured, whereas with the jet-in-air type, cells are emitted from the chip into the air in a laminar flow. After being emitted, laser irradiation and measurement are performed. Although FIG. 2 shows the case of a sense-in-chip type, a jet-in-air type can also be used with the same configuration except for the configuration of the cell sorter device in that a single cell analysis device is directly connected.

The configuration of the direct connection shown in FIG. 2 will be explained. The container (tube) 1 for the cell suspension 2 in which the sample cells are suspended in a buffer is usually a disposable plastic container. By pressurizing this container, the cell suspension 2 passes through the insertion tube 5 and flows through the chip 6 in a laminar flow. At this time, the flow of the cell suspension must be narrowed within the chip in order to allow each cell to separate and flow through the cell suspension. In order to narrow down the flow of the cell suspension, the sheath liquid 4 must be flowed outside the flow of the cell suspension in the chip, so that the pressure applied to the sheath liquid is higher than the pressure applied to the cell suspension. It is known that it is necessary to make it larger. 3 is a container (tube) for the sheath liquid, and 4 is the sheath liquid (usually PBS buffer).

Cell sorters identify cells by irradiating cells with laser light and measuring the scattered light and fluorescence from the cells, and then sort the ejection direction of the cells for each identified cell type. In order to optically measure individual cells arranged in a line in the laminar flow of the cell suspension by the hydrodynamic constriction described above, the laser beam is directed through lens 8 to the center of the laminar flow of the cell suspension. Narrow it down to the narrowest size. The obtained scattered light (same wavelength as the laser beam) is also measured using a filter 9 (dichroic mirror or optical filter, e.g. bandpass filter) for fluorescence (different wavelength than the laser beam (usually on the long wavelength side)). The wavelength of signal light from the desired cell is selected, and the optical receiver 10 receives the pulsed optical signal. Although only one filter and light receiver are described here, multiple filters (dichroic mirrors) are placed along the direction of light propagation at the installation positions of multiple filters, and the light receivers are arranged at the corresponding positions. By doing so, it is possible to simultaneously measure multiple fluorescence wavelengths from individual cells. The light pulse intensity signal measured by the (multiple) light receivers is input to the signal amplifier/discriminator 11 to identify cells. The user decides what threshold value to use for identification. The cells that have been measured go straight through the chip, are further narrowed down, the flow rate is increased, and are ejected from the nozzle 12 together with the sheath liquid and cell suspension. The inner diameter of the nozzle is approximately 70 to 130 μm. In order to ensure that the injected cell solution forms stable droplets containing individual cells, a piezoelectric element 13 is used to control the injection direction with appropriate amplitude and high frequency (20-200kHz). vibrate the nozzle in a direction parallel to the Depending on the cell identification result, each droplet containing one cell is charged by applying a pulsed voltage to the sheath liquid (electrolyte) and cell suspension at the position immediately before injection from the nozzle. . The charged droplet is introduced into the target collection well 101 by changing the ejection direction of only the droplet 103 containing the desired cells by the deflection plate 14 to which a constant high voltage is applied. At this time, it is necessary to stabilize the flow rate by controlling the pressure applied to the sheath liquid and cell suspension, and to control the timing of the pulse voltage and the position where the droplet exits from the nozzle and is formed.

By controlling the ejection direction of the droplet containing the cell based on this cell identification, it can be dispensed into a desired well 101 on the single cell analysis device. In addition, droplets 104 of unnecessary cells are dispensed into a waste liquid container (tube) 102. Here is a single cell analysis device 105 having one or more wells 101, into each well of which cells identified by one or more cell sorters are dispensed. A single cell analysis device 105 and a waste liquid container (tube) 102 are fixed on a fixed adapter 107, and this adapter is fixed on an electric movable stage 108. In order to dispense cells into a plurality of wells, cells are dispensed into desired wells 101 by controlling the voltage applied to the deflection plate 14 and the position of the single cell analysis device using the motorized movable stage 108. Although FIG. 2 shows a configuration example in which one deflection plate 14 is installed, it is also possible to use a combination of a plurality of deflection plates, and such a configuration example is shown in FIG.

The present inventor recognized another problem during the development process of the single cell analysis device having the above configuration. For the suspension containing multiple cells, i.e. Cell Suspension 2, in order to reduce the percentage of dead cells as much as possible, add approximately 1-2% FBS (Fetal Bovine Serum) etc. to the cell suspension. proteins are often mixed together. This cell suspension is pooled in a cell suspension container (tube) 1 and introduced into the chip through an insertion tube 5. In particular, FBS is considered to be effective in suppressing adsorption of cells into the tube 1 and the insertion tube 5. In this case, a droplet containing a mixture of a cell suspension containing FBS and a sheath liquid is dispensed into a well of a single cell analysis device. When the cell membrane of cells dispensed into a well is disrupted with a cell lysis reagent, mRNA is extracted, and a reverse transcription reaction is performed on the device, reverse transcription efficiency may decrease if FBS contains substances that inhibit the reverse transcription reaction. descend. FIG. 3 is a graph showing changes in reverse transcription efficiency depending on the FBS concentration contained in the cell suspension. Briefly, 1 μL of RT probe-immobilized beads (φ1 μm, 7.5 × 10 ¹¹ RT probe/10 ⁷ beads/μL) was added to a PCR tube, the beads were captured with a magnet, and the supernatant was removed (n=9). . Add sheath fluid (Iso Flow, BECKMAN COULTER, #8546859), RPMI (Thermo Fisher, #21870-076) + 1% FBS (Thermo Fisher, #26140079), and RPMI (same as above) + 10% FBS (same as above) to these beads. 0.85 μL of each was added and mixed (n=3 each for 3 conditions). 1 μL of cRNA (10 ⁵ molecules/μL) was added to each of these bead mixed solutions and mixed. Subsequently, 3.15 μL of RT reagents (1 μL of 5xFS buffer, 0.25 μL of 0.1M DTT, 0.8 μL of 10mM dNTPs, 0.3 μL of 10% Tween20, 0.4 μL of RNase OUT, 0.4 μL of SuperScriptIII (ThermoFisher)) were added and incubated at 50 °C. Reverse transcription reaction was performed by incubating for 50 minutes. The amount of synthesized cDNA was evaluated by qPCR. The leftmost graph is when sheath liquid is used as the cell suspension buffer, the second from the left is when 1% FBS-containing medium (RPMI) is used as the cell suspension, and the rightmost graph is 10% FBS-containing medium (RPMI). The case using FBS-containing medium (RPMI) is shown. From FIG. 3, it can be seen that the reverse transcription efficiency decreases significantly as the FBS increases.

Furthermore, Figure 4 shows the ratio of sheath liquid and medium (RPMI + 1% FBS) in the reverse transcription reaction solution of a certain amount of RNA molecules (10 ⁵ molecules) (the horizontal axis indicates the mixing ratio of medium: 0 to 100%). This is a graph showing the results of qPCR quantitative analysis of the amount of cDNA synthesized by reverse transcription reaction after addition of different amounts of cDNA (RT-qPCR: Reverse Transcript-quantitative Polymerase Chain Reaction). Briefly, 1 μL of RT probe-immobilized beads (φ1 μm, 7.5×10 ¹¹ RT probe/10 ⁷ beads/μL) was added to a PCR tube, and after capturing the beads with a magnet, the supernatant was removed (n=33). . Add mixture #1 of sheath fluid (Iso Flow, BECKMAN COULTER, #8546859) and RPMI medium (Thermo Fisher, #21870-076) supplemented with 1% FBS (Thermo Fisher, #26140079) to these beads as shown in Table 1. Add 0.85 μL of ~5 to each (n = 6 for each mixture #1 ~ #4 in Table 1, and n = 9 for mixture #5) and store them under ice conditions (each n = 6 for mixture #1 ~ #5 in Table 1). n=3) and room temperature conditions (n=3 for each mixture #1 to #4, n=6 for mixture #5). 0.5 μL of RNase OUT was added to n=3 of mixture #5 under room temperature conditions.

1 μL of cRNA (10 ⁵ molecules/μL) was added to each of these bead mixed solutions and mixed. Subsequently, 3.15 μL of RT reagents (1 μL of 5xFS buffer, 0.25 μL of 0.1M DTT, 0.8 μL of 10mM dNTPs, 0.3 μL of 10% Tween20, 0.4 μL of RNase OUT, 0.4 μL of SuperScriptIII (ThermoFisher)) were added and incubated at 50 °C for 50 min. The reverse transcription reaction was performed by incubating for minutes. The amount of synthesized cDNA was evaluated by qPCR. The case where the reverse transcription reaction solution was prepared at room temperature is indicated by a black square, and the case where it was prepared at ice temperature is indicated by a black circle. It can be seen that the adverse effects of FBS derived from the medium are significantly alleviated by treatment at ice temperature. Also, the black triangle indicates the condition of 100% medium, but by adding an RNase inhibitor to the reverse transcription reaction solution, it can be improved to almost the same value as the cDNA quantification value under 0% condition without medium. I understand. This result shows that the cause of the negative effect of FBS in reducing the cDNA quantification value is the RNase activity in FBS, and that by suppressing this activity, it is possible to reduce the above negative effect.

Therefore, cell suspensions used in cell sorters generally often contain proteins such as FBS, and such proteins may contain components with nuclease activity. It has been found that in direct connection, it is desirable that the cell suspension has substantially no nuclease activity such as RNase. Therefore, the cell suspension used in this single cell analysis device or this single cell method is
(a) contains proteins, but the suspension has substantially no nuclease activity, or (b) does not contain proteins containing components with nuclease activity.

Here, "having substantially no nuclease activity" means that the nuclease activity is 80 to 100%, preferably 90 to 100%, more preferably 95 to 100% compared to the case where no treatment is performed. , more preferably 98 to 100% reduction. Further, the nuclease is at least one type selected from RNA degrading enzyme (RNase) and DNA degrading enzyme (DNase).

The protein contained in the cell suspension is not particularly limited as long as it is a protein that is conventionally used in cell sorter suspensions and contains a component with nuclease activity, such as fetal bovine serum (FBS). and bovine serum albumin (BSA).

In one embodiment, if the cell suspension contains (a) protein, but the suspension does not substantially have nuclease activity, the suspension is substantially free of nuclease activity; , the protein is subjected to a treatment to remove nucleases, such as purification. For example, highly purified proteins FBS and BSA that do not contain nucleases (RNase and DNase) are commercially available, and such proteins can be used.

In another embodiment, a substance that inhibits nuclease activity is incorporated into the suspension to render it substantially free of nuclease activity. Substances that inhibit nuclease activity are known in the art, and for example, a substance that does not affect the cells used can be selected from known RNase inhibitors and DNase inhibitors.

In yet another embodiment, the suspension is cooled to render it substantially free of nuclease activity. Nuclease activity is reduced at temperatures below about 5°C, preferably at ice-cold temperatures. Therefore, in the present single cell analysis device or the present single cell analysis method, problems caused by nuclease activity can be solved by cooling the suspension.

For example, when FBS is mixed with a cell suspension, an inhibitor for suppressing RNase activity in FBS is mixed in, or RNase is removed by purification or the like. Another method of mitigating the adverse effects is to keep the container for storing the cell suspension, the insertion tube for injecting the cell suspension into the chip, the sheath liquid, etc. in the device at ice temperature.

In addition, bovine serum albumin (BSA) is sometimes mixed into the cell suspension, but in this case too, an RNase inhibitor is added to reduce RNase activity, or the protein is unintentionally denatured by protein denaturation such as acetylation treatment. A method of suppressing the activity of mixed RNase or a method of purifying and removing RNase by column purification etc. can be applied.

Normally, the DNase activity in the FBS and BSA mentioned above is sufficiently low, but if the DNase activity is high, it is possible to remove the DNase by purifying it before mixing it with the cell suspension, or by mixing it with a DNase inhibitor. It is possible to suppress the degradation of immobilized DNA probes during cell analysis, and is expected to improve measurement efficiency. Further, when the measurement target is a DNA sequence, the above processing is even more important. Similarly, avoiding proteolytic enzymes in the cell suspension is important because proteins such as streptavidin used to immobilize DNA probes may be degraded and the DNA probes may be detached, leading to a decrease in mRNA capture efficiency and cDNA synthesis. It is possible to suppress a decrease in efficiency and a decrease in PCR efficiency.

Alternatively, if the cell suspension does not contain (b) a protein containing a component with nuclease activity, the above-mentioned problem due to nuclease activity does not occur.

As mentioned above, in this single cell analysis device and this single cell analysis method, the nuclease activity in the cell suspension used in the cell sorter is suppressed or the nuclease is removed. Contamination with nucleases (eg RNase) can be prevented. Therefore, mRNA eluted from cells dispensed directly from the cell sorter to a single cell analysis device is captured by the single cell analysis device without being degraded, enabling highly efficient cDNA synthesis. By analyzing this PCR-amplified sample with a next-generation DNA sequencer, highly efficient (that is, highly sensitive) molecular counting of mRNA can be achieved. In addition, by directly connecting the cell sorter and single cell analysis device, processing time and operations can be reduced, thereby suppressing mRNA degradation (downregulation of gene expression) caused by cell damage.

In this single cell analysis device and this single cell analysis method, cells selected by a cell sorter are captured in the cell capture section of the single cell analysis device, and after cell-derived mRNA is captured in the nucleic acid capture section, the cells are captured in the nucleic acid capture section. A reverse transcription reaction may be performed using the mRNA captured by the protein as a template.

The present invention will be specifically explained below by way of examples, but these examples are provided merely to explain the present invention, and do not limit or restrict the scope of the invention disclosed in this application. It's not something you can do.

[Example 1]
In this example, by directly connecting the single cell analysis device described in WO2016/125251A (Patent Document 1) to a sense-in-chip type cell sorter, centrifugation processing is omitted, and mRNA in cells before being introduced into the device is This is an example of a single cell analysis method that suppresses the decomposition of . At the same time, BSA (bovine serum albumin) from which RNase has been purified is used in the cell suspension to reduce the introduction of RNase into the single cell analysis device and degrade the mRNA captured in the single cell analysis device. This is an example of how cDNA can be synthesized from mRNA with high efficiency by suppressing this, and mRNA molecules can be counted with high efficiency (that is, with high sensitivity) using a next-generation DNA sequencer.

The following description of the configuration of the cell sorter shows the minimum configuration necessary to implement the method of this example, but the wavelength of the laser light source, the number of lasers, the number of filters, the number of light receivers, etc. Multiple configurations may be used. In addition, although identification using fluorescent labels is used to select cells here, the results of various optical measurements such as forward scattering, side scattering, various cell imaging, and nonlinear spectroscopy such as Raman spectroscopy and two-photon spectroscopy are also used. It can also be used as identification information.

FIG. 2 shows a configuration diagram of this embodiment. Here, the laser light source 7 used was an Ar+ multimode laser (488 nm, 514.5 nm). The laser light source is not limited to this, and other lasers such as semiconductor lasers may be used. For filter 9, a 550nm long-pass dichroic mirror and a 560nm±10nm bandpass filter were used. A PMT (Photo Multiplier Tube) was used as the photoreceiver 10. In addition, the chip 6 was a cuvette made of quartz, and the inside size was 300 μm square. The material of the chip is not limited to this, and other resins such as PMMA (polymethyl methacrylate) and COP (cyclopolyolefin polymer) with low fluorescence background may also be used.

Further, the inner diameter of the nozzle 12 was set to 100 μm, a voltage of ±3000 V was applied to the deflection plate 14, and the piezo element 13 was made to vibrate at 20 kHz in a direction parallel to the flow path. As a result, the droplet size obtained was 0.09 uL. Since 100 wells were used on the single cell analysis chip VFACs (Vertical Flow Array Chip) installed in one well of the single cell analysis device, 80 samples were dispensed per well. The solution volume at this time is 7.2 μl.

The following steps are: 1. Fluorescent labeling, 2. Cell sorting and dispensing to a single cell analysis device, 3. Reverse transcription reaction on a single cell analysis device, and 4. Preparation of a sample for next generation sequencing by PCR amplification. An analysis method based on this example will be described.

1. Labeling of target cells
Here, as an example of labeling CD8-positive T cells, a procedure using a fluorescent antibody (an anti-mouse anti-CD8 antibody with PE (Phycoerythrin)) is shown. The detailed conditions are shown below.

Frozen primary T cells (CD3 positive, 5x10 ⁶ cells/tube) from mice stored in liquid nitrogen (-196°C) are removed from liquid nitrogen and warmed in a 37°C water bath for 1 minute. Immediately mix the entire amount of T cells into approximately 15 mL of cell culture medium (RPMI1640, 10% FBS, containing 2 mM L-glutamine) pre-warmed to 37°C. After centrifuging (200 g, 3 minutes), remove the supernatant, mix with approximately 1 mL of PBS (containing 1% Ultra Pure BSA (RNase Free BSA, ThermoFisher, #AM2618), 0.005% Tween), and use a cell counter. Measure cell concentration and viable cell percentage. Dispense 100 μL of the cell suspension adjusted to a cell concentration of 10 ⁶ cells/mL into a 1.5 mL tube, add 0.5 μL of anti-mouse CD16/32 antibody as a blocking agent, mix, and leave at room temperature for 10 minutes. Incubate. Next, mix 5 μL of anti-mouse CD8 antibody with PE and incubate on ice for 30 minutes. After adding and mixing 1.4 mL of PBS (containing 2% Ultra Pure BSA, 0.01% Tween), centrifuge (200 g, 3 minutes) and remove the supernatant. Repeat this washing procedure three times to wash the cells, and finally suspend them in 3 mL of PBS (containing 2% Ultra Pure BSA).

2. Dispensing CD8-positive T cells for single cell analysis using a cell sorter Add 8 μL of PBS (A) (1.33 U/μL RNase OUT, 0.1%) to the chip (VFACs) mounted in the single cell analysis device. Preliminarily clean the inside of each microchamber by adding Tween 20, 0.005% BSA) and applying pump suction (90 kPa) from below the VFACs. Repeat this again twice. Next, dispense 3 uL of PBS (B) (1.33 U/μL RNase OUT, 0.1% Tween 20) into each well. A single cell analysis device is fixed on the motorized movable stage 108 in order to sort CD8+T cells. This single cell analysis device is equipped with two rows of six chips (VFACs) 109. Further, two containers (tubes) 102 for waste liquid are installed in the adapter. Dispense 0.5 mL of cell suspension 2 into cell suspension container (tube) 1 of the cell sorter and place it in the cell sorter. Fill container 3 for sheath fluid with 500 mL of PBS as sheath fluid 4. Pressure is applied to each of the cell suspension container 1 and the sheath liquid container 3 to stabilize the droplet size and adjust it to 0.01 to 0.1 μL (particularly 0.09 μL in this example). At the same time, set the fluorescence intensity for CD8+ identification. Using a cell sorter, dispense 80 identified CD8-positive T cells (7.2 uL of cell suspension) into each VFAC. As a result, 10.2 μL of a solution containing CD8-positive T cells is dispensed into each well.

3. Cell capture using a single cell analysis device and reverse transcription reaction from cells The material of the chip (VFACs) installed in the single cell analysis device is PDMS, and the diameter of the through hole for capturing cells is on average The nucleic acid trapping section, which is laser-processed to a diameter of 3 μm and filled with beads, is constructed by filling beads into a concave portion of a cylinder with a diameter of 75 μm and a depth of 70 μm. In this way, in a single cell analysis device, the cell trapping part and the nucleic acid trapping part may be formed in a directly connected through-hole, and the cell suspension is passed through such a through-hole into a single cell. It can be discharged outside the analysis device. A poly-T sequence-containing RT probe (CCATCTCATCCCTGCGTGTCTCCGACTCAGTCGCGTACNNNNNNNTTTTTTTTTTTTTTTTVN: SEQ ID NO: 1) for capturing mRNA is immobilized on the beads (diameter 1 μm) to be filled, and this RT probe has a polyT sequence-containing RT probe (CCATCTCATCCCTGCGTGTCTCCGACTCAGTCGCGTACNNNNNNNTTTTTTTTTTTTTTTTVN: SEQ ID NO: 1), and this RT probe has the following structure as described in WO2016/125251A (Patent Document 1). As described, a cell identification tag (TCGCGTAC as an example of about 100 types of known sequences) and a molecular identification tag sequence (NNNNNNN, N=A, G, C, or T) are also inserted. The processing method up to the reverse transcription reaction after cell dispensing is shown below.

The single cell analysis device fixed to the fixing adapter 107 is taken out from the cell sorter, and the suction pump is connected to the suction port 110. Turn on the suction pump and apply pump suction (90 kPa) from below the VFAC to capture individual cells in the 3 μm cell trapping section on the VFACs. Next, after adding 8 μL of Cell wash buffer (100 mM Tris (pH8.0), 500 mM NaCl, 5 mM DTT, 0.4 U/μL RNase OUT, 0.1% Tween 20), pump suction (90 kPa) was applied to the VFACs. Re-capture a small number of cells remaining on the surface etc. Add 1μL of Cell Lysis buffer (100mM Tris (pH8.0), 500mM NaCl, 10mM EDTA, 1% SDS, 5mM DTT, 1.33U/μL RNase OUT) to lyse the cells and lyse the eluted cells. The captured mRNA is captured using a bead-immobilized RT probe. After the reaction, this reagent is removed by pump suction (90 kPa). After adding 8μL of Lysis wash buffer (100mM Tris (pH8.0), 500mM NaCl, 5mM DTT, 0.4U/μL RNase OUT, 1% Tween 20), apply pump suction (90 kPa) to remove enzyme reaction inhibition. Remove residual reagents from Cell Lysis buffer that may be the cause. Repeat this operation twice. We have confirmed that no loss of cell-derived mRNA (approximately 10 ⁶ molecules/cell) occurs even when a series of pump suctions are performed at a strength of 90 kPa in this process. Cell Lysis buffer and Lysis wash buffer both contain NaCl at a high concentration of 500 mM, and a sufficient amount ( ^1.5x10 molecules) of RT probe is immobilized on the magnetic beads, so that trace amounts of intracellular mRNA is efficiently captured.

Add 4.5 μL of reverse transcription reaction reagent (1 x FS Buffer (Takarabio), 2mM DTT, 2mM dNTPs, 3.2U/μL RNase inhibitor (Takarabio), 10 Unit/μL SmartScribe RT (Takarabio), to the top of each chip (VFACs). Add 0.2% Tween20). Seal the opening on the top of the flow cell device (Thermo Fisher, Optical Adhesive Film) and incubate for 60 minutes in a constant temperature bath preheated to 42°C. After incubating for 5 minutes at room temperature, peel off the seal on the device and aspirate the reverse transcription reaction reagent using a pump. Remove the VFAC and membrane from the flow cell device with tweezers and place them into a PCR tube to which 100 μL of Suspension Buffer (50 mM NaCl, 50 mM Tris (pH 8.0)) has been added in advance. By bringing a neodymium magnet close to the bottom of the tube and loosening the VFAC with tweezers, completely stir the beads filled in the microchamber into the buffer. Move the VFAC to the top of the tube with a pipette tip, spin down (dehydrate) to remove residual reagents contained in the VFAC, completely remove the supernatant again, and remove the VFAC as well. Wash the beads twice with 50 μL of wash buffer (0.1% Tween 20, 10 mM Tris, pH 8.0), then suspend the beads in 1 μL of the same solution.

4. Preparation of samples for next-generation sequencer (NGS) analysis by PCR amplification
4.1. 1st multiplex PCR amplification
For the sample prepared in step 3, after decomposing the RT probe on the magnetic beads with Exonuclease I, perform 1st multiplex PCR amplification. Here, a Forward primer set containing 44 types of oligos (SEQ ID NOs: 9 to 52) listed in Table 2 below and one type of Reverse primer (PA primer, CCATCTCATCCCTGCGTGTCT: SEQ ID NO: 2) were used.

Details of the 1st multiplex PCR amplification are as follows. Prepare Exonuclease I reaction solution (1x Exonuclease I buffer, 0.067 Unit/μL) on ice. Mix 14 μL of this with the samples prepared in 2. and 3. and incubate at 37°C for 15 minutes. Wash the beads three times with 50 μL of wash buffer (0.1% Tween 20, 50 mM Tris, pH 8.0), then suspend the beads in 1 μL of 10 mM Tris (pH 8.0). Prepare 9 μL of 1st Multiplex PCR reagent (1 x Gflex PCR buffer, 0.2 μM 44plex primer mix, 2 μM PA primer, 0.075 Unit/μL Tks Gflex DNA polymerase) on ice. Mix 9 μL of the prepared 1st Multiplex PCR reagent with 1 μL of bead sample and incubate under appropriate temperature conditions (after heat inactivation at 94 °C for 1 minute, 14 cycles of 98 °C for 10 seconds → 58 °C for 3 minutes → 68 °C for 25 seconds). Perform PCR amplification at 68°C for 2 minutes, then at a constant temperature of 4°C. After capturing the beads with a neodymium magnet, collect 10 μL of the supernatant containing the amplified product into a tube, wash the beads with 40 μL of wash buffer (0.1% Tween 20, 10 mM Tris, pH 8.0), and combine the supernatant with the amplified product. Mix to make a total of 50 μL. Add and mix 35 μL of Ampure Collect in a separate tube.

4.2. 2nd Multiplex PCR amplification
For the 1st Multiplex PCR product (gene analysis product) obtained in 4.1., 44 kinds of Forward primer set (Table 3, SEQ ID NO: 53 to 96) with R2SP (Illumina NGS common sequence) added and one type 2nd Multiplex PCR amplification is performed using the Reverse primer (PA primer, SEQ ID NO: 2). This amplifies DNA for gene expression analysis.

Details of the 2nd multiplex PCR amplification are as follows. After mixing 13 μL of 2nd Multiplex PCR reagent (1x Multiplex PCR Plus, 0.3 μM 2nd R2SP added 44plex primer mix, 3 μM PA primer) with 7 μL of 1st Multiplex PCR product, heat under appropriate temperature conditions (heating at 95℃ for 5 minutes). After inactivation, 3 cycles of 95℃ for 30 seconds → 61℃ for 5 minutes → 72℃ for 30 seconds, 3 cycles of 95℃ for 30 seconds → 59℃ for 5 minutes → 72℃ for 30 seconds, then 3 cycles of 95℃ for 30 seconds → After 57°C for 5 minutes → 72°C for 30 seconds, carry out 3 cycles of 95°C for 30 seconds → 55°C for 5 minutes → 72°C for 30 seconds, and after 72°C for 2 minutes, amplify at a constant temperature of 4°C). Add 30 μL of 0.1% Tween 20 (10 mM Tris, pH 8.0) to 20 μL of 2nd Multiplex PCR product (50 μL in total). Add and mix 35 μL of Ampure Collect in a separate tube.

4.3. 3rd PCR for NGS library preparation
By performing 3rd PCR amplification using the 2nd Multiplex PCR product obtained in 4.2 as a template, the common sequences necessary for Illumina NGS (Next Generation Sequencing) analysis (P5-R1SP (AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT: SEQ ID NO: 3), P7- R2SP (CAAGCAGAAGACGGCATACGAGATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT: SEQ ID NO: 4)) and a Chip Tag (CT) sequence that identifies VFAC (TGACATA as an example of 64 types of known sequences) are introduced. The detailed conditions are shown below.

22 μL of 3rd PCR reagent (1 x Gflex PCR buffer, 0.23 μM P5_R1SP_CT_PA primer (including one example of 64 types of CT, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTTGACATACCATCTCATCCCTGCGTGTCTC: SEQ ID NO: 5), 0.23 μM P7_R2SP primer (CAAGCAGAAGACGGCATACGAGATGTGACTG GAGTTCAGACGTGT: SEQ ID NO: 6), 0.01μM P5 primer ( Prepare AATGATACGGCGACCACCGAGATCTACAC: SEQ ID NO: 7), 0.01 μM P7 primer (CAAGCAGAAGACGGCATACGAGAT: SEQ ID NO: 8), 0.045 Unit/μLTks Gflex DNA polymerase on ice, and mix with 8 μL of the 2nd Multiplex PCR product obtained in 4.2. Appropriate temperature conditions (after heat inactivation at 94℃ for 1 minute, 1 cycle of 98℃ for 10 seconds → 61℃ for 1 minute → 68℃ for 25 seconds, then 2 cycles of 98℃ for 10 seconds → 59℃ for 1 minute → 68℃ for 25 seconds) After 2 cycles of 98℃ for 10 seconds → 57℃ for 1 minute → 68℃ for 25 seconds, 2 cycles of 98℃ for 10 seconds → 55℃ for 1 minute → 68℃ for 25 seconds, and after 68℃ for 2 minutes, 4℃ amplified at a constant temperature). Add 20 μL of 0.1% Tween 20 (10 mM Tris, pH 8.0) to 30 μL of the amplified product to bring the volume up to 50 μL, then add and mix 35 μL of Ampure XP, which corresponds to x0.7 volume of the sample, as recommended by the manufacturer. Purify according to the protocol, and finally elute with 40 μL of wash buffer (10 mM Tris (pH 8.0), 0.1% Tween20), and collect the supernatant in a separate tube. Analyze 1 μL of the 3rd PCR amplification product by chip electrophoresis to determine the amplification product size (bp) and concentration (pmol/L), and then perform NGS analysis (Illumina, Miseq). The data after NGS analysis is separated by tag sequence (chip tag, cell identification tag, molecular identification tag), and the number of mRNA molecules is counted by mapping it to sequences published on a public database of 44 genes. , it becomes possible to obtain gene sequence data for each cell. The results are shown in FIG. As shown in the results, it was shown that the single cell analysis device and single cell analysis method of this example can perform gene expression analysis derived from a single cell.

