JP2022147578A - Transpiration suppressing agent using jasmonic acid or the like - Google Patents

Abstract

To provide a transpiration suppressing composition.SOLUTION: Provided is a composition for suppressing transpiration of plant body or part thereof that contains jasmonic acid or the like. The present disclosure also provides a method for suppressing transpiration of plant body or part thereof, comprising applying a jasmonic acid derivative to the plant or part thereof. Jasmonic acid or the like can include, but is not limited to, prohydrojasmonic acid. Target plant can include, but is not limited to, emergent plant or wet plant.SELECTED DRAWING: None

Description

There is an application for the application of Article 30, Paragraph 2 of the Patent Law Publication 1: Abstracts of the 249th Annual Meeting of the Crop Science Society of Japan (2020), Release date: March 26, 2020

The present disclosure relates to transpiration suppression technology. More particularly, the present disclosure relates to reversible transpiration inhibition technology using jasmonates.

Climate change caused by global warming is a serious problem in the field of agriculture. In paddy rice, there are problems such as planting pain and dryness damage to the leaves when transplanting seedlings, and a decrease in yield and quality due to overtranspiration due to high temperature at the time of ripening. It's becoming One solution to the problem is the suppression of excessive transpiration by applying a transpiration inhibitor.

The present disclosure enables the application of jasmonic acids to rapidly suppress the transpiration of plants (for example, rice), and prevent deterioration in quality and yield due to planting pain, drying damage, and excessive transpiration due to high temperatures during ripening. and Although not wishing to be bound by theory, the present disclosure physically closes the stomata, making it difficult to reversibly increase transpiration again, resulting in a decrease in yield and quality depending on the time of application and weather conditions. solved what happened.

The agent used in the present disclosure temporarily induces stomatal closure and suppresses transpiration by application, but it is a reversible reaction, and it is possible to suppress transpiration flexibly according to changes in weather conditions and the like.

It is contemplated in the present invention that one or more of the above features may be provided in further combinations in addition to the explicit combination. Still further embodiments and advantages of the present invention will be appreciated by those skilled in the art upon reading and understanding the following detailed description, if necessary.

The present disclosure has solved a significant problem in the agricultural sector due to climate change caused by global warming. For example, in paddy rice, we have solved the problems of planting pain and drying damage on the leaves when transplanting seedlings, and yield and quality deterioration due to overtranspiration due to high temperatures during grain filling. The present disclosure solves the problem of overtranspiration control by applying a transpiration control agent. In particular, the present disclosure, for example, by applying jasmonic acids such as prohydrojasmone, rapidly suppresses the transpiration of plants such as rice, planting pain, drying damage, quality due to overtranspiration due to high temperature during ripening It made it possible to prevent the decrease in yield.

The transpiration-suppressing effect of the present disclosure on plants such as rice has a feature that the effect is reversible compared to existing transpiration-suppressing agents.

FIG. 1 is a thermal image confirming the transpiration suppression effect of microcrystalline wax. Thermal images (left) and visible images (right) of plants 2 days (top) and 7 days (bottom) after spray application of 5-fold or 10-fold diluted microcrystalline wax formulations are shown. FIG. 2 is a thermal image confirming the transpiration suppression effect of paraffin wax. Thermal images (left) and visual images (right) of plants 2 days (top) and 7 days (bottom) after spray application of 100-fold or 200-fold diluted paraffin wax are shown. FIG. 3 is a thermal image confirming the transpiration suppression effect of microcrystalline wax. Thermal images (left) and visible images (right) of plants before (top) and 0.5 hours after (bottom) spraying a 5-fold or 10-fold diluted microcrystalline wax formulation are shown. FIG. 4 is a thermal image confirming the transpiration suppression effect of the paraffin wax agent. Thermal images (left) and visible images (right) of plants before (top) and 0.5 hours after (bottom) spray application of 5-fold or 10-fold diluted paraffin wax are shown. FIG. 5 is a thermal image confirming the transpiration suppression effect of PDJ. PDJ diluted 2,000-fold or 20,000-fold was sprayed before application (A, B), 0.5 hours after application (C, D), 2 days after application (E, F), and 7 days after application (G, H). A thermal image (left) and a visible image (right) of the plant are shown. FIG. 6 shows the results of RNAseq analysis using PDJ-treated glumes. For each gene, the gene expression level of the control was shown as 1.

The present disclosure is described below. It should be understood that throughout this specification, expressions in the singular also include the concept of the plural unless specifically stated otherwise. Thus, articles in the singular (eg, “a,” “an,” “the,” etc. in the English language) should be understood to include their plural forms as well, unless otherwise stated. Also, it should be understood that the terms used in this specification have the meanings commonly used in the relevant field unless otherwise specified. Thus, unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. In case of conflict, the present specification (including definitions) will control.

(definition)
As used herein, the term "about" refers to plus or minus 10% of the following numerical value unless otherwise specified.

As used herein, the term “transpiration suppression” means that when applied to all or part of a plant body (e.g., leaves, ears, etc.), transpiration of water is suppressed compared to when it is not applied. Say. The effect of suppressing transpiration may be directly based on the component, or when the component is a gene or the like, it may be realized by a gene product or the like expressed as a result of being applied to or incorporated into the plant.

As used herein, the term “reversible transpiration suppression” means that the transpiration suppression effect is reversible, that is, once the transpiration suppression effect is achieved, it returns to its original state (the transpiration suppression effect disappears or is reduced). It means that you can

In one embodiment, the transpiration evaluated by the method for confirming the transpiration-suppressing effect in the present disclosure is suppressed to 80% or less, preferably 50% or less, compared to the transpiration of plants not using the transpiration-suppressing component of the present invention. More preferably 35% or less, most preferably 20% or less. The dosage form of the transpiration suppressing component is exemplified by liquid, fine powder, paste, etc., as long as it does not impair the stability of the active ingredient contained in the transpiration suppressing component of the present disclosure and can be used in the usage examples described later. Other dosage forms may also be employed in

As used herein, the term "jasmonic acids" includes jasmonic acid and jasmonic acid derivatives. Jasmonic acid includes free jasmonic acid and salts of jasmonic acid. The salt of jasmonic acid is not particularly limited, but examples thereof include sodium salt, potassium salt, magnesium salt and calcium salt. Jasmonic acid derivatives include methyl jasmonate, prohydrojasmone, jasmonate glucoside, epijasmonic acid, methyl epijasmonate, dihydrojasmonic acid, tuberonic acid and amino acid derivatives of jasmonic acid. Amino acid derivatives of jasmonic acid include isoleucine jasmonate, phenylalanine jasmonate, and valine jasmonate. These jasmonic acid-related compounds may be contained alone as a transpiration suppressing component, or may be contained in any combination.

