JP2016216408A - Muscular degradation inhibitor - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide novel techniques capable of inhibiting muscular degradation.SOLUTION: A muscular degradation inhibitor contains a lactic-acid-bacteria strain which is Lactobacillus curvatus or Lactobacillus amylovorus, processed products of the lactic-acid-bacteria strain, or their extracts.SELECTED DRAWING: None

Description

  The present invention relates to inhibition of muscle degradation, and particularly to inhibition of muscle degradation caused by the expression of Atrogin-1.

  For example, aging is known as muscle degradation in humans. Specifically, it is known that the decrease in skeletal muscle with aging begins around the age of 30, and the rate of decrease increases beyond the age of 60. This decrease in skeletal muscle mass and strength over a certain level is called sarcopenia, and about 10% of people in their 60s and 35% of late elderly people over 75 years old are actually sarcopenia. Sarcopenia not only increases the risk of quality of life (QOL) reduction, fractures due to falls, hospitalization, bedridden, etc., but is also involved in the risk of worsening prognosis after acute disease and surgery.

This decrease in skeletal muscle due to aging is mainly caused by accelerated muscle degradation.
More specifically, skeletal muscle is formed by a balance between synthesis and decomposition, and skeletal muscle synthesis is promoted by exercise and nutrition intake. On the other hand, the degradation of skeletal muscle is promoted by aging, inactivity (Betrest, Gibbs fixation), nutritional starvation, disease and the like.

  For example, inflammatory cytokines (IL-6), tumor necrosis factor-α (TNF-α), glucocorticoids and the like produced in the body due to aging and stress in the body increase. These are known to promote muscle degradation.

  Elderly people often have excessive secretion of these cytokines and hormones due to aging and the like, and as a result, degradation of skeletal muscle is promoted.

  Here, a technique disclosed in Patent Document 1 has been proposed as a technique capable of suppressing a decrease in QOL in elderly people. Patent Document 1 relates to a physical activity promoter that supports an increase in muscle mass and activity, and uses Lactobacillus gaseri, which is a kind of lactic acid bacteria, as an active ingredient.

JP 2013-47192 A

The physical activity promoter disclosed in Patent Document 1 increases muscle mass by ingesting it, but does not suppress muscle degradation.
An object of this invention is to provide the novel technique which can suppress decomposition | disassembly of a muscle.

The prevention and improvement of sarcopenia is focused on promoting muscle synthesis through exercise and nutrition, but it is possible to efficiently prevent sarcopenia by improving the cause of muscle degradation that progresses from the internal environment.
It is known that the degradation of skeletal muscle is caused by proteolytic enzymes, and in particular, the ubiquitin-proteasome system is enhanced. In addition, two muscle-specific ubiquitin ligase genes [MAFbx (muscle atrophy F-box) / Atrogin-1 and MuRF1 (muscle ring finger 1)] are known.
Glucocorticoids, undernutrition, IL-6, TNF-α and inactivity enhance these muscle-specific ubiquitin ligase genes, resulting in degradation of skeletal muscle. Thus, these genes are indicators of sarcopenia.
As a result of earnest research, the present inventor found that ingestion of Lactobacillus carbatus CP2998 strain or Lactobacillus amyloboraus CP1750 strain suppresses the expression of Atrogin-1, and suppresses the degradation of skeletal muscle. Was completed.

The gist of the present invention is as follows.
[1] A muscle degradation inhibitor comprising a lactic acid strain which is Lactobacillus carbatus or Lactobacillus amylobora, a processed product of the lactic acid strain, or an extract thereof.
[2] Lactobacillus carbatus CP2998 strain (Accession number: NITE P-02033) or Lactobacillus amylobolus CP1750 strain (Accession number: FERM BP-10532), treated product of the lactic acid strain, or extraction thereof The muscle degradation inhibitor according to [1], comprising a product.
[3] The extract is an extract extracted with chloroform, ethyl acetate, hexane, benzene, toluene, diethyl ether, dimethyl sulfoxide, methanol, ethanol, water, or a mixed solvent thereof [1] or [2 ] The muscle decomposition inhibitor described in the above.
[4] The muscle degradation inhibitor according to any one of [1] to [3], wherein muscle degradation is derived from the expression of Atrogin-1.
[5] Lactobacillus carbatus CP2998 strain (Accession number: NITE P-02033) or Lactobacillus amyloboraus CP1750 strain (Accession number: FERM BP-10532), processed product of the lactic acid strain, or extraction thereof Atrogin-1 expression inhibitor comprising a product.
[6] Lactobacillus carbatus CP2998 strain (Accession number: NITE P-02033) or Lactobacillus amylobolus CP1750 strain (Accession number: FERM BP-10532), treated product of the lactic acid strain, or extraction thereof A method of inhibiting muscle breakdown, including ingesting things (except for medical practice for humans).

