JP2020137423A - Novel sugar chain-binding proteins and polynucleotides encoding same - Google Patents

Abstract

To provide novel sugar chain-binding proteins and polynucleotides encoding them.SOLUTION: The invention provides a polynucleotide encoding a sugar chain-binding protein, preferably comprising a specific nucleotide sequence derived from the genus Bryopsis, a protein having sugar chain-binding property, preferably comprising a specific amino acid sequence derived from the genus Bryopsis, and a pharmaceutical composition comprising the protein for treating or diagnosing cancer.SELECTED DRAWING: None

Description

The present invention relates to novel proteins and polynucleotides encoding them, and in particular to sugar chain binding proteins and polynucleotides encoding them.

Glycan chains of complex carbohydrates such as glycoproteins and glycolipids present on the cell surface and body fluids function as a kind of information element and are deeply involved in important biological phenomena such as development, immunity, cancer, and infection. .. On the other hand, lectin, which is a sugar chain-binding protein, functions as a sugar chain recognition molecule and plays an important biological role like sugar chains.

So far, many types of lectins have been isolated from seaweeds or algae (freshwater cyanobacteria), and their biochemical properties have been clarified. It is known that a part of lectins specifically binds to viruses such as human immunodeficiency virus (HIV) and influenza virus (Non-Patent Documents 1 to 11). In addition, sugar chains are not limited to viruses, but are also related to cancer as described above. In recent years, sulfated glycosaminoglycans have been a major cancer immune antigen in cancer tissues (non-patent documents). 12) It has been reported that it is deeply involved in the development and metastasis of cancer cells (Non-Patent Documents 13 and 14).

Boyd, M.R. et al., Antimicrob. Agents Chemother.41, 1521-1530, 1997. O’Keefe, B.R. et al., Antimicrob. AgentsChemother. 47, 2518-2525, 2003. Helle, F., .et al., J. Biol. Chem. 281, 25177-25183, 2006. Barrientos, LG., Et al., Antiviral. Res. 58, 47-56, 2003. Dey, B., et al., J. Virol. 74, 4562-4569, 2000. O’Keefe, B.R. et al., J. Virol. 84, 2511-2521, 2010. Hori, K. et al., Glycobiology, 17, 479-491, 2007. Sato, Y., Okuyama, S., and Hori, K., J. Biol. Chem. 282, 11021-11029, 2007. Sato, Y., Morimoto, K., Hirayama, M., and Hori, K. Biochem. Biophys. Res. Commun. 405,291-296, 2011. Yuichiro Sato, Makoto Hirayama, Yoshifumi Fujiwara, Kinjiro Morimoto, Kanji Hori (2010) Abstracts of the 13th Annual Meeting of the Marine Biotechnology Society (announced on May 29, 2010) Sato, Y., Hirayama, M., Morimoto, K., Yamamoto, N., Okuyama, S., and Hori, K.J. Biol.Chem. 286, No.22, 19446-19458, 2011. Hiroto Kato et al., Cell Reports. 20,1073-1087, 2017. Adam Pudelko et al., The FEBS Journal (First published: 13 January2019, online: https://doi.org/10.1111/febs.14748) Shuji Mizumoto et al., J. Biol. Chem.287, 18985-18994, 2012.

However, at present, it is difficult to say that a substance that specifically recognizes such a sulfated glycosaminoglycan sugar chain is sufficiently known, and the number is limited, so that the above substance is sufficient. It is not in a situation where it can be supplied to. Since such substances have the potential to be used in the treatment and diagnosis of cancer, it is necessary that more new substances be found and their properties clarified.

The present invention has been made in view of the above problems, and an object of the present invention is to search for and provide a novel protein that recognizes a sulfated sugar chain that may be used for the diagnosis and treatment of cancer as described above. To be able to do it.

In order to achieve the above object, the present inventors have synthesized cDNA from RNA obtained from algae of the genus Bryopsidales as a result of diligent research, and expressed a novel protein (lectin) from the cDNA. I succeeded in making it.

Specifically, the novel polynucleotide according to the present invention encodes a sugar chain-binding protein and contains the nucleotide sequence of SEQ ID NO: 1 or 2, or the nucleotide sequence of SEQ ID NO: 1 or 2 or a sequence complementary thereto. It is characterized by containing a nucleotide sequence that hybridizes with and stringent conditions.

In addition, the polynucleotide according to the present invention may be derived from the genus Bryopsidales such as Bryopsidales (Bryopsis corticulans), Bryopsidales (Bryopsis plumose), and Bryopsidales (Bryopsis maxima).

The novel protein according to the present invention has sugar chain binding property, and one or several amino acids are substituted in the amino acid sequence shown in SEQ ID NO: 3 or 4 or the amino acid sequence shown in SEQ ID NO: 3 or 4. It is characterized by containing a deleted, inserted or added amino acid sequence.

In addition, the novel protein according to the present invention is characterized in that it specifically recognizes a sugar chain containing a sulfate group, and is a Bryopsidales such as Bryopsidales (Bryopsis corticulans), Bryopsidales (Bryopsis plumose), and Bryopsidales (Bryopsis maxima). It may be derived from a genus.

The pharmaceutical composition for treating or diagnosing cancer according to the present invention is characterized by containing the above-mentioned novel protein according to the present invention. Because the pharmaceutical composition according to the present invention contains the above-mentioned novel protein that can recognize a sugar chain containing a sulfate group such as a sulfated glycosaminoglycan that is expressed in cancer cells and is known to be a cancer antigen. , Can be used for cancer treatment and cancer diagnosis.