In the present specification, “prohydrojasmone” is a propyl=(1RS,2RS) containing 10±2% propyl=(1RS,2SR)-(3-oxo-2-pentylcyclopentyl)acetate on agricultural chemical registration. -(3-oxo-2-pentylcyclopentyl)acetate and is known as a jasmonic acid derivative plant growth regulator, but for the purposes of this disclosure, this proportion can be arbitrary. Prohydrojasmone is an artificially produced jasmonic acid derivative that is commonly used as a plant growth regulator in various fruit and rice seedlings. Prohydrojasmones have been identified to affect various biological processes in a manner similar to jasmonic acid. Prohydrojasmone promoted anthocyanin accumulation in grapes and apples, improved hand-picking efficiency of mandarin oranges, induced a protective response against armyworm in maize, and phenolic compounds, anthocyanin accumulation, and antioxidant activity in Japanese mustard spinach and lettuce. There is also an effect on It is also a growth regulator that inhibits germination and root growth for both indica and japonica rice cultivars.

In this disclosure, the effect of prohydrojasmone (also denoted as PDJ) on transpiration was investigated in comparison with commercial microcrystalline waxes and paraffin agents. Takanari is a high-yielding indica cultivar that exhibits higher transpiration than common japonica cultivars (Fukuda et al., 2018). In some examples of the present disclosure, Takanari was used to demonstrate PDJ activity to prevent transpiration in rice. The results of this example show that PDJ functions differently than commercial agents and can be used to reduce excessive transpiration in rice.

As used herein, the term "plant application" refers to direct application of a target component to a plant. In plant body spraying, the target component may be mainly sprayed to the plant body, and a small amount of the component may be additionally sprayed into the environment. In plant body spraying, for example, the intended effect of the present disclosure can be exhibited by directly applying the target component to the plant body. Examples of methods for spraying the plant body include direct application of the transpiration-suppressing component, spraying so that the target component is applied to the underside of the leaf surface, and suppression of transpiration over the entire plant body, including the panicle, after heading. This can include, but is not limited to, compressing the ingredients. Spraying on plants can be said to be a concept that specifically includes spraying on foliage, spraying on flowers, spraying on spikes, spraying on trees, and the like.

As used herein, the term “environmental application” refers to the application of the desired component to the environment surrounding the plant body. In environmental spraying, the target component may be mainly sprayed into the environment, and a small amount of the component may be additionally sprayed onto the plant body. In environmental spraying, for example, the effects intended by the present disclosure can be exhibited by spraying the target component into the environment. Examples of the method of environmental spraying include spraying in the environment of the plant body, and in addition to this, soil treatment in which it is applied directly to the soil in advance, and application at the base of the plant. It is not limited to these. Environmental spraying can be said to be a concept including water surface spraying, soil spraying, stock spraying, irrigation water spraying, and the like.

As used herein, the term "application" refers to applying a drug or active ingredient to a target site.

In the present disclosure, any dosage form that can be used with pesticides can be used, such as dust, DL dust, FD (flow dust), granules, jumbo, powder, fine granules, fine granules, Powders, wettable powders, flowable sol (SC), wettable powders, dry flowable water solutions, water solution granules, emulsions, EW agents, liquid agents, ME liquid agents, oil agents, surf agents, aerosols, paste agents, fumigants, Fumigants, microcapsules, packs may be used.

As used herein, the term "liquid drug" refers to a drug provided in a liquid state at room temperature.

As used herein, the term "powder" refers to a product prepared by diluting an agricultural chemical raw material with mineral fine powder such as clay and adding an antidegradant as necessary to form a fine powder of, for example, 45 μm or less. . Used as is. In order to reduce scattering (drift), a bulking agent containing less fine powder of 10 µm or less is used, and a flocculant is used to agglomerate the mixed fine powder to make it difficult to scatter. DL stands for DRIFT LESS. In order to prolong the time it floats in the air, it is made into an ultra-fine powder of 2μm or less.

As used herein, the term "granule" refers to a drug that is solid at room temperature and provided in the form of grains. According to the Agricultural Chemicals Regulation Law, it is a fine granule with a particle size of 300 to 1700 μm and is used as it is. There are various shapes depending on the manufacturing method, such as a type in which the active ingredient of an agricultural chemical is kneaded into a mineral material such as clay (mainly cylindrical), a type in which the active ingredient is impregnated into a porous mineral material (mainly fine sand), etc. There is There are also pellets and tablets with larger particle sizes. As used herein, the term "jumbo formulation" corresponds to a granule formulation under the Agricultural Chemicals Regulation Law. There are 50g tablets (tablets) and 50g water-soluble film-wrapped granules/tablets/powder packs. It is labor-saving because it does not use spray equipment. Mostly herbicides.

As used herein, the term "wettable powder" refers to a water-compatible powdery preparation, which is used by suspending it in water, and precipitates when the preparation is allowed to stand. As used herein, the term “flowable agent” refers to a formulation in which an active ingredient is finely divided (average particle size: 1 to 5 μm) and dispersed in a liquid with an appropriate surfactant.

As used herein, the term "water solvent" refers to water-soluble powdery or granular formulations, which are used by dissolving them in water. Since the active ingredient is completely soluble in water, the preparation does not settle.

As used herein, the term "emulsion" refers to an oily liquid formulation obtained by dissolving a sparingly water-soluble active ingredient in an organic solvent and adding an emulsifier. Use after diluting with water and emulsifying.

As used herein, the term “microcapsules” refers to preparations containing micro-sized capsules coated with a polymer film or the like to contain the desired ingredients. Microencapsulation enhances the durability of the drug's effect and reduces inhalation poisoning, chemical damage, and paint contamination. The formulation has a liquid appearance similar to that of a flowable formulation.

As used herein, the term "aerosol" refers to a can (cylinder) containing aerosol, which sprays the target component under internal gas pressure. It has the advantage of being easy to use.

As used herein, the term "plant body" is used in the broadest sense in the relevant field, and refers to an organism that undergoes life phenomena and lives without photosynthesis and movement. Plants typically have various characteristics such as cell structure, proliferation (self-reproduction), growth, regulation, substance metabolism, and repair ability. It has as a basic attribute involvement of proliferation. Cells of either angiosperms or gymnosperms, dicotyledonous or monocotyledonous plants, and herbaceous or woody plants may be used. Examples of herbaceous plants include cereal plants, lawn grasses, and vegetables, and examples of woody plants include evergreen broad-leaved trees and deciduous broad-leaved trees. Specifically, rice, wheat, barley, corn, grapes, apples, pears, peaches, cherry, oysters, citrus, soybeans, green beans, strawberries, potatoes, cabbage, lettuce, tomatoes, cucumbers, eggplants, watermelons, sugar beets, spinach. , snow peas, pumpkins, sugarcane, tobacco, green peppers, sweet potatoes, taro, konnyaku, cotton, sunflowers, tulips, chrysanthemums, shiba and other agricultural and horticultural crops, but not limited to these. In addition, the term "plant body" as used in the present invention includes all parts constituting the plant individual. Here, preferably such plants may be fertile. More preferably, such plants are capable of producing seeds. It is understood that the compositions and methods of the present disclosure can be applied to any plant that has leaves.