  ADVANTAGE OF THE INVENTION According to this invention, the novel technique which can suppress muscle decomposition | disassembly can be provided.

It is a graph which shows the relationship between each lactic acid bacteria and Atrogin-1 / GAPDH concerning the test example 1. FIG. It is a graph which shows the relationship between each lactic acid bacteria and gastrocnemius muscle weight in connection with Test Example 2. It is a graph which shows the relationship between the extract of Lactobacillus carbatus CP2998 strain and Atrogin-1 / GAPDH according to Test Example 3. It is a graph which shows the relationship between the expression level of Lactobacillus carbatus CP2998 strain and Myogenin according to Test Example 4.

Hereinafter, one embodiment of the present invention will be described in detail.
The present embodiment relates to a muscle degradation inhibitor (hereinafter also simply referred to as a degradation inhibitor), and contains a lactic acid strain that is Lactobacillus carbatus or Lactobacillus amylovorus, a processed product of the lactic acid strain, or an extract thereof. Preferably, the degradation inhibitor of the present embodiment is a Lactobacillus carbatus CP2998 strain (hereinafter also simply referred to as CP2998 strain) or a Lactobacillus amylobolus CP1750 strain (hereinafter also simply referred to as CP1750 strain), the lactic acid bacterium Contains processed stock of strains or extracts thereof.
The decomposition inhibitor of the preferred embodiment will be described in more detail. The decomposition inhibitor includes a CP2998 strain, a CP1750 strain, or a mixture thereof, a lactic acid strain, a processed product of the lactic acid strain, and the lactic acid strain and / or Or it contains at least any one of the extract of the processed material.
In the following description, Lactobacillus carbatus, its processed product, and an extract thereof, and Lactobacillus amylobolus, its processed product, and their extract are collectively referred to as lactic acid bacteria according to the present embodiment.

  Lactobacillus carbatus CP2998 strain is a kind of lactic acid bacteria, and deposited with the Patent Microorganism Depositary Center on April 15, 2015 as the accession number: NITE P-02033. In addition, Lactobacillus amyloborus CP1750 strain is also a kind of lactic acid bacteria, and was deposited internationally at the Patent Organism Depositary Center on February 20, 2006 under the accession number: FERM BP-10532. The CP1750 strain is described in WO 2006/093313.

The medium for culturing the lactic acid strain according to the present embodiment is not particularly limited as long as the lactic acid strain can grow, and is appropriately selected from a medium generally used in culturing lactic acid bacteria, a modified medium thereof, and the like. It can be selected and used.
Moreover, it is not specifically limited about the carbon source and nitrogen source which are contained in the culture medium which culture | cultivates the lactic acid strain which concerns on this embodiment. For example, as the carbon source, one or more selected from the group consisting of glucose, sucrose, lactose, molasses and the like used for normal microorganism culture can be used. Further, as the nitrogen source, one type or two or more types selected from the group consisting of peptone, casein, casein degradation product, whey, whey degradation product and the like can be used.
Moreover, you may make it use 1 or 2 or more types selected from the group which consists of corn steep liquor (CSL), a yeast extract, a meat extract, a liver extract, a tomato juice etc. as a supply source of another nutrient.
Furthermore, the medium for culturing the lactic acid strain according to this embodiment is a reducing agent such as L-cysteine; vitamins, nucleic acid-related substances, acetates and citrates, fatty acid esters, particularly preferably Tween 80 and the like. Promoting factor; a compound capable of imparting buffering capacity such as phosphate may be added as appropriate.
As a medium that can be used for culturing the lactic acid strain according to the present embodiment, for example, production of fermented milk such as synthetic medium such as MRS medium, juice such as vegetables and fruits, milk, soy milk, reduced skim milk medium, etc. Examples of the medium are generally used.

