JP2009168526A - Serum tumor marker for detecting gastrointestinal cancer, gastrointestinal cancer detection kit, and gastrointestinal cancer detection method - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a serum tumor marker for detecting gastrointestinal cancer such as stomach cancer with high specificity and sensitivity and available for detecting early cancer and a means of detecting gastrointestinal cancer. <P>SOLUTION: The serum tumor marker for detecting gastrointestinal cancer of the present invention includes olfactomedin 4 protein and Reg IV protein. Gastrointestinal cancer such as stomach cancer can be detected with high specificity and sensitivity by the serum tumor marker for detecting gastrointestinal cancer of the present invention. In addition, early cancer can be detected with high sensitivity. Furthermore, the serum tumor marker for detecting gastrointestinal cancer of the present invention is a serum tumor marker, therefore, existence of gastrointestinal cancer can be detected by a convenient test using serum, etc. <P>COPYRIGHT: (C)2009,JPO&INPIT

Description

  The present invention is equipped with a novel serum tumor marker for detecting gastrointestinal cancer including gastric cancer and a detection means for detecting the novel serum tumor marker for detecting digestive cancer. The present invention relates to a gastrointestinal cancer detection kit and a method for detecting a gastrointestinal cancer comprising a step of detecting the novel serum tumor marker for gastrointestinal cancer detection. The novel serum tumor marker for detecting gastrointestinal cancer comprises olfactomedin 4 protein and Reg IV protein. In particular, the novel serum tumor marker for detection of digestive organ cancer according to the present invention is a serum tumor marker that can detect the presence or absence of digestive organ cancer by a simple test using serum or the like.

  Conventionally, pathomorphological diagnosis has been mainly used for diagnosis of cancer. The qualitative diagnosis of lesions by pathomorphological diagnosis, the extent of spread, the presence of intravascular invasion and stump invasion are essential for the selection and determination of post-treatment. However, lesions that show an intermediate form between benign and malignant are not uncommon, and there are limits to the analogy of malignancy and prognosis with changes in form. Further, the pathomorphological diagnosis is to detect and diagnose cancer visually from each specimen. For this reason, not only skilled experience is required, but there is a risk of making a diagnosis by subjective judgment. Further, since each specimen is examined one by one, it is difficult to easily examine many specimens. In order to compensate for the weak points of such pathomorphological diagnosis, molecular biological analysis has been used, and various cancer detection markers have been developed. In particular, the so-called “serum tumor marker” that can detect the presence or absence of cancer by detecting the difference in the expression level of proteins present in body fluids such as serum is a simple test using serum or the like. This is particularly useful because the presence or absence can be detected.

  Examples of serum tumor markers already in practical use include CEA and CA19-9. CEA and CA19-9 are widely used for the detection of adenocarcinoma including gastrointestinal cancer (for example, see Non-Patent Documents 1 and 2). However, since CEA and CA19-9 are not expressed in early gastrointestinal cancers, they are inappropriate for detecting early cancers in gastric cancer and colorectal cancer, and also due to the effects of smoking, cirrhosis, etc. It has also been pointed out as a problem that there are many false positives because it is detected in the serum (see, for example, Non-Patent Document 3).

By the way, it is known that Reg IV protein can be detected in the serum of gastric cancer patients and can be a serum tumor marker for gastric cancer (see, for example, Non-Patent Document 4). On the other hand, the expression of olfactomedin 4 (also known as hGC-1) protein was confirmed by immunostaining in gastric cancer tissue and normal cell tissue (see, for example, Non-Patent Document 5). However, it is not known that olfactomedin 4 protein can serve as a serum tumor marker for gastric cancer.
Horie Y, Miura K, Matsui K, Yukimasa A, Ohi S, Hamamoto T, Kawasaki H. Marked elevation of plasma carcinoembryonic antigen and stomach carcinoma. Cancer. 1996; 77 (10): 1991-7. Kochi M, Fujii M, Kanamori N, Kaiga T, Kawakami T, Aizaki K, Kasahara M, Mochizuki F, Kasakura Y, Yamagata M. Evaluation of serum CEA and CA19-9 levels as prognostic factors in patients with gastric cancer. 2000; 3 (4): 177-186. Molnar IG, Vandevoorde JP, Gitnick GL.CEA levels in fluids bathing gastrointestinal tumors.Gastroenterology.1976; 70 (4): 513-5. Mitani Y, Oue N, Matsumura S, Yoshida K, Noguchi T, Ito M, Tanaka S, Kuniyasu H, Kamata N, Yasui W. Reg IV is a serum biomarker for gastric cancer patients and predicts response to 5-fluorouracil-based chemotherapy .Oncogene. 26 (30): 4383-4393, 2007 Liu W, Zhu J, Cao L, Rodgers GP.Expression of hGC-1 is correlated with differentiation of gastric carcinoma.Histopathology. 51 (2): 157-65, 2007

  As described above, conventionally known serum tumor markers have a problem that early detection of gastric cancer, pancreatic cancer, and colon cancer is difficult and there are many false positives. That is, a highly specific serum tumor marker capable of detecting early gastrointestinal cancer (especially gastric cancer and pancreatic cancer) has not been known so far. Therefore, development of a highly specific serum tumor marker capable of detecting early gastrointestinal cancer (especially gastric cancer and pancreatic cancer) is strongly desired.

  The present invention has been made in view of the above problems, and its purpose is to provide a serum tumor marker effective for selective detection of gastrointestinal cancer including gastric cancer, and gastrointestinal cancer including gastric cancer. It is an object to provide a kit for selective detection and a method for selective detection of digestive organ cancer using the serum tumor marker.

  In order to solve the above-mentioned problems, the present inventors conducted a gene expression analysis in gastric cancer using a serial analysis of gene expression method (SAGE method), and constructed a SAGE library. The data of the SAGE library was compared with the SAGE data of normal tissues of main organs registered in the NCBI SAGE database, and genes that were highly expressed in gastric cancer tissues but not expressed in normal tissues were searched. Using the real-time RT-PCR method for the candidate genes found by this, gene expression analysis was performed using 14 normal tissues and 9 gastric cancer tissues as materials. As a result, it was revealed that olfactomedin 4 gene and Reg IV gene are highly expressed in gastric cancer and very low in normal tissues. Furthermore, as a result of measuring the concentration of olfactomedin 4 protein and Reg IV protein in the sera of gastric cancer patients and the concentration of olfactomedin 4 protein and Reg IV protein in the sera of healthy subjects by ELISA, olfactomedin 4 protein and Confirmed that the concentration of Reg IV protein is increased, olfactomedin 4 protein and Reg IV protein are the objectives of the present invention as effective serum tumor markers for selective detection of gastrointestinal cancer including gastric cancer Found that it is available. In particular, it has been found that by combining olfactomedin 4 protein and Reg IV protein, a highly selective means of detecting digestive organ cancer can be provided. The present invention has been completed by the above inventors' intensive studies.

  That is, the serum tumor marker for gastrointestinal cancer detection according to the present invention is characterized by including olfactomedin 4 protein and Reg IV protein.

  The serum tumor marker for detecting digestive organ cancer according to the present invention can be suitably used for detection of gastric cancer.

