JP2009118749A - Stable antibody-binding protein - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide an improved protein of protein G extracellular domain which does not deteriorate the antibody-binding action of the protein G extracellular domain and improves the stability of protein molecule such as thermal stability, chemical stability against modifying agents, and resistance to proteases. <P>SOLUTION: This improved protein of protein G extracellular domain is obtained by selecting an amino acid residue in a partial segment, having a three-dimensional structure stabilized by the interaction of amino acid residues close to the amino acid sequence of the domain with the three-dimensional structure coordinate data of the protein G extracellular domain, as a mutation target site, selecting an amino acid residue high in appearance frequency in a conformation identical or similar to the conformation of the partial segment, as another amino acid residue for replacing the mutation target site, and then replacing the mutation target site. <P>COPYRIGHT: (C)2009,JPO&INPIT

Description

  The present invention relates to a novel and improved protein G extracellular domain which is an antibody-binding protein, and a nucleic acid encoding the protein.

  Protein G, which is a streptococcal protein, is known to have specific binding activity to the Fc region of an antibody (immunoglobulin G) (Non-patent Document 1, Patent Document 1). Protein G is a multi-domain membrane protein composed of a plurality of domains, and it is the extracellular domain of some of these that shows the binding activity to the Fc region of immunoglobulin G (hereinafter referred to as antibody binding activity) ( Non-patent document 2.). For example, in the case of protein G derived from the G148 strain shown in FIG. 1, three domains B1, B2, and B3 exhibit antibody binding activity (also referred to as C1, C2, and C3 domains in the literature). In addition, there are three antibody binding domains in protein G of GX7805 strain and two antibody binding domains in protein G of GX7809. These are all small proteins of less than 60 amino acids, and high homology is observed between their amino acid sequences (FIG. 2). In addition, it is known that antibody binding activity is maintained even when protein G is cleaved to isolate each domain alone (Non-patent Document 3).

  As for the extracellular domain of protein G, many products containing the extracellular domain of protein G utilizing its antibody binding activity are currently on the market (for example, carriers for affinity chromatography for antibody purification (Patent Documents 3 and 4). : JP-A-03-128400, JP-A-2003-088381) and test reagents for detecting antibodies). Since these products utilize the protein G extracellular domain, which is a protein, they are basically unstable, and deterioration due to long-term storage and long-term use is inevitable.

Bjorck L, Kronvall G. (1984) Purification andsome properties of streptococcal protein G, a novel IgG-binding reagent.J Immunol. 133, 969-974. Boyle M. D.P., Ed. (1990) Bacterial Immunoglobulin Binding Proteins. Academic Press, Inc., San Diego, CA. Gallagher T, Alexander P, Bryan P, GillilandGL. (1994) Two crystalstructures of the B1 immunoglobulin-binding domain of streptococcal protein Gand comparison with NMR.Biochemistry19, 4721-4729. Japanese National Publication No. 03-501801 Japanese Patent No.2764021 Japanese Unexamined Patent Publication No. 03-128400 JP 2003-088381 A

  An object of the present invention is to eliminate the problems in the above prior art, and more specifically, to the extracellular domain of the wild-type protein G without impairing the antibody binding activity of the protein G extracellular domain. It is an object of the present invention to provide an improved protein having improved thermal stability, chemical stability against denaturing agents, and resistance to proteolytic enzymes.

The present inventor believes that the main cause of deterioration associated with long-term storage and long-term use of a protein G extracellular domain-containing product depends on the physicochemical properties of the protein G extracellular domain itself. If we can modify the extracellular domain of the G cell itself and improve its natural stability, we will be able to prevent deterioration of the above product due to long-term storage and long-term use. Developed a method to produce a stable mutant protein using the three-dimensional structure coordinate data, applied this to the wild-type protein G • B1 domain, and synthesized a new mutant that satisfies the above-mentioned purpose. It was confirmed that the protein has the intended physical properties, and the present invention has been completed.
That is, the present invention is as follows.

(1) It consists of an amino acid sequence represented by the following (a), (b) or (c), or in the amino acid sequence represented by (a), (b) or (c), X35 to X37, X47 and Consists of an amino acid sequence in which one or several amino acid residues are deleted, substituted, inserted, or added in a portion other than the amino acid residue of X48, and binding activity to an antibody, immunoglobulin G, or Fc region of immunoglobulin G A protein having
(a) AspThrTyrLysLeuIleLeuAsnGlyLysThrLeuLysGlyGluThrThrThrGluAlaValAspAlaAlaThrAlaGluLysValPheLysGlnTyrAlaX35X36X37GlyValAspGlyGluTrThrTyrPrThrThrTyrAr
(In the above amino acid sequences, X35 represents Asn or Lys, X36 represents Asp or Glu, X37 represents Asn, His, or Leu, X47 represents Asp or Pro, and X48 represents Ala, Lys, or Glu, respectively. (Except when X35 is Asn, X36 is Asp, X37 is Asn, X47 is Asp, and X48 is Ala.)
(B) ThrThrTyrLysLeuValIleAsnGlyLysThrLeuLysGlyGluThrThrThrGluAlaValAspAlaAlaThrAlaGluLysValPheLysGlnTyrAlaX35X36X37GlyValAspGlyGluTrpThrTyrPrThrThrTyrArXV
(In the above amino acid sequences, X35 represents Asn or Lys, X36 represents Asp or Glu, X37 represents Asn, His, or Leu, X47 represents Asp or Pro, and X48 represents Ala, Lys, or Glu, respectively. (Except when X35 is Asn, X36 is Asp, X37 is Asn, X47 is Asp, and X48 is Ala.)
(c) ThrThrTyrLysLeuValIleAsnGlyLysThrLeuLysGlyGluThrThrThrLysAlaValAspAlaGluThrAlaGluLysAlaPheLysGlnTyrAlaX35X36X37GlyValAspGlyValTrpThrTyrPrThrThrTyrAr
(In the above amino acid sequences, X35 represents Asn or Lys, X36 represents Asp or Glu, X37 represents Asn, His, or Leu, X47 represents Asp or Pro, and X48 represents Ala, Lys, or Glu, respectively. (Except when X35 is Asn, X36 is Asp, X37 is Asn, X47 is Asp, and X48 is Ala.)
(2) In the above (1), comprising the amino acid sequence represented by any of SEQ ID NOs: 4 to 11, or consisting of a sequence in which one or several amino acid residues are added to the N-terminal side in the amino acid sequence The protein described.
(3) It consists of an amino acid sequence in which the amino acid sequence of the protein according to (1) or (2) above and the amino acid sequence of the linker peptide or linker protein are alternately repeated a plurality of times, and the antibody or immunoglobulin G or Fc of immunoglobulin G A protein having binding activity in a region.
(4) A fusion protein comprising an amino acid sequence obtained by linking the amino acid sequence of the protein according to any one of (1) to (3) above and an amino acid sequence of another protein, wherein the antibody, immunoglobulin G, or immunoglobulin G A protein having binding activity to the Fc region of
(5) A nucleic acid encoding the protein according to any one of (1) to (4) above.
(6) A nucleic acid comprising the base sequence represented by any of SEQ ID NOs: 13 to 20.
(7) A nucleic acid that hybridizes with the nucleic acid according to (5) or (6) above under a stringent condition and encodes an antibody, immunoglobulin G, or a protein having a binding activity to the Fc region of immunoglobulin G.
(8) A recombinant vector containing the nucleic acid according to any one of (5) to (7) above.
(9) A transformant into which the recombinant vector according to (8) is introduced.