  The culture method of the lactic acid strain according to the present embodiment can be performed by, for example, static culture or neutralization culture with a constant pH controlled. However, the culture method is not particularly limited as long as the bacteria grow well. Absent. For example, the cells can be cultured according to a conventional method for lactic acid bacteria culture, and can be obtained from the obtained culture by means of collecting bacteria such as centrifugation.

In the present embodiment, as described above, the lactic acid strain itself, a processed product obtained by performing some treatment on the lactic acid strain, or a lactic acid strain and / or an extract of the processed product are contained in the degradation inhibitor. Any one of these may be contained in the decomposition inhibitor of this embodiment, or one or more of these may be combined and contained in the decomposition inhibitor of this embodiment. May be.
As the lactic acid strain, live cells, wet bacteria, dry bacteria and the like can be used as appropriate.
Examples of the processed product include lactic acid bacteria, lactic acid bacteria-containing materials, fermented milk concentrates containing the lactic acid strain according to the present embodiment, pasted products, dried products, liquid products, diluted products, and crushed products. The dried product can be at least one selected from spray-dried products, freeze-dried products, vacuum-dried products, and drum-dried products. In addition, the processed product of the lactic acid strain according to the present embodiment may be dead cells. Dead cells can usually be obtained by heating the cells. The heating conditions are not particularly limited as long as the cells die, but generally sufficient results can be obtained by heating at 105 ° C. for about 30 minutes. The method for the heat treatment is not particularly limited, and examples thereof include a heat sterilization treatment, a radiation sterilization treatment, and a crushing treatment.
Examples of the extract include chloroform, ethyl acetate, hexane, diethyl ether, dimethyl sulfoxide, methanol, ethanol, water, or a mixed solvent thereof extracted from the lactic acid strain according to this embodiment and / or a processed product thereof. Things.

It does not specifically limit about the form (dosage form) of the decomposition inhibitor of this embodiment, It can manufacture as a pharmaceutical, a quasi drug, food-drinks, etc.
In the case of pharmaceuticals, quasi-drugs or foods and drinks, for example, lactic acid bacteria strains and the like according to this embodiment, for example, excipients, binders, stabilizers, disintegrants, lubricants, flavoring agents, suspending agents, coating agents In addition, other arbitrary components can be appropriately mixed and formulated. The dosage form can be tablets, pills, capsules, granules, powders, powders, syrups, etc., and these are preferably administered orally.
Or although it does not specifically limit, when manufactured with the aspect as food / beverage products, special-purpose foods, such as food for specific health, nutritional functional foods, etc. other than normal food / beverage products may be sufficient. Specific examples of food and drink include, for example, dietary supplements (supplements), milk, processed milk, milk drinks, soft drinks, fermented milk, yogurt, cheese, bread, biscuits, crackers, pizza crusts, ice creams, candy, gummi , Gum, prepared milk powder, liquid food, food for the sick, food such as infant milk powder, food such as milk powder for lactating women, feed and the like.

  The daily intake of the decomposition inhibitor of the present embodiment is not particularly limited. For example, in the case of an adult, the lactic acid strain according to the present embodiment is used as the weight before the treatment of the microbial cell or the microbial cell processed product. What is necessary is just to adjust a compounding quantity etc. so that 0.001-4g, Preferably 0.01-2g can be ingested. The content ratio of the lactic acid bacterial strain and the like according to the present embodiment in the muscle decomposition inhibitor of the present embodiment is not particularly limited, and may be appropriately adjusted according to the ease of production, the preferable daily dose, and the like.

As mentioned above, according to this embodiment, the novel technique which can suppress decomposition | disassembly of muscle can be provided.
That is, although the aspect of ingestion of the lactic acid strain and the like according to the present embodiment is not particularly limited, for example, by ingesting in the form of a pharmaceutical, quasi-drug, food or the like containing the lactic acid strain described above, muscle decomposition Can be suppressed. Specifically, the expression of the muscle-specific ubiquitin ligase gene Atrogin-1 involved in muscle degradation can be suppressed. Therefore, although there are individual differences, for example, it is possible to expect an effect of suppressing the degradation of muscle mass by suppressing muscle degradation due to aging or the like. Further, since the lactic acid strain according to the present embodiment is a kind of lactic acid bacteria, it can be supplied in large quantities at a relatively low cost, and is extremely safe.