In the serum tumor marker for detecting digestive organ cancer according to the present invention, the olfactomedin 4 protein is (a) an amino acid sequence represented by SEQ ID NO: 1; or (b) one amino acid sequence represented by SEQ ID NO: 1 or Having an amino acid sequence in which several amino acids are substituted, deleted, inserted and / or added;
The Reg IV protein comprises (c) the amino acid sequence shown in SEQ ID NO: 2; or (d) one or several amino acids in the amino acid sequence shown in SEQ ID NO: 2 are substituted, deleted, inserted, and / or It may be a serum tumor marker for detecting digestive organ cancer characterized by having an added amino acid sequence.

  On the other hand, the digestive cancer detection kit according to the present invention is characterized by comprising detection means A for detecting the expression of olfactomedin 4 protein and detection means B for detecting the expression of Reg IV protein.

  In the digestive cancer detection kit according to the present invention, the detection means A is a substance that specifically interacts with olfactomedin 4 protein, and the detection means B is a substance that specifically interacts with Reg IV protein. May be.

  In the digestive cancer detection kit according to the present invention, the substance that specifically interacts with the olfactomedin 4 protein is an anti-olfactomedin 4 antibody, and the substance that specifically interacts with the Reg IV protein is an anti-Reg IV antibody. It is preferable that

  In the digestive cancer detection kit according to the present invention, the olfactomedin 4 protein is (a) an amino acid sequence represented by SEQ ID NO: 1; or (b) one or several amino acid sequences represented by SEQ ID NO: 1. And the Reg IV protein has (c) the amino acid sequence shown in SEQ ID NO: 2; or (d) the amino acid sequence shown in SEQ ID NO: 2. It may be a digestive cancer detection kit characterized by having an amino acid sequence in which one or several amino acids are substituted, deleted, inserted, and / or added.

  Moreover, the digestive organ cancer detection kit concerning this invention can be used suitably for the detection of gastric cancer.

  On the other hand, the method for detecting digestive organ cancer of a sample derived from a subject according to the present invention is characterized by including a measurement step of measuring the expression levels of olfactomedin 4 protein and Reg IV protein in the sample derived from the subject.

  In the method for detecting digestive organ cancer of a sample derived from a subject according to the present invention, the measurement step may be a step of measuring the concentration of olfactomedin 4 protein and Reg IV protein in the sample derived from the sample.

  In the digestive organ cancer detection method for a subject-derived sample according to the present invention, the subject-derived sample may be serum.

  Further, in the method for detecting digestive organ cancer of a sample derived from a subject according to the present invention, the olfactomedin 4 protein is (a) an amino acid sequence represented by SEQ ID NO: 1; or (b) an amino acid sequence represented by SEQ ID NO: 1; The Reg IV protein has an amino acid sequence in which one or several amino acids are substituted, deleted, inserted and / or added, and the Reg IV protein comprises (c) the amino acid sequence shown in SEQ ID NO: 2; or (d) SEQ ID NO: In the amino acid sequence shown in 2, it may be a digestive cancer detection method characterized by having an amino acid sequence in which one or several amino acids are substituted, deleted, inserted and / or added.

  Moreover, the digestive organ cancer detection method of the sample derived from the subject concerning this invention can be used suitably for the detection of gastric cancer.

  The effect of being able to detect digestive organ cancer based on objective molecular criteria by using a serum tumor marker for detecting digestive organ cancer, a digestive cancer detection kit, and a digestive cancer detection method according to the present invention. Play. Therefore, it is possible to make a diagnosis based on molecular criteria for a cancer whose pathomorphological diagnosis is difficult, and contribute to elucidation of the mechanism of cancer.

  In addition, detection with a conventionally known serum tumor marker has a problem that there are many false positives. However, since the cancer detection method according to the present invention has extremely high specificity, there is an effect that there are few false positives. Furthermore, detection of early stage cancer was difficult with a conventionally known serum tumor marker. However, using the method for detecting digestive organ cancer of a sample derived from a subject according to the present invention, early stage cancer can be selectively detected with extremely high sensitivity. There is an effect that can be.

  An embodiment of the present invention will be described as follows. Note that the present invention is not limited to this. In addition, all the nonpatent literatures and patent literatures described in this specification are used as reference in this specification.

<1. Gastrointestinal cancer detection marker>
A serum tumor marker for detecting digestive organ cancer according to the present invention (hereinafter referred to as “marker of the present invention”) is characterized by containing olfactomedin 4 protein and Reg IV protein. As a result of intensive studies to solve the above problems, the present inventors have found that olfactomedin 4 protein can be used as a serum tumor marker for detecting digestive organ cancer. Furthermore, the present inventors are able to detect gastric cancer with extremely high detection sensitivity and extremely high specificity by measuring olfactomedin 4 protein and Reg IV protein levels in serum derived from a subject. It has been discovered that it can also be detected, and the present invention has been completed. The marker of the present invention including olfactomedin 4 protein and Reg IV protein can detect gastrointestinal cancer including gastric cancer with extremely high detection sensitivity and high specificity, and can also detect early cancer. This is a remarkable and advantageous effect not found in conventional markers.

  Here, the “serum tumor marker for detecting digestive organ cancer” according to the present invention means “a serum tumor marker used for detecting digestive organ cancer”. A “serum tumor marker” is a so-called “tumor marker” that can detect a tumor (cancer) in a subject using a test using serum, plasma, or the like as a sample. In other words, the marker of the present invention uses body fluid such as serum or plasma derived from a subject as a sample, measures the concentration of olfactomedin 4 protein and Reg IV protein in the sample, and in a body fluid sample of a healthy person It is possible to detect gastrointestinal cancer in a subject by comparing with the concentration of. More specifically, if the concentration of olfactomedin 4 protein and Reg IV protein in the subject-derived sample are higher than those in the healthy subject-derived sample, it can be determined that digestive organ cancer is present in the subject. In addition, since the marker of the present invention is a serum tumor marker, digestive cancer in a subject can be detected only by a simple test using serum or plasma as a sample without performing pathomorphological diagnosis that requires skill. Therefore, it is possible to enjoy the effect that a large number of specimens can be examined efficiently. In particular, the marker of the present invention can be preferably used for detection of gastric cancer and pancreatic cancer among digestive organ cancers. The above-mentioned “tumor marker” means a substance that can determine whether a tumor (cancer) is present in a subject by detecting the presence / absence, concentration, mutation status, and the like. .

  The markers of the present invention include both olfactomedin 4 protein and Reg IV protein. As shown in the examples described later, the present inventors have found that cases in which serum olfactomedin 4 protein concentration is elevated and cases in which serum serum Reg IV protein concentration is elevated do not tend to match. I found it. And it discovered that the detection sensitivity of gastric cancer in a subject could be remarkably improved by measuring the concentration of olfactomedin 4 protein and Reg IV protein in serum. Therefore, by including olfactomedin 4 protein and Reg IV protein in the marker of the present invention, a method for detecting digestive organ cancer having high detection sensitivity can be realized. The marker of the present invention may include a conventionally known serum tumor marker.

Here, the gene of “olfactomedin 4 protein” has already been cloned, and the base sequence of the cDNA (mRNA) is registered in GenBank ( Accession No. NM — 006418). The amino acid sequence of olfactomedin 4 protein is shown in SEQ ID NO: 1, and the base sequence of cDNA that is olfactomedin 4 gene is shown in SEQ ID NO: 3. In addition, the amino acid sequence of olfactomedin 4 protein is not limited to this, The amino acid shown by sequence number 1 includes the variant of olfactomedin 4 protein which has a row | line | column. That is, the origin of the olfactomedin 4 gene encoding olfactomedin 4 protein and the mutated protein that can be generated by mutation are also included in the olfactomedin 4 protein in the description of the present invention. In other words, a mutant protein having an amino acid sequence in which one or several amino acids are substituted, deleted, inserted, and / or added in the amino acid sequence shown in SEQ ID NO: 1 is also olfactomedin 4 in the description of the present invention. Included in proteins. The above “one or several amino acids are substituted, deleted, inserted, and / or added” is not particularly limited, but known mutant protein preparations such as site-directed mutagenesis The number of amino acids (preferably 10 or less, more preferably 7 or less, and even more preferably 5 or less) that can be substituted, deleted, inserted and / or added by the method is substituted, deleted, inserted, and / or Or it means to be added. The function of olfactomedin 4 protein has not been identified so far, and the relationship between the concentration of olfactomedin 4 protein in serum and digestive organ cancer is not known at all. Therefore, the present inventors found great achievements that the olfactomedin 4 protein can function as a serum tumor marker for gastrointestinal cancer including gastric cancer.

  On the other hand, the gene for “Reg IV protein” has already been cloned, and the base sequence of the cDNA (mRNA) is registered in GenBank (Accession No. NM — 032044). The amino acid sequence of Reg IV protein is shown in SEQ ID NO: 2, and the nucleotide sequence of cDNA that is Reg IV gene is shown in SEQ ID NO: 4. The amino acid sequence of Reg IV protein is not limited to this, and the amino acid shown in SEQ ID NO: 2 includes a variant of Reg IV protein having a sequence. That is, the origin of the Reg IV gene encoding the Reg IV protein and the mutant protein that can be generated by mutation are also included in the Reg IV protein in the description of the present invention. In other words, in the amino acid sequence shown in SEQ ID NO: 2, a mutant protein having an amino acid sequence in which one or several amino acids are substituted, deleted, inserted, and / or added is also Reg IV in the description of the present invention. Included in proteins. The above “one or several amino acids are substituted, deleted, inserted, and / or added” is not particularly limited, but known mutant protein preparations such as site-directed mutagenesis The number of amino acids (preferably 10 or less, more preferably 7 or less, and even more preferably 5 or less) that can be substituted, deleted, inserted and / or added by the method is substituted, deleted, inserted, and / or Or it means to be added. The function of Reg IV protein is known to phosphorylate epidermal growth factor receptor and suppress apoptosis (“Mitani Y, Oue N, Matsumura S, Yoshida K, Noguchi T, Ito M, Tanaka S, Kuniyasu H, Kamata N, Yasui W. Reg IV is a serum biomarker for gastric cancer patients and predicts response to 5-fluorouracil-based chemotherapy. Oncogene. 2007; 26 (30): 4383-4393. , Luo Q, Murmu N, Houchen CW, Anant S, Dieckgraefe BK.Reg IV activates the epidermal growth factor receptor / Akt / AP-1 signaling pathway in colon adenocarcinomas.Gastroenterology. 2006; 130 (1): 137-149 See

  In the description of the present invention, “olfactomedin 4 gene” and “Reg IV gene” mean “polynucleotide encoding olfactomedin 4 protein” and “polynucleotide encoding Reg IV”, respectively. The “polynucleotide” may contain an intron, and may be DNA or RNA.

<2. Digestive system cancer detection method>
The method for detecting gastrointestinal cancer of a sample derived from a subject according to the present invention (hereinafter referred to as “the detection method of the present invention”) measures the expression level of olfactomedin 4 protein and the expression level of Reg IV protein in a sample derived from the sample. It is characterized by including a measurement process. That is, as described above, olfactomedin 4 protein and Reg IV protein can be tumor markers for gastrointestinal cancer including gastric cancer. Therefore, by examining the expression level of the protein constituting the marker of the present invention in the sample derived from the subject, digestive organ cancer in the sample derived from the subject can be detected. More specifically, if the expression level of olfactomedin 4 protein and the expression level of Reg IV protein in a sample derived from a subject are higher than those in a sample derived from a healthy subject, it can be determined that digestive organ cancer is present in the sample. .

  In the description of the detection method of the present invention, the terminology in the section of the marker of the present invention is used as appropriate for the terms common to the marker of the present invention.

  In one embodiment of the detection method of the present invention, the measurement step is a step of measuring the concentration of olfactomedin 4 protein and the concentration of Reg IV protein in the sample derived from the subject. Here, the sample derived from the subject is not particularly limited, and blood (serum, plasma), body fluid, lymph, urine, digestive organ (eg, stomach) cells, digestive secretions collected from the subject, Is available. From the viewpoint of ease of sample preparation, blood, particularly serum, is preferable as the specimen-derived sample. As described above, since the marker of the present invention is a so-called serum tumor marker, it can also be detected in serum. As a method for preparing the specimen-derived sample, a known method may be appropriately performed. For example, when preparing serum, blood is obtained from a subject, the blood is centrifuged, and the supernatant is obtained.

  The subject to be detected by the detection method according to the present invention is not particularly limited as long as it is a subject capable of developing gastrointestinal cancer. For example, human, dog, cat, sheep, goat, mouse, rat, rabbit , Mammals including cattle, horses, and pigs.

  In the measurement process, when measuring the concentration of olfactomedin 4 protein and Reg IV protein in the sample derived from the subject, it is specific to substances that specifically interact with olfactomedin 4 protein and Reg IV protein, such as olfactomedin 4 protein. Antibody (referred to as “anti-olfactomedin 4 antibody”) and an antibody specific to Reg IV protein (referred to as “anti-Reg IV antibody”), Western blotting, ELISA (solid phase enzyme immunoassay), immunoprecipitation In addition, known methods such as immunohistochemistry and antibody array methods may be appropriately adopted and applied. Of the above measurement methods, the ELISA method is preferred because it is more sensitive and simple. The specific conditions for these measurement methods are matters that can be appropriately set by those skilled in the art.

  Here, in the ELISA method, the protein contained in the specimen sample is immobilized on a multi-well plate (also referred to as “microtiter plate”), and then the olfactomedin 4 protein concentration and Reg This is a method for detecting IV protein concentration. For example, an antibody bound to olfactomedin 4 protein and Reg IV protein may be detected using alkaline phosphatase or peroxidase-conjugated anti-IgG antibody as a secondary antibody. The ELISA method may be a sandwich method.

On the other hand, in Western blotting, a sample derived from an analyte is separated by SDS-polyacrylamide electrophoresis, and then transferred to a nitrocellulose membrane or the like. This is a method for detecting protein concentration. The antibody bound to olfactomedin 4 protein and Reg IV protein may be detected using, for example, ¹²⁵ I-labeled protein A, peroxidase-conjugated anti-IgG antibody or the like as the secondary antibody. The concentration of olfactomedin 4 protein and Reg IV protein can be measured, for example, by confirming the signal intensity obtained using a densitometer or the like. That is, the stronger the signal intensity, the higher the olfactomedin 4 protein concentration and the Reg IV protein concentration, and the concentration can be measured using a calibration curve.