The polynucleotide according to the present invention encodes a novel sugar chain-binding protein, and since the novel protein can recognize a sulfated sugar chain as a cancer antigen, it may be used for cancer treatment or diagnosis. , Extremely useful.

It is a figure which shows the nucleotide sequence and the deductive amino acid sequence of the full-length cDNA of BcBry1-1 obtained in Example 1. It is a figure which shows the nucleotide sequence and the deductive amino acid sequence of the full-length cDNA of BcBry1-2 obtained in Example 1. It is a photograph which shows the result of SDS-PAGE for confirming the expression of His-rBcBry1-1 in Example 2. It is a photograph which shows the result of SDS-PAGE for examining the enzyme digestion condition by Factor Xa for His-rBcBry1-1 in Example 2. 6 is a photograph showing the results of SDS-PAGE and Western blotting for examining the detectability of His-rBcBry1-1 by an anti-His tag antibody in Example 2. It is a figure which shows the sugar chain used in the sugar chain immobilization array in Example 4. 3 is a photograph showing the results of SDS-PAGE and Western blotting for examining the detectability of His-rBcBry1-1N and C by Anti-His-tag-Alexa Fluor 647 in Example 4. It is a graph which shows the result of the sugar chain immobilization array of His-rBcBry1-1C in Example 4.

Hereinafter, embodiments for carrying out the present invention will be described with reference to the drawings. The following description of preferred embodiments is merely exemplary and is not intended to limit the invention, its application methods or its uses.

One embodiment of the present invention is a novel protein (BcBry1) derived from Bryopsidales (Bryopsis corticulans), which is a Bryopsidales algae. The novel protein according to the present invention has sugar chain binding property and is encoded by, for example, a polynucleotide containing the nucleotide sequence of SEQ ID NO: 1 or 2. The amino acid sequences of the proteins expressed by the nucleotide sequence of SEQ ID NO: 1 or 2 are shown in SEQ ID NO: 3 or 4, respectively.

The term "protein" as used herein is used interchangeably with "peptide" or "polypeptide". In addition, the protein according to the present invention may be isolated from a natural source or chemically synthesized.

The term "isolated" polypeptide or protein is intended to be a polypeptide or protein taken from its natural environment. On the other hand, even in the case of recombinantly produced polypeptides and proteins expressed in a host cell, those that have been substantially purified by any suitable technique and isolated from the host cell are used.

The proteins according to the invention are from natural purified products, products of chemical synthesis procedures, and prokaryotic or eukaryotic hosts (including, for example, bacterial cells, yeast cells, higher plant cells, insect cells and mammalian cells). Includes products produced by recombinant techniques. Depending on the host used in the recombinant production procedure, the proteins according to the invention can be glycosylated or non-glycosylated. In addition, the proteins according to the invention may contain an initiating modified methionine residue as a result of a host-mediated process.

In one embodiment, the protein according to the invention is a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 3 or 4, or a variant of the polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 3 or 4. The protein according to the present invention is characterized by being a novel protein having very low homology with the amino acid sequence of a conventionally known lectin.

Variants include deletions, insertions, reversals, repetitions, and type substitutions (eg, substitution of a hydrophilic residue with another, but usually a strongly hydrophilic residue and a strongly hydrophobic residue. Does not replace). In particular, "neutral" amino acid substitutions in a polypeptide generally have little effect on the activity of that polypeptide.

It is well known in the art that some amino acids in the amino acid sequence of a polypeptide can be easily modified without significantly affecting the structure or function of the polypeptide. Furthermore, it is also well known that there are variants of intrinsically disordered proteins that are not only artificially modified but do not significantly alter the structure or function of the protein.

One of ordinary skill in the art can easily mutate one or several amino acids in the amino acid sequence of a polypeptide using well-known techniques. For example, any known base of a polynucleotide encoding a polypeptide can be mutated according to a known point mutation introduction method. In addition, a primer corresponding to an arbitrary site of a polynucleotide encoding a polypeptide can be designed to prepare a deletion mutant or an addition mutant. Furthermore, by using the methods described herein, it can be easily determined whether or not the produced mutant is a desired mutant having sugar chain binding property.

The above "one or more amino acids have been substituted, deleted, inserted, or added" means that the term "substitute, deleted, inserted, or added by a known mutagenesis method such as a site-specific mutagenesis method" is used. A sufficient number of amino acids (preferably 1 to 10, more preferably 1 to 7, still more preferably 1 to 5, particularly preferably 1 to 3) can be substituted, deleted, inserted or added. It means that it has been done. As described above, such a mutant polypeptide is not limited to a polypeptide having a mutation artificially introduced by a known mutant polypeptide preparation method, and a naturally occurring polypeptide is isolated and purified. It may be a peptide.

In other embodiments, the polypeptides of the invention can be recombinantly expressed in modified forms such as fusion proteins. For example, regions of additional amino acids, especially charged amino acids, of the polypeptides according to the present invention may improve stability and persistence in a host cell during purification or subsequent manipulation and storage. It can be added to the N-terminus of the polypeptide.

Recombinant production can be carried out using methods well known in the art, for example using vectors and cells as detailed below.

The present inventors have found that the protein according to the present invention recognizes a sugar chain containing a sulfate group. Here, the "sugar chain" means a linear or branched oligosaccharide or polysaccharide. In addition, the above sugar chains bind to N-glycosidic bond sugar chains (hereinafter referred to as "N-type sugar chains" and "N-glycans") that bind to asparagine, and O- that binds to serine, threonine, etc., depending on the binding mode to proteins. Glycosidic bond sugar chains (hereinafter referred to as "O-type sugar chains" and "O-glycans") are roughly classified, and Lewis type, ABO type, glycosaminoglycan (GAG), Lac series and the like are also known. ..

The oligosaccharide refers to a monosaccharide or a monosaccharide substituted derivative formed by dehydration bonding of 2 to 10 monosaccharides. A carbohydrate to which a large number of monosaccharides are bound is called a polysaccharide. Although polysaccharides differ depending on the type of constituent sugars, sugars containing a large amount of uronic acid and ester sulfuric acid are called acidic polysaccharides, and those containing only neutral sugars are called neutral polysaccharides. Of the polysaccharides, most of the group of polysaccharides called mucopolysaccharides are bound to proteins and are called proteoglycans. A monosaccharide is a constituent unit of a sugar chain, and is a basic substance that cannot be made into a simpler molecule by hydrolysis.

Further, monosaccharides are roughly classified into three types: acidic sugars having an acidic side chain such as a carboxyl group, amino sugars in which a hydroxyl group is replaced with an amino group, and other neutral sugars. Examples of monosaccharides existing in the living body include sialic acid such as N-acetylneuraminic acid and N-glycolylneuraminic acid (hereinafter referred to as "Neu5Gc"), uronic acid, and the like as amino sugars. Examples include N-acetylglucosamine (hereinafter referred to as "GlcNAc") and N-acetylgalactosamine, and examples of neutral sugars include glucose, mannose, galactose, and fucose.

Whether or not the polypeptide binds to the sugar chain can be determined by using the method shown in the following Examples, but in addition, for example, a target sugar chain or a column on which a glycoprotein to which the sugar chain is bound is immobilized. , And whether or not the polypeptide is bound to the column through the polypeptide to be tested is evaluated by the amount of the polypeptide contained in the passing solution or the amount of the polypeptide eluted from the column with a specific eluent. be able to. In addition, Western blotting (Practice and Research of Forensic Medicine, 37, 155,) in which a glycoprotein to which a target sugar chain is bound is immobilized on a membrane or the like and detected using a polypeptide labeled with biotin, fluorescein isothiocyanate, peroxidase, etc. (See 1994), dot blotting (see Analytical Biochemistry, 204 (1), 198, 1992), etc. can be used for evaluation.

The present invention provides a polynucleotide encoding a polypeptide according to the present invention, as described above. As used herein, the term "polynucleotide" is used interchangeably with "nucleic acid" or "nucleic acid molecule" and is intended to be a polymer of nucleotides. As used herein, the term "base sequence" is used interchangeably with "nucleic acid sequence" or "nucleotide sequence" and is a sequence of deoxyribonucleotides (abbreviated as A, G, C and T). Shown as.

The polynucleotide according to the invention can be present in the form of RNA (eg, mRNA) or DNA (eg, cDNA or genomic DNA). The DNA can be double-stranded or single-stranded. The single-stranded DNA or RNA can be a coding strand (also known as the sense strand) or a non-coding strand (also known as the antisense strand).

As used herein, the term "oligonucleotide" is intended to be a combination of several to dozens of nucleotides and is used interchangeably with "polynucleotide". The short ones are called dinucleotides (dimers) and trinucleotides (trimers), and the long ones are represented by the number of polymerized nucleotides such as 30 mer or 100 mer. Oligonucleotides may be produced as fragments of longer polynucleotides or chemically synthesized.

In addition, the polynucleotide according to the present invention can be fused to a polynucleotide encoding the above-mentioned tag label (tag sequence or marker sequence) on the 5'side or 3'side thereof.

The present invention further relates to variants of the polynucleotide encoding the polypeptide according to the invention. Mutants can occur naturally, like natural allelic variants. An "allelic variant" is intended as one of several exchangeable forms of a gene that occupies a given locus on an organism's chromosome. Non-naturally occurring variants can be produced, for example, using mutagenesis techniques well known in the art.

Examples of such a mutant include a mutant in which one or several bases are deleted, substituted, or added in the base sequence of the polynucleotide encoding the polypeptide according to the present invention. Mutants can be mutated in the coding and / or non-coding regions. Mutations in the coding region can result in conservative or non-conservative amino acid deletions, substitutions, or additions.

The present invention further provides an isolated polynucleotide comprising a polynucleotide encoding a polynucleotide according to the invention or a polynucleotide hybridizing to the polynucleotide under stringent hybridization conditions.

The above-mentioned "stringent condition" means that hybridization occurs only when at least 90% or more identity, preferably at least 95% or more identity, and most preferably 97% or more identity exists between sequences. Means to happen.

The hybridization can be performed by a well-known method such as that described in Sambrook et al., Molecular Cloning, A Laboratory Manual, 2d Ed., Cold Spring Harbor Laboratory (1989). Generally, the higher the temperature and the lower the salt concentration, the higher the stringency (difficulty in hybridization), and more homologous polynucleotides can be obtained.

Conventionally known conditions can be preferably used as the hybridization conditions, and the conditions are not particularly limited. For example, 42 ° C., 6 × SSPE, 50% formamide, 1% SDS, 100 μg / ml salmon sperm DNA, 5 × Denhardt's solution (however, 1 x SSPE; 0.18 M sodium chloride, 10 mM sodium phosphate, pH 7.7, 1 mM EDTA. 5 x Denhardt's solution; 0.1% bovine serum albumin, 0.1% ficol, 0.1% Polyvinylpyrrolidone) can be mentioned.

The polynucleotide or oligonucleotide according to the present invention includes not only double-stranded DNA but also single-stranded DNA and RNA such as the sense strand and antisense strand constituting the double-stranded DNA. In addition, DNA includes, for example, cDNA and genomic DNA obtained by cloning, chemical synthesis technology, or a combination thereof. Furthermore, the polynucleotide or oligonucleotide according to the present invention may include a sequence such as a sequence of an untranslated region (UTR) or a vector sequence (including an expression vector sequence).

Examples of the method for obtaining the polynucleotide or oligonucleotide according to the present invention include a method for isolating and cloning a DNA fragment containing the polynucleotide or oligonucleotide according to the present invention by a known technique. For example, a probe that specifically hybridizes with a part of the nucleotide sequence of the polynucleotide in the present invention may be prepared, and a genomic DNA library or a cDNA library may be screened. As such a probe, any sequence and / or length can be used as long as it is a probe that specifically hybridizes to at least a part of the nucleotide sequence of the polynucleotide according to the present invention or its complementary sequence. Good.

Alternatively, as a method for obtaining the polynucleotide according to the present invention, a method using an amplification means such as PCR can be mentioned. For example, among the cDNAs of the polynucleotide in the present invention, primers are prepared from the 5'side and 3'side sequences (or their complementary sequences), respectively, and genomic DNA (or cDNA) or the like is used as a template using these primers. By performing PCR or the like to amplify the DNA region sandwiched between the two primers, a large amount of DNA fragment containing the polynucleotide according to the present invention can be obtained.

Hereinafter, examples for explaining in detail the novel protein according to the present invention and the polynucleotide encoding the same are shown.

[Example 1: cDNA cloning of BcBry-1 derived from Nezashihanemo]
<Method>
(Sample for RNA collection)
As a sample for RNA collection, a sample of Bryopsis corticulans algae collected in Ujina, Hiroshima City, Hiroshima Prefecture, which had been shredded in RNAlater (Ambion) and stored at -30 ° C until use, was used.

(Extraction of total RNA, purification of mRNA and synthesis of cDNA)
Total RNA was extracted from the above sample using Pure Link Plant RNA Reagent (Invitrogen), and the obtained total RNA was used as a sample to purify mRNA using NucleoTrap mRNA (Macherey-Nagel). Furthermore, full-length cDNA was synthesized from the same mRNA using the GeneRacer Kit (Invitrogen). All operations were performed according to the manual attached to the kit.

(CDNA cloning of BcBry-1)
The Rapid Amplification of cDNA Ends (RACE) method for Bry-1 (BcBry-1) derived from Nezashihanemo (Bryopsis corticulans) was performed according to the manual using GeneRacer KitTM (Invitrogen) and Blend Taq® (TOYOBO). First, degenerate primers Bry1-F1 and Bry1-F2 were designed with reference to the N-terminal partial amino acid sequence of Bry-1 derived from known Bryopsis sp., And 3'RACE was performed. First, a PCR product (annealing temperature 52 ° C.) amplified using a primer pair of Bry1-F1 (5'-GGIGGITAYGTIATHAA-3'; SEQ ID NO: 5) and GeneRacer 3'primer was excised and purified after agarose gel electrophoresis. .. Here, I is an IUB code indicating inosine, Y is C or T, and H is A or C or T, respectively. Using this as a template, PCR amplification (annealing temperature 64 ° C.) was further performed using a primer pair of Bry1-F2 (5'-ACITTYGAYGAYGCIACITAYGA-3'; SEQ ID NO: 6) and GeneRacer 3'nested primer as nested primers. The obtained PCR product was inserted into a pGEM-T Easy vector and then subjected to nucleotide sequencing by a conventional method using a BigDye Terminator v3.1 Cycle Sequencing kit. As a result, a sequence containing the 3'end sequence and polyA tail of two types of BcBry-1 having clearly different sequences was obtained. Therefore, one was designated as BcBry1-1 and the other as BcBry1-2. Primers BcBry1-1-3'endR (5'-GCCGCACAATGGAGAAAGCGATTAC-3'; SEQ ID NO: 7) from the 3'end sequences of BcBry1-1 and BcBry1-2, respectively, in order to further try to determine the full-length nucleotide sequence of these two genes. ) And BcBry1-2-3'endR (5'-CGCACGAGGAAACCAGTTAC-3'; SEQ ID NO: 8), and BcBry1-common-R1 (5'-ACTTTGTATAAGCCGTGCTACTCTC-3'; SEQ ID NO: 9) from the sequence common to both BcBry1. Designed. Perform 5'RACE using BcBry1-1-3'endR or BcBry-1-2-3'endR for 1st PCR and BcBry1-common-R1 for nested PCR, and the obtained PCR product has the same nucleotide sequence as described above. I made a decision. As a result, the 5'terminal sequences of each of BcBry1-1 and BcBry1-2 could be determined. Primers BcBry1-1-5'endF (5'-ACACACTTTGCGAGCTGTGTG-3'; SEQ ID NO: 10) and BcBry1-2-5'endF (5'-ACAGTGTTCAACATGAAGCTGAGACGC-3', respectively, from the 5'end sequences of BcBry1-1 and BcBry1-2. '; SEQ ID NO: 11) was designed and the primer pairs of BcBry1-1-5'endF and BcBr1-1-3'endR and the primer pairs of BcBry1-1-5'endF and BcBr1-1-3'endR were used. Then, PCR was performed using a highly accurate DNA polymerase, KOD plus Neo (TOYOBO), using cDNA derived from Bryopsis corticulans as a template. As a result, DNA fragments encoding the full length of the cDNAs of BcBry1-1 and BcBry1-2 were obtained, and their nucleotide sequences were confirmed using a conventional method.