As used herein, "a part of a plant" may be a specific part of a plant such as a stem, leaf, root, seed, flower, fruit, etc., or a stem, leaf, seed, etc. It may be a combination of a plurality of organs including, for example. The part of the plant body may include parts such as above-ground parts (for example, leaves/stems/nodes or leaves/stems/nodes/ears) and underground parts.

As used herein, the term "seed" refers to a plant that stores nutrients for seedling germination and is used for agricultural propagation. Specifically, grains such as rice, corn, cottonseed, wheat, and barley; grains such as pearl millet, millet, millet, finger millet, barnyard millet, millet, sorghum, pearl barley, oat, and rye; sunflower seeds; pumpkin seeds; Seeds, legumes, rapeseed seeds, and the like. Alternatively, the present disclosure may be directed to edible parts of crops (seeds of cereals and fruits of fruit trees).

As used herein, the term "above-ground part" refers to a portion of a plant, including leaves and stems during vegetative growth, and leaves, stems, flower stalks and flowers during reproductive growth. For example, the ``above-ground parts'' during the vegetative growth period of gramineous plants consist of leaves, stems, and nodes, and the ``above-ground parts'' during the reproductive growth period are composed of leaves, stems, nodes, and panicles (branchs, stems, and flowers). ).

In the present disclosure, the plant body may be a part of the plant body that is used for food other than seeds. For example, the plant part may be the fruit of a vegetable such as tomato, cucumber, eggplant, snow pea, squash, green pepper, and the like. Alternatively, the part of the plant body may be leafy vegetables such as spinach, mizuna, and nozawana. The plant part may also be edible underground, such as taro, potato, sweet potato, konnyaku, lotus root, lily root, and the like. Plants and parts thereof utilized in the present disclosure may also be non-edible. The plant body or part thereof may be a seed tuber, a lily, a bulb such as a tulip, or a seed bulb such as a Chinese scallion.

As used herein, the term "aquatic plant" refers to a plant whose roots are submerged in water during its normal life cycle. Examples include floating plants, floating plants, submerged plants, emerging plants, and wet plants. It may be freshwater, brackish water or seawater, but freshwater is preferred. The term "floating plant" refers to a plant whose roots are exposed in the water without extending to the bottom of the water, and whose whole plant body floats on the surface of the water. Examples include Lemnaceae plants such as Lemna aoukikusa and Lemna minor, and Pontederiaceae plants such as Eichhorniacrassipes. “Floating leaf plant” refers to a plant that has roots on the bottom of water and leaves that float on or near the water surface. For example, Nymphaeaceae plants such as Nymphaeatetragona and Brasenia schreberi, Trapaceae plants such as Trapajaponica, and Menyanthaceae plants such as Nymphoidespeltata is applicable. A "submerged plant" refers to a plant whose roots are spread on the bottom of the water and whose entire plant body is below the surface of the water. Examples include Hydrocharitaceae plants such as Hydrillaverticillata, Potamogetonaceae plants such as Potamogetoncrispus, and Charophyceae algae such as Charabraunii.

As used herein, the term "emerging plant" refers to a plant that has roots on the bottom of water and leaves and stems above the water surface. For example, Oryza sativa, Poaceae plants such as Zizania latifolia and Phragmites australis, Nelumbonaceae plants such as Nelumbonucifera, and Nuphar japonicum. plants of the family Nymphaceae, and plants of the family Typhaceae, such as Cattail (Typhalatifolia).
As used herein, the term “hygrophyte” refers to plants that live in places where the roots can be immersed in water, such as wetlands, around rivers or ponds, and the majority of the plant body, excluding roots and rhizomes, is It means something that cannot be submerged in water. Examples include Lythraceae plants such as Lythrum anceps, Orchidaceae plants such as Habenariaradiata, and Iridaceae plants such as Irispseudacorus.

As used herein, the term "stomatal closure" refers to the closure of stomata in a plant, which can be observed under a microscope.

As used herein, the term “planting pain” refers to a disorder that occurs when planting seedlings (for example, rice or vegetables) or during transplantation, and includes temporary cessation of growth due to cut roots, etc. falls.

In this specification, "dryness damage" means drought, light rain, etc., when an appropriate amount of rain does not fall at appropriate intervals, and the soil moisture is depleted, and at the same time, measures such as irrigation are not taken, or due to weather conditions such as high temperature and dryness. This is the damage that occurs when the required amount of water is not supplied to the plant body.

As used herein, “the quality of harvested products” refers to the quality of the target agricultural product (for example, rice in the case of rice).

As used herein, the term “(harvested product) yield” refers to the yield of the target agricultural product (e.g., rice for rice), and usually the yield per planted area (e.g., for rice, per 10 ares).

(preferred embodiment)
Preferred embodiments of the present disclosure are described below. The embodiments provided below are provided for a better understanding of the disclosure, and it is understood that the scope of the disclosure should not be limited to the following description. Therefore, it is clear that those skilled in the art can refer to the description herein and make appropriate modifications within the scope of the present disclosure. It is also understood that the following embodiments of the disclosure can be used singly or in combination.

It should be noted that the embodiments described below are all comprehensive or specific examples. Numerical values, shapes, materials, components, arrangement positions and connection forms of components, steps, order of steps, and the like shown in the following embodiments are examples, and are not intended to limit the scope of the claims. In addition, among the constituent elements in the following embodiments, constituent elements that are not described in independent claims representing the highest concept will be described as arbitrary constituent elements.

(transpiration inhibitor)
In this aspect, the present disclosure provides a composition for suppressing plant transpiration.

In one aspect, the present disclosure provides a composition for reversible transpiration inhibition of a plant body or part thereof, which contains jasmonates. In the present disclosure, application of jasmonic acids to a plant can inhibit transpiration of the plant, and this can preferably be reversible. The compositions of the present disclosure may be provided in a ready-to-use form as a diluent, or a concentrate or concentrate (also referred to herein as a stock solution) intended to be diluted for use prior to or at the time of use. .) may be provided as Therefore, when the composition of the present disclosure is provided as a stock solution, it can be provided as a diluent by diluting with an appropriate diluent medium (e.g., water, organic solvents (such as alcohol), mixtures thereof, etc.).