  One embodiment of the detection method of the present invention is such that the concentration of olfactomedin 4 protein and the concentration of Reg IV protein in the sample derived from the subject measured as described above are compared with these concentrations in the sample derived from a healthy subject. The gastrointestinal cancer in the sample is detected using whether or not it is high as an index. Here, the concentration of olfactomedin 4 protein and Reg IV protein in the sample derived from the subject was compared with those in the sample derived from the healthy subject. The above measurement process was performed on the sample derived from the healthy subject simultaneously with the sample derived from the subject. And can be carried out by comparing the concentration obtained thereby. At this time, whether or not the concentration of olfactomedin 4 protein and the concentration of Reg IV protein in the sample derived from the subject are higher than those in the sample derived from a healthy subject can be determined by comparing the two. Good. In addition, the concentration of olfactomedin 4 protein and the concentration of Reg IV protein in the sample derived from the subject were compared with those in the sample derived from the healthy subject. It may be performed by comparing the concentration of the IV protein with these concentrations measured for the analyte-derived sample. Furthermore, a boundary value (cutoff value) that can be used to determine the presence or absence of digestive organ cancer in the subject is set in advance, and whether or not the concentration in the subject-derived sample is higher than the boundary value. The presence or absence of digestive organ cancer may be determined.

  Here, the boundary value is not limited because it may vary depending on the sample used, but, for example, the boundary value of olfactomedin 4 protein concentration and Reg IV protein concentration in human-derived serum in the examples described later The boundary values are 2 ng / ml and 8.31 ng / ml, respectively. In the detection method of the present invention, if the concentration of olfactomedin 4 protein and the concentration of Reg IV protein in the subject-derived sample are higher than the boundary values, respectively, it can be determined that digestive organ cancer is present in the subject. it can. Conversely, if the concentration of olfactomedin 4 protein and Reg IV protein in the sample derived from the subject are lower than the above boundary values, it can be determined that digestive organ cancer does not exist in the subject.

The anti-olfactomedin 4 antibody and the anti-Reg IV antibody can be prepared by using various known methods, and the preparation method is not particularly limited. For example, using the method of HarLow et al., “Antibodies: A laboratory manual, Cold Spring Harbor Laboratory, New York (1988)”, Iwasaki et al., “Monoclonal antibody hybridoma and ELISA, Kodansha (1991)”, etc. Can do. The antibody may be a polyclonal antibody or a monoclonal antibody, and is not only a complete antibody molecule capable of specifically binding to olfactomedin 4 protein or Reg IV protein, but also, for example, Fab and F (ab ′) ₂ fragments. Such an antibody fragment may be used. Fab and F (ab ′) ₂ fragments lack the Fc portion of the complete antibody, are removed more rapidly by circulation, and have little non-specific tissue binding of the complete antibody (Wahl et al., J. Nucl. Med. 24: 316-325 (1983)), which can be preferably used.

  By the way, the measuring step in the detection method of the present invention may be a step of measuring the amount of mRNA of olfactomedin 4 gene and the amount of mRNA of Reg IV gene in the sample derived from the subject. That is, in the detection method of the present invention, the measurement step measures the expression level of olfactomedin 4 protein and the expression level of Reg IV protein by measuring the amount of mRNA of olfactomedin 4 gene and the amount of mRNA of Reg IV gene. It may be. In such an embodiment, by measuring the expression level of the gene from the amount of mRNA of olfactomedin 4 gene and Reg IV gene in the sample derived from the subject, and comparing this level with the expression level of the sample derived from the healthy subject, It is the aspect of detecting the presence or absence of digestive organ cancer in the inside.

  Using as an index whether the expression level of olfactomedin 4 gene and the expression level of Reg IV protein gene in the sample derived from the subject measured as described above are higher than those in the sample derived from healthy subjects Detect gastrointestinal cancer in a specimen. Here, the comparison between the expression level of olfactomedin 4 gene and Reg IV gene in the sample derived from the subject and those in the sample derived from the healthy subject is as follows. This can be done by taking measurements and comparing the resulting mRNA amounts. At this time, whether the expression level of olfactomedin 4 gene and the expression level of Reg IV gene in the sample derived from the subject are higher than those in the sample derived from the healthy subject is compared between the amounts of mRNA. Relative judgment. In addition, the expression level of olfactomedin 4 gene and the expression level of Reg IV gene in the sample derived from the subject and comparison with these in the sample derived from the healthy subject are compared with the mRNA of olfactomedin 4 gene in the sample derived from the healthy subject measured in advance. It may be carried out by comparing the amount of mRNA of Reg IV gene and the amount of mRNA measured for a sample derived from a subject. In addition, a boundary value (cut-off value) that can determine the presence or absence of digestive organ cancer in the subject is set in advance, and whether or not the amount of mRNA in the subject-derived sample is higher than the boundary value is derived from the subject. The presence or absence of digestive organ cancer in the sample may be determined.

  The method for measuring the amount of mRNA is not particularly limited as long as it can measure the desired amount of mRNA, and can be appropriately selected from known methods. For example, the above-mentioned polynucleotide consisting of mRNA of olfactomedin 4 gene and mRNA of Reg IV gene, or cDNA thereof or a part of their complementary strand, and site in RNA or cDNA of olfactomedin 4 gene and Reg IV gene Examples thereof include a method using a primer or a probe containing a polynucleotide that specifically binds (hybridizes).

Specifically, the mRNA or cDNA can be detected by labeling the primer or probe and detecting the label. Then, the amount of mRNA can be measured by examining the signal intensity of the label. It is not particularly restricted but includes the label, for example, addition of a radioactive material represented by ^{32 P,} it is possible to use a fluorescent material represented by fluorescein. The polynucleotide used as the primer and / or probe is, for example, by a conventionally known method based on the base sequence of olfactomedin 4 gene shown in SEQ ID NO: 3 and the base sequence of Reg IV gene shown in SEQ ID NO: 4. Can be designed. For example, it is well known to those skilled in the art that a polynucleotide that can be used as a primer for specifically amplifying a target mRNA (cDNA) can be used as a probe for specifically detecting the mRNA (cDNA). Based on this knowledge, a polynucleotide that can be used as a probe may be designed.

  Known methods for detecting mRNA using primers or probes containing polynucleotides that specifically bind to mRNA or cDNA include, for example, RT-PCR, real-time RT-PCR, competitive PCR, in situ high Examples include a hybridization method, an in situ PCR method, a DNA array method, and a northern blot method.

  RT-PCR (Reverse transcribed-Polymerase chain reaction) method is a method of synthesizing cDNA by reverse transcriptase reaction using mRNA of olfactomedin 4 gene and Reg IV gene as a template and then amplifying DNA by PCR [Kawasaki ES, et al., Amplification of RNA. In PCR Protocol, A Guide to methods AND applications, Academic Press, Inc., San Diego, 21-27 (1991)]. The amplification reaction of DNA is not particularly limited, and those skilled in the art can appropriately adopt optimum conditions after studying them. Further, the amplification regions of the olfactomedin 4 gene and the Reg IV gene are not necessarily full length, and may be a partial region of the gene as long as there is no problem in confirming the amplification product. The amount of amplified DNA (corresponding to the amount of mRNA) can be detected by, for example, using the above DNA amplification reaction solution for agarose gel electrophoresis and then using a probe that specifically hybridizes to the target amplified fragment. it can. On the other hand, when a sufficient amount of amplification product is obtained, after agarose gel electrophoresis, the gel can be stained with EtBr and confirmed by the position of the amplified polynucleotide and its fluorescence intensity.

  Furthermore, a real-time RT-PCR method can be performed by using a real-time monitoring reagent during RT-PCT. The real-time RT-PCR method is a method for monitoring and analyzing the production process of amplification products in real time. Therefore, the amplification reaction can be stopped before the amplification amount of the amplification product is saturated. Therefore, the amount of mRNA of olfactomedin 4 gene and the amount of mRNA of Reg IV gene can be measured more accurately. Examples of the real-time monitoring reagent include SYBR (registered trademark: Molecular Probes) Green, TaqMan (registered trademark: Applied Biosystems) probe, and the like.

  Also, the amount of mRNA of olfactomedin 4 gene and the amount of mRNA of Reg IV gene can be measured by Northern hybridization. In this case, a certain amount of crude RNA sample extracted from the sample is fixed to a nylon filter or the like after fractionation based on molecular weight, etc., and the mRNA of the olfactomedin 4 gene and Reg IV gene mRNA to be detected are contacted with the probe, The amount of mRNA can be measured by detecting the probe hybridized to the mRNA.

  The detection of mRNA levels of olfactomedin 4 gene and Reg IV gene by in situ hybridization can be performed, for example, by the following method. A specimen-derived sample (a sample such as a cell or tissue section) is fixed with formalin or the like. After processing the probe so that it can permeate the sample using Triton-X or the like, the probe is added and hybridized with mRNA of olfactomedin 4 gene and mRNA of Reg IV gene. And it can implement by detecting the probe hybridized to the said mRNA.

  The detection of the amount of olfactomedin 4 gene mRNA and Reg IV gene mRNA by the DNA array method can be performed, for example, by the following method. The cDNA of olfactomedin 4 gene and Reg IV gene or a partial sequence thereof is immobilized on a support and hybridized with mRNA or cDNA prepared from a sample derived from a subject. At this time, hybridization between the cDNA or its partial sequence immobilized on the support and RNA or cDNA prepared from the sample can be detected by fluorescent labeling of the mRNA or cDNA.

  The amount of mRNA can be measured, for example, by confirming the signal intensity obtained using a densitometer or the like for the mRNA or cDNA detected by the above-described method. That is, it can be judged that the amount of mRNA or cDNA is higher as the signal intensity is stronger.

<3. Gastrointestinal cancer detection kit>
A digestive cancer detection kit according to the present invention (hereinafter referred to as “kit of the present invention”) comprises detection means A for detecting the expression of olfactomedin 4 protein and detection means B for detecting the expression of Reg IV protein. It is characterized by including. As described above, olfactomedin 4 protein and Reg IV protein can be serum tumor markers of gastrointestinal cancer including gastric cancer. Therefore, according to the kit including means capable of examining the expression level of the protein constituting the marker of the present invention in the sample derived from the subject, digestive organ cancer in the sample derived from the subject is selectively and easily detected. be able to. That is, using the kit of the present invention, if the expression level of olfactomedin 4 protein and Reg IV protein in a sample derived from a subject is higher than those in a sample derived from a healthy subject, it is judged that digestive organ cancer exists in the sample. can do.

  In the description of the detection method of the present invention, for terms common to the marker of the present invention, the description of terms in the section of the marker and detection method of the present invention is incorporated as appropriate.

  Here, as detection means A for detecting the expression of olfactomedin 4 protein, a substance that specifically interacts with olfactomedin 4 protein, for example, an antibody specific to olfactomedin 4 protein (referred to as “anti-olfactomedin 4 antibody”). Can be mentioned. Expression of olfactomedin 4 protein is performed by performing known methods such as Western blotting, ELISA (solid phase enzyme immunoassay), immunoprecipitation, immunohistochemistry, and antibody array using this detection means A. Can be detected. The explanation of the antibody and the specific method for detecting the expression of olfactomedin 4 protein are as described in the detection method of the present invention.

  The detection means A may be a primer or probe containing a polynucleotide that binds (hybridizes) site-specifically to RNA or cDNA of the olfactomedin 4 gene. The polynucleotide that can constitute such detection means A can also be referred to as a polynucleotide that hybridizes with the olfactomedin 4 gene under stringent conditions. The term “stringent conditions” as used herein means that hybridization occurs only when at least 90% identity, preferably at least 95% identity, most preferably 97% identity exists between sequences. Means what happens. The hybridization can be performed by a well-known method such as the method described in “Sambrook et al., Molecular Cloning, A Laboratory Manual, 2d Ed., Cold Spring Harbor Laboratory (1989)”. Generally, the higher the temperature and the lower the salt concentration, the higher the stringency (that is, the more difficult it is to hybridize). Conventionally known hybridization conditions can be suitably used, and are not particularly limited. For example, 42 ° C., 6 × SSPE, 50% formamide, 1% SDS, 100 μg / ml salmon sperm DNA, 5 × Denhardt's solution (however, 1 × SSPE; 0.18M sodium chloride, 10 mM sodium phosphate, pH 7.7, 1 mM EDTA. 5 × Denhardt's solution; 0.1% bovine serum albumin, 0.1% Ficoll, 0.1% Polyvinylpyrrolidone).

  On the other hand, detection means B for detecting the expression of Reg IV protein includes a substance that specifically interacts with Reg IV protein, for example, an antibody specific to Reg IV protein (referred to as “anti-Reg IV antibody”). It is done. The detection means B may be a primer or probe containing a polynucleotide that specifically binds (hybridizes) to RNA or cDNA of the Reg IV gene. The polynucleotide that can constitute such detection means B can also be referred to as a polynucleotide that hybridizes with the Reg IV gene under stringent conditions. In the description of the detecting means B, “olfactomedin 4” in the description of the detecting means A is replaced with “Reg IV” and used.

  The kit of the present invention may include an instrument in which the detection means A and the detection means B are immobilized on a support. More specifically, a polynucleotide that hybridizes with the olfactomedin 4 gene under stringent conditions (detection means A) and a polynucleotide that hybridizes with the Reg IV gene under stringent conditions (detection means B) are present on the support. Examples include an immobilized DNA array (DNA chip). The polynucleotide immobilized on the support is a polynucleotide that hybridizes with the olfactomedin 4 gene under stringent conditions (detection means A) and a polynucleotide that hybridizes with the Reg IV gene under stringent conditions (detection means B). ) Is not particularly limited. Further, on the support, a polynucleotide other than the polynucleotide that hybridizes with the olfactomedin 4 gene under stringent conditions (detection means A) and the polynucleotide that hybridizes with the Reg IV gene under stringent conditions (detection means B). In addition, a polynucleotide, for example, a polynucleotide capable of detecting a conventionally known tumor marker may be immobilized.

  The support is not particularly limited as long as the polynucleotide can be immobilized, and may be any shape or material. In general, for example, inorganic materials such as glass and silicon wafers, natural polymers such as paper, synthetic polymers such as nitrocellulose and nylon, synthetic polymers and natural polymers are used as the support material. And the like.

  As a method for immobilizing a polynucleotide on a support, a known DNA array production method can be employed. For example, a cDNA array can be prepared by preparing a polynucleotide solution consisting of cDNA (full length sequence or partial sequence) and spotting it on a support with a spotter or the like. The polynucleotide to be immobilized may be a synthetic oligonucleotide having a cDNA base sequence. It is also possible to use a so-called affiliometric DNA chip technique for synthesizing DNA on a substrate.

  In addition, a known technique relating to a DNA chip can also be applied to the present invention. For example, a cDNA or cRNA prepared from total RNA or mRNA derived from a subject is fluorescently labeled and immobilized on a support. Hybridize with nucleotide. The expression level of the gene can be evaluated by measuring the amount of the hybridized cDNA or cRNA using fluorescence as an index. In addition, if cDNA and cRNA prepared from two types of samples are labeled with fluorescent substances that emit different colors, and hybridized to polynucleotides on the same support, the color tone and fluorescence intensity are measured, Differences in gene expression can be assessed.

  In addition, the kit of the present invention may include a device in which an anti-olfactomedin 4 antibody (detection means A) and an anti-Reg IV antibody (detection means B) are immobilized on a support. More specifically, an antibody array or ELISA plate in which an anti-olfactomedin 4 antibody (detection means A) and an anti-Reg IV antibody (detection means B) are immobilized on a support can be mentioned. In addition, the above-mentioned device has the same support for an antibody other than anti-olfactomedin 4 antibody (detection means A) and anti-Reg IV antibody (detection means B) (for example, an antibody that can specifically bind to a conventionally known tumor marker protein). It may be fixed on the top.

  The support is not particularly limited as long as it can immobilize an antibody, that is, a polypeptide, and may have any shape or material. As a support material, generally, for example, inorganic materials such as glass and silicon wafers, natural polymers such as paper, synthetic polymers such as nitrocellulose, nylon and polystyrene, synthetic polymers, natural polymers The gel body using can be mentioned.

  A known technique for detecting a polypeptide using an antibody can also be applied in the present invention. For example, Cyphergen Biosystems sells a biological chip as one type of protein chip. This is one having a carbonyldiimidazole or epoxy active group on the surface of a substrate (support), and is used by a user to freely immobilize a desired polypeptide or antibody. The anti-olfactomedin 4 antibody (detection means A) and anti-Reg IV antibody (detection means B) can be applied to the production of an instrument in which the antibody is immobilized on a support.

  The kit of the present invention may contain a configuration other than the above. For example, a reagent for preparing RNA from a sample derived from a subject, a reverse transcriptase, a buffer used for a reverse transcription reaction, a heat-resistant DNA polymerase, a PCR reagent, a real-time PCR reagent, a PCR tube, a PCR plate, Reagents for fluorescently labeling cDNA, hybridization reagents, and the like may be included.

  In addition, the kit of the present invention may contain a configuration for performing an ELISA method or a Western blot method, for example, a labeled secondary antibody, a coloring reagent, a washing buffer, and the like.

  The present invention is not limited to the above-described embodiments, and various modifications can be made within the scope of the claims, and the embodiments can be obtained by appropriately combining technical means disclosed in different embodiments. The form is also included in the technical scope of the present invention.

  EXAMPLES Hereinafter, although this invention is demonstrated further in detail using an Example, this invention is not limited to these Examples. Unless otherwise specified, methods necessary for general gene recombination, such as nucleic acid extraction, cleavage, ligation, E. coli transformation, and gene sequencing, are commercially available reagents and equipment used for each operation. The basic instructions were followed in accordance with the instructions attached to the above, and experimental documents (for example, “Molecular Cloning, a Laboratory Manual, 3rd Ed (Sambrook et al. (2001), Cold Spring Harbor Laboratory Press)”).

(1) Identification of gastric cancer-specific gene candidates by SAGE method Gene expression of human-derived gastric cancer tissues was comprehensively analyzed using the SAGE method. That is, reverse transcription reaction was performed using biotin-labeled oligo dT primer using mRNA (5 μg) prepared from the above gastric cancer as a material to synthesize first strand and second strand. Next, the fragment was cleaved with a restriction enzyme NlaIII that recognizes and cleaves CATG, and 3′-side fragments were recovered using magnetic beads coated with avidin. After binding the linker by ligase, the fragment was cleaved with restriction enzyme BsmFI that recognizes and cleaves 10-12 bases 3 ′ from CATG, and the 5 ′ fragment was recovered using magnetic beads coated with avidin. Two molecules of the obtained fragment were ligated using ligase and amplified by PCR using a primer having a linker base sequence as a template.

  After the amplification product was purified on a gel, several fragments were ligated in series by ligase. A fragment of 500 bp or more was recovered by electrophoresis, incorporated into pZero, and transformed into E. coli DH10B. Escherichia coli was cultured in an LB medium containing the antibiotic zeocin, a plasmid was extracted from the grown colonies, and the nucleotide sequence of the incorporated fragment was determined. Base sequence information was converted into gene expression information using SAGE2000 software, and a gastric cancer SAGE library was constructed.

  In order to identify genes specifically expressed in gastric cancer, the SAGE library of normal gastric tissue that can be used in “SAGEmap”, a SAGE database of NCBI (National Biotechnology Information Center), and the above-mentioned gastric cancer SAGE library Were compared on the computer. As a result, 54 candidate genes (including olfactomedin 4 gene and Reg IV gene) that were highly expressed in gastric cancer tissues and not expressed in normal stomach tissues were found.

(2) Measurement of expression level of marker gene by real-time RT-PCR method Using the real-time RT-PCR method, the levels of 54 candidate genes including the above olfactomedin 4 gene and Reg IV gene in human-derived gastric cancer did. Nine human-derived gastric cancer tissues were used as samples, and 14 types of human normal tissues were used as control samples. Total RNA was extracted from each of the 9 cases of gastric cancer. Total RNA of 14 types of normal tissues was purchased from Clontech (cerebrum (catalog number 636530), spinal cord (catalog number 636554), heart (catalog number 636532), lung (catalog number 636524), stomach (catalog number). 636578), small intestine (catalog no. 636539), colon (catalog no. 636553), liver (catalog no. 636553), pancreas (catalog no. 636529), kidney (catalog no. ), Skeletal muscle (catalog number 636534), white blood cell (catalog number 636580)).

  CDNA was synthesized according to a conventional method using the total RNAs of 9 cases of gastric cancer and 14 cases of normal tissue as templates. Next, real-time RT-PCR was performed using the above cDNA as a template and specific primers. Real-time RT-PCR was performed on the ABI PRISM (registered trademark) 7700 Sequence Detection System manufactured by Applied Biosystems using the SYBR Green PCR Core Reagents Kit.

The composition of the reaction solution, 10 × SYBR Green PCR Buffer: 5μL, 25mM MgCl2 Solution: 6μL, 12.5mM dNTP Mix: 4μL, 5U / μL Ampli Taq Gold TM: 0.25μL, 1U / μL AmpErase ( TM): 0.5 [mu] L Forward primer: 0.5 μL, Reverse primer: 0.5 μL, Sample (cDNA derived from each tissue): 1 μL, and sterile distilled water: 32.25 μL. All but the primer, sample and sterile distilled water are included with the SYBR Green PCR Core Reagents Kit. The reaction conditions were 50 ° C / 2 minutes and 95 ° C / 10 minutes, followed by 40 cycles of reaction at 95 ° C / 15 seconds and 60 ° C / 1 minute.

  In addition, the primer of the base sequence represented by sequence number 5 (TGGTGAACATCAGCAAACCG) was used as a Forward primer for olfactomedin 4 gene, and the primer of the base sequence represented by sequence number 6 was used as a reverse primer (TCCCTACCCCAAGCACCATA). Moreover, the primer of the base sequence represented by sequence number 7 (GCCCCGCCATCCCTT) was used as the Forward primer for Reg IV gene, and the primer of the base sequence represented by sequence number 8 was used as the reverse primer (CTGCTCGAGACAGCCAGAGA).

  As a result of the real-time RT-PCR, it was found that olfactomedin 4 gene and Reg IV gene are highly expressed in gastric cancer tissues and very low in normal tissues.

  FIG. 1 shows the results of real-time RT-PCR for olfactomedin 4 gene. Specifically, FIG. 1 shows the amount of mRNA of olfactomedin 4 gene in each sample of 9 cases of gastric cancer and 14 types of normal tissues. 1 represents the relative value of the amount of olfactomedin 4 gene mRNA in each sample, where the highest amount of olfactomedin 4 gene mRNA in normal tissues is 1. The result of FIG. 1 shows that the expression of olfactomedin 4 gene is high in gastric cancer tissues and very low in normal tissues.

  FIG. 2 shows the results of real-time RT-PCR for the Reg IV gene. Specifically, FIG. 2 shows the amount of mRNA of Reg IV gene in each sample of 9 cases of gastric cancer and 14 types of normal tissues. The value on the vertical axis in FIG. 2 represents the relative value of the amount of Reg IV gene mRNA in each sample, assuming that the highest amount of Reg IV gene mRNA in normal tissues is 1. The results in FIG. 2 indicate that Reg IV gene is highly expressed in gastric cancer tissues and very low in normal tissues.

(3) Detection of marker protein in serum by ELISA method Serum of gastric cancer patients (35 patients with Stage I, 6 patients with Stage II, 10 patients with Stage III, 9 patients with Stage IV) and healthy subjects (olfactomedin 4 protein The serum of 35 cases and 101 cases of Reg IV protein were used as samples, and the concentrations of olfactomedin 4 protein and Reg IV protein were measured by ELISA. Specifically, it was as follows.
<For olfactomedin 4 protein>
(1) Add 10 μg / mL of mouse anti-olfactomedin 4 antibody (prepared by the present inventors), which is the primary antibody, to each well of a microtiter plate (hereinafter referred to as “plate”), and let stand at 4 ° C. overnight. And solidified. The mouse anti-olfactomedin 4 antibody was diluted with 1% BSA, Tris-HCl (pH 7.4).
(2) The plate was washed 3 times with PBS. Thereafter, 5% skim milk was added to each well of the plate, and blocking was performed at 37 ° C. for 3 hours.
(3) Serum sample and standard (recombinant olfactomedin 4: prepared by the inventor) diluted 5 times with PBS and diluted 5 times were added to each well of the plate and allowed to stand at 4 ° C. overnight. Serum samples were diluted with 1% BSA, PBS (pH 7.4).
(4) The plate was washed 3 times with PBS. Thereafter, 0.75 μg / mL of a biotin-labeled mouse anti-olfactomedin 4 antibody (prepared by the present inventors) as a secondary antibody was added to each well of the plate and treated at 37 ° C. for 1 hour. The antibody was diluted with 1% BSA, Tris-HCl (pH 7.4), 0.05% goat serum.
(5) Washed 3 times with PBS. Thereafter, streptavidin-labeled alkaline phosphatase (purchased from Dako, catalog number D0396) diluted 2000 times was added to each well of the plate and treated at 37 ° C. for 1 hour. Streptavidin labeled alkaline phosphatase was diluted with 1% Tris-HCl (pH 7.4).
(6) Washed 3 times with PBS. pNPP (purchased from Sigma, catalog number N7653) was added to each well of the plate and treated at 37 ° C. for 1 hour.
(7) OD 405 nm was measured, and serum olfactomedin 4 protein concentration was calculated from the standard curve.
<Reg IV protein>
(1) A mouse anti-Reg IV antibody (purchased from R & D Systems, catalog number MAB1379) 2.5 μg / mL as a primary antibody was added to each well of the plate and allowed to stand overnight at 4 ° C. for solidification. The mouse anti-olfactomedin 4 antibody was diluted with 1% BSA and Tris-HCl (pH 7.4).
(2) The plate was washed 3 times with PBS. Thereafter, 5% skim milk was added to each well of the plate, and blocking was performed at 37 ° C. for 3 hours.
(3) Serum sample and standard (recombinant Reg IV: prepared by the inventor) diluted 5 times with PBS and diluted 5 times were added to each well of the plate and allowed to stand at 4 ° C. overnight. Serum samples were diluted with 1% BSA, PBS (pH 7.4).
(4) The plate was washed 3 times with PBS. Thereafter, a biotin-labeled goat anti-Reg IV antibody (purchased from R & D Systems, catalog number BAF1379) 1.5 μg / mL as a secondary antibody was added to each well of the plate and treated at 37 ° C. for 1 hour. The antibody was diluted with 1% BSA, Tris-HCl (pH 7.4), 0.05% goat serum.
(5) Washed 3 times with PBS. Thereafter, streptavidin-labeled alkaline phosphatase (purchased from Dako, catalog number D0396) diluted 2000 times was added to each well of the plate and treated at 37 ° C. for 1 hour. Streptavidin labeled alkaline phosphatase was diluted with 1% Tris-HCl (pH 7.4).
(6) Washed 3 times with PBS. pNPP (purchased from Sigma, catalog number N7653) was added to each well of the plate and treated at 37 ° C. for 1 hour.
(7) OD 405 nm was measured, and serum Reg IV protein concentration was calculated from the standard curve.

  FIG. 3 shows the results of measuring the concentration of olfactomedin 4 protein in the serum of gastric cancer patients and in the serum of healthy individuals by the ELISA method. The horizontal axis in FIG. 3 shows each group of gastric cancer patients and healthy subjects, and the vertical axis shows the concentration of olfactomedin 4 protein (ng / ml). Moreover, the boundary value (cut-off value: 83.1 ng / ml) of olfactomedin 4 protein concentration which can judge the presence or absence of gastric cancer in a subject is shown by the broken line in FIG. “Cutoff value = (average of serum olfactomedin 4 protein concentration of healthy subject) + 2 × standard deviation”. Further, [number of cases judged to have gastric cancer (= positive)] / [number of analyzed cases] and the ratio (%) are shown in FIG.

  According to the result of FIG. 3, 7 out of 35 Stage I patients were judged positive by detection with olfactomedin 4 protein (20%). In 6 patients with Stage II, 4 patients were judged positive by detection with olfactomedin 4 protein (67%). In 10 Stage III patients, 4 were determined to be positive by detection with olfactomedin 4 protein (40%). In 9 patients with Stage IV, 3 patients were judged positive by detection with olfactomedin 4 protein (33%). On the other hand, 3 out of 35 healthy subjects were determined to be positive by detection with olfactomedin 4 protein (9%). To summarize the results, the sensitivity (= the ratio of the number of cases judged to be positive with respect to the number of cases of gastric cancer patients) when olfactomedin 4 protein was used as a gastric cancer marker was 30%, and the specificity (= [1-positive] The percentage of healthy individuals judged] × 100) was 91%. Therefore, it was confirmed that olfactomedin 4 protein is a serum tumor marker for gastric cancer detection having high sensitivity and high specificity, and can be used for early cancer detection. Furthermore, since it can be detected with high sensitivity even in patients with Stage I and II, it was confirmed that it can be used for detection of early cancer.

  Next, FIG. 4 shows the results of measuring the concentration of Reg IV protein in the serum of gastric cancer patients and the serum of healthy individuals by the ELISA method. The horizontal axis in FIG. 4 shows each group of gastric cancer patients and healthy subjects, and the vertical axis shows the concentration of Reg IV protein (ng / ml). In addition, a boundary value of Reg IV protein concentration (cut-off value: 2 ng / ml) from which the presence or absence of gastric cancer in the subject can be determined is indicated by a broken line in FIG. In addition, “cut-off value = (average of serum Reg IV protein concentration of normal subjects) + 2 × standard deviation”. Further, [number of cases judged to have gastric cancer (= positive)] / [number of analyzed cases] and the ratio (%) are shown in FIG.

  According to the results of FIG. 4, 12 out of 35 Stage I patients were judged positive by detection with Reg IV protein (34%). In 6 patients with Stage II, 3 patients were judged positive by detection with Reg IV protein (50%). In 10 patients with Stage III, 5 patients were judged positive by detection with Reg IV protein (50%). In 9 patients with Stage IV, 2 patients were judged positive by detection with Reg IV protein (22%). On the other hand, in 101 healthy subjects, one case was judged positive by detection with Reg IV protein (1%). To summarize this result, the sensitivity (= ratio of the number of cases judged to be positive with respect to the number of cases of stomach cancer patients) when using Reg IV protein as a marker for detection of gastric cancer was 37%, and the specificity (= [1- Percentage of healthy subjects judged positive] × 100) was 99%. Therefore, it was confirmed that Reg IV protein is a serum tumor marker for gastric cancer detection with high sensitivity and high specificity. Furthermore, since it can be detected with high sensitivity even in patients with Stage I and II, it was confirmed that it can be used for detection of early cancer.

  FIG. 5 shows the results of examining the correlation between the concentration of olfactomedin 4 protein and the concentration of Reg IV protein for each gastric cancer patient. The concentration of olfactomedin 4 protein is plotted on the horizontal axis of FIG. 5, and the concentration of Reg IV protein is plotted on the vertical axis. According to FIG. 5, it was found that patients with high serum olfactomedin 4 protein concentration and patients with high serum Reg IV protein concentration had a low correlation and the two tended to be inconsistent (P = 0.3431, r = −0.1245). When the olfactomedin 4 protein concentration in serum and the Reg IV protein concentration in serum were measured together, the sensitivity of gastric cancer detection increased to 53%. This is much higher than the sensitivity of 15%, which is the sensitivity when CEA and CA19-9, which are conventionally known serum tumor markers, are combined. Therefore, it can be said that measuring the concentration of olfactomedin 4 protein in serum and the concentration of Reg IV protein is extremely effective in detecting gastric cancer.

  As described above, the present invention is effective in selective detection of gastrointestinal cancer including gastric cancer. The marker of the present invention can be used as a digestive cancer diagnostic agent, a digestive cancer diagnostic kit, a digestive cancer research reagent, and the like. Therefore, the present invention can be used in industries such as pharmaceuticals, clinical test drugs, medical devices, and research reagents.

It is a figure which shows the result of having performed real-time RT-PCR about olfactomedin 4 gene. It is a figure which shows the result of having performed real-time RT-PCR about Reg IV gene. It is a figure which shows the result of having measured the density | concentration of olfactomedin 4 protein in the serum of a stomach cancer patient, and the serum of a healthy subject by ELISA method. It is a figure which shows the result of having measured the density | concentration of Reg IV protein in the serum of a stomach cancer patient, and the serum of a healthy subject by ELISA method. It is a figure which shows the result of having investigated the correlation with the density | concentration of olfactomedin 4 protein and the density | concentration of Reg IV protein about each stomach cancer patient.

Claims (13)

  A serum tumor marker for detection of digestive organ cancer comprising olfactomedin 4 protein and Reg IV protein.   The serum tumor marker for gastrointestinal cancer detection according to claim 1, which is used for detection of gastric cancer. The olfactomedin 4 protein comprises (a) the amino acid sequence shown in SEQ ID NO: 1; or (b) one or several amino acids in the amino acid sequence shown in SEQ ID NO: 1, substitution, deletion, insertion, and / or Having an added amino acid sequence;
The Reg IV protein comprises (c) the amino acid sequence shown in SEQ ID NO: 2; or (d) one or several amino acids in the amino acid sequence shown in SEQ ID NO: 2 are substituted, deleted, inserted, and / or The serum tumor marker for detecting digestive organ cancer according to claim 1 or 2, wherein the serum tumor marker has an added amino acid sequence.   A digestive cancer detection kit comprising detection means A for detecting the expression of olfactomedin 4 protein and detection means B for detecting the expression of Reg IV protein. The detection means A is a substance that specifically interacts with olfactomedin 4 protein,
The gastrointestinal cancer detection kit according to claim 4, wherein the detection means B is a substance that specifically interacts with Reg IV protein. The substance that specifically interacts with the olfactomedin 4 protein is an anti-olfactomedin 4 antibody,
The gastrointestinal cancer detection kit according to claim 5, wherein the substance that specifically interacts with the Reg IV protein is an anti-Reg IV antibody. The olfactomedin 4 protein comprises (a) the amino acid sequence shown in SEQ ID NO: 1; or (b) one or several amino acids in the amino acid sequence shown in SEQ ID NO: 1, substitution, deletion, insertion, and / or Having an added amino acid sequence;
The Reg IV protein comprises (c) the amino acid sequence shown in SEQ ID NO: 2; or (d) one or several amino acids in the amino acid sequence shown in SEQ ID NO: 2 are substituted, deleted, inserted, and / or The digestive cancer detection kit according to any one of claims 4 to 6, wherein the kit has an added amino acid sequence.   The digestive organ cancer detection kit according to any one of claims 4 to 7, which is used for detection of gastric cancer.   A method for detecting digestive organ cancer of a sample derived from a subject, comprising a measurement step of measuring the expression level of olfactomedin 4 protein and Reg IV protein in the sample derived from the sample.   The method for detecting digestive organ cancer according to claim 9, wherein the measurement step is a step of measuring the concentration of olfactomedin 4 protein and Reg IV protein in the sample derived from the subject.   The method for detecting digestive organ cancer according to claim 9 or 10, wherein the sample derived from the subject is serum. The olfactomedin 4 protein comprises (a) the amino acid sequence shown in SEQ ID NO: 1; or (b) one or several amino acids in the amino acid sequence shown in SEQ ID NO: 1, substitution, deletion, insertion, and / or Having an added amino acid sequence;
The Reg IV protein comprises (c) the amino acid sequence shown in SEQ ID NO: 2; or (d) one or several amino acids in the amino acid sequence shown in SEQ ID NO: 2 are substituted, deleted, inserted, and / or It has an added amino acid sequence, The digestive organ cancer detection method of any one of Claims 9 thru | or 11 characterized by the above-mentioned.   The method for detecting digestive organ cancer according to any one of claims 9 to 12, which is used for detection of gastric cancer.

Images