The mutant protein of the present invention maintains its original antibody-binding activity, and is more heat stable and chemotactic against denaturing agents than the wild-type protein G · B1 domain consisting of the amino acid sequence represented by [SEQ ID NO: 12]. Stability and resistance to proteolytic enzymes are improved.
On the other hand, wild-type protein G extracellular domain is currently marketed as an affinity chromatography carrier for antibody purification and a test reagent for antibody detection, and is widely used in each field of life science. In addition, with the recent development of antibody-related industries including antibody drugs, the demand for these products has increased dramatically.
Therefore, in many products containing protein G extracellular domain, by substituting the improved protein of the present invention with the wild type, the product can be used for long-term storage, reduction of functional deterioration due to long-term use, and improvement of stability. Expansion of conditions and scope, product storage, operation and management are facilitated, which greatly contributes to technological development in a wide range of technical fields dealing with antibodies.

  Protein G, a streptococcal protein, is known to have a specific binding activity to the Fc region of an antibody (immunoglobulin G) (Reference 1), and purification of the antibody using this antibody binding property It is a protein that is useful for diagnosis, treatment, testing, etc. using antibodies. Protein G is a multidomain membrane protein composed of a plurality of domains, and it is the extracellular domain of some of these that shows binding activity to the Fc region of immunoglobulin G (hereinafter referred to as antibody binding activity) ( Reference 2.). For example, in the case of protein G derived from the G148 strain shown in FIGS. 1, 16, and (SEQ ID NO: 21), three domains B1, B2, and B3 exhibit antibody binding activity (C1, C2 depending on literature). , Also referred to as the C3 domain). In addition, there are three antibody binding domains in protein G of GX7805 strain, and two antibody binding domains in protein G of GX7809. These are all small proteins of less than 60 amino acids, and high homology is observed between their amino acid sequences (FIG. 2). In addition, it is known that antibody binding activity is maintained even when protein G is cleaved and each domain alone is isolated (reference document 3).

The improved protein of the present invention comprises an artificially designed amino acid sequence based on the amino acid sequence of protein G, and maintains antibody binding activity at a high level as compared to wild type protein G. It has extremely high thermal stability, chemical stability against denaturing agents and resistance to proteolytic enzymes.
The improved protein of the present invention is specifically a variant of the above-mentioned BI, B2, and B3 domains of protein G, and is represented by the following amino acid sequences (a) to (c).

(A) Amino acid sequence of an improved protein that is a protein G / B1 domain variant (SEQ ID NO: 1)
In the above amino acid sequences, X35 represents Asn or Lys, X36 represents Asp or Glu, X37 represents Asn, His, or Leu, X47 represents Asp or Pro, and X48 represents Ala, Lys, or Glu.
However, except when X35 is Asn, X36 is Asp, X37 is Asn, X47 is Asp and X48 is Ala (wild type amino acid sequence).

(B) Amino acid sequence of an improved protein that is a protein G / B2 domain variant (SEQ ID NO: 2)
In the above amino acid sequences, X35 represents Asn or Lys, X36 represents Asp or Glu, X37 represents Asn, His, or Leu, X47 represents Asp or Pro, and X48 represents Ala, Lys, or Glu.
However, except when X35 is Asn, X36 is Asp, X37 is Asn, X47 is Asp and X48 is Ala (wild type amino acid sequence).

(C) Amino acid sequence of an improved protein that is a protein G / B3 domain variant (SEQ ID NO: 3)
In the above amino acid sequences, X35 represents Asn or Lys, X36 represents Asp or Glu, X37 represents Asn, His, or Leu, X47 represents Asp or Pro, and X48 represents Ala, Lys, or Glu.
However, except when X35 is Asn, X36 is Asp, X37 is Asn, X47 is Asp and X48 is Ala (wild type amino acid sequence).

The improved protein of the present invention is obtained by introducing a mutation selected into the extracellular domain of wild-type protein G using a newly developed computer algorithm.
The amino acid sequence of the improved protein of the present invention exemplified below is the B1 domain having the highest thermostability and strong antibody binding property among the three extracellular domains B1, B2, and B3 of protein G (reference document 3). 4) Based on the amino acid sequence of 4), it was designed for the purpose of obtaining an improved protein having higher stability than that of the wild-type B1 domain by introducing the selected mutation. However, since the amino acid sequence of the B1 domain has a high homology with the B2 and B3 domains (FIG. 2), it is possible to introduce the selected mutation into the amino acid sequence of the B2 or B3 domain. Thus, an improved protein having higher stability than the wild type B2 or B3 domain can be obtained.

  The improved protein of the present invention is designed on the basis of the site to be mutated selected as follows and the amino acid residue that replaces the site, and is obtained by genetic engineering techniques. Hereinafter, the process for producing the improved protein of the present invention will be described.

1. Selection of Mutation Target Site The target site for introducing a mutation for designing the amino acid sequence of the improved protein of the present invention can be determined using the three-dimensional structure coordinate data of the antibody binding domain of protein G. For example, using the three-dimensional structure coordinate data of the protein G / B1 domain, calculate the local contact index I ^loc and select the partial segment whose three-dimensional structure is stabilized by the interaction between amino acid residues near the sequence. . Next, the non-local contact index I ^nl is calculated using the three-dimensional structure coordinate data of the protein G · B1 domain, and amino acid residues having weak interaction with amino acid residues far from the sequence are selected. Thereafter, the mutation aptitude index I ^M is calculated from the calculated values of I ^loc and I ^nl , and the amino acid residue as the mutation target site is determined.
A partial segment whose steric structure has been stabilized by the interaction between amino acid residues in the vicinity of the sequence can prevent the unforeseen disadvantage on the entire protein molecule by setting a mutation site in the segment. It can be expected to improve the structural stability. In addition, by excluding amino acid residues that strongly interact with amino acid residues far from the sequence from the mutation site, it can be expected to suppress unexpected disadvantages on the entire protein molecule. Thus, amino acid residues present in the partial segment selected as above using the local contact index I ^loc and selected as above using the non-local contact index I ^nl Is preferred as a candidate site for mutation.
Specifically, as shown in Examples below, these processes allow Ala24, Thr25, Lys28, Gln32, Asn35 of the wild-type amino acid sequence of the protein G · B1 domain represented by [SEQ ID NO: 12]. , Asp36, Asn37, Asp47, Ala48, and Thr49 were determined as mutation target sites.

2. Selection of amino acid residue to be substituted The amino acid residue to be substituted for designing the amino acid sequence of the improved protein of the present invention can be specified using the three-dimensional structure coordinate data of the antibody binding domain of protein G.
First, the conformation of the main chain of the partial segment including the site to be mutated is identified using the three-dimensional structure coordinate data of the protein G · B1 domain. Next, a conformation similar to or similar to the conformation of the identified partial segment main chain is extracted from the structure database, and the appearance frequency for each type of amino acid residue at the position corresponding to the site to be mutated in the conformation is obtained. An amino acid residue having a high appearance frequency is considered to be an important amino acid residue for forming a similar or similar conformation, and is likely to be an amino acid residue having a high degree of contribution to protein structural stability. Therefore, when there is an amino acid residue having a higher appearance frequency than the wild-type amino acid residue at the site to be mutated, an amino acid residue having a higher appearance frequency is selected as an amino acid residue that replaces the site to be mutated. .
In addition, if the size of the side chain of the selected amino acid residue is larger than the size of the side chain of the amino acid residue before substitution, substitution is performed using the three-dimensional structure coordinate data of the protein G / B1 domain. Evaluate the degree of burying of the previous amino acid residue. When the degree of burying is small, in the three-dimensional structure in the natural state, the amino acid residue side chain is mostly exposed to the solvent, and even if it is replaced with an amino acid residue having a large side chain size, the stress applied to the entire protein molecule is Expect less. On the other hand, when the degree of burying of the amino acid residue before substitution is large, it can be determined that substitution with an amino acid residue that increases the selected side chain size is not preferable.
Specifically, as shown in Examples below, by these processes, as a substitution target site of the wild-type amino acid sequence of the protein G · B1 domain represented by [SEQ ID NO: 12] and amino acids to replace it, for example, Asn35Lys, Asp36Glu, Asn37His, Asn37Leu, Asp47Pro, Ala48Lys, Ala48Glu were selected.

3. Design of amino acid sequence of improved protein As apparent from the above, according to the method of the present invention, the site to be mutated and the amino acid residue replacing the site are not limited to one each. The amino acid sequence of the improved protein can be designed by appropriately selecting from the site to be mutated and the amino acid residue that replaces the site.
In the above, mutations selected using the three-dimensional structure coordinate data of the protein G · B1 domain are Asn35Lys, Asp36Glu, Asn37His, Asn37Leu, Asp47Pro, Ala48Lys, and Ala48Glu. By performing a point mutation or multiple mutation combining these 5 mutation sites / 7 substitutions on the wild-type amino acid sequence of the protein G / B1 domain represented by [SEQ ID NO: 12], the amino acid sequences of multiple improved proteins can be obtained. Can be designed.
The amino acid sequence of (a) described above contains such point mutations and multiple mutations. Among these, preferred ones are specifically shown, for example, 1 of the amino acid sequence shown in [SEQ ID NO: 4]. ~ 56th, or 1 to 56 of the amino acid sequence shown in [SEQ ID NO: 5], or 1 to 56th of the amino acid sequence shown in [SEQ ID NO: 6], or of the amino acid sequence shown in [SEQ ID NO: 7] 1 to 56th, or 1 to 56 of the amino acid sequence shown in [SEQ ID NO: 8], or 1 to 56 of the amino acid sequence shown in [SEQ ID NO: 9], or the amino acid sequence shown in [SEQ ID NO: 10] 1 to 56, or the amino acid sequence represented by 1 to 56 of the amino acid sequence shown in [SEQ ID NO: 11].

  On the other hand, point mutations and multiple mutations combining the selected 5 mutation sites / 7 substitutions were introduced into the amino acid sequences of the wild-type B2 and B3 domains having high homology with the wild-type B1 domain, and B2 Alternatively, the amino acid sequence of the improved protein of the B3 domain can be used. That is, the amino acid sequences of (b) and (c) described above contain a mutation similar to the mutation introduced into the wild-type B1 domain as described above, and the mutation introduced into the B1 domain. For application to the B2 and B3 domains, the original amino acid residues at the above five mutation sites, namely Asn35, Asp36, Asn37, Asp47, and Ala48, are also conserved in the wild-type amino acid sequences of the B2 and B3 domains. This is effective because there is almost no difference between the three-dimensional structures of the domains (see reference 3).

  As long as the improved protein of the present invention has binding activity to an antibody, immunoglobulin G, or Fc region of immunoglobulin G, the protein other than the mutation site in the amino acid sequence represented by the above (a), (b) or (c) In the site, mutation such as deletion, substitution, insertion, addition, etc. may occur in one or several amino acid residues. For example, when the improved protein of the present invention is synthesized in the form of a histagged or fusion protein with another protein, even if it is degraded with a proteolytic enzyme, 1 to 3 is added to the N-terminal side or C-terminal side of the improved protein. Several amino acid residues may remain, and when the improved protein of the present invention is produced using Escherichia coli or the like, a methionine derived from an initiation codon may be added to the N-terminal side. The addition of these amino acid residues does not change the antibody binding property. Moreover, the addition of these amino acid residues does not lose the stability improvement effect exerted by the designed mutation. Therefore, the improved protein of the present invention naturally includes these mutations. In order to prepare such an improved protein without addition of amino acid residues, for example, an improved protein produced using Escherichia coli or the like is further added to an N-terminal using an enzyme such as methionylaminopeptidase. Can be obtained by selectively cleaving the amino acid residue (Reference 9) and separating and purifying the reaction mixture by chromatography or the like.

  The amino acid sequence of the improved protein of the present invention may be a tandem amino acid sequence in which the above amino acid sequence and any linker sequence are alternately repeated a plurality of times as long as the protein has antibody binding activity. For example, [amino acid sequence (a)]-linker sequence A- [amino acid sequence (a)]-linker sequence B- [amino acid sequence (a)] or [amino acid sequence (a)]-linker sequence C -[Amino acid sequence (b)]-linker sequence D-[amino acid sequence (c)]. This tandem amino acid sequence is set so that wild-type protein G has a repetitive structure of a plurality of antibody binding domains via a linker sequence (FIG. 1). As is clear from the fact that antibody-binding activity is maintained even when isolated alone (Ref. 3), wild-type protein G repeats a plurality of antibody-binding domains that function alone to increase the local concentration. This setting is effective in view of enhancing the antibody binding effect.

The improved protein of the present invention may be a fusion protein comprising a fused amino acid sequence obtained by linking the amino acid sequences (a) to (c) above and the amino acid sequence of any other protein. For example, [amino acid sequence (a)]-linker sequence E-protein A, or protein B-linker sequence F- [amino acid sequence (a)]-linker sequence G-protein C-linker sequence H- [amino acid sequence (c )]. The fusion type amino acid sequence is set such that wild-type protein G has a multi-domain structure in which an antibody-binding domain and other domains are linked (FIG. 1). Antibody binding activity can be maintained even if isolated alone (Ref. 3), that is, it is possible to perform multiple functions including antibody binding activity by linking the antibody binding domain to a protein responsible for other functions. The setting is valid because
Examples of other amino acid sequences used in such fusion proteins include the amino acid sequence of glutathione S-transferase (GST) shown in [SEQ ID NO: 23]. In this case, the GST fusion protein can bear a plurality of functions of glutathione binding activity derived from the GST region and antibody binding activity derived from the protein G mutant region in a single molecule.

4). Production of improved protein (1) Production of improved protein by genetic engineering techniques a. Gene Encoding Improved Protein In the present invention, a genetic engineering method can be used to produce the designed improved protein.
The gene used in such a method encodes the amino acid sequence represented by (a), (b) or (c) above, or in the amino acid sequence represented by (a), (b) or (c) A protein having an amino acid sequence in which one or several amino acid residues have been deleted, substituted or added at a site other than the mutation site, and has an activity of binding to an antibody, immunoglobulin G, or Fc region of immunoglobulin G It consists of a nucleic acid that encodes a protein having it, and more specifically, a nucleic acid consisting of any one of the base sequences shown in SEQ ID NOs: 13 to 20.

The gene used in the present invention is a nucleic acid that hybridizes with the above nucleic acid under stringent conditions and encodes an antibody, immunoglobulin G, or a protein having binding activity to the Fc region of immunoglobulin G. Also included are nucleic acids. Here, stringent conditions refer to conditions in which a specific hybrid is formed and a non-specific hybrid is not formed. For example, it refers to conditions under which nucleic acids having high homology (homology is 60% or more, preferably 80% or more) hybridize. More specifically, the sodium concentration is 150 to 900 mM, preferably 600 to 900 mM, and the temperature is 60 to 68 ° C, preferably 65 ° C. For example, when hybridization conditions are 65 ° C. and washing conditions are 0.1 × SSC containing 0.1% SDS at 65 ° C. for 10 minutes, hybridization is performed by a conventional method such as Southern blotting or dot blot hybridization. When it is confirmed that the hybridization occurs, it can be said that the cells hybridize under stringent conditions.
Furthermore, the gene used in the present invention may be one in which a plurality of the above nucleic acids and the nucleic acid encoding any of the above linker sequences are alternately linked, or a nucleic acid encoding the amino acid sequence of any protein and the nucleic acid. May be designed to encode a fused amino acid sequence.

b. Gene, recombinant vector and transformant The gene of the present invention described above can be synthesized by chemical synthesis, PCR, cassette mutagenesis, site-directed mutagenesis, and the like. For example, a plurality of oligonucleotides of up to about 100 bases having a complementary region of about 20 base pairs at the end are chemically synthesized, and the target gene is fully synthesized by performing an overlap extension method (Reference 5) by combining them. be able to.
The recombinant vector of the present invention can be obtained by linking (inserting) a gene containing the above-described base sequence to an appropriate vector. The vector used in the present invention is not particularly limited as long as it can be replicated in the host or can integrate the target gene into the host genome. For example, bacteriophage, plasmid, cosmid, phagemid and the like can be mentioned.

As plasmid DNA, plasmids derived from actinomycetes (eg pK4, pRK401, pRF31 etc.), plasmids derived from E. coli (eg pBR322, pBR325, pUC118, pUC119, pUC18 etc.), plasmids derived from Bacillus subtilis (eg pUB110, pTP5 etc.) Yeast-derived plasmids (eg, YEp13, YEp24, YCp50, etc.) and the like, and phage DNAs include λ phage (λgt10, λgt11, λZAP, etc.). Furthermore, animal viruses such as retrovirus or vaccinia virus, and insect virus vectors such as baculovirus can also be used.
In order to insert a gene into a vector, first, a method in which purified DNA is cleaved with a suitable restriction enzyme, inserted into a restriction enzyme site or a multicloning site of a suitable vector DNA, and linked to the vector is employed. . The gene needs to be integrated into the vector so that the improved protein of the invention is expressed. Therefore, the vector of the present invention includes a promoter, a base sequence of a gene, a cis element such as an enhancer, a splicing signal, a poly A addition signal, a selection marker, a ribosome binding sequence (SD sequence), an initiation codon, a termination codon, if desired. Etc. can be connected. A tag sequence for facilitating purification of the protein to be produced can also be linked. As the tag sequence, a base sequence encoding a known tag such as a His tag, a GST tag, or an MBP tag can be used.

Whether or not a gene has been inserted into a vector can be confirmed using a known genetic engineering technique. For example, in the case of a plasmid vector or the like, it can be confirmed by subcloning the vector using a competent cell, extracting the DNA, and then specifying the base sequence using a DNA sequencer. For other vectors that can be subcloned using bacteria or other hosts, the same technique can be used. In addition, vector selection using a selection marker such as a drug resistance gene is also effective.
A transformant can be obtained by introducing the recombinant vector of the present invention into a host cell so that the improved protein of the present invention can be expressed. The host used for transformation is not particularly limited as long as it can express a protein or polypeptide. Examples include bacteria (E. coli, Bacillus subtilis, etc.), yeast, plant cells, animal cells (COS cells, CHO cells, etc.) and insect cells.

When a bacterium is used as a host, the recombinant vector is autonomously replicable in the bacterium, and at the same time, it is composed of a promoter, a ribosome binding sequence, a start codon, a nucleic acid encoding the improved protein of the present invention, and a transcription termination sequence. It is preferable. Examples of Escherichia coli include Escherichia coli DH5α, and examples of Bacillus subtilis include Bacillus subtilis. The method for introducing a recombinant vector into bacteria is not particularly limited as long as it is a method for introducing DNA into bacteria. Examples thereof include a method using calcium ions and an electroporation method.
When yeast is used as a host, for example, Saccharomyces cerevisiae, Schizosaccharomyces pombe and the like are used. The method for introducing a recombinant vector into yeast is not particularly limited as long as it is a method for introducing DNA into yeast, and examples thereof include an electroporation method, a spheroplast method, and a lithium acetate method.

When animal cells are used as hosts, monkey cells COS-7, Vero, Chinese hamster ovary cells (CHO cells), mouse L cells, rat GH3, human FL cells and the like are used. Examples of methods for introducing a recombinant vector into animal cells include an electroporation method, a calcium phosphate method, and a lipofection method.
When insect cells are used as hosts, Sf9 cells and the like are used. Examples of the method for introducing a recombinant vector into insect cells include the calcium phosphate method, lipofection method, electroporation method and the like.
Whether or not a gene has been introduced into the host can be confirmed by PCR, Southern hybridization, Northern hybridization, or the like. For example, DNA is prepared from the transformant, PCR is performed by designing a DNA-specific primer. Subsequently, the PCR amplification product is subjected to agarose gel electrophoresis, polyacrylamide gel electrophoresis, capillary electrophoresis, or the like, stained with ethidium bromide, SyberGreen solution, etc., and the amplification product is detected as a single band. You can confirm that it has been converted. Moreover, PCR can be performed using a primer previously labeled with a fluorescent dye or the like to detect an amplification product.

c. Obtaining Improved Protein by Transformant Culture When manufactured as a recombinant protein, the improved protein of the present invention can be obtained by culturing the aforementioned transformant and collecting it from the culture. “Culture” means any of culture supernatant, cultured cells, cultured cells, or disrupted cells or cells. The method for culturing the transformant of the present invention is carried out according to a usual method used for culturing a host.

  A medium for culturing transformants obtained using microorganisms such as Escherichia coli and yeast as a host contains a carbon source, nitrogen source, inorganic salts, etc. that can be assimilated by the microorganisms, and efficiently cultures the transformants. As long as the medium can be used, either a natural medium or a synthetic medium may be used. Examples of the carbon source include carbohydrates such as glucose, fructose, sucrose, and starch, organic acids such as acetic acid and propionic acid, and alcohols such as ethanol and propanol. Examples of the nitrogen source include ammonia, ammonium chloride, ammonium sulfate, ammonium acetate, ammonium salts of organic acids such as ammonium phosphate or other nitrogen-containing compounds, peptone, meat extract, corn steep liquor, and the like. Examples of the inorganic substance include monopotassium phosphate, dipotassium phosphate, magnesium phosphate, magnesium sulfate, sodium chloride, ferrous sulfate, manganese sulfate, copper sulfate, and calcium carbonate. The culture is usually performed at 20 to 37 ° C. for 12 hours to 3 days under aerobic conditions such as shaking culture or aeration and agitation culture.

When the improved protein of the present invention is produced in cells or cells after culturing, the protein or cells are disrupted by sonication, repeated freeze-thawing, homogenizer treatment, etc. Collect. When the protein is produced outside the cells or cells, the culture solution is used as it is, or the cells or cells are removed by centrifugation or the like. Thereafter, by using general biochemical methods used for protein isolation and purification, such as ammonium sulfate precipitation, gel chromatography, ion exchange chromatography, affinity chromatography, etc. alone or in appropriate combination, Thus, the improved protein of the present invention can be isolated and purified.
In addition, when using a so-called cell-free synthesis system in which only factors (enzymes, nucleic acids, ATP, amino acids, etc.) involved in protein biosynthesis reactions are mixed, the improved protein of the present invention can be obtained from a vector without using living cells. Can be synthesized in vitro (Reference 8). Thereafter, the improved protein of the present invention can be isolated and purified from the mixed solution after the reaction, using the same purification method as described above.
In order to confirm whether the isolated and purified improved protein of the present invention is a protein having an intended amino acid sequence, a sample containing the protein is analyzed. As an analysis method, SDS-PAGE, Western blotting, mass spectrometry, amino acid analysis, amino acid sequencer, etc. can be used (Reference Document 6).

(2) Production of improved protein by other methods The improved protein of the present invention can also be produced by an organic chemical method such as solid phase peptide synthesis. Protein production methods using such techniques are well known in the art and are briefly described below.
When a protein is chemically produced by a solid phase peptide synthesis method, the amino acid sequence of the improved protein of the present invention is preferably obtained by repeating the polycondensation reaction of the activated amino acid derivative using an automatic synthesizer. A protected polypeptide is synthesized on the resin. Next, the protective polypeptide is cleaved from the resin and the side chain protecting group is cleaved simultaneously. This cleaving reaction is known to have an appropriate cocktail depending on the type of resin, protecting group, and amino acid composition (Reference Document 7). Thereafter, the crude protein is transferred from the organic solvent layer to the aqueous layer, and the target mutant protein is purified. As a purification method, reverse phase chromatography or the like can be used (Reference Document 7).

5). Performance confirmation test of improved protein The improved protein produced as described above can be selected by performing the following performance confirmation test, but the improved protein of the present invention has good performance. Had.

(1) Antibody binding test The antibody binding of the improved protein of the present invention is confirmed using Western blotting, immunoprecipitation, pull-down assay, ELISA (Enzyme-Linked ImmunoSorbent Assay), surface plasmon resonance (SPR) method, etc. -Can be evaluated. In particular, since the SPR method can observe the interaction between living organisms over time in real time without labeling, the improved protein binding reaction can be quantitatively evaluated from a kinetic viewpoint.

(2) Thermal stability test of improved protein The thermal stability of the improved protein of the present invention is determined by circular dichroism (CD) spectrum, fluorescence spectrum, infrared spectroscopy, differential scanning calorimetry, after heating. The residual activity can be used for evaluation. In particular, the CD spectrum is a spectroscopic analysis method that sharply reflects changes in the secondary structure of proteins, so the change in conformation with temperature of the improved protein is observed, and the structural stability is quantified thermodynamically. Can be evaluated.

(3) Stability test of modified protein against denaturing agent The stability of the modified protein of the present invention against denaturing agent should be evaluated using circular dichroism (CD) spectrum, fluorescence spectrum, residual activity, etc. Can do. Above all, the fluorescence spectrum shows that all improved proteins retain one tryptophan residue in the molecule, and the fluorescence emitted from tryptophan changes greatly due to denaturation of the improved protein. This is an appropriate method for evaluating the stability to the agent.

(4) Stability test of improved protein against proteolytic enzyme The improved protein of the present invention is stable against proteolytic enzyme by mixing a proteolytic enzyme such as chymotrypsin with low substrate selectivity and the improved protein. The amount of decomposed product generated or the amount of unreacted residue can be evaluated by analyzing it over time using SDS-PAGE, liquid chromatography or the like. Among them, analysis by SDS-PAGE is an appropriate method for evaluating the stability of the improved protein to proteolytic enzymes because it can be carried out easily and with a small amount of protein.

[References]
Reference 1; Bjorck L, Kronvall G. (1984) Purification and some properties of streptococcal protein G, a novel IgG-binding reagent. J Immunol. 133, 69-74.
Reference 2; Boyle MDP, Ed. (1990) Bacterial Immunoglobulin Binding Proteins. Academic Press, Inc., San Diego, CA.
Reference 3; Gallagher T, Alexander P, Bryan P, Gilliland GL. (1994) Two crystal structures of the B1 immunoglobulin-binding domain of streptococcal protein G and comparison with NMR. Biochemistry 19, 4721-4729.
Reference 4; Alexander P, Fahnestock S, Lee T, Orban J, Bryan P. (1992) Thermodynamic analysis of the folding of the streptococcal protein G IgG-binding domains B1 and B2: why small proteins tend to have high denaturation temperatures. Biochemistry 14, 3597-3603.
Reference 5; Horton RM, Hunt HD, Ho SN, Pullen JM and Pease LR (1989). Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene 77, 61-68.
Reference 6; supervised by Shigeo Ohno and Yoshifumi Nishimura (1997) Protein Experiment Protocol 1-Functional Analysis, Shujunsha Reference 7; supervised by Shigeo Ohno and Yoshifumi Nishimura (1997) Protein Experiment Protocol 2-Structural Analysis, Shujunsha Reference 8; Masato Okada, Kaoru Miyazaki (2004) Protein Experiment Notes (above), Yodosha Reference 9; D'souza VM, Holz RC. (1999) The methionyl aminopeptidase from Escherichia coli can function as an iron (II ) enzyme.Biochemistry 38, 11079-11085.

  EXAMPLES The present invention will be specifically described below using examples, but the technical scope of the present invention is not limited to these examples.

Example 1
(1) A process for selecting a partial segment in which the three-dimensional structure is stabilized by the interaction between amino acid residues near the sequence using the three-dimensional structure coordinate data of the protein G / B1 domain.
First, the three-dimensional structure coordinate data of the protein G / B1 domain was downloaded from Protein Data Bank (PDB; http://www.rcsb.org/pdb/home/home.do), an international protein three-dimensional structure database. (PDB code: 1PGA). Subsequently, the contact atom number defined below was calculated using the three-dimensional structure coordinate data.

Here, n _{i, j} is the number of contact atoms between residues i and j (i ≠ j), and N is the chain length of the protein molecule (or subunit). C _{p, q} is the number of contacts between heavy atom p and heavy atom q excluding hydrogen atoms in the protein molecule, 1 if the distance between the centers of the two heavy atoms is within 0.5 nm, 0 otherwise Amount. The calculated results are shown in FIG.

Next, the local contact number density defined below was calculated.
Here, D ^loc _k represents the local contact number density of the kth amino acid residue. In FIG. 3, ½ of the value obtained by adding n _{i, j} inside the square of one side w represented by the thick frame line corresponds to D ^loc _k . Note that w is the window width and is a parameter expressing “amino acid residues near the sequence”. That is, the k- (w-1) / 2nd to k + (w-1) / 2th amino acid residues are regarded as amino acid residues located in the vicinity of the k-th amino acid residue sequence. In this process, the calculation was performed with w = 9 fixed.
Next, the local contact index defined below was calculated.

Here I ^loc _k topical contact index of k-th amino acid residue, mu _D ^loc is the average value of _D ^loc, σ D ^loc represent the standard deviation of D ^loc. Assuming that the protein is composed of partial segments with w as a unit, I ^loc of a partial segment in which amino acid residues are in close local contact is a positive value, and the local contact is in sparse contact. I ^loc of the partial segment is represented as a negative value. The calculated results are shown in FIG. In this process, a region having a larger value of I ^loc was selected as a partial segment whose steric structure was stabilized by the interaction between amino acid residues in the vicinity of the sequence.

  The calculation of this process is based on the newly developed program using intel fortran complier for linux ver9.0 (Intel), Red Hat Enterprise Linux WS release 3 (Taroon Update 8) (red hat) This was done using a Dell Precision Workstation370 (Dell) (above hardware).

(2) A process for selecting amino acid residues that have weak interactions with amino acid residues far from the sequence, using the three-dimensional coordinate data of the protein G / B1 domain.
Using the three-dimensional structure coordinate data of the protein G · B1 domain downloaded in the process (1) above, the non-local contact atom number defined below was calculated.
Where N ^nl _i is the non-local contact number of atoms of the i-th amino acid residue. N represents the chain length of the protein molecule (or subunit). C '_{p', q} is the number of contacts between the heavy atom p 'on the side chain of amino acid residue i and the heavy atom q of amino acid residue j, if the distance between the centers of the two heavy atoms is within 0.5 nm 1; otherwise 0. When the amino acid residue i is Gly, C′p _{′, q} is set to 0. w is the window width. In this process, w = 9 was fixed as in the process (1) above. Since the above formula is the sum of the number of contacts for all amino acid residues minus the sum of the number of contacts for amino acid residues near the sequence, it has many side chains that are in contact with amino acid residues far in the sequence. Amino acid residues will show large N ^nl values.

Next, the non-local contact index defined below was calculated.
Here I ^nl _i is the non-local contact index of the i th amino acid residue. a is an arbitrary constant intended to reduce the number of non-local contacts. In this process, a = 3 was fixed and calculated. From the above formula, I ^nl of an amino acid residue that is not in contact with an amino acid residue far from the sequence is 1, and I ^nl of an amino acid residue that is frequently in contact approaches 0. The calculated results are shown in FIG. In this process, the value is greater than the amino acid residue I ^nl, interaction of the amino acids residues of SEQ on distant was selected as a weak amino acid residues.
The calculation of this process is based on the newly developed program using intel fortran complier for linux ver9.0 (Intel), Red Hat Enterprise Linux WS release 3 (Taroon Update 8) (red hat) This was done using a Dell Precision Workstation370 (Dell) (above hardware).

(3) A process for determining amino acid residue candidates to be mutated from the amino acid sequences constituting the protein G / B1 domain.
By focusing on amino acid residues whose I ^loc value calculated by the above process (1) and I ^nl value calculated by (2) are both large, It is possible to select an amino acid residue that is in a partial segment in which the three-dimensional structure is stabilized and has a weak interaction with a distant amino acid residue in the sequence, and determine this amino acid residue as a site to be mutated. . In this process, the good mutation index defined below is calculated, and the higher the value, the more the segment is stabilized by the interaction between amino acid residues near the sequence. In addition, the amino acid residues are weakly interacting with amino acid residues far from the sequence.
Here, I ^M _i indicates the mutation suitability index of the i-th amino acid residue. The calculated results are shown in FIG. Here, amino acid residues of I ^M _i > 0.5, that is, Ala24, Thr25, Lys28, Gln32, Asn35, Asp36, Asn37, Asp47, Ala48, and Thr49 were used as candidates for mutation sites.
The calculation of this process is based on the newly developed program using intel fortran complier for linux ver9.0 (Intel), Red Hat Enterprise Linux WS release 3 (Taroon Update 8) (red hat) This was done using a Dell Precision Workstation370 (Dell) (above hardware).

(4) The process of identifying the conformation of the partial segment main chain including the site to be mutated using the three-dimensional structure coordinate data of the protein G / B1 domain.
The main chain dihedral angles (φ, ψ, ω) were calculated using the three-dimensional structure coordinate data of the protein G · B1 domain downloaded in the process (1). For the definition of the main chain dihedral angle, refer to “Arisaka Fumio (2004) Introductory Protein Science for Biosciences, Yuhuabo”. Next, the main chain conformation of the partial segment including the mutation site was identified by extracting the main chain dihedral angle of the partial segment of (w-1) / 2 residues including the mutation site. w is the window width. In this process, w = 9 was fixed as in (1) above. As an example of the calculated results, FIG. 7 shows the case of a partial segment (43-51) of the protein G · B1 domain.
The calculation of this process is based on the newly developed program using intel fortran complier for linux ver9.0 (Intel), Red Hat Enterprise Linux WS release 3 (Taroon Update 8) (red hat) This was done using a Dell Precision Workstation370 (Dell) (above hardware).

(5) A process for specifying an amino acid sequence having a high appearance frequency when forming the conformation of the partial segment main chain specified in the process of (4) above.
First, in the search window of the protein local structure database ProSeg (http://riodb.ibase.aist.go.jp/proseg/index.html) developed and published by the National Institute of Advanced Industrial Science and Technology ( By inputting the value of the dihedral angle of the main chain of the partial segment calculated in the process of 4), the main chain conformation is the same as or similar to the main chain conformation of the partial segment specified in the process of (4) above. We searched for local structure clusters of proteins with Next, the details of the statistical value of the appearance frequency of each amino acid residue in the amino acid sequence of the most similar local structure cluster are displayed, and by referring to the score of the displayed PSSM (position specific scoring matrix), the above (4) An amino acid sequence having a high appearance frequency was identified when forming a conformation of the main chain of the partial segment identified in the process. That is, a sequence composed of a combination of amino acids having a high score at each position of PSSM is expected to stably form the main chain conformation. The definition of PSSM in ProSeg is specified in “Sawada Y. and Honda S. (2006) Structural diversity of protein segments follows a power-law distribution. Biophysical J., 91 (4), 1213-1223.” Yes. As an example of the search result, FIG. 8 shows the case of a partial segment (43-51) of the protein G · B1 domain.
The calculation of this process is firefox ver 2.0.0.4 for linux (mozilla.org), Red Hat Enterprise Linux WS release 3 (Taroon Update 8) (red hat) (above software), Dell Precision Workstation370 (Dell) ( This was done using hardware.

(6) A process for selecting the type of amino acid residue to replace in place of the amino acid residue at the site to be mutated.
First, using the PSSM score obtained in (5) above, the preference of permutation defined below was calculated.
Where p _k is the preferred exchange of the k-th amino acid residue, s ^PSSM _k (original) is the score of the amino acid residue before substitution at the mutation site k, and s ^PSSM _k (candidate) is the mutation site k It is the score of the amino acid residue after substitution. As amino acid residues after substitution, in principle, amino acid residues having the highest PSSM score were used as candidates. However, Cys was excluded. In addition, when there were a plurality of amino acid residues having a large PSSM score, they were selected as candidates in addition to the largest one. p _k is a measure of the effect after substitution at the mutation site k, and a larger effect can be expected as p _k is larger. In this process, only exchanges with p _k > = 2.0 are left for consideration. That is, among the 10 candidate mutation sites Ala24, The25, Lys28, Gln32, Asn35, Asp36, Asn37, Asp47, Ala48, Thr49 identified in (3) above, Ala24Glu, The25Trp, Lys28Ala, Gln32Ala, Thr49Thr are p _{Since k} <2.0, it was excluded and Asn35Lys, Asp36Glu, Asn37His, Asn37Leu, Asp47Pro, Ala48Lys, and Ala48Glu were selected as candidates for substitution sites and amino acid residues to be substituted. An example of the calculated result is shown in FIG.
The calculation of this process is based on the newly developed program using intel fortran complier for linux ver9.0 (Intel), Red Hat Enterprise Linux WS release 3 (Taroon Update 8) (red hat) This was done using a Dell Precision Workstation370 (Dell) (above hardware).

(7) A process for determining the substitution tolerance of amino acid residues based on the evaluation of the degree of burying of amino acid residues using the three-dimensional structure coordinate data of the protein G / B1 domain.
When amino acid residue substitution is performed, the size of the side chain of the amino acid residue after substitution is larger than that before substitution. of accessible surface area).

On the other hand, among those selected by the process of (6) above, Asn35Lys, Asp36Glu, Asn37His, Asp47Pro, Ala48Lys, and Ala48Glu are those in which the side chain size of the amino acid residue after substitution becomes larger than before substitution. As an example of the calculated result, R _i of these replacement candidates is shown in FIG. In this process, if R _i, the size of the side chain of an amino acid residue after substitution was allowing even be larger than that before replacement.
The calculation of this process is based on the newly developed program using intel fortran complier for linux ver9.0 (Intel), Surface Racer 3.0 for Linux (Dr. Oleg Tsodikov, The University of Michigan), MOE v2006.08 ( Chemical Computing Group Inc.), Red Hat Enterprise Linux WS release 3 (Taroon Update 8) (software), Dell Precision Workstation370 (Dell), Dell DimensionXPS / Gen3 (windows XP SP2) (Dell) (above) Hardware).

Example 2
Design of an amino acid sequence constituting the improved protein and a base sequence of a gene encoding the improved protein.
In addition to the types of amino acid residues to be replaced in place of the amino acid residues at the site of mutation selected in the process of Example 1 (6) above, the tolerance of amino acid residue substitution determined in the process of Example 1 (7) above In consideration of the above, the amino acid sequence of the improved protein was designed. That is, in the process of Example 1 (6), seven substitution candidates of Asn35Lys, Asp36Glu, Asn37His, Asn37Leu, Asp47Pro, Ala48Lys, and Ala48Glu were selected. Of these, the six amino acid residues that have larger side chains than those before substitution are Asn35Lys, Asp36Glu, Asn37His, Asp47Pro, Ala48Lys, and Ala48Glu. As described above, the process (7) These six substitutions have been determined to be acceptable.

Therefore, considering this information, we decided to further examine the results of the previous processes. According to the crystal structure of the complex, Asn35 forms a hydrogen bond with Asn434, His433, and Tyr436 of the Fc domain of immunoglobulin G, and is a very important amino acid residue for protein G / B1 domain binding to the antibody. It was inferred that Therefore, Asn35 was excluded from the mutation site. Finally, it was decided to replace Asp36Glu, Asn37His, Asn37Leu, Asp47Pro, Ala48Lys, and Ala48Glu, and the amino acid sequences of a plurality of multiple mutants ([SEQ ID NO: 4] to [SEQ ID NO: 11]) by these combinations Designed. The amino acid sequence represented by [SEQ ID NO: 12] corresponds to the wild-type amino acid sequence of the protein G · B1 domain.

The base sequence of the gene encoding the improved protein was designed through the following steps based on the amino acid sequence of the improved protein designed above.
(i) The portion corresponding to the amino acid residue other than the mutation site basically adopts the wild-type base sequence of the protein G • B1 domain represented by [SEQ ID NO: 22].
(ii) The portion corresponding to the substituted amino acid residue is basically the codon usage frequency of E. coli (codon
Refer to usage) and decide.
(iii) When the GC content of the designed base sequence is remarkably high, when the mRNA structure of the designed base sequence is remarkably stable, and when a restriction enzyme recognition site is generated in the designed base sequence, Each state is relaxed and eliminated by substitution.

  Since the improved protein is manufactured by dividing into the following three systems from the practical viewpoint of protein synthesis, the base sequence of the gene was finely adjusted for each system in consideration of the base sequence of the vector. GR-PG protein is produced using a cell-free protein synthesis system as an N-terminal tagged protein. Although the N-terminal His tag is removed by proteolytic enzyme, a gap with the proteolytic enzyme recognition sequence is generated, and as a result, 2 amino acid residues are added to the N-terminal of the designed amino acid sequence. That is, in the GR-PG protein group, Gly-Arg is added to the N-terminus of the amino acid sequence represented by [SEQ ID NO: 4] to [SEQ ID NO: 8] and [SEQ ID NO: 12]. The GST-PG protein group is produced using a cell-free protein synthesis system as an N-terminal Glutathione S-Transferase (GST) fusion protein shown in FIG. That is, an amino acid sequence obtained by linking [SEQ ID NO: 23] and [SEQ ID NO: 7] and an amino acid sequence obtained by linking [SEQ ID NO: 23] and [SEQ ID NO: 12] are synthesized. The M-PG protein group is produced using E. coli as a simple protein with no tag and no fusion. Therefore, a start codon sequence is added to the designed amino acid sequence. That is, in the M-PG protein group, Met is added to the N-terminus of the amino acid sequence represented by [SEQ ID NO: 7] to [SEQ ID NO: 12].

Example 3
In this example, genes encoding improved proteins (protein G variants) were synthesized, and then recombinant proteins (GR-PG01, GR-PG03, GR-PG05) shown in Table 1 using a cell-free protein synthesis system. , GR-PG06, GR-PG07, GR-PG08, GST-PG01, GST-PG07) are shown.

a: After synthesis as a tagged protein, isolation and purification by protease treatment
b: Isolation and purification after synthesis as untagged simple protein
c: Isolation and purification after synthesis as glutathione S-transferase fusion protein

(1) Synthesis of GR-PG gene
Combining 56-59mer chemically synthesized oligo DNA fragments (Tables 2 and 3) with complementary regions at the 5'- and 3'-ends, annealing and polymerase extension reaction (55 ° C, 1 min, 72 ° C, 1 Minutes → 50 ℃, 1 minute, 72 ℃, 1 minute → 44 ℃, 15 seconds, 72 ℃, 1 minute) [SEQ ID NO: 13], [SEQ ID NO: 14], [SEQ ID NO: 15], [SEQ ID NO: 16] Each PG gene consisting of the base sequences of [SEQ ID NO: 17] and [SEQ ID NO: 22] was synthesized.

  Using this as a template, a primer containing a restriction enzyme recognition sequence was added and amplified by PCR (anneal 55 ° C., 5 seconds) to synthesize the GR-PG gene. The primers used were a sense primer (aaggaattaagcggccgc gacacttacaaattaatcc (SEQ ID NO: 34)) and an antisense primer (attggatcc ttattcagtaactgtaaaggt (SEQ ID NO: 25)). The obtained amplified product was confirmed by agarose electrophoresis (3%, 100V) and then purified using a QIAquick PCR Purification kit (Qiagen).

(2) Cloning Same restriction as plasmid pIVEX2.4a (Roche) digested with restriction enzymes Not I and BamH I (Nippon Gene, 37 ° C, overnight) and dephosphorylated (Takara Shuzo, CIAP, 50 ° C, 30 min) The GR-PG gene digested with the enzyme was ligated (Toyobo, Ligation High, 16 ° C, 1 hour), and the resulting plasmid vector was used to transform E. coli DH5α strain for storage (Toyobo, Competent high), 100 µg / Selection was made on LB plate medium containing mL ampicillin. A transformant having the correct insertion sequence was selected by colony PCR and DNA sequencing (AB, BigDye Terminator v1.1), and a GR-PG expression plasmid was extracted using Qiaprep Spin Miniprep kit (Qiagen).

(3) Tagged protein expression and purification The obtained GR-PG expression plasmid and RTS500 E. coli HY (Roche) reagent are mixed, and the cell-free protein synthesis system RTS500 ProteoMaster (Roche) is used. The recombinant protein was expressed (120 rpm, 30 ° C., 20 hours). The obtained culture solution was injected into a liquid chromatography device AKTApurifier (GE Healthcare Bioscience) equipped with an IgG Sepharose 6 Fast Flow column (GE Healthcare Bioscience), and affinity chromatography (running buffer: 50 mM Tris-HCl) (pH7.6), 150 mM NaCl, 0.05% Tween20; elution buffer: 0.5 M acetic acid) and / or injection into liquid chromatography device AKTApurifier (GE Healthcare Bioscience) with HisTrap HP column (GE Healthcare Bioscience) And tagged GR-PG by affinity chromatography (running buffer: 20 mM sodium phosphate, 500 mM NaCl, 20 mM imidazole, pH 7.4; elution buffer: 20 mM sodium phosphate, 500 mM NaCl, 400 mM imidazole, pH 7.4) The replacement protein was purified. The fractionated fraction was dialyzed against 20 mM Tris-HCl (pH 6.8).

(4) Tag site cleavage of tagged protein The obtained tagged protein was digested with Factor Xa protease (Qiagen) (37 ° C, overnight) to cleave the His tag site. Thereafter, the His tag site and the undigested sample were removed using a His Microspin purification module (GE Healthcare Bioscience). Furthermore, GR-PG protein (GR-PG01, GR-PG03, GR-PG05, GR-PG06, GR-PG07, GR-PG08) was purified using IgG Sepharose 6 Fast Flow microspin. The obtained sample solution was dialyzed against 20 mM Tris-HCl (pH 6.8) and stored at 4 ° C.

(5) GST fusion protein expression and purification
The plasmid pIVEX-GST (Roche) digested with Not I and BamH I (Nippon Gene, 37 ° C, overnight) and dephosphorylated (Takara Shuzo, CIAP, 30 ° C, 30 minutes) and the same restriction enzyme digested GR- The PG gene was ligated (Toyobo, Ligation High, 16 ° C., 1 hour) and transformed by the same method as in (2) above, and then a GST fusion protein expression plasmid was extracted. The resulting GST fusion protein expression plasmid was mixed with the RTS500 E. coli HY (Roche) reagent, and the cell-free protein synthesis system RTS500 ProteoMaster (Roche) was used to express the GST fusion protein (120 rpm, 30 ° C, 20 time). The obtained culture solution was injected into a liquid chromatography device AKTApurifier (GE Healthcare Bioscience) equipped with an IgG Sepharose 6 Fast Flow column (GE Healthcare Bioscience), and affinity chromatography (running buffer: 50 mM Tris) AKTApurifier (GE Healthcare Bioscience), a liquid chromatography system equipped with -HCl (pH 7.6), 150 mM NaCl, 0.05% Tween20; elution buffer: 0.5 M acetic acid) and / or GSTTrap HP column (GE Healthcare Bioscience) Affinity chromatography method (running buffer: 10 mM sodium phosphate, 1.8 mM potassium phosphate, 140 mM NaCl, 2.7 mM KCl, pH 7.3; elution buffer: 50 mM Tris-HCl, 10 mM reduced glutathione, pH 8.0 The fractions purified and fractionated were dialyzed against 20 mM Tris-HCl (pH 6.8).

(6) Identification of improved protein The improved protein isolated and purified in (5) above was prepared in an aqueous solution having a concentration of 15 to 25 µM. The concentration of the improved protein was determined using the molar extinction coefficient in Table 1-4. Next, 1 μl of a matrix solution (a solution in which α-cyano-4-hydroxycinnamic acid is saturated in 50% (v / v) acetonitrile-0.1% