JP2010187702A - Reversibly immortalized mammalian liver cell and use thereof - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide reversibly immortalized mammalian liver cells with more safety and high reversibility which solve conventional problems, are replaceable with healthy human liver cells, allow mass proliferation, and are controllable in life, and to provide bio-artificial liver cells or cell preparations. <P>SOLUTION: There is provided a nonviral vector having a nonviral promoter, encoding an immortalizing gene between a pair of site-specific recombination sequences, and encoding a suicide gene at a site excluding the prescribed pair of the site-specific recombination sequences. <P>COPYRIGHT: (C)2010,JPO&INPIT

Description

  The present invention relates to an immortalized mammalian liver cell that can proliferate reversibly and contains a suicide gene even in cells after reversion, and a bioartificial liver and a cell preparation using the liver cell.

  Currently, there are 2 million people with hepatitis C in Japan (4 million in the United States) and about 1.5 million people with hepatitis B (120 million people in China are infected with hepatitis B) (Nikkei Science, February 2000 issue, Hepatitis Information Center). Approximately 9000 people die annually in Japan due to the complications of hepatitis C, and the number of deaths is expected to triple by 2010.

  From these predictions, there is a high need for bioartificial organs for liver cell transplantation and liver failure treatment, and effective examples of human hepatocyte transplantation in metabolic liver diseases have been reported (Non-patent Documents 1 and 2).

  In Europe, the United States, and China, bioartificial liver trials using porcine hepatocytes have already been conducted in humans, but zoonotic infections such as porcine endogenous retrovirus infections are regarded as problems, and future progress is being made. The current situation is severe.

  Healthy human cells are ideal as a source for such cell transplantation and bioartificial liver, but such cells are extremely difficult to obtain due to a serious shortage of donors.

  Thus, embryonic stem cells (embryonic stem (ES) cells), stem cells, and heterologous animal cells have been studied. However, when using stem cells and progenitor cells, the difficulty of control derived from the pluripotency and active proliferation ability of these cells is inherently involved, and a report on differentiation induction into hepatocytes. However, it is not enough (Non-patent Document 3). Furthermore, in xenogeneic cells, there is no guarantee that the transplanted cells will eventually be rejected, and stable chimerism with xenogeneic animals and accidental engraftment of HLA-incompatible allogeneic tumors have been reported in humans ( Non-patent document 4).

  On the other hand, it is known that a cell line retaining an appropriate differentiation function can be produced by introducing an oncogene to immortalize a cell (Non-patent Document 5). Infusion or use in extracorporeal circulation assist devices such as bioartificial livers can expose patients to the risk of unexpected canceration.

  A reversible immortalized cell capable of immortalizing a cell by introducing an immortalized gene and excising the immortalized gene after growing has also been studied (Non-patent Document 6). However, when a retroviral vector is used, there are problems such as that the LTR on the structure of the virus causes tumorigenicity, and disadvantages that the number of copies to be introduced increases. In addition, even if an immortalized gene is excised with a site-specific recombination enzyme, cells that have undergone genetic manipulation may remain, and these cells may adversely affect the host (such as forming a tumor). Since it is not zero, it has been pointed out that it may cause anxiety to patients receiving treatment.

Strom SC, Fisher RA, Thompson MT, Sanyal AJ, Cole PE, Ham JM, Posner MP., Transplantation (1997) 63: 559-569 Fox IJ, Roy Chowdhury J, Kaufman SS, et al., New Eng. J. Med. (1998) 338: 1422-1426 Rambhatla L, Chiu CP, Kundu P, et al., Cell Transplant. 2003; 12: 1-11; Schwartz RE, Reyes M, Koodie L, et al., J. Clin. Invest. 109; 1291-1302, 2002 Gartner et al., N. Eng. J. Med., 335, 1494, (1996); K. Paradis et al., Science, 285, 1236, (1999) Kobayashi N, et al., Transplantation 69: 202-207, 2000 Westerman KA, Leboulch P., Proc. Natl. Acad. Sci. U S A 93: 8971-8976, 1996

  The present invention eliminates the conventional problems, replaces healthy human liver cells, can be proliferated in large quantities, can control its survival, and is a safer reversible immortalized mammalian liver cell and use thereof The purpose is to provide bioartificial liver and cell preparations.

  As a result of extensive studies to solve the above problems, we have introduced a vector encoding a suicide gene outside of an immortalized gene sandwiched between a pair of site-specific recombination sequences into mammalian liver cells. Thus, it has been found that a safe liver cell line can be established that is an immortalized cell that can be reversibly grown and has a feature that the suicide gene can be activated after removing the immortalized gene. It was.

  That is, the present invention relates to a reversible immortalized mammalian liver cell line containing an immortalizing gene sandwiched between a pair of site-specific recombination sequences and containing a suicide gene outside the pair of site-specific recombination sequences. The present invention relates to a reversible immortalized mammalian liver cell line or its passage, wherein a suicide gene can be activated after excising the pair of site-specific recombination sequences.

  In the reversible immortalized mammalian liver cell, the mammal is preferably a human.

  It is preferred that the reversible immortalized mammalian liver cell does not contain a virus-derived promoter.

  The reversible immortalized mammalian liver cell line is CYNK-1 (deposited organization: National Institute of Advanced Industrial Science and Technology, Patent Biological Deposit Center, address: 1-1-1 Higashi 1-chome, Tsukuba, Ibaraki, Japan, postal code 305 -8566), deposit date: March 10, 2004, deposit number: FERM BP-08657).

  The present invention also relates to a mammalian liver cell (hereinafter referred to as reverting cell) obtained by removing an immortalizing gene from the reversibly immortalized mammalian liver cell line or its passage.

  The present invention further relates to a bioartificial liver containing the reversible immortalized mammalian liver cell line or its passages or their reverted cells.

  The present invention also relates to a cell preparation containing the reversibly immortalized mammalian liver cell line or its passage, or their reverted cells.

  The present invention relates to a non-viral vector that contains a non-viral promoter, encodes an immortalizing gene between a pair of site-specific recombination sequences, and encodes a suicide gene outside the pair of site-specific recombination sequences.

  The reversible immortalized mammalian liver cells of the present invention can be easily secured in a number corresponding to the demand, and are excellent in safety, without causing anxiety to the patient, as a material for bioartificial liver and cell preparations Can be used. In addition, the reversible immortalized mammalian liver cell of the present invention can produce physiologically active substances such as albumin and blood coagulation factors, and therefore can be applied to the development of cellular medicines. In addition, reverted cells are further safe and retain the ability of liver cells, and are very useful in the treatment of liver diseases.