  Hereinafter, the decomposition inhibitor of this embodiment will be described in more detail by way of examples. Note that the present invention is not limited to this.

[Preparation of lactic acid bacteria suspension]
Each lactic acid bacterium was smeared on a MRS agar medium (Difco) with about one platinum loop from a glycerol stock, and cultured at 30 ° C. for 24-48 hours under anaerobic conditions. Colonies that grew on the agar were picked and suspended in MRS liquid medium (Difco) and cultured at 30 ° C. for 24 hours. Thereafter, the cells were collected from the lactic acid bacteria culture solution by centrifugation. Distilled water was added to the collected cells and centrifuged again, and the supernatant was removed to wash the cells. The obtained lactic acid bacterial cells were heated at 105 ° C. for 20 minutes, and then dried dead bacterial cells were prepared using a freeze dryer. A suspension of the lactic acid bacterial cells, which are the dried dead cells, in water or a solvent was used as a lactic acid bacterial suspension.
[Test Example 1] Atrogin-1 expression inhibition evaluation
As an in vitro test, C2C12 cells (DS Pharma Biomedical), which are mouse striated cells, were used. C2C12 cells were suspended in Dulbecco's modified Eagle's medium (Sigma) containing 10% fetal bovine serum, 1% Penicillin-Streptomaycin and 1.9 × 10 ⁴ cells / ml, and 1 ml each was added to a 12-well plate. Thereafter, the cells were cultured at 37 ° C. and 5% CO _{2 for} 72 hours to 80% confluence while changing the medium every 2-3 days.
Next, the medium was changed to Dulbecco's modified medium containing 2% horse serum and 1% Penicillin-Streptomaycin and low glucose, and cultured for 4 days while changing the medium every 2-3 days to differentiate C2C12 cells. Thereafter, a low glucose Dulbecco modified medium containing 1% Penicillin-Streptomaycin was added. Add lactic acid bacteria suspension to the medium to a concentration of 100 mg / ml, and add dexamethasone, which is known to increase Atorogin-1 expression in skeletal muscle, to 50 mM. did. Thereafter, cellular RNA was recovered using RNeasy Plus Mini (QIAGEN). RNA was diluted with sterilized distilled water to 100 ng / ml, and cDNA was prepared using High Capacity cDNA Reverse Transcription Kit (Applied Biosytems). Furthermore, the expression levels of GAPDH and Atorogin-1 were measured using 7500 Fast (Applied Biosystems), and the value of Atrogin-1 / GAPDH was determined. For the measurement, Fast SYBR Green Master Mix (Applied Biosystems) was used. As a primer, Atrogin-1 expression is Atrogin-1F, 5 ′ ATCCCAGCACACGACAACAC 3 ′ and Atrogin-1R, 5 ′ CGGCAACTGCATCTCTTC 3 ′, GAPDH expression is GAPDH F 5 ′ ATGGCCTTCCGTGTTCCTAC 3 ′ and GAPDH R, 5 ′ TGCCTGCTTCACCACCTTC 3 'was used. Measurements were performed at N = 3 using dexamethasone as an index.

  The results are shown in Figure 1. As a result of evaluating 10 strains of lactic acid bacteria, Lactobacillus amylobolus No1 strain, CP1750 strain, and Lactobacillus carbatus CP2998 strain showed high activity.

[Test Example 2] Muscle degradation inhibition test using rats
Seven-week old male SD rats were acclimatized for one week and then grouped so that the body weight was uniform. Each group had 8 animals per group. Each lactic acid bacteria suspension was orally administered to the lactic acid bacteria administration group at a dose rate of 1 g / kg. In addition, a group in which leucine was orally administered at 1 g / kg was also set as a positive control. Dexamethasone (Mesadron injection: Kobayashi Kako Co., Ltd.) was administered subcutaneously at 600 mg / kg. After one week of oral administration of the lactic acid bacteria suspension, the lactic acid bacteria suspension and dexamethasone were administered for 2 days, necropsied on the third day, the gastrocnemius muscle was extracted, and the muscle mass was measured.

  The result is shown in figure 2. The gastrocnemius muscle weight was significantly reduced in the dexamethasone administration group compared to the control. The leucine administration group showed a recovery trend compared to the dexamethasone administration group. In the lactic acid bacteria administration group, the CP1750 strain and CP2998 strain administration groups showed a tendency to recover gastrocnemius muscle, similar to leucine.

[Test Example 3] Suppression of Atrogin-1 expression by extract
Using CP2998 strain, the Atrogin-1 expression inhibitory effect of each fraction of the bacterial cell extract was compared.
After adding 5 ml of distilled water (DW) to 0.5 g of CP2998 strain cells and suspending well, it was centrifuged at 6,000 rpm for 10 minutes. Thereafter, only the supernatant was collected so that the cells did not enter, and lyophilized to obtain a DW fraction.
Further, 5 ml of distilled water (DW) was added to 0.5 g of CP2998 strain cells and well suspended, and then 15 ml of chloroform: methanol (1: 2) was further suspended. Thereafter, 5 ml each of DW and chloroform was added and well suspended. The lower chloroform layer was recovered by centrifugation at 6,000 rpm for 10 minutes. The obtained chloroform layer was dried under reduced pressure to recover the solid content (chloroform fraction). 1% BSA (Sigma) was added so that the solid content was 10 mg / ml, and the cells were subjected to the same cell test as in Test Example 1. The upper DW: methanol layer was also recovered, and the solid content was recovered by drying under reduced pressure (DW: methanol fraction). It was dissolved in phosphate buffered saline (PBS) so as to be 10 mg / ml, and it was subjected to the same cell test as in Test Example 1.
As a control group, IGF-1 (TAKARA) at a final concentration of 100 ng / ml and PBS were added and incubated at 37 ° C. for 16 hours, respectively.

  The results are shown in Figure 3. FIG. 3 shows values when PBS is 1. Inhibition of Atrogin-1 expression was observed in the chloroform fraction, DW: methanol fraction, and DW fraction. Among them, the chloroform fraction was confirmed to have particularly high activity.

[Test Example 4] Myogenin expression level promotion evaluation The expression level of Myogenin known as an index of skeletal muscle differentiation was compared. That is, C2C12 cells were cultured to 80% confluent using Dulbecco's modified Eagle medium containing 10% fetal bovine serum, 1% Penicillin-Streptomaycin, and low glucose, and then 2% horse serum, 1% Penicillin-Streptomaycin-containing low glucose-containing Dulbecco. The medium was changed to an improved medium. Furthermore, CP2998 strain lactic acid bacteria suspension and leucine were added to a final concentration of 10 mg / ml and cultured for 4 days. Subsequently, RNA was extracted and the gene expression level of Myogenin was measured using Real time PCR according to the method of Miyata et al. (Miyata et al. Journal of Physical Therapy Science, 21 (1): 81-84 2009). .
The results are shown in FIG. The expression level of Myogenin by leucine was higher than that of PBS, whereas the expression level of Myogenin by CP2998 strain was lower than that of PBS. From this, it was clarified that the CP2998 strain does not have a skeletal muscle synthesis promoting action and has a different effect on C2C12 cells from leucine.

Claims (6)

  A muscle degradation inhibitor comprising a lactic acid strain which is Lactobacillus carbatus or Lactobacillus amylobora, a processed product of the lactic acid strain, or an extract thereof.   Lactobacillus carbatus CP2998 strain (Accession number: NITE P-02033) or Lactobacillus amylobolus CP1750 strain (Accession number: FERM BP-10532) The muscular degradation inhibitor according to claim 1.   The muscle decomposition inhibitor according to claim 1 or 2, wherein the extract is an extract extracted using chloroform, ethyl acetate, hexane, diethyl ether, dimethyl sulfoxide, methanol, ethanol, water, or a mixed solvent thereof. .   The muscle degradation inhibitor according to any one of claims 1 to 3, wherein muscle degradation is derived from expression of Atrogin-1.   Lactobacillus carbatus CP2998 strain (Accession number: NITE P-02033) or Lactobacillus amylobolus CP1750 strain (Accession number: FERM BP-10532) Atrogin-1 expression inhibitor. Lactobacillus carbatus CP2998 strain (Accession number: NITE P-02033) or Lactobacillus amyloboraus CP1750 strain (Accession number: FERM BP-10532) Lactic acid strain, treated product of the lactic acid strain, or an extract thereof A method of suppressing muscle decomposition including excluding medical treatment for humans.

Images