The jasmonic acids used in the present disclosure are jasmonic acid, jasmonic acid derivatives, or mixtures thereof (e.g., a mixture of jasmonic acid and one or more jasmonic acid derivatives, or a mixture of two or more different jasmonic acid derivatives). There may be.) In preferred embodiments, the jasmonic acid derivative comprises prohydrojasmone. Alternatively, prohydrojasmone or derivatives thereof that may be used in the present disclosure are methyl jasmonate, prohydrojasmone, isoleucine jasmonate, phenylalanine jasmonate, valine jasmonate, glucoside jasmonate, epijasmonic acid, methyl epijasmonate, and the like. could be. In a preferred embodiment, the jasmonic acid derivative is prohydrojasmone.

The present disclosure can be used for any plant, but preferably for monocotyledonous plants. In a preferred embodiment, the subject of the present disclosure may be cereal grains. Alternatively, the present disclosure may relate to grasses (eg, rice, preferably paddy rice), and the like.

In one embodiment, the subject of the present disclosure may be aerial parts, edible parts of crops, or the like, or seeds. The present disclosure can provide reversible transpiration inhibition. If the transpiration suppression is irreversible, the absorption of water and nutrient elements using the transpiration flow will also decrease, leading to a decrease in crop yield and quality.

Plants targeted by the present disclosure have any vegetation, but are preferably aquatic plants, more preferably emergent plants or wet plants, but are not limited thereto.

The composition of the present disclosure can take any dosage form, powder, DL powder, FD (flow dust), granules, jumbo, powder, fine granules, fine granules, powder, wettable powder, flowable sol. (SC), wettable powder, dry flowable water solution, water solution granule, emulsion, EW agent, liquid agent, ME liquid agent, oil agent, surf agent, aerosol, paste agent, smoke agent, fumigant agent, microcapsule agent or pack It may be a formulation, preferably a liquid formulation, granules, flowable formulations, jumbo formulations, emulsions, wettable granules, powders, microcapsules or aerosols.

In one embodiment, the jasmonates may be prohydrojasmones. When prohydrojasmone is applied, it is particularly used for suppressing transpiration for a period of 0.5 hours or more and less than 2 days after application.

For transpiration suppression, natural or artificially synthesized plant hormones and their derivatives can be used to promote adaptation to abiotic and biotic stresses such as lack of heat and water. Transpiration inhibitors can be used to prevent excessive transpiration by closing stomata and reducing transpiration, thus increasing leaf temperature under heat stress.

The technology of the present disclosure solves concerns about severe water shortages in agricultural production and food supply caused by global warming. Water scarcity is reported to affect crop production in Europe, India, South America, and America. Increased temperature results in increased transpiration in plants due to upregulation of stomatal conductance and decreased leaf water potential. The present disclosure has resolved these issues. According to the technology of the present disclosure, transpiration inhibitors can be used to retard excessive transpiration as a solution to improve water deficit tolerance of rice. Commercially available microcrystalline waxes and paraffin waxes conventionally used for this purpose can physically coat the surface of leaves to reduce water loss, but have the disadvantage of being irreversible. However, according to the technology of the present disclosure, it was possible to realize reversible transpiration suppression.

In one embodiment, the present disclosure demonstrated the superiority of prohydrojasmone (PDJ) in controlling transpiration in the indica rice cultivar Takanari compared to commercial microcrystalline waxes and paraffin agents in the greenhouse. . Microcrystalline wax and paraffin agent suppressed transpiration by about 30-50% 3 hours after application, and the suppression of transpiration lasted for 7 days after treatment, depending on the concentration and the drug used, but PDJ was 0.5 after treatment. After hours, the transpiration was suppressed by about 40-80% compared to the control, and the effect lasted for 1 day. However, the effect had almost disappeared after 7 days of treatment. Therefore, PDJ affects transpiration differently than commercial products and can be used to reduce excessive transpiration in rice, especially when initial transient and reversible suppression is required.

In the present disclosure, the compositions of the present disclosure function to inhibit transpiration in a manner distinct from the physical inhibition caused by microcrystalline waxes and paraffin wax agents. For example, the transpiration control ingredients used in the present disclosure physically seal the stomata or leaf surface when applied and the effect can wear off after 3 hours and up to 7 days after treatment, It was shown that the effect is reversible as well as showing short-term to medium-term effects.

Jasmonic acids, such as their methyl esters (MeJA), have been shown to induce water stress tolerance in several plant species, including soybean and barley, and 12-oxo-phytodienoic acid (12-OPDA) has been shown to co-operate with ABA in Arabidopsis thaliana. It is also known to function as a regulator of stomatal closure. In view of these reports, JA, its derivatives and precursors play an important role in adaptation to drought stress by stomatal closure, but effective concentrations and timings vary by compound and plant species.

In the composition of the present disclosure, the active ingredient used, such as PDJ, can be used at any concentration, and the range is 0.01 to 1000 (μmol/L), preferably 0.1 to 500 (μmol/L). ), more preferably 10 to 100 (μmol/L). For example, PDJ is fast acting and active in relatively small amounts. Effects such as PDJ can be observed 0.5 hours to 2 days after application for application of about 10 μmol/L.

Because the compositions of the present disclosure are mediated by hormonal responses, their effects are reversible. Stomatal closure is controlled by various signals such as light, humidity, and sugar degradation, and the long-term inhibitory effect of external application of PDJ is unstable, and negative feedback control is possible depending on PDJ concentration and application timing. can be induced.

The compositions of the present disclosure can be used as inhibitors of excessive transpiration in plants of interest, such as rice, for initial, transient and reversible inhibition. These traits are important in adaptation to transient heat stresses such as the Foehn phenomenon and water scarcity, and normal growth and harvesting require early recovery from transpiration suppression.

Thus, according to the present disclosure, application of a plant hormone derivative as a transpiration suppression component can transiently induce stomatal closure and cause transpiration suppression. Since this transpiration suppression is a reversible reaction, it is possible to effectively suppress transpiration by applying it flexibly to changes in weather conditions and the like.

The present disclosure can be used, for example, at a paddy rice cultivation site. The present disclosure can also suppress overtranspiration in response to prediction of sudden high temperatures, etc., and can be used to suppress commutation of heavy metals and the like.

(Plant Transpiration Control Method)
The present disclosure also provides a method of suppressing plant transpiration. Preferably, this transpiration inhibition may be reversible.

In one aspect, the present disclosure provides a method of suppressing transpiration in a plant, which includes applying jasmonates to the plant. The methods of the present disclosure may employ any combination of any of the embodiments and features described herein, particularly in the Transpiration Suppressants section, as desired. In one embodiment, the present disclosure provides a composition containing jasmonates directly as a ready-to-use liquid (also referred to herein as a diluent), and the jasmonates may be applied as such. Alternatively, in another exemplary embodiment, in the present disclosure, when the jasmonic acids are provided as a concentrated solution, they are (such as a mixture of

Application in the present disclosure can be any method such as spraying, painting, adding to the growing environment (also referred to as environmental application). As for spraying, in addition to spraying on plants, spraying in the environment can be considered.

In the case of spraying on plants, it is effective to spray on the underside of leaves with many stomata. In the case of foliar application, it may contain adjuvants for foliar retention. Surfactants can be mentioned as such aids.

In the case of environmental spraying, absorption is expected mainly from the roots, so manual spraying from product bags, manual sprayers, mechanical spraying using power sprayers, unmanned helicopters and drones, soil treatment, and stocks. It can be implemented by a technique such as application.

(reduction of planting pain)
The compositions or methods of the present disclosure can reduce or eliminate planting pain. Planting pain refers to a disorder that occurs when planting seedlings (for example, rice, vegetables) when planting or replanting. techniques can be used to reduce or eliminate such disturbances.

It is effective to use 0.5 to 24 hours before transplanting or planting to reduce or eliminate planting pain. When drought, light rain, high temperature, drought, etc. are predicted before transplanting seedlings, it is possible to reduce or eliminate the pain of planting by using it before the occurrence of these phenomena is predicted.

(Drying damage reduction of plants)
The composition or method of the present disclosure can reduce or eliminate drought damage to plants. Drought damage refers to damage that occurs in plant bodies (eg, rice and vegetable seedlings) when water is scarce. Drought damage is damage caused by a shortage of water due to, for example, drought, and it occurs unless an appropriate amount of rain does not fall at appropriate intervals and measures such as irrigation are not taken at the same time. A composition or method of the disclosure can reduce or eliminate such disorders.

In order to reduce or eliminate the damage caused by dryness, it is effective to use it 0.5 to 24 hours before drought, light rain, high-temperature dryness, etc. are expected. When drought, light rain, high-temperature dryness, etc. are predicted, it is possible to reduce or eliminate drought damage by using it before the occurrence of these phenomena is predicted.

(Reduction of deterioration in quality or yield of harvested plant body)
The compositions or methods of the present disclosure can also reduce or improve the quality or yield of the harvest. Suppression of deterioration in quality yield can be confirmed by grain discrimination, the number of grains per panicle (dividing the total number of grains by the number of panicles), and the weight of 1000 grains of unpolished rice (calculated by measuring the grain count of 20 g of polished brown rice). It is possible to suppress or improve the quality and / or yield of harvested products (for example, rice in rice) when using the present disclosure when cultivated in an environment that causes planting pain and drying damage. It can be said that this is a remarkable effect.

In the case of reproductive growth and paddy rice, when drought, light rain, high temperature, aridity, and high-temperature dry wind (foehn) are predicted, especially during the grain-filling period from one week before heading to three weeks after heading, the occurrence of these phenomena. Harvest quality or yield loss can be reduced or eliminated when used 0.5-24 hours before expected If the above weather conditions persist, several applications may be made every 3-7 days.

(for agricultural chemicals)
The compositions of the present disclosure can be used as inhibitors of excessive transpiration in plants (eg, rice) for transient and reversible inhibition. The compositions of the present disclosure can be used during early plant growth. These properties are important in adaptation to transient heat stress such as the Foehn phenomenon and water scarcity. Transient and reversible inhibition is particularly useful because normal growth and harvesting require early recovery from transpiration suppression.

For example, when drought, light rain, high temperature, drought, etc. are expected before transplanting seedlings, drought damage caused during transplanting can be reduced by applying the agent 0.5 to 24 hours before transplanting. In the reproductive growth period and in the case of paddy rice, drought, light rain, high temperature, aridity, and high-temperature dry wind (foehn) are expected, especially during the grain-filling period from one week before heading to three weeks after heading. By applying 0.5 to 24 hours before the expected occurrence of , it not only reduces the deterioration of quality and yield, but also improves quality and yield depending on the application conditions. Spray 0.5 to 24 hours in advance when light rain, high temperature, dryness, hot dry wind (foehn), etc. are expected throughout the cultivation period.

(Cultivation method)
Cultivation of plants herein can be done by any method known in the art. Plant cultivation methods are described, for example, in Paddy Rice Cultivation Guidelines (Niigata Prefecture Agriculture, Forestry and Fisheries Department), etc., which can be referred to as appropriate in the present disclosure, and where necessary, necessary descriptions (preferably the entirety) Incorporated herein by reference.

(Note)
In this specification, "or" is used when "at least one or more" of the items listed in the sentence can be employed. The same applies to "or". When "within a range of two values" is stated herein, the range includes the two values themselves.

All references, such as scientific articles, patents, patent applications, etc., cited herein are hereby incorporated by reference in their entireties to the same extent as if each were specifically set forth.

The present disclosure has been described above showing preferred embodiments for ease of understanding. While the present disclosure will now be described based on the examples, the foregoing description and the following examples are provided for illustrative purposes only and not for the purpose of limiting the present disclosure. The present invention will be described in more detail below by means of Reference Examples, Examples and Test Examples, which are provided for illustrative purposes only and are not intended to limit the present disclosure. The compound names shown in the following Reference Examples and Examples do not necessarily follow the IUPAC nomenclature. Abbreviations may be used for simplification of the description, but these abbreviations have the same meanings as those described above. The scope of the present disclosure is not limited to the embodiments or examples specifically described herein, but only by the claims.

When necessary, the organisms used in the following examples were handled in compliance with the standards set forth by the Japanese government or the National Agriculture and Food Research Organization. In addition, the reagents specifically used the products described in the examples, but equivalent products from other manufacturers (SIGMA-ALDRICH, Wako Pure Chemical, Nacalai Techs, Kanto Kagaku, etc.) can be substituted.

(Example 1: Rice: Comparison between conventional transpiration inhibitors and PDJ)
This example shows a comparison between a conventional transpiration inhibitor and PDJ.

(Material and method)
(Plant growth conditions)
Seeds of rice indica cultivar Takanari were sterilized with 5% ipconazole and 4.6% copper hydroxide, and then germinated by soaking in 1/10 MS medium containing MS vitamins at 25.0° C. under continuous white fluorescence conditions. The germinated seeds were raised under the same conditions as above for 10 to 14 days in seedling soil containing nitrogen, phosphorus, and potassium, and 5 seedlings were transplanted into pots (150 mm×150 mm) containing 350 g of soil. Cultivated in a greenhouse under natural photoperiod conditions of 25° C./20° C. (day/night) for 5 to 6 weeks, up to around tiller stage.

(Application of drug)
To evaluate inhibition of transpiration, 2,000-fold or 20,000-fold dilutions of PDJ (5 wt% PDJ, final concentrations of 98.3 μM and 9.83 μM, respectively, jasmomate; Meiji Seika Pharma Co., Ltd., Japan), 5-fold or 10-fold diluted microcrystalline wax (Greener; 10% microcrystalline wax, Greener Ltd., JP), or 100-fold or 200-fold diluted solution of paraffin wax (Abion C; 36% paraffin wax, Avion Co., Ltd., Japan) ) 100 ml was sprayed on 20 plants with a plastic spray bottle according to the manufacturer's instructions for each drug. As control plants, plants sprayed with a 2000-fold dilution of the solvent in the case of PDJ, or with tap water used for dilution in other cases were used.

(Measurement of transpiration amount)
Transpiration was measured using a porometer (AP4, Delta-T, UK) at 0.5 hours, 1 day, 2 days and 7 days after PDJ treatment and from paraffin wax and microcrystalline wax treatments. After 3 hours, 2 days and 7 days measurements were taken as above. At the same time, 0, 0.5, 2, and 7 days after PDJ treatment, and 2 and 7 days after paraffin wax and microcrystalline wax treatments, a thermo camera (Thermal Shot F30S, NEC/Avio ) was used to acquire thermal images. Thermal images were analyzed using image analysis software (NS9500LT, Avio, Japan). Two independent similar experiments were performed.

(result)
In this example, first, experimental conditions were examined using a microcrystalline wax agent that is commonly used to suppress transpiration in various plants including rice. Stomatal conductance was measured using a porometer on unfolded leaves of indica rice cultivar Takanari sprayed with microcrystalline wax. About 50% of the amount of transpiration was suppressed 3 hours after spraying a 5-fold or 10-fold dilution of the microcrystalline wax agent. The effect lasted for 2 days regardless of the drug concentration. The effect was seen even after 7 days of treatment (Table 1).

Suppression of transpiration in foliage can also be monitored by leaf foliage temperature (Fukuda et al., 2018, Iseki and Olaleye, 2020). Therefore, thermal images were taken using a thermo camera. The foliage temperature of control plants was also found to be lower than that of plants sprayed with microcrystalline wax 2 days after treatment. Differences between treated and control groups were seen even after 7 days of treatment (Fig. 1).

A 100-fold or 200-fold dilution of the paraffin wax agent reduced the amount of transpiration by about 35% to 50% 3 hours after spraying, regardless of the concentration of the agent. This effect persisted for 2 days and was detectable even after 7 days of treatment (Table 2).

However, the foliage temperatures in the thermal images after 2 and 7 days of treatment were not significantly different from those in the control images (Fig. 2).

In plants sprayed with paraffin wax, transpiration could not be monitored by thermal imaging, but was clearly suppressed. The reason why the foliage temperature failed to reflect the inhibitory effect of the paraffin agent is unknown, but it may be due to the presence of surfactants in the solvent.

These agents physically coat the leaf surface and their effects cannot be measured with a porometer until they dry to a waxy coating. Therefore, no initial response was detected by the porometer. Therefore, thermal images of plants sprayed with either microcrystalline wax or paraffin wax, taken 0.5 hours later, initially showed no clear difference from plants sprayed with these agents (Fig. 3, 4).

Although no difference between the microcrystalline and paraffin wax agents was revealed in this example, both agents were clearly able to inhibit transpiration in a greenhouse under natural light conditions.

Using the method used to confirm the effect of microcrystalline wax and paraffin wax application, a 2,000-fold or 20,000-fold dilution of the PDJ solution was applied to the fully expanded leaves to determine the transpiration control effect of PDJ. investigated. PDJ treatment reduced transpiration by approximately 40% to 80% 0.5 hours after spraying, regardless of concentration. Inhibition with PDJ was observed 1 day after nebulization and disappeared 2 and 7 days after 20,000-fold dilution nebulization. The disappearance of the inhibitory effect observed 1 day after spraying of the 2,000-fold dilution was faster than that of the 20,000-fold dilution (Table 3).

This result suggests that the concentration at the 20,000-fold dilution was sufficient to inhibit transpiration, and it is possible that the 2000-fold dilution induced a negative feedback response faster than the 20,000-fold dilution. Therefore, the concentration of PDJ should be selected according to its intended use. Leaf flock temperature was monitored at 0.5 and 3 hours and 2 and 7 days after PDJ treatment. Control plants had lower foliage temperature than plants sprayed with PDJ 0.5 hours after treatment, although differences in the concentration of sprayed PDJ were unclear. No effect of PDJ was seen after 2 and 7 days. This is consistent with stomatal conductance measurement data (Fig. 5).

Since PDJ early and transiently suppressed transpiration in rice compared to other agents, the results of this example demonstrate that PDJ is a physical stimulus induced by commercially available microcrystalline wax agents and paraffin wax agents. suggest that it functions to inhibit transpiration in a manner that is different from that of transpiration inhibition. These agents physically sealed the stomata or leaf surface and their effect was seen 3 hours after treatment and up to 7 days after treatment. This result indicates that the anti-transpiration effect of the microcrystalline wax agent and the paraffin wax agent is not temporary, and that the effect continues for about one week.

Since PDJ is a derivative of JA, it functions partly like JA. Classically, the methyl ester of JA (MeJA) induces water stress tolerance in several plant species including soybean and barley (Horton, 1991; Wang et al., 2020). 12-oxo-phytodienoic acid (12-OPDA), the precursor of JA, functions together with ABA as a regulator of stomatal closure in Arabidopsis thaliana (Savchenko, et al., 2014). In view of these reports, JA, its derivatives and precursors play an important role in adaptation to drought stress by stomatal closure, but effective concentrations and timings vary by compound and plant species. PDJ acts rapidly and is active in relatively small amounts. The effect was detected 0.5 hours after spraying with a 20,000-fold dilution of PDJ (a 20,000-fold dilution (9.8 μM) of a 5% by weight PDJ concentration solution), and was detected 1 day after spraying. Although it was observed, it disappeared two days after spraying (Table 3, Fig. 5).

Of course, the hormonal response is reversible and stomatal closure is controlled by various signals such as light, humidity and glycolysis (Daszkowska-Golec and Szarejko, 2013, Lawson and Matthews, 2020). Therefore, the long-term inhibitory effect of external application of PDJ is unstable, and negative feedback regulation can be induced depending on the PDJ concentration.

In summary, PDJ can be used as an inhibitor of excessive transpiration in rice, especially due to its initial transient and reversible inhibition. These properties are important in adaptation to transient heat stress such as the Foehn phenomenon and water scarcity. On the other hand, normal growth and harvest require early recovery from transpiration suppression. However, MeJA has been reported to inhibit stomata development in Arabidopsis thaliana (Deng et al., 2020).

(Example 2: Suppression of planting pain when transplanting seedlings)
(Method)
If drought, light rain, high temperature, dryness, etc. are expected before transplanting seedlings, spray 20,000-fold diluted PDJ, or in some cases 2000-fold diluted PDJ for paddy rice 0.5 to 24 hours before transplanting.
(result)
By spraying PDJ, it is possible to suppress planting pain when transplanting seedlings.

(Example 3: Suppression of yield and quality deterioration due to overtranspiration caused by dryness damage and high temperature during ripening)
(Method)
0.5 to 24 hours during the reproductive growth period and paddy rice, especially during the grain-filling period from 1 week before heading to 3 weeks after heading, when drought, light rain, high temperature, dryness, and hot dry wind (foehn) are expected. Spray application of PDJ, diluted 20,000 and possibly 2000 before. At this time, if the above weather conditions persist, several applications may be made every 3-7 days.
(result)
By spraying PDJ, it is possible to suppress yield and quality deterioration due to excessive transpiration caused by drying damage and high temperature during ripening.

(Example 4: Suppression of rice leaf blight (Nagasaki Prefecture) and white ears (Niigata Prefecture) due to high-temperature dry wind (foehn))
(Method)
Spray 20,000 diluted PDJ, sometimes 2000 times diluted, 0.5 to 24 hours before when light rain, high temperature, dryness, hot dry wind (foehn), etc. is expected throughout the cultivation period. At this time, if the above weather conditions persist, several applications may be made every 3-7 days.
(result)
By spraying PDJ, it is possible to control rice leaf blight and white spikes caused by high-temperature dry wind (foehn).

(Example 5: agent)
The composition of the present disclosure can be provided in any formulation, for example, as a liquid formulation as follows. These can be made by mixing the ingredients presented.
Jasmomate solution undiluted propyl = 3 oxo-2-pentylcyclopentyl acetate
(generic name: prohydjasmon) 1.0-10.0w/v% (e.g. 5.0w/v%)
1-propanol 30.0-40.0w/v% (e.g. 33.0w/v%)
Surfactant 25.0-35.0w/v% (e.g., 30.0%w/v%)
remaining water

At the time of use, instructions can be attached to use at an appropriate magnification (eg, 2000-fold dilution (eg, PDJ final concentration 100 μM)).

(Example 6: gene expression analysis)
The conventionally cultivated cultivar Hinohikari was placed in a 1/5000a Wagner pot around the young panicle differentiation stage, and 20 mL of PDJ (Jasmomate, Meiji Seika Pharma Co., Ltd., Japan) diluted 2,00 times on the 7th day of ear emergence was added. Each pot was sprayed. RNAseq analysis was performed by extracting total RNA from glume flowers that had been allowed to stand for one day and night in an artificial stage room set at 32/28°C (day/night). Plants sprayed with a 2,000-fold dilution of the solvent were used as control plants.

RNASeq analysis is as follows.
After PDJ treatment, total RNA was extracted from glume flowers that had been allowed to stand for one day and night, and a library was constructed using KAPA Stranded mRNA-Seq Kit (KAPABIOSYSTEMS). At that time, amplification by PCR was performed for 14 cycles, and an adapter of Fast Gene Adapter Kit (Fast Gene) was used. Using Fragment Analyzer High Sensitivity NGS Fragment Analysis Kit (Advanced Analytical Technologies), the quality of the prepared library was confirmed, and sequencing was performed using NextSeq500 under the condition of 2x76bp. The obtained reads were quality-checked using Sickle (ver. 1.33), bases with a value of less than 20 were removed, and reads with fragment lengths of 30 bases or less and their paired reads were discarded. The filtered reads were mapped to the reference sequence (The Rice Annotation Project Database http://rapdb.dna.affrc.go.jp/download/irgsp1.html) using Hisat2 (ver.2.1.0) and analyzed using Samtools bam file was obtained using (ver.1.3). Read sequences mapped onto the gene region were counted using feature Counts (ver.1.5.0p3). After normalization using the iDEGES normalization method, DESeq was used to identify differentially expressed genes.

The sequences of the primers used are as follows.
(Primer sequence used for library creation)
(index ligation)
Ad153_5T_1-index/5Phos/AGTCGGAGGCCAAGCGGTCTTAGGAAGACAATGAAGCGTTGCAACTCCTTGGCTCACA (SEQ ID NO: 1)
Ad153_5T_1-index/5Phos/AGTCGGAGGCCAAGCGGTCTTAGGAAGACAACGTGCGATCCCAACTCCTTGGCTCACA (SEQ ID NO: 2)
MGI Tech Co.,Ltd Tech. Support Center Field Application Support Team
Ad153_5T_1-index/5Phos/AGTCGGAGGCCAAGCGGTCTTAGGAAGACAATCGGAAGGCACAACTCCTTGGCTCACA (SEQ ID NO: 3)
Ad153_5T_1-index/5Phos/AGTCGGAGGCCAAGCGGTCTTAGGAAGACAACCGATGTCGCCAACTCCTTGGCTCACA (SEQ ID NO: 4)
Ad153_5T_1-index/5Phos/AGTCGGAGGCCAAGCGGTCTTAGGAAGACAAACTTAGAATGCAACTCCTTGGCTCACA (SEQ ID NO: 5)
Ad153_5T_1-index/5Phos/AGTCGGAGGCCAAGCGGTCTTAGGAAGACAATCCAAGCCTGCAACTCCTTGGCTCACA (SEQ ID NO: 6)
Ad153_5T_1-index/5Phos/AGTCGGAGGCCAAGCGGTCTTAGGAAGACAAAGACGATGATCAACTCCTTGGCTCACA (SEQ ID NO: 7)
Ad153_5T_1-index/5Phos/AGTCGGAGGCCAAGCGGTCTTAGGAAGACAAAGTCTCGTGTCAACTCCTTGGCTCACA (SEQ ID NO: 8)
Ad153Ω_Bottom_2:
TTGTCTTCCTAAGGAACGACATGGCTACGATCCGACTT (SEQ ID NO: 9)
(Amplification by PCR)
Ad153_PCR2_2: TGTGAGCCAAGGAGTTG (SEQ ID NO: 10)
Ad153_PCR2_1:/5Phos/GAACGACATGGCTACGA (SEQ ID NO: 11)

(sequence)
Read 1 sequencing primer: GCTCACAGAACGACATGGCTACGATCCGACTT (SEQ ID NO: 12)
Read 2 sequencing primer: TTGTCTTCCTAAGACCGCTTGGCCTCCGACTT (SEQ ID NO: 13)

(adapter sequence)
Read1 side: AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA (SEQ ID NO: 14)
Read2 side: AAGTCGGATCGTAGCCATGTCGTTCTGTGAGCCAAGGAGTTG (SEQ ID NO: 15)

The results are shown in FIG. For each gene, the control expression level is shown as 1.
These results indicated that gene products related to transpiration were suppressed.

(Note)
While the invention has been illustrated using the preferred embodiments thereof, it is understood that the invention is to be construed in scope only by the appended claims. The patents, patent applications and other publications cited herein are hereby incorporated by reference in their entirety to the same extent as if the content itself were specifically set forth herein. It is understood.

The present disclosure can be utilized in agriculture, particularly in the cultivation of cereals.

SEQ ID NO: 1: Primer sequence for index ligation SEQ ID NO: 2: Primer sequence for index ligation SEQ ID NO: 3: Primer sequence for index ligation SEQ ID NO: 4: Primer sequence for index ligation SEQ ID NO: 5: Primer sequence for index ligation SEQ ID NO: 6: Index Primer sequence for ligation SEQ ID NO: 7: Primer sequence for index ligation SEQ ID NO: 8: Primer sequence for index ligation SEQ ID NO: 9: Primer sequence for index ligation SEQ ID NO: 10: Primer sequence for PCR amplification SEQ ID NO: 11: Primer sequence for PCR amplification Number 12: Primer sequence for sequencing SEQ ID NO: 13: Primer sequence for sequencing SEQ ID NO: 14: Adapter sequence SEQ ID NO: 15: Adapter sequence

Claims (44)

A composition for suppressing transpiration of a plant body or part thereof, containing jasmonic acids. 2. The composition of claim 1, wherein said transpiration inhibition is reversible. 3. The composition according to claim 1 or 2, wherein the jasmonic acids comprise jasmonic acid or a jasmonic acid derivative. 4. The composition of claim 3, wherein the jasmonic acid derivative is prohydrojasmone or a derivative thereof. The jasmonic acid derivative is selected from the group consisting of methyl jasmonate, prohydrojasmone, isoleucine jasmonate, phenylalanine jasmonate, valine jasmonate, jasmonate glucoside, epijasmonic acid, methyl epijasmonate, dihydrojasmonic acid and tuberonic acid. 4. The composition of claim 3, wherein A composition according to any one of claims 3 to 5, wherein the jasmonic acid derivative is prohydrojasmone. The composition according to any one of claims 1 to 6, wherein the plant is a monocotyledon. The composition according to any one of claims 1 to 7, wherein said plant is a cereal. The composition according to any one of claims 1 to 8, wherein the plant is a gramineous plant. The composition according to any one of claims 1 to 9, wherein said plant is an aquatic plant. A composition according to any one of claims 1 to 6, wherein the plant is an emergent plant or a wet plant. The composition according to any one of claims 1 to 6, wherein the plant is paddy rice. 13. The dosage form according to any one of claims 1 to 12, which is a dosage form selected from the group consisting of liquid formulations, granules, flowable formulations, jumbo formulations, emulsions, wettable granules, powders, microcapsules and aerosols. composition. The composition according to any one of claims 1 to 8, wherein the jasmonic acids are prohydrojasmone, and the prohydrojasmone is used after being diluted to 10 µM to 100 µM. The composition according to any one of claims 1 to 15, wherein the jasmonic acids are prohydrojasmone, and the prohydrojasmone is used for suppressing transpiration for 0.5 hours or more and less than 2 days after application. thing. A method for reversibly inhibiting transpiration of a plant, comprising the step of applying jasmonates to the plant. 17. The method of claim 16, wherein the jasmonic acids comprise jasmonic acid or jasmonic acid derivatives. 18. The method of claim 17, wherein the jasmonic acid derivative is prohydrojasmone or a derivative thereof. The jasmonic acid derivative is selected from the group consisting of methyl jasmonate, prohydrojasmone, isoleucine jasmonate, phenylalanine jasmonate, valine jasmonate, jasmonate glucoside, epijasmonic acid, methyl epijasmonate, dihydrojasmonic acid and tuberonic acid. 18. The method of claim 17, wherein The method according to claims 17-19, wherein said jasmonic acid derivative is prohydrojasmone. The method according to any one of claims 16 to 20, wherein the plant is monocotyledonous. The method according to any one of claims 16 to 21, wherein the plant is cereal. The method according to any one of claims 16 to 22, wherein the plant is a gramineous plant. The method according to any one of claims 16 to 23, wherein said plant is an aquatic plant. A method according to any one of claims 16 to 20, wherein said plant is an emergent plant or a wet plant. The method according to any one of claims 16 to 20, wherein the plant is paddy rice. The method according to any one of claims 16 to 26, wherein the jasmonic acids are prohydrojasmone, and the prohydrojasmone is used after being diluted to 10 µM to 100 µM. The method according to any one of claims 16 to 27, wherein the jasmonic acids are prohydrojasmone, and the prohydrojasmone is used for suppressing transpiration for 0.5 hours or more and less than 2 days after application. . A composition for alleviating the planting pain of plants, the composition containing jasmonates. A composition for reducing drought damage to plants, the composition containing jasmonates. A composition for alleviating deterioration in the quality or yield of harvested plants, the composition containing jasmonates. A composition according to any one of claims 29 to 31, wherein said jasmonic acids comprise jasmonic acid or a jasmonic acid derivative. 33. The composition of claim 32, wherein the jasmonic acid derivative is prohydrojasmone or a derivative thereof. The jasmonic acid derivative is selected from the group consisting of methyl jasmonate, prohydrojasmone, isoleucine jasmonate, phenylalanine jasmonate, valine jasmonate, jasmonate glucoside, epijasmonic acid, methyl epijasmonate, dihydrojasmonic acid and tuberonic acid. 33. The composition of claim 32, wherein The composition according to claims 32-34, wherein said jasmonic acid derivative is prohydrojasmone. The composition according to any one of claims 29 to 35, wherein said plant is a monocotyledon. A composition according to any one of claims 29 to 36, wherein said plant is a cereal. The composition according to any one of claims 29 to 37, wherein the plant is a gramineous plant. A composition according to any one of claims 29 to 38, wherein said plant is an aquatic plant. A composition according to any one of claims 29 to 35, wherein said plant is an emergent or wet plant. The composition according to any one of claims 29 to 35, wherein said plant is paddy rice. The dosage form according to any one of claims 29 to 41, which is a dosage form selected from the group consisting of liquid, granule, flowable, jumbo, emulsion, wettable powder, powder, microcapsule and aerosol. composition. The composition according to any one of claims 29 to 42, wherein the jasmonic acids are prohydrojasmone, and the prohydrojasmone is used after being diluted to 10 µM to 100 µM. The composition according to any one of claims 29 to 43, wherein the jasmonic acids are prohydrojasmone, and the prohydrojasmone is used for suppressing transpiration for 0.5 hours or more and less than 2 days after application. thing.

Images