[Example 2]
In this example, by directly connecting the single cell analysis device described in WO2016/125251A (Patent Document 1) to a sense-in-chip type cell sorter, centrifugation processing is omitted, and mRNA in cells before being introduced into the device is This is an example of a single cell analysis method that suppresses the decomposition of . At the same time, by mixing an RNase inhibitor into the cell suspension, the activity of RNase in the single cell analysis device is reduced, and by suppressing the degradation of mRNA captured in the single cell analysis device, This is an example of highly efficient synthesis of cDNA from mRNA and highly efficient (that is, highly sensitive) molecular counting of mRNA using a next-generation DNA sequencer. This example is a method in which the cell labeling process of Example 1 was modified as follows. The subsequent steps are the same as in Example 1, so they will be omitted.

1. Labeling of target cells
Frozen primary T cells (CD3 positive, 5 x 10 ⁶ cells/tube) from mice stored in liquid nitrogen (-196°C) are removed from liquid nitrogen and warmed in a 37°C water bath for 1 minute. Immediately mix the entire amount into approximately 15 mL of cell culture medium (RPMI1640, 10% FBS, containing 2 mM L-glutamine) pre-warmed to 37°C. After centrifuging (200 g, 3 minutes), remove the supernatant and mix with approximately 1 mL of PBS (containing 1% BSA (an inexpensive BSA for general molecular biology, ThermoFisher, #37525), and 0.005% Tween). Then, measure the cell concentration and viable cell rate using a cell counter. Dispense 100 μL of the cell suspension adjusted to a cell concentration of 10 ⁶ cells/mL into a 1.5 mL tube, add 0.5 μL of anti-mouse CD16/32 antibody as a blocking agent, mix, and leave at room temperature for 10 minutes. Incubate. Next, mix 5 μL of anti-mouse CD8 antibody with PE and incubate on ice for 30 minutes. After adding and mixing 1.4 mL of PBS (containing 2% BSA, 0.01% Tween), centrifuge (200 g, 3 minutes) and remove the supernatant. Repeat this washing procedure three times to wash the cells, and finally suspend them in 3 mL of PBS (2% BSA, 0.5 units/μL, RNase OUT (Thermo Fisher, #10777019), containing 1 mM DTT).

[Example 3]
This example describes a method for performing single cell analysis by dispensing individual desired cells into individual wells of a 96-well plate into a sense-in-chip type cell sorter, in which an RNase inhibitor is pre-contained in the wells. The addition of reagents reduces RNase activity in the 96-well plate and suppresses the degradation of mRNA captured on beads in each well 121, allowing for highly efficient cDNA synthesis from mRNA. This is an example of highly efficient (that is, highly sensitive) molecular counting of mRNA using a DNA sequencer. In addition, beads on which a polyT sequence-containing RT probe (SEQ ID NO: 1) with a different cell identification sequence (SEQ ID NO: 1) was immobilized for each well of the plate (beads filled in the nucleic acid capture part of the VFACs described in Examples 1 and 2) were used. This is a method to perform analysis on a single cell basis by dispensing the equivalent amount). The differences from Example 1 will be mainly described. A configuration diagram of this embodiment is shown in FIG. One drop of the cells identified by the cell sorter is dispensed into each well 121 of a 96-well plate, and the other cells are dispensed into a waste liquid container (tube) 102. The process is as follows.

1. The fluorescent labeling method is the same as in Example 1.

2. Dispensing one CD8-positive T cell into each well of a 96-well plate using a cell sorter
Prepare magnetic beads (e.g., diameter 1 μM, 10 ⁶ beads/μL) immobilized with polyT sequence-containing RT probes containing 96 different cell recognition sequences at a rate of 7.5 molecules/magnetic bead each, and add one per well. Dispense 1 μL of each type of magnetic beads. Next, add 4μL of reverse transcription reaction reagent (1.25 x FS Buffer (Thermo Fisher), 6.4mM DTT, 2.29mM dNTPs, 6.1 Units/μL RNase OUT (Thermo Fisher), 4.9 Units/μL SuperScriptIII (Thermo Fisher), 0.45% NP40 ) into each well and mix. A 96-well plate is fixed on the motorized movable stage 108 in order to sort out CD8+T cells. Further, eight waste liquid containers (tubes) 102 are installed in a fixed adapter 107. Dispense 0.5 mL of cell suspension 2 into cell suspension container (cell suspension tube) 1 of the cell sorter and place it on the cell sorter. Fill container 3 for sheath fluid with 500 mL of PBS (sheath fluid 4). Apply pressure to the cell suspension tube and sheath liquid container, respectively, and adjust the droplet size so that it becomes stable and becomes 0.01 to 0.1 μL (particularly 0.09 μL in this example). At the same time, set the fluorescence intensity for CD8+ identification. Using a cell sorter, dispense one cell (0.09 uL of cell suspension) of the identified CD8-positive T cells into each well 121 of a 96-well plate, and seal the 96-well plate. As a result, 5.09 uL of a solution containing CD8-positive T cells is dispensed into each well. In the case of 1 plate and 1 cell, the enzyme used for 80 cells after the reverse transcription reaction is required for 1 cell, which significantly increases the reagent cost.

3. Reverse transcription reaction
Incubate the 96-well plate for 60 minutes in a thermostat preheated to 50°C. After incubating for 5 minutes at room temperature, remove the seal, add 50 μL of wash buffer (0.1% Tween 20, 10 mM Tris, pH 8.0), capture the beads using a 96-well plate type neodymium magnet, and remove the supernatant. Remove. Add 15 μL of wash buffer again, collect 96 samples into a 1.5 mL tube, and merge. Capture the beads with a neodymium magnet and remove the supernatant, then suspend in 1 μL of wash buffer.

4. The subsequent PCR amplification reaction is the same as in Example 1.

1: Container (tube) for cell suspension
2: Cell suspension
3: Container (tube) for sheath fluid
4: Sheath liquid
5: Insertion tube
6: Chip
7: Laser light source
8: Lens
9: Filter (dichroic mirror or optical filter)
10: Receiver
11: Signal amplifier/discriminator
12: Nozzle
13: Piezoelectric element (piezo element)
14: Deflection plate
101: Desired well on single cell analysis device
102: Container (tube) for waste liquid
103: Droplet containing desired cells
104: Droplet
105: Single cell analysis device
107: Fixed adapter
108: Electric movable stage
109: Chips (VFACs)
110: Suction port
121: each well of a 96-well plate

Claims (14)

A single cell analysis device,
a cell sorter equipped with a channel for introducing a suspension containing a plurality of cells and a selection device for selecting a part of the plurality of cells;
A single cell analysis device equipped with a cell trapping section that captures cells and a nucleic acid capturing section that captures mRNA derived from the cells,
The cell sorter and the single cell analysis device may be arranged so that the cells selected by the cell sorter are captured by the cell trapping section of the single cell analysis device,
The suspension introduced into the flow path is
(a) contains a protein, but the suspension has substantially no nuclease activity, or (b) does not contain a protein containing a component with nuclease activity;
A single cell analysis device characterized by: The device according to claim 1, wherein the protein includes at least one selected from fetal bovine serum (FBS) and bovine serum albumin (BSA). The device according to claim 1, wherein the nuclease is at least one selected from RNA degrading enzymes and DNA degrading enzymes. 2. The apparatus according to claim 1, wherein the protein is subjected to a treatment to remove the nuclease, so that the suspension has substantially no nuclease activity. 2. The device according to claim 1, wherein the suspension is substantially free of nuclease activity by incorporating a substance that inhibits the nuclease activity into the suspension. 2. The apparatus of claim 1, wherein the suspension is cooled so that the suspension is substantially free of nuclease activity. 2. The apparatus according to claim 1, wherein the single cell analysis device performs a reverse transcription reaction using the mRNA captured by the nucleic acid capture portion as a template. In the single cell analysis device, the cell capture part and the nucleic acid capture part are formed in a directly connected through hole, and the suspension passes through the through hole to the outside of the single cell analysis device. 2. The device of claim 1, wherein the device is ejectable. A single cell analysis method, the method comprising:
Introducing a suspension containing a plurality of cells into a flow path of a cell sorter and selecting a part of the plurality of cells;
capturing the selected cells in the cell capturing section of a single cell analysis device that includes a cell capturing section that captures cells and a nucleic acid capturing section that captures mRNA derived from the cells;
eluting mRNA from the captured cells and capturing it in the nucleic acid capture unit,
The suspension introduced into the flow path is
(a) contains a protein, but the suspension has substantially no nuclease activity, or (b) does not contain a protein containing a component with nuclease activity;
A single cell analysis method characterized by: 10. The method according to claim 9, wherein the selected cells are directly captured in the cell capture unit without any other processing. 10. The method according to claim 9, wherein the protein comprises at least one selected from fetal bovine serum (FBS) and bovine serum albumin (BSA). The method according to claim 9, wherein the nuclease is at least one selected from RNA degrading enzymes and DNA degrading enzymes. The protein is treated to remove the nuclease, or the suspension is mixed with a substance that inhibits the nuclease activity, or the suspension is cooled.
10. The method of claim 9, wherein the suspension is substantially free of nuclease activity. 10. The method according to claim 9, further comprising the step of performing a reverse transcription reaction using the mRNA captured by the nucleic acid capture portion as a template in the single cell analysis device.

Images