FIG. 1 is a schematic diagram showing a non-viral vector pYK1. Where ATG is the initiation codon, CAG is the CAG promoter sequence, LoxP is the LoxP sequence, HygR is the hygromycin resistance gene, HSVTK is the herpes simplex virus-thymidine kinase, EMCV IRES is the ribosome entry site in encephalomyocarditis virus, and SV40T is the simian Virus 40 large T antigen gene, ZeoR is a zeocin resistance gene, and pA is a poly A signal. FIG. 2 is a diagram showing an example of a method for producing the non-viral vector pYK1. Where ATG is the initiation codon, CAG is the CAG promoter sequence, LoxP is the LoxP sequence, HygR is the hygromycin resistance gene, HSVTK is the herpes simplex virus-thymidine kinase, EMCV IRES is the ribosome entry site in encephalomyocarditis virus, and SV40T is the simian Virus 40 large T antigen gene, ZeoR is a zeocin resistance gene, and pA is a poly A signal. FIG. 3 is a diagram showing the excision mechanism of the LoxP sequence by CreDNA recombinase. Here, ATG is the initiation codon, LoxP is the LoxP sequence, HygR is the hygromycin resistance gene, HSVTK is herpes simplex virus-thymidine kinase, EMCV IRES is the ribosome entry site in encephalomyocarditis virus, SV40T is the simian virus 40 large T antigen gene ZeoR represents a zeocin resistance gene, and pA represents a poly A signal. Fig. 4 shows reversible immortalized human hepatocytes CYNK-1 (Deposit organization: National Institute of Advanced Industrial Science and Technology, Patent Biological Deposit Center, Address: 1st, 1st East, 1st Street, Tsukuba, Ibaraki, Japan, 6th post 305-8656), deposit date: March 10, 2004, deposit number: FERM BP-08657). Part 1 shows a nucleolus, part 2 shows a large nucleus with nucleolus and part 3 shows an intracellular granule. FIG. 5 is a diagram showing one embodiment of the production process, taking one embodiment of the bioartificial liver reactor of the present invention as an example. FIG. 5A is a diagram in which the hollow fiber membranes 6 are arranged on the nonwoven fabric 5 on which the backing 4 is applied. Here, a slit 7 is provided in the nonwoven fabric 5 provided with the backing 4. FIG.5 (b) is a figure which shows the process of winding Fig.5 (a) in roll shape. FIG. 5C is an enlarged cross-sectional view taken along the line XX of FIG. FIG. 5D is a schematic diagram showing a bioartificial liver reactor 10 in which a roll made of a hollow fiber membrane 6 and a nonwoven fabric 5 is incorporated in a cylindrical container 9 provided with a liquid leakage preventing member 8 at both ends. The reactor is provided with a cell inlet 11 and an outlet 12 from which a cell sample can be collected, and the slit 7 is arranged so as to communicate with the cell inlet 11. Fig. 6 (a) shows CYNK-1 (depositing organization: National Institute of Advanced Industrial Science and Technology, Patent Biological Depositary Center, Address: 1-1, Higashi 1-chome, Tsukuba City, Ibaraki, Japan, 6th postal code (305-8856). , Deposit date: March 10, 2004, deposit number: FERM BP-08657), is a photograph showing the expression of liver-specific gene and SV40T gene. Lanes 1 to 7 respectively show an albumin gene, an asialoglycoprotein receptor (hereinafter referred to as ASGPR) gene, a hepatic bilirubin-uridine diphosphate glucuronosyltransferase (hereinafter referred to as bilirubin-UGT) gene, and a glutamine synthetase (hereinafter referred to as “Glucamine synthetase”). , GS) gene, glutathione-S-transferase π (hereinafter referred to as GST-π) gene, human blood coagulation factor X (hereinafter referred to as HBCF-X) gene and SV40T gene. M represents a marker. FIG. 6 (b) is a photograph showing the expression of liver-specific gene and SV40T gene in reverted CYNK-1 cells. Lanes 1 to 7 show the expression of albumin gene, ASGPR gene, bilirubin-UGT gene, GS gene, GST-π gene, HBCF-X gene and SV40T gene, respectively. M represents a marker. Fig. 7 shows reversible immortalized human hepatocytes CYNK-1 (Deposit organization: National Institute of Advanced Industrial Science and Technology, Patent Biological Deposit Center, Address: 1st, 1st East, Tsukuba City, Ibaraki, Japan, Central 6 (postal code) 305-8656), deposit date: March 10, 2004, deposit number FERM: BP-08657) is a graph showing the sensitivity to ganciclovir. Fig. 8 shows reversibly immortalized human hepatocytes CYNK-1 treated with ganciclovir (Depositor: National Institute of Advanced Industrial Science and Technology, Patent Organism Depositary, Address: 1-1 1-1 Higashi 1-chome Tsukuba, Ibaraki, Japan 6 (zip code 305-8656), deposit date: March 10, 2004, deposit number: FERM BP-08657). Dead cells 13 are observed. FIG. 9 is a phase contrast micrograph of reverted CYNK-1 cells treated with ganciclovir. Dead cells 13 are observed. FIG. 10 is a graph showing the survival curve of pigs after administration of D-galactosamine. FIG. 11 is a scanning electron micrograph of a non-woven fabric of BAL-1 after being moved by bioartificial liver treatment. The cells 14 adhere well to the non-woven fibers 15. FIG. 12 is a scanning electron micrograph of the BAL-1 hollow fiber membrane after movement in bioartificial liver treatment. No cells are attached to the surface of the hollow fiber membrane 16.

  In the present invention, “reversible immortalization” or “reversibly proliferative” means that a cell is transduced with an immortalizing gene so that the cell can proliferate indefinitely. After the cells are grown to the number of cells, the immortalized gene is removed to stop cell growth and return to the original highly safe state.

  The mammalian liver cells used in the present invention are, for example, pigs, monkeys, apes, human liver cells and the like, and preferably human liver cells. For example, human adult liver cells and human fetal liver cells can be used in the present invention.

  “Liver cells” used in the present invention include, for example, the ability to produce proteins such as albumin and various coagulation factors, which are indicators of liver function, gluconeogenic ability, urea producing ability, blood detoxification and purification ability, and amino acids, It is a cell having carbohydrate and lipid metabolism ability. Specific examples include hepatocytes, hepatic sinusoidal endothelial cells, hepatic stellate cells, pit cells, and Kupffer cells.

  Liver cells used in the present invention are commercially available (for example, Sanko Junyaku Co., Ltd., Dainippon Pharmaceutical Co., Ltd., etc.).

  In the present invention, a “site-specific recombination sequence” is a specific base sequence recognized by a site-specific recombination enzyme, and when a pair of sequences in the same direction are present on the same DNA molecule, DNA strands are cleaved between these sequences.

  Site-specific recombination sequences include LoxP sequences and FRT sequences, with LoxP sequences being preferred. The LoxP sequence is a known site-specific recombination sequence recognized by Cre recombinase. When a pair of LoxP sequences in the same direction are present on the same DNA molecule, Crex derived from P1 phage of E. coli is used. A series of reactions in which the recombinant enzyme 1) recognizes a LoxP sequence consisting of 34 bases, 2) binds to the site and cuts out the DNA encoded between the LoxP sequences can be carried out independently.

  Therefore, the gene encoded between a pair of LoxP sequences can be excised later by the action of Cre recombinase.

  In the present invention, “immortalizing gene” means a gene that makes human somatic cells have an infinite mitotic life, and examples thereof include the SV40T gene and the human telomerase reverse transcriptase (hTERT) gene.

  The SV40T gene is a known tumor antigen (T antigen) gene of a DNA type tumor virus.

  The hTERT gene is derived from the TERT gene of normal cells. The hTERT gene is naturally expressed in stem and progenitor cells of organs that regenerate throughout life, such as blood, skin, intestinal mucosa, and endometrium, and lymphocytes that are clonally proliferating each time they are exposed to a specific antigen It is an enhanced gene.

  In the present invention, the term “suicide gene” refers to a gene encoding an enzyme derived from bacteria or viruses, which has a function of metabolizing a prodrug having low activity to convert it into a substance having strong cytotoxic activity. A cell into which such a suicide gene has been introduced is selectively killed by administration of a prodrug.

  Therefore, when the suicide gene is introduced into a target cell, the target cell can be selectively removed according to the purpose by administration of the prodrug. Typical combinations of suicide gene and prodrug include herpes simplex thymidine kinase (HSVTK) gene and ganciclovir, which is clinically used as an antiviral agent, and Escherichia coli cytosine deaminase gene and antibacterial agent. -Combinations with fluorocytosine (Elion GB. Am. J. Med. 73, 7, 1982; Craig AM. Proc. Acad. Sci. USA 89, 33, 1992). The effectiveness of the suicide gene used in the present invention has already been proven in animal experiments (Moolten FL, Wells JM: J Natl Cancer Inst. 82: 297-300, 1990; Culver KW, Ram Z, Wallbridge S Ishii H, Oldfield EH. Science 1992; 256: 1550), and HSVTK gene is preferred because its effectiveness has been confirmed in clinical application of gene therapy for human prostate cancer.

  The reversible immortalized mammalian liver cell of the present invention comprises an immortalizing gene sandwiched between a pair of site-specific recombination sequences, and a DNA sequence encoding a suicide gene in addition to the pair of site-specific recombination sequences. It can be prepared by introducing it into mammalian liver cells using a vector.

  As the vector, both viral vectors and non-viral vectors can be used, but viral vectors can be efficiently transferred by simply filtering the culture supernatant of recombinant virus vector-producing cells and adding them to the target cells. Although it is preferable in that it is possible, there is a problem that the LTR on the structure of the virus causes tumorigenicity, and there are also disadvantages that the number of copies to be introduced is increased. Therefore, it is preferable to use a non-viral vector.

  Such vectors include, for example, the SV40T gene and hygromycin resistance (HygR) herpes simplex virus-thymidine kinase (HSVTK) between a pair of loxP sequences that contain the non-viral promoter CAG and are targeted by Cre recombinase. A non-viral vector pYK1 (FIG. 1) that encodes a fusion gene and also encodes a zeocin resistance (ZeoR) / HSVTK fusion gene outside the LoxP sequence can be used. Here, as the non-viral promoter, a CAG promoter or the like can be used, but the CAG promoter is preferable because of its strong expression. The CAG promoter is composed of cytomegalovirus IE enhancer, chicken β-actin promoter and rabbit β-globin polyadenylation signal. It can be produced by those skilled in the art by referring to the following paper (Kanegae Y, Takamori K, Sato Y, et al., Gene (1996) 181: 207-212.).

  Non-viral vector introduction methods include calcium phosphate method, lipofection method, electroporation method using nucleofector and the like. From the viewpoint of gene introduction efficiency, an electroporation method using a nucleofector or the like is preferable.

  For the gene transfer and subsequent establishment and passaging of an immortalized strain, cell culture in a serum-free medium is preferable. Examples of serum-free media include CS-C serum-free media, ISE-RPMI, and HGM (hepatocyte growth medium). From the viewpoint of procurement, for example, CS-C serum-free medium available from Cell Systems (Seattle, Washington, USA) or Dainippon Pharmaceutical Co., Ltd. is preferable.

  As described above, among the reversible immortalized mammalian liver cells of the present invention, the CYNK-1 cell line established by introducing pYK1 which is a non-viral vector into normal human hepatocytes (deposit agency: Industrial Technology, Incorporated Administrative Agency) Research Institute Patent Biological Depositary Center, Address: 1-1, Higashi 1-chome, Tsukuba City, Ibaraki, Japan 6th (Postal Code 305-8656), Deposit Date: March 10, 2004, Deposit Number: FERM BP-08657 And its passage strains are most preferred. Further, the reversible immortalized hepatocytes of the present invention are shown in FIG. 2 (CYNK-1 cells (deposited organization: National Institute of Advanced Industrial Science and Technology, Patent Organism Depositary Center, address: 1-1 1-1 Higashi, Tsukuba, Ibaraki, Japan) As shown in Chuo No. 6 (zip code 305-8656), deposit date: March 10, 2003, deposit number: FERM BP-08657)), it has a large nucleus 2 with several nucleoli 1 It has morphological characteristics of so-called liver parenchymal cells rich in intracellular granules 3.

  As described above, the reversible immortalized mammalian liver cell of the present invention can remove an immortalized gene by acting a site-specific recombinant enzyme. The recombinant enzyme can be easily selected by those skilled in the art according to the site-specific recombination sequence used as described above.

  For example, in the case of Cre recombinase, (1) a method of transducing Cre recombinase with an adenovirus vector having good gene transfer efficiency, and (2) a calcium phosphate method. (3) Fusion of TAT protein derived from human immunodeficiency virus (HIV) and Cre recombinase into the culture supernatant. A method of adding a protein, (4) a method of cationically adding a Cre recombinase protein and adding it to a cell culture medium, and (5) adding a drug by introducing a drug-inducible Cre recombinase expression vector. Thus, a method of adding a system for freely causing the removal of the gene can be used.

  The reverting cells obtained by removing the immortalizing gene from the reversible immortalized mammalian liver cell line of the present invention or its passages are slightly larger than the cells before reversion, and have nuclei having several nucleoli. It maintains the morphological characteristics of so-called liver parenchymal cells, rich in intracellular granules.

  On the other hand, as a liver cell for improving liver dysfunction, several biochemical requirements must be satisfied. That is, i) reduces bilirubin plasma and jaundice, ii) improves hepatic encephalopathy due to hyperammonemia, iii) detoxification and purification of blood, iv) supplementation of albumin and blood coagulation factors, and the like. Reduction of hyperammonemia is particularly important in preventing the development of hepatic encephalopathy and brain death (Strom SC. Transplantation 63, 559, 1997). Glutamine synthetase (GS) is a major enzyme for ammonia removal, and expression of this enzyme is important as an established hepatocyte cell line for improving liver dysfunction (Strom SC. Transplantation 63, 559, 1997). ).

  Therefore, reversible immortalized mammalian liver cells and their passage cells and their reverted cells express at least one of albumin gene, bilirubin-UGT gene, GS gene, GST-π gene and HBCF-X gene. It is preferable that all these genes are expressed.

  Such reversible immortalized mammalian liver cells of the present invention and their passage cells and their reverted cells can be used as bioartificial livers or cell preparations for the treatment of various liver diseases.

  Examples of the “liver disease” in the present invention include liver failure such as acute liver failure due to viruses, drugs, and poisoning (mushrooms, etc.), hemophilia, α1-antitrypsin deficiency, galactosemia, hepatorenal tyrosineemia , Maple syrup urine disease, glycogenosis type 1a, hepatic porphyria, hypobetalipoproteinemia, hypercholesterolemia, primary hyperoxaluria type 1, Crigler-Nager syndrome type 1, hyperphenylalaninemia, etc. Metabolic liver disease, acute exacerbation of chronic liver disease and the like. The therapeutic agent of the present invention is preferably used for the treatment of liver failure and metabolic liver disease.

  In the cell preparation of the present invention, the reversible immortalized mammalian liver cells or their passage cells or their reverted cells are concentrated by a suspension suspended in a medium, an isotonic solution, a buffer solution, or centrifugation. Examples include cell clusters such as pellets. The medium, isotonic solution, or buffer is appropriately selected so as to be compatible with the liver cells. Furthermore, the cell preparation can be cryopreserved by adding a protective agent such as DMSO. As the cell preparation, it is preferable to use reverted cells from which the immortalizing gene has been removed in consideration of being inoculated into the human body. In order to use the cell preparation more safely, the cell preparation may be treated under conditions such as heat treatment, radiation treatment, mitomycin C treatment, etc. while leaving the function as a cell preparation and the protein of the pathogenic cell is denatured. it can.

  As the administration form (transplantation method) of the cell preparation, transportal administration, intraperitoneal administration, intrasplenic administration, and the like can be used. Of these, transportal administration and intrasplenic administration are more preferable, and transportal administration is most preferable. The dose (transplantation amount) of the cell preparation is preferably 100 to 10 billion / solid, more preferably 500 to 10 billion / solid, and most preferably 1 to 10 billion / solid. The dose (transplant amount) can be appropriately changed depending on the age, weight, symptoms, etc. of the patient to be administered.

  Examples of the bioartificial liver include a hybrid type artificial liver combining a hollow fiber type reactor (device) and separated / cultured cells. There are three types of bioartificial livers: those that are attached outside the body and connected to blood vessels, those that are placed in the body and connected to blood vessels, and those that are placed in the abdominal cavity without being connected to blood vessels. Both the reversible immortalized and reverted liver cells of the present invention can be used in any form of bioartificial liver.

  In the development of bioartificial liver, the design and development of reactors is also an important factor. Bioreactors include Demetriou of Cedars-Sinai Medical Center (Los Angeles, California, USA) with the support of Circe Biomedical Inc. (Lexington, Massachusetts, USA). HepatAssist (Hui T, Rozga J, Demetriou AA. J Hepatobiliary Pancreat Surg 2001; 8: 1-15.) And porcine hepatocytes for bioartificial liver treatment using porcine hepatocytes Various types are known, such as MELS (Modular Extracorporeal Liver System) by Gerlach et al. In Germany. These reactors can of course be used in the present invention, but because there is no scaffold for hepatocytes to attach, the cells are simply suspended in the space inside the hollow fiber or the space outside the hollow fiber. There is a tendency to become a state. In the floating state, hepatocytes have a tendency that the differentiation function is not sufficiently expressed, and further, they collide with surrounding cells and are easily subjected to stress stimulation.

  Therefore, in the present invention, a reactor comprising a hollow fiber and a non-woven fabric is preferable so that a scaffold can be provided for hepatocytes.

  Any hollow fiber membrane can be used as long as cells do not adhere to the membrane surface and hinder the substance exchange. Specifically, it is a commercially available product that has been used for medical purposes. For example, a polysulfone film, an ethylene-vinyl acetate random copolymer saponified film (for example, trade name: EVAL, manufactured by Kuraray Medical Co., Ltd.) and the like are preferable. The pore size of commercially available hollow fiber membranes includes dialysis membranes (˜5 nm), plasma component separation membranes (20-30 nm), plasma separation membranes (30-200 nm), and the like. From the viewpoint of substance permeability, a plasma separation membrane (30 to 200 nm) is preferred.

  The nonwoven fabric is preferably processed and modified so that cells can adhere to it. Of these, polytetrafluoroethylene (PTFE) subjected to polyamino acid urethane (PAU) processing is preferable from the viewpoint of ease of processing.

  Taking one embodiment of the bioartificial liver reactor of the present invention as an example, the process up to the housing is shown in FIG. A hollow fiber membrane 6 is placed on the nonwoven fabric 5 provided with the backing 4 (FIG. 5A). Here, slits 7 are provided in the nonwoven fabric 5 provided with the backing 4. This is wound into a roll shape (FIG. 5B). The XX line cross section is FIG.5 (c). This is incorporated into a cylindrical container 9 provided with a liquid leakage preventing member 8 at both ends. The reactor is provided with a cell inlet 11 and an outlet 12 through which a cell sample can be collected, and the slit 7 is disposed so as to communicate with the cell inlet 11.

  In order to implement bioartificial liver treatment safely and scientifically, 1) real-time monitoring of inflow pressure and outflow pressure of the artificial liver reactor, 2) activation of alarm when bubbles are generated, and 3) reactor It is preferable to implement with an apparatus that integrates a function capable of warming (37 degrees).

  Hereinafter, the present invention will be described with reference to specific examples, but the present invention is not limited thereto.

Example 1
Production of non-viral vector pYK-1 A non-viral vector pYK-1 (FIG. 1) was prepared by the following procedure (see FIG. 2).

(1) In order to obtain a zeocin resistance gene (ZeoR) fragment, using pCMV / Zeo (manufactured by Invitrogen) as a template, primer P3 incorporating XhoI on the 5 ′ side and primer P5 ′ incorporating HSVTK on the 3 ′ side Set at both ends of zeocin region, using this, reaction conditions, 95 ° C, 5 minutes, (95 ° C, 30 seconds, 60 ° C, 30 seconds, 72 ° C, 2 minutes) x 30 cycles, 72 ° C, 15 minutes PCR reaction was performed. The P3 primer removed the zeocin start codon so that zeocin could not be expressed.

(2) In order to obtain an HSVTK fragment, SSR # 69 (Westerman KA, Leboulch P., Proc. Natl. Acad. Sci. USA 93: 8971-8976, 1996) was used as a template, and primers P6 ′ and P7 were used in the HSVTK region. Set at both ends and use this for PCR reaction at 95 ° C, 5 minutes, (95 ° C, 30 seconds, 60 ° C, 30 seconds, 72 ° C, 2 minutes) × 30 cycles, 72 ° C, 15 minutes I did it.

(3) In order to obtain a zeocin, HSVTK-binding fragment, the zeocin recovered in (1) above and the TK fragment recovered in (2) above were used as templates, using primers P3 and P7, reaction conditions, 95 ° C., 5 ° C. The PCR reaction was carried out in minutes (95 ° C., 30 seconds, 61 ° C., 1 minute, 72 ° C., 3 minutes) × 30 cycles, 72 ° C., 15 minutes. Since 3 'side of primer P5' and 5 'side of P6' were designed to be complementary, zeocin and HSVTK fragment were combined by this PCR.

(4) In order to obtain a fragment containing a hygromycin resistance gene, HSVTK gene, EMCV-IRES gene, and SV40T gene, reaction conditions were set at 95 ° C. using primers P1 and P2 set at both ends of this region using SSR69 as a template. The PCR reaction was performed for 5 minutes (95 ° C., 30 seconds, 60 ° C., 1 minute, 72 ° C., 5 minutes) × 30 cycles, 72 ° C., 15 minutes.

  HCV 5′UTR and LoxP are incorporated on the 5 ′ side of the P1 primer, and LoxP and XhoI are incorporated on the 3 ′ side of the P2 primer.

  The obtained PCR product was subjected to electrophoresis on a gel containing 1.2% of a mixture of NuSieve agarose and SeaKem agarose at a ratio of 3: 1, and then purified by DNACELL (Daiichi Chemical Co., Ltd.). Recovered.

  Next, the Zeocin and HSVTK binding fragments were treated with XhoI and T4PNK, and inserted into a LOXP switching expression vector pCALNL5 / pBR322H treated with XhoI and SmaI using a LigaFast Rapid DNA Ligation System (Promega). In addition, pCALNL5 / pBR322H was produced by exchanging pUC Ori of pCALNL5 (RIKEN Bank RDB-1862) with pBR322 Ori. The cells were transformed into competent cells (JM109) by electroporation and selected on LB plates containing ampicillin. A fragment containing the hygromycin resistance gene, HSVTK gene, EMCV-IRES gene, and SV40T gene treated with XhoI and T4K was inserted into the clone treated with MluI, T4pol, and XhoI, and inserted into a competent cell (JM109). After transformation, selection was performed on an LB plate containing ampicillin to produce pYK1.

Example 2
Reversible immortalized human hepatocyte cell line CYNK-1 (Deposit organization: National Institute of Advanced Industrial Science and Technology, Patent Biological Deposit Center, Address: 1st, 1st East, Tsukuba City, Ibaraki, Japan, Central 6 (Zip 305-8856) ), Date of deposit: March 10, 2004, deposit number: FERM BP-08657), normal human hepatocytes with passage number 1 (CS-ABI-3716, 80% confluent in T-25 flask) Dainippon Pharmaceutical Co., Ltd.) was treated with trypsin to obtain 1 million human hepatocytes. This was diluted with 1 ml of Nucleofector System Buffer (Nucleofector ^TM Solution, manufactured by Wako Pure Chemical Industries, Ltd.), and a suspension of pYK-1 plasmid DNA in TE buffer (TE buffer, manufactured by Sigma) was added thereto. 2 μl of the solution (1 μg / μl) was added, and the gene was introduced by a Nucleofector system (Nucleofector ^™ system, manufactured by Wako Pure Chemical Industries, Ltd.) according to the protocol of the system. The obtained cells were seeded in a T-25 flask and cultured in a CS-C serum-free medium (CS-SF-4Z0-500, sold by Dainippon Pharmaceutical Co., Ltd.). Forty-eight hours after gene transfer, resistant clones were selected in a 100-g / ml hygromycin-containing CS-C serum-free medium. Two weeks after the start of selection, the appearance of resistant clones was confirmed. After four weeks, the cloning ring was used, and the CYNK-1 cell line (Depositor: National Institute of Advanced Industrial Science and Technology, Patent Organism Depositary, Address: Ibaraki, Japan) Tsukuba City East 1-chome 1 1 Chuo 6th (Postal Code 305-8656), Deposit Date: March 10, 2004, Deposit Number: FERM BP-08657).

  The cells were deposited at the Patent Organism Depositary, National Institute of Advanced Industrial Science and Technology (Address: 1st, 1st East, 1-chome, Tsukuba, Ibaraki, Japan, 6th postal code (305-8856), date of deposit: 2004 March 10, accession number: FERM BP-08657).

  CYNK-1 cells obtained (Depositing organization: National Institute of Advanced Industrial Science and Technology, Patent Biological Deposit Center, Address: 1-1-1 Higashi 1-chome, Tsukuba, Ibaraki, Japan, Chuo 6th (zip code 305-8666), date of deposit : March 10, 2004, accession number: FERM BP-08657) is a so-called liver parenchymal cell morphology rich in intracellular granules 3 with a large nucleus 2 having several nucleoli 1 The characteristic was shown (FIG. 4). CYNK-1 cells (Deposited organization: National Institute of Advanced Industrial Science and Technology, Patent Organism Depositary Center, Address: 1-1-1 Higashi 1-chome, Tsukuba-shi, Ibaraki, Japan, Central 6th (Zip code 305-8666), Date of deposit: Heisei 16 March 10, 2010, accession number: FERM BP-08657), immortalized without the crisis of stopping the growth (crisis), proliferated in a monolayer under serum-free CS-C medium, the number in about 48 hours Doubled.

Example 3
Excision of SV40T gene by Cre recombinase (see FIG. 3)
A non-replicatable recombinant adenovector AxCANCre (3 × 10 ⁸ pfu / ml) (RIKEN Genebank, Japan, RDB No. 1748) that produces a nuclear recombination signal (NLS) -labeled Cre recombinase (MOI) Multiplicity of infection) = 5 and CYNK-1 cells (Deposit organization: National Institute of Advanced Industrial Science and Technology, Patent Biological Deposit Center, Address: 1st, 1st East, Tsukuba City, Ibaraki, Japan, 6th Central (Zip 305-8586) ), Deposit date: March 10, 2004, deposit number: FERM BP-08657). After infection with AxCANCre for 1 hour, the cells were collected by treatment with trypsin, and a complete SV40T gene-expressing cell was obtained by zeocin selection (cultured in CS-C serum-free medium containing 5 μg / ml zeocin (Sigma)) for 5 days. Elimination was achieved. Transient Cre recombinase expression resulted in excision of DNA between LoxP sequences.

  The obtained cells were slightly larger than the cells before reversion, and maintained the morphological characteristics of so-called liver parenchymal cells, rich in intracellular granules with nuclei having several nucleoli.

Test example 1
CYNK-1 cells before and after SV40T gene removal (Deposit organization: National Institute of Advanced Industrial Science and Technology, Patent Biological Deposit Center, Address: 1st, 1st East, Tsukuba City, Ibaraki, Japan, Central 6 (Zip 305-8586), Deposit date: March 10, 2004, Deposit number: FERM BP-08657) CYNK-1 cells before and after SV40T gene excision by RT-PCR method (Deposit organization: National Institute of Advanced Industrial Science and Technology) Patent Biological Depositary Center, Address: 1st East, 1-chome, Tsukuba City, Ibaraki, Japan 1st Central (Postal Code: 305-8656), Deposit Date: March 10, 2004, Deposit Number: FERM BP-08657) Important genes involved in metabolism, ie, albumin gene, albumin gene, ASGPR gene, biryl The expression of bin-UGT gene, GS gene, GST-π gene, HBCF-X gene, and SV40T gene was examined. In the RT-PCR method, CYNK-1 cells (deposited organization: National Institute of Advanced Industrial Science and Technology, Patent Biological Depositary Center, Japan) using RNAzol (Sinna / Biotex, Friendswood, Texas, USA) Extract 1 RNA from Tsukuba 1-chome, Ibaraki Prefecture, 1st Central 1 (Postal Code 305-8666), Deposit Date: March 10, 2004, Deposit Number: FERM BP-08657), 1 μg of total RNA Reverse transcription reaction was carried out using RNA reverse transcriptase at 22 ° C for 10 minutes and further at 42 ° C for 20 minutes.

  2 μg of the reverse transcription product obtained was used for PCR amplification using the AmpliTag Gold kit (Perkin-Elmer / Cetus, Norwalk, Conn., USA) with 20 pmol / ml of each primer. PCR was performed at 95 ° C. for 10 minutes, followed by 35 cycles of incubation consisting of 95 ° C. for 30 seconds, 60 ° C. for 30 seconds and 72 ° C. for 30 seconds, and finally 72 ° C. for 7 minutes. The following primers were used for each gene.

Albumin gene (576 bp)
5 'primer: AAACCCTCTTGTGGAAGAGCC (SEQ ID NO: 1)
3 'primer: CAAAGCAGGTCTCCTTATG (SEQ ID NO: 2)
ASGPR gene (495 bp)
5 'primer: TAGGAGCCAAGCTGGGAGAAA (SEQ ID NO: 3)
3 'primer: ACCTGCAGGGCAAGAGTCATC (SEQ ID NO: 4)
Bilirubin-UGT gene (495 bp)
5 'primer: ATGACCCGTGCCTTTATACAC (SEQ ID NO: 5)
3'primer: TCTTGGATTTGTGGGCTTTC (SEQ ID NO: 6)
GST-π gene (496 bp)
5 ′ primer: GCCCTACACCGTGGTCCTATT (SEQ ID NO: 7)
3 'primer: GGCTAGGACCCATCATGGATCA (SEQ ID NO: 8)
GS gene (535 bp)
5'primer: ATGCTGGAGTCAAAGTGCG (SEQ ID NO: 9)
3'primer: TCATTGAGAAGACACTGTGCG (SEQ ID NO: 10)
HBCF-X gene (493 bp)
5 'primer: GTGCATGGAAGAGACCTGCT (SEQ ID NO: 11)
3 'primer: GAAGTCCAAGCAGGTCGAAGG (SEQ ID NO: 12)
SV40T gene (422 bp)
5 'primer: CAGGCATAGAGGTCTGC (SEQ ID NO: 13)
3 'primer: CAACAGCCCTGTTGCATATTG (SEQ ID NO: 14)

  Expression of these liver function genes was preserved before and after reversible immortalization, and SV40T gene removal by Cre / loxP recombination was observed (see FIGS. 6 (a) and 6 (b)). In addition, the results are as follows. CYNK-1 cells before and after the removal of the SV40T gene (deposited organization: National Institute of Advanced Industrial Science and Technology, Patent Biological Depositary Center, address: 1-1-1 Higashi 1-chome, Tsukuba, Ibaraki, Japan) Postal code 305-8656), deposit date: March 10, 2004, deposit number: FERM BP-08657) to manufacture physiologically active substances such as albumin and blood coagulation factors and apply them to the development of cellular medicines This data suggests that it is possible.

Test example 2
CYNK-1 cells before and after SV40T gene removal (Deposit organization: National Institute of Advanced Industrial Science and Technology, Patent Biological Deposit Center, Address: 1st, 1st East, Tsukuba City, Ibaraki, Japan, Central 6 (Zip 305-8586), Deposit date: March 10, 2004, accession number: FERM BP-08657) susceptibility to ganciclovir 200 CYNK-1 cells (Depositor: National Institute of Advanced Industrial Science and Technology, Patent Organism Depositary, Address: Japan) 1-chome, 1-chome, Higashi 1-chome, Tsukuba-shi, Ibaraki Pref. 6 (postal code 305-8656), deposit date: March 10, 2004, deposit number: FERM BP-08657), seeded in a 96-well plate, CS-C CS-C bloodless with serum-free medium alone or with various concentrations of ganciclovir (5, 10, 20, 50 and 100 μM) Cultured in medium, MTT assay (Mcsmann TJ, Immunol. Methods, 65, 55, 1983) at was examined cell proliferation.

  Cell viability is shown in FIG. 7 as relative sensitivity. CYNK-1 cells (Deposited organization: National Institute of Advanced Industrial Science and Technology, Patent Organism Depositary Center, Address: 1-1-1 Higashi 1-chome, Tsukuba-shi, Ibaraki, Japan, 6th postal code (305-8565), Date of deposit: 2004 The sensitivity to ganciclovir of March 10, 2010, accession number: FERM BP-08657) was dependent on the concentration of ganciclovir, and the growth was stopped by culturing with 5 μM GCV for 1 week, and some cells died ( 7 and 8).

  Reverted CYNK-1 cells were similarly sensitive to GCV and stopped growing by culturing for 1 week in the presence of 5 μM GCV, some cells died (FIG. 9), all within 10 days Cells were killed.

  These data indicate that cell proliferation can be controlled by administration of ganciclovir.

Test example 3
Hepatic failure treatment effect by reverted CYNK-1 cells Using T225 cell culture flask (Corning, NY, USA), CYNK-1 cells (Deposited organization: National Institute of Advanced Industrial Science and Technology) Patented Biology Deposit Center, Address: 1-chome, East 1-chome, Tsukuba City, Ibaraki, Japan 1st Central (Postal Code 305-8656), Date of Deposit: March 10, 2004, Deposit Number: FERM BP-08657) A (CS-C serum-free medium (CS-SF-4Z0-500, sold by Dainippon Pharmaceutical Co., Ltd.) with 0.1 mg / L streptomycin and 100 U / ml penicillin G) at room temperature of 37 ° C., The cells were cultured in an incubator with a carbon dioxide concentration of 5%. CYNK-1 cells (Deposited organization: National Institute of Advanced Industrial Science and Technology, Patent Organism Depositary Center, Address: 1-1-1 Higashi 1-chome, Tsukuba-shi, Ibaraki, Japan, Central 6th (Zip code 305-8666), Date of deposit: Heisei 16 On March 10, 2012, the accession number: FERM BP-08657) proliferated and procured 20 million cells in one flask. Using 8 ml of 0.25% trypsin solution in which 0.02% EDTA is added to PBS (phosphate buffered saline), the cells are detached from the surface of the flask, and 40 ml of culture medium A is added and stirred. The cells were collected by centrifuging at 4 ° C., 800 rpm, 7 min. CYNK-1 cells obtained (Depositing organization: National Institute of Advanced Industrial Science and Technology, Patent Biological Deposit Center, Address: 1-1-1 Higashi 1-chome, Tsukuba, Ibaraki, Japan, Chuo 6th (zip code 305-8666), date of deposit : March 10, 2004, accession number: FERM BP-08657) (3 T225 cell culture flasks, 60 million in total), after adding 30 ml of culture medium A, stirring, roller bottle (official name: 1700 cm ² (Expanded Surface Roller Bottle, Corning) was added, and 500 ml of the culture solution A was added to carry out the culture. The four roller bottles were subjected to mass culture using a cell preparation roller apparatus (Bellco). With the cells confluent, the adenovirus vector AxCANCre was added to cause a recombination reaction. After 48 hours from the addition of AxCANCre and culturing in a zeocin-containing medium for 5 days, the cells were collected by trypsin treatment in the same manner. From one roller bottle, 300 million cells, a total of 4 cells, obtained 1.2 billion reverted cells.

  Ten female pigs (5 kg) of Landrace White purchased from Miho-cho, Okayama Prefecture, were fasted for 12 hours before surgery. Atropine sulfate (manufactured by Fuso Yakuhin Kogyo Co., Ltd., Osaka, Japan) and ketal for animals (ketamine hydrochloride) (manufactured by Sankyo Co., Ltd., Tokyo, Japan) were injected intramuscularly, and after sedation, doloreptan (droperidol) (Sankyo) Intratracheal intubation was performed by intravenously injecting 1 mg of Myoblock (pancuronium bromide) (manufactured by Organon, Netherlands) 2 mg, manufactured by Tokyo, Japan. Using oxygen, laughter, and sevoflurane, anesthesia was maintained with a ventilator, the left external jugular vein was exposed, and a 6Fr atom tube (Atom Medical Co., Ltd., Tokyo, Japan) was cannulated. Then, after abdominal midline incision, a 6Fr atom tube (Atom Medical Co., Ltd., Tokyo, Japan) was cannulated from the splenic vein, and the tip was placed on the portal trunk. It was confirmed by palpation that the tip was located at the portal vein trunk. The end of each atom tube was sutured to the skin surface after forming a subcutaneous tunnel. Before and after surgery, 0.5 g of cepatren (cephalosporin antibiotic) (Sumitomo Pharmaceutical Co., Ltd., Osaka, Japan) was injected intravenously. After the operation, the endotracheal tube was removed after confirming complete awakening. Immediately after that, 0.5 g / kg D-galactosamine (manufactured by Sigma) was dissolved in 50 ml of physiological saline from an atom tube inserted into the left external jugular vein, and then intravenously administered over 10 minutes to cause drug-induced liver injury. Induced.

  Each atom tube was locked with 1 ml of heparin (1000 units) to prevent thrombus formation. 18 hours after administration of D-galactosamine, 1 billion reverted CYNK-1 cells procured by roller bottle culture were diluted to 100 ml of Ringer's solution and about 30 portal veins from a 6Fr atom tube inserted into the splenic vein. Transplanted over minutes (transplant group, n = 5). As a control experiment, the remaining 5 mice did not transplant cells (control group, n = 5).

ECG, heart rate, and arterial pressure were monitored to understand the general condition of the pig. In the transplant group, a transient increase in portal vein pressure (25 cmH ₂ 0) was observed at the time of transplantation, but the pigs were able to withstand hepatocyte transplantation.

  The results are shown in FIG. In the control group, all cases died of liver failure, but in the reverted CYNK-1 cell transplantation group, 4 out of 5 cases survived for 1 month or more, and a statistically significant difference was observed. The data suggests that transplantation of reverted CYNK-1 cells is also effective in human liver failure.

Example 4
Production of Bioartificial Liver A bioartificial liver (BAL) (see FIG. 5) of a whole blood reflux system composed of a hollow fiber and a nonwoven fabric was produced according to the following procedure. As shown in Table 1, BAL-1 to BAL-6 were used depending on the type of hollow fiber membrane.

  550 pieces of 10 cm hollow fiber membranes were regularly placed on a non-woven fabric (10 × 10 cm) lined with rayon (see FIG. 5A), and wound into a roll (see FIG. 5B). A schematic diagram of the cross section is shown in FIG. The roll made of the nonwoven fabric and the hollow fiber membrane was incorporated into a cylindrical container provided with a liquid leakage preventing member at both ends (see FIG. 5 (d)). Reactor immortalized hepatocytes CYNK-1 (repository organization: National Institute of Advanced Industrial Science and Technology, Patent Biological Deposit Center, address: 1-1-1 Higashi 1-chome, Tsukuba, Ibaraki, Japan) No. 305-8656), deposit date: March 10, 2004, deposit number: FERM BP-08657) about 1 billion CS-C serum-free medium (CS-SF-4Z0-500, Dainippon Pharmaceutical Co., Ltd.) (Sales) Suspended in 10 ml and filled.

  In addition, as a nonwoven fabric, the PTFE (polytetrafluoroethylene) nonwoven fabric (made by Kuraray Medical Co., Ltd.) of the polyamino acid urethane (PAU) process which has cell adhesiveness was used.

  In order to determine the biocompatibility of the obtained reactor, each reactor was installed and operated between the cervical arteriovenous veins of healthy pigs, and was able to operate safely without adversely affecting the circulation dynamics for 24 hours. Also, no decrease in blood cell components such as red blood cells and platelets was observed.

  In order to implement BAL treatment safely and scientifically, 1) real-time monitoring of inflow and outflow pressures of BAL reactors, 2) activation of alarms when bubbles occur, and 3) warming of reactors ( 37 degrees), we developed a device that integrates the functions that can be performed, and verified that the system works well in pig experiments.

Test example 4
Liver Failure Treatment Effect of Bioartificial Liver According to institutional animal experiment handling guidelines, the safety and effectiveness of the bioartificial liver produced in Example 4 using quarantined cynomolgus monkeys (purchased from Clea Japan) were examined.

  Male cynomolgus monkeys (4 kg, n = 6) were intravenously injected with 0.5 g / kg of D-galactosamine (purchased from Sigma) to induce drug-induced liver injury.

  18 hours after administration of D-galactosamine, an Atom 6Fr catheter (Atom Medical Co., Tokyo, Japan) was inserted into the left internal carotid artery of the monkey (n = 2) in the treatment group under general anesthesia, and the left external jugular vein was inserted. An Atom 6Fr catheter was inserted, and the reactor BAL-1 prepared in Example 4 was connected between them. Using PERISTA BIO-MINIPUNP (ATTO, Tokyo, Japan) as a pump, extracorporeal circulation was performed at a flow rate of 10 ml / min for 6 hours. For anesthesia, dupriban was used as intravenous anesthesia (5 ml / hour). As anti-thrombotic therapy, 1000 units of heparin were injected from the central side of the reactor immediately before blood passed through the reactor, and then heparinization was performed by continuous infusion of heparin (heparin 500 units / hour) during extracorporeal circulation. .

  As a positive control group (n = 2), CYNK-1 cells (deposited organization: National Institute of Advanced Industrial Science and Technology, Patent Biological Deposit Center, address: 1-chome, 1-chome, Tsukuba-shi, Ibaraki, Japan, Chuo 6th (postal mail) No. 305-8666), deposit date: March 10, 2004, deposit number: FERM BP-08657), instead of a reactor filled with about 1 billion freshly isolated porcine hepatocytes (viability> 90%) The BAL treatment for 6 hours was performed in the same manner as in the treatment group. Freshly isolated porcine hepatocytes were isolated from the surgically excised outer liver by a four-step reflux method using dispase and collagenase (Masayama Maruyama, Naoya Kobayashi, Toshinori Tsutsukawa et al., Organ Biology, Vol. 9). No. 3. 295-301, 2002).

  As a negative control group (n = 2), a similar test was performed using an empty reactor not filled with cells.

  As a result, in the negative control group, 2 monkeys both died of liver failure within 1 week after administration of D-galactosamine. At necropsy, hepatic hemorrhage necrosis, prominent atrophy, jaundiceous pleural effusion and ascites were observed, and extensive hepatocyte necrosis was observed. On the other hand, all positive control groups loaded with about 1 billion pig liver cells survived for 3 weeks or more, and no abnormalities were found in autopsy findings.

  In the treatment group, both cases survived for more than 3 weeks. The liver was completely normalized both macroscopically and histologically. In the treatment group, an improvement in the Fischer ratio (ratio of branched chain amino acids / aromatic amino acids) was observed.

  After treatment, the reactor was fixed and the degree of cell attachment was observed under a scanning electron microscope. The cells adhered well to the non-woven fibers (FIG. 11), and agglomerates consisting of several cells were observed. Such an agglomeration is preferable for exerting the differentiation function of cells. On the other hand, no cells adhered to the surface of the hollow fiber membrane (FIG. 12), and a very favorable finding was obtained in view of material exchange through the hollow fiber membrane.

SEQ ID NO: 1 5 ′ primer for polymerase chain reaction for detecting albumin gene
SEQ ID NO: 3 3 'primer for polymerase chain reaction for detecting albumin gene
SEQ ID NO: 5 5 'primer for polymerase chain reaction for detecting ASGPR gene
SEQ ID NO: 4: 3 'primer for polymerase chain reaction for detecting ASGPR gene
SEQ ID NO: 5: 5 ′ primer for polymerase chain reaction for detecting bilirubin-UGT gene
SEQ ID NO: 6: 3 ′ primer for polymerase chain reaction for detecting bilirubin-UGT gene
SEQ ID NO: 7: 5 ′ primer for polymerase chain reaction for detecting GST-π gene
SEQ ID NO: 8: 3 ′ primer for polymerase chain reaction for detecting GST-π gene
SEQ ID NO: 9: 5 ′ primer for polymerase chain reaction for detecting GS gene
SEQ ID NO: 10: 3 ′ primer for polymerase chain reaction for detecting GS gene
SEQ ID NO: 11: 5 ′ primer for polymerase chain reaction for detecting HBCF-X gene
SEQ ID NO: 12: 3 ′ primer for polymerase chain reaction for detecting HBCF-X gene
SEQ ID NO: 13: 5 ′ primer for polymerase chain reaction for detecting SV40T gene
SEQ ID NO: 14: 3 ′ primer for polymerase chain reaction for detecting SV40T gene

Claims (1)

A non-viral vector containing a non-viral promoter, encoding an immortalizing gene between a pair of site-specific recombination sequences, and encoding a suicide gene outside the pair of site-specific recombination sequences, A non-viral vector having a structure.