<Result>
(CDNA sequence and amino acid sequence of BcBry-1)
The sequence information of the obtained full-length BcBry1-1 and BcBry1-2 cDNAs is shown in FIGS. 1 and 2, respectively. In addition, the mature protein region was estimated from the comparison with the known N-terminal amino acid of Bry-1 derived from Bryopsis sp. And the signal peptide sequence prediction result using the Signal P program. The amino acid sequences obtained from the cDNAs of BcBry1-1 and BcBry1-2 are also shown in FIGS. 1 and 2, respectively. As shown in FIG. 1, each full-length cDNA of BcBry1-1 has a length of 575 nucleotides (the full-length cDNA sequence is designated as SEQ ID NO: 12), and the 81st to 83rd nucleotides serve as a start codon and 438. Nucleotides ~ 440 are codons from beginning to end. The nucleotide sequence at positions 81 to 440 of the cDNA is designated as SEQ ID NO: 1, and the amino acid sequence of the protein obtained from this nucleotide sequence is designated as SEQ ID NO: 3. On the other hand, as shown in FIG. 2, each of the full-length cDNAs of BcBry1-2 has a length of 495 nucleotides (the full-length cDNA sequence is designated as SEQ ID NO: 13), and the 12th to 15th nucleotides serve as start codons. Nucleotides 369 to 371 serve as codons from beginning to end. The 12th to 371st nucleotide sequences of the cDNA are designated as SEQ ID NO: 2, and the amino acid sequence of the protein obtained from this nucleotide sequence is designated as SEQ ID NO: 4.

As shown in FIGS. 1 and 2, the mature protein regions of BcBry1-1 and BcBry1-2 both consisted of 100 amino acid residues, and their amino acid identity was 83%. As a result of BLAST search, both BcBry1 showed no homology with not only known lectins but also known proteins. That is, it was clarified that it has an extremely novel protein primary structure.

[Example 2: Construction of Escherichia coli expression system of BcBry1-1]
<Method>
(Preparation of expression construct pCold-rBcBry1-1)
A primer designed to design and synthesize DNA encoding BcBry1-1 optimized for Escherichia coli codons and add a His tag and a Polymer Xa recognition sequence to the template. PCR was performed using SEQ ID NO: 14), BcBry1-1_pCold_R (5'-AGATTACCTATTAGCTAGCATGTGTGGCCCATG-3'; SEQ ID NO: 15), and Platinum Pfx DNA polymerase (Invitrogen) as the DNA polymerase. The obtained amplification product is expressed by inserting it into pCold II DNA (Takarabio) linearized by restriction enzyme XbaI and NdeI cleavage using the In-Fusion Advantage PCR Cloning Kit (Clontech) and confirming the nucleotide sequence. Constructed for pCold-rBcBry1-1.

(Preparation of His-rBcBry1-1)
The Escherichia coli strain SHuffle Express was transformed with the above expression construct pCold-rBcBry1-1 to obtain a recombinant BcBry1-1 expression strain (SHuffle Express / pCold-BcBry1-1). For the same expression strain, 1/20 volume was added to 3 ml of LB / Amp ⁺ liquid medium, and the cells were shake-cultured at 37 ° C. until the middle logarithmic growth phase. When the OD ₆₀₀ reached 0.5, the culture solution was allowed to stand at 15 ° C. for 30 minutes, ipTG was added so that the final concentration became 0.1 mM, and the culture was shaken at 15 ° C. for 24 hours to induce expression. After inducing the expression, the culture solution is centrifuged (20400 × g, 5 minutes, 4 ° C.) to collect the cells, and 1/20 volume of the culture solution is used as a buffer solution for ultrasonic crushing (50 mM Tris-hydrochloric acid (pH)). It was suspended in 8.0), 150 mM NaCl) and sonicated. This was centrifuged again (20400 × g, 20 minutes, 4 ° C.), and the supernatant was used as a soluble fraction and the residue was used as an insoluble fraction. For the soluble fraction, His-rBcBry1-1 was purified using nickel chelate beads MagExtractor (registered trademark) His-tag (Toyobo), and this was used as a His-tag purified standard.

(Examination of enzyme digestion conditions by Factor Xa)
In order to prepare rBcBry1-1 from the His-tag fusion protein His-rBcBry1-1, enzymatic digestion with Factor Xa was performed. First, the purified sample His-rBcBry1-1 was sufficiently dialyzed against a dialysis buffer (50 mM Tris-hydrochloric acid (pH 8.0), 100 mM NaCl). The dialysis solution was centrifuged (20400 × g, 20 minutes, 4 ° C.), and the obtained supernatant His-rBcBry1-1 was collected. In order to determine the optimum conditions for the enzyme reaction from this supernatant, the amount of enzyme added and the reaction time were examined. Prepare 50 μl of the enzyme reaction solution (10 μg His-rBcBry1-1, 5 μl of 10 × Factor Xa treatment buffer, 1 μl of Factor Xa (0.1, 0.2, 0.5 U), 24 μl of sterile water). Enzyme treatment was performed at 20 ° C. and 37 ° C., and the amount of enzyme added was Factor Xa (0.1 U, 0.2 U) under 37 ° C. conditions. Further, a product to which Factor Xa was not added was prepared under both temperature conditions and subjected to the same treatment to obtain a negative control. 10 μl each was recovered from this reaction solution over time (2, 4, 8, 16 hours) and subjected to SDS-PAGE.

(Detection of His-rBcBry1-1 by Western blotting using anti-His tag antibody)
The prepared His-rBcBry1-1 was subjected to a sugar chain-immobilized array to comprehensively investigate the binding to the sugar chain. Therefore, the anti-His tag antibody Anti-His-tag-Alexa Fluor was used as a labeling antibody for detecting the recombinant. It was tested by Western blotting to see if 647 (Research Institute for Medical Biology) could be used. That is, purified His-rBcBry1-1 and recombinant Kappaphycus alvarezii agglutinin 1 (His-rKAA1) having a His tag on the N-terminal side stored in our laboratory as a positive control, and His-rKAA1 to His tag as a negative control. Using the removed rKAA, each sample was prepared to correspond to 5 μg and subjected to SDS-PAGE under non-reduction. The protein was transferred to the PVDF membrane using a migration gel different from the one stained with CBB using a wet transfer device Mini Trans-Brot Cell Module (Bio-Rad). After transfer, soak the membrane in 5% blocking buffer (5% skim milk, TBS-T (20 mM Tris-HCl (pH 8.0), 0.15 M NaCl, 0.05% Tween 20)) and gently soak at room temperature for 1 hour. I shook it. Then, it was rinsed twice with TBS-T, and the operation of shaking with TBS-T for 15 minutes was repeated once, and the operation of shaking for 5 minutes was repeated twice. After washing, add 3 ml of Anti-His-tag-Alexa Fluor 647 diluted to 1 μg / ml with 2.5% blocking buffer (2.5% skim milk, TBS-T), and shake at room temperature for 1 hour. The antibody was reacted. After the reaction was completed, the operation of shaking with TBS-T for 10 minutes was repeated 3 times for washing. After air-drying the membrane, the presence or absence of detection by an anti-His tag antibody was examined using a detector Typhoon FLA 7000 (GE Healthcare) at an excitation wavelength of 633 nm.

<Result>
(Expression and preparation of His-rBcBry1-1)
A liquid volume of about 450 μl per soluble fraction of the E. coli strain and about 200 μl per purified sample was obtained, and clear hemagglutination activity was detected for the soluble fraction and the His tag purified sample. To evaluate the hemagglutination activity, 25 μL of each well of the 96-well plate was dispensed with a 2-fold dilution of the series with physiological saline, and an equal amount of 2% erythrocyte suspension was applied to them. After the addition, the mixed solution was gently shaken, incubated at room temperature for 60 minutes, and the hemagglutination activity was observed with the naked eye. In addition, the His-tag purified preparation gave a single band at the position of the predicted molecular weight in non-reduced and reduced SDS-PAGE, and the expression of His-rBcBry1-1 was confirmed (Fig. 3). In FIG. 3, lane M is a molecular weight marker, lane 1 is a cell disruption solution before expression induction, lane 2 is a cell disruption solution after expression induction, lane 3 is a soluble fraction, lane 4 is an insoluble fraction, and lane 5 is Is a non-adsorbed fraction, lanes 6 and 7 are cleaning liquids, lane 8 is a His-tag purified sample (reduction), and lane 9 is a His-tag purified sample (non-reduction). The yield of His-rBcBry1-1 was 40 μg per 9 ml of the medium, and the minimum aggregation concentration was 1.55 μg / ml. Further, when the expression was induced by scaling up separately, 240 μg of His-rBcBry1-1 was obtained per 200 ml of the culture solution.

(Examination of enzyme digestion conditions by Factor Xa)
When Factor Xa treatment was attempted to remove the His-rBcBry1-1 His-tag portion, no cutting was performed at 20 ° C. under any conditions ((a) to (d) in FIG. 4). In FIG. 4, (a) is untreated Factor Xa at 20 ° C., (b) is treated with 0.1 U / 50 μl Factor Xa at 20 ° C., and (c) is 0.2 U / 50 μl at 20 ° C. Factor Xa is treated, (d) is treated with 0.5 U / 50 μl Factor Xa at 20 ° C., (e) is treated with 0.2 U / 50 μl Factor Xa at 37 ° C., (f) is treated with 0.2 U / 50 μl Factor Xa at 37 ° C. It is the result of the condition treated with 5U / 50μl Factor Xa. Further, it was found that the fusion protein moiety was not cleaved as in the case of 20 ° C. when the enzyme treatment was performed under the reaction temperature condition of 37 ° C. ((e) and (f) in FIGS. 4). It was considered that the reason why the fusion protein portion was not cleaved was that the Factor Xa recognition sequence present in His-rBcBry1-1 could not be recognized or contacted due to steric interference.

(Detection of His-rBcBry1-1 by Western blotting using anti-His tag antibody)
Since His-rBcBry1-1 has a Factor Xa recognition sequence fused to the N-terminal of the lectin coding region and a His tag further upstream, it is expected that the recombinant can be detected using a fluorescently labeled anti-His tag antibody. It was. Therefore, the reactivity of His-rBry1-1 with the anti-His tag antibody was examined by Western blotting. Although a clear signal was obtained with His-rKAA1 used as a positive control, it was similar to rKAA1 used as a negative control. No signal was obtained with His-rBcBry1-1 (Fig. 5). In FIG. 5, lane M is a molecular weight marker, lane 1 is His-rBcBry1-1, lane 2 is rKAA1, and lane 3 is His-rKAA1. In addition to the result that the tag could not be cleaved by Factor Xa described above, it was considered that there is a possibility that the enzyme / antibody has difficulty in contacting each recognition site.

[Example 3: Construction of E. coli expression system of BcBry1-1 having different His tag fusion positions]
<Method>
(Preparation of expression constructs pET28a-rBcBry1-1N and pET28a-rBcBry1-1C)
Based on the above results, His-rBcBry1-1N with a linker inserted between the N-terminal His tag and the lectin region, and the His tag fusion position so that the tag-cleaving enzyme and the tag-recognizing antibody can contact each recognition site. Was tried to prepare His-rBcBry1-1C with the C-terminal side. First, the coding region of rBcBry1-1 was amplified using the following primer pair using the BcBry1-1 coding synthetic DNA optimized for the codon for Escherichia coli as a template. That is, for the expression of His-rBcBry1-1N, pET_rBcBry1-1_F (5'-CGCGCGGGCAGGCCATATGCCGTACCATTACGTGTTT-3'; SEQ ID NO: 16) and pET_rBcBry1-1_R (5'-GGTGGTGGTGCGTCCGTA For 1C expression, pET_rBcBry1-1_CF (5'-AGGAGATATACCATGAGCCGTACCATTACGTGTTT-3'; SEQ ID NO: 18) and pET_rBcBry1-1_CR (5'-GGTGGGTGGTGCTACGACGCTGGCCGGCGCGTACCGACTGCACTGCCGGCCGCATGCACTGCACTGCCGACTGACTGCACTGCCGACTGACTGCCGCAT Next, the expression vector pET28a (Novagen) was treated with the restriction enzymes NdeI and XhoI for the His-rBcBry1-1N expression construct, and with the restriction enzymes NcoI and XhoI for the His-rBcBry1-1C expression construct. Expression constructs pET28a-rBcBry1-1N and pET28a using In-Fusion® HD Cloning Kit (Takara Bio) with linearized pET28a and PCR amplification products containing the coding regions for each of the BcBry1-1s described above. -rBcBry1-1C was prepared.

(Preparation of Escherichia coli strains expressing His-rBcBry1-1N and His-rBcBry1-1C)
The Escherichia coli strain SHuffle T7 Express was transformed with the constructed expression construct. An appropriate amount of the transformant was applied to LB / Kan ⁺ agar medium and cultured at 37 ° C. overnight. It was confirmed that the inserts were correctly inserted in the obtained colonies by insert check and sequencing. The clone was cultured in LB / Kan ⁺ liquid medium to make His-rBcBry1-1 expression strains SHuffle T7 Express / pET28a-rBcBry1-1N and SHuffle T7 Express / pET28a-rBcBry1-1C, and 1/2 volume of 40% glycerol was added ( The final concentration was 20%), and the mixture was stored at −80 ° C. until use.

(Large expression of His-rBcBry1-1N and His-rBcBry1-1C)
The above-mentioned SHuffle T7 Express / pET28a-rBcBry1-1N and SHuffle T7 Express / pET28a-rBcBry1-1C expression strains were inoculated into LB / Kan ⁺ 1 L of liquid medium and cultured at 37 ° C. with shaking until the middle logarithmic growth phase. The cells were cultured until the OD ₆₀₀ was between 0.5 and 0.8, expression induction was started by adding ipTG so that the final concentration was 0.5 mM, and the cells were shake-cultured at 20 ° C. for 12 hours. After culturing, the cells were collected by centrifugation (10000 × g, 4 ° C., 10 minutes), and 1/20 volume of the culture solution was used as an ultrasonic crushing buffer (20 mM phosphate buffer (pH 7.4), 500 mM NaCl, After suspending in 20 mM imidazole), ultrasonic crushing was performed. After sonication, the mixture was centrifuged (10000 × g, 4 ° C., 30 minutes) to recover the supernatant as a soluble fraction and the residue as an insoluble fraction.

(Purification with nickel chelate column)
The His-tag fusion recombinant contained in the previously prepared soluble fraction was purified by a nickel chelate column His Gravi Trap (GE Healthcare Bioscience). After sufficiently equilibrating the column with an equilibration buffer (20 mM phosphate buffer (pH 7.4), 500 mM NaCl, 20 mM imidazole), a soluble fraction is added, and the column carrier and His-rBcBry1-1N and His-rBcBry1 are added. -1C was combined. After thoroughly washing the column with an equilibration buffer, an elution buffer (20 mM phosphate buffer (pH 7.4), 500 mM NaCl, 500 mM imidazole) was added to elute the recombinant. The eluted fraction was sufficiently dialyzed against a buffer solution (300 mM arginine hydrochloride, 50 mM Tris (pH 8.0), 100 mM NaCl) to prepare a purified sample.

<Result>
(Yield of purified drift and its hemagglutination activity)
Induce the expression of SHuffleT7 Express / pET28a-rBcBry1-1N and SHuffle T7Express / pET28a-rBcBry1-1C with 1 L of LB / Kan ⁺ , respectively, ultrasonically crush, and then subject the soluble fraction to a nickel chelate column for purification and then dialysis. As a result, we obtained a refined standard. When the protein yield and hemagglutination activity of the purified preparation were measured, 0.96 mg and 512 HA activities were confirmed for rBcBry1-1N, and 2.52 mg and 128 HA activities were confirmed for rBcBry1-1C (Table 1). .. The protein yield was determined by measuring the absorbance at UV 280 nm. Specifically, when the absorbance at 280 nm is 1.0, the protein concentration is estimated to be 1 mg / mL, or bovine serum albumin (BSA) is used as a standard, and the Pierce BCA Protein Assay Kit (Thermo Fisher Scientific, IL, USA). ), And the hemagglutination activity was measured in the same manner as above. When this result was compared with the yield of His-rBcBry1-1 obtained by expressing the above-mentioned SHuffle Express / pCold-rBcBry1-1 strain (240 μg per 200 ml of culture medium), the pET system and the Escherichia coli strain SHuffle T7 Express were used. No dramatic increase in yield was observed.

[Example 4: Sugar chain binding specificity analysis of BcBry1-1 by sugar chain immobilization array]
<Method>
(Detection by Western blotting using anti-His tag antibody)
The prepared His-rBcBry1-1N or His-rBry1-1C was subjected to a sugar chain-immobilized array to comprehensively investigate the binding to the sugar chain. Therefore, the anti-His tag antibody Anti- was used as a labeling antibody for detecting the recombinant. Whether His-tag-Alexa Fluor 647 (Institute of Medical Biology) could be used was tested by Western blotting. That is, His-rBcBry1-1N and His-rBcBry1-1C were targeted, and His-rKAA was used as a positive control and rKAA was used as a negative control. Each sample was prepared to correspond to 5 μg and subjected to SDS-PAGE under non-reduction. Western blotting was performed in the same manner as described above.

(Glycan-immobilized array)
For His-rBcBry1-1C, 7 types of N-glycan, 2 types of O-glycan, 5 types of glycosaminoglycan (GAG), 4 types of Lewis type, 7 types of Lac and 3 types of ABO type, total 28 An anti-His-tag antibody Anti-His-tag-Alexa Fluor 647 (Institute of Medical Biology) was used as a detection reagent in a sugar chain-immobilized array (Fig. 6, Sumitomo Bakelite) in which the type was immobilized. That is, rBcBry1-1C was diluted with a reaction buffer (50 mM Tris-HCl (pH 7.5), 100 mM NaCl, 1 mM CaCl ₂ , 1 mM MnCl ₂ , 1 mM MgCl ₂ , 0.05% (v / v) Tween 20) (final concentration). 83.9 μg / ml), an appropriate amount was added dropwise to the detection plate. Cover and incubate at room temperature for 2 hours, then shake off the cover in ultrapure water, then wash buffer (50 mM Tris-HCl (pH 7.5), 100 mM NaCl, 1 mM CaCl ₂ , 1 mM MnCl ₂ , 1 mM). It was gently washed in MgCl ₂ ) for 1 minute. Further, the operation of gently washing with ultrapure water for 1 minute was repeated twice, and then the array slide was dried by air blowing. Anti-His-tag-Alexa Fluor 647 was diluted with reaction buffer to 1 μg / ml, an appropriate amount was added dropwise to a detection plate, and the mixture was incubated at room temperature for 1 hour to react the antibody. After the reaction was completed, the cover was shaken off in ultrapure water, and then gently washed in a washing buffer for 1 minute. Further, the operation of gently washing with ultrapure water for 1 minute was repeated twice, and then the array slide was dried by air blowing. Fluorescence detection and data analysis were outsourced to Sumitomo Bakelite.

<Result>
(Detection of His-rBcBry1-1N and C by Western blotting using anti-His tag antibody)

When His-rBcBry1-1N or C was subjected to a sugar chain-immobilized array, it was confirmed by Western blotting whether Anti-His-tag-AlexaFluor 647 could be used as a detection antibody. The detection result is shown in FIG. In FIG. 7, lane M is a molecular weight marker, lane 1 is His-rBcBry1-1N, lane 2 is His-rBcBry1-1C, lane 3 is His-rKAA, and lane 4 is rKAA. As shown in FIG. 7, the detection of rKAA used as a negative control was not confirmed, and the detection from His-rKAA, His-rBcBry1-1N and His-rBcBry1-1C used as a positive control was confirmed. Therefore, it was shown that Anti-His-tag-Alexa Fluor 647 can be used for the detection of His-rBcBry1-1N and C. In addition, His-rBcBry1-1C was detected more strongly than His-rBcBry1-1N even though an equal amount of protein was added, and His-rBcBry1-1 (pCold vector) with a His tag fused to the N-terminal side was detected. In consideration of the fact that it could not be detected by (expression using), His-rBcBry1-1C was decided to be used for the sugar chain immobilization array test.

(Glycan-immobilized array test)
His-rBcBry1-1C was subjected to a sugar chain-immobilized array (Sumitomo Bakelite) using Anti-His-tag-Alexa Fluor 647 as a detection reagent. The results are shown in FIG. As shown in FIG. 8, a significant signal was observed in heparin, and a weak signal was also observed in De2S Hep, De6S Hep, and DeNS / AcHep. That is, the binding was observed only in GAG, and the signal tended to decrease due to the elimination of the sulfate group, suggesting that rBcBry1-1 recognizes the sulfate group portion of GAG.

Claims (8)

Encodes a glycan-binding protein
A polynucleotide comprising the nucleotide sequence of SEQ ID NO: 1 or 2, or comprising a nucleotide sequence that hybridizes with the nucleotide sequence of SEQ ID NO: 1 or 2 or a sequence complementary thereto under stringent conditions. .. The polynucleotide according to claim 1, which is derived from the genus Bryopsidales. The polynucleotide according to claim 2, which is derived from Nezashihanemo (Bryopsis corticulans). Has sugar chain binding properties
It is characterized by containing the amino acid sequence set forth in SEQ ID NO: 3 or 4, or an amino acid sequence in which one or several amino acids are substituted, deleted, inserted or added in the amino acid sequence set forth in SEQ ID NO: 3 or 4. New protein to be. The novel protein according to claim 4, wherein a sugar chain containing a sulfate group is specifically recognized. The novel protein according to claim 4 or 5, characterized in that it is derived from the genus Bryopsidales. The novel protein according to claim 6, which is derived from Nezashihanemo (Bryopsis corticulans). A pharmaceutical composition for treating or diagnosing cancer, which comprises the novel protein according to any one of claims 4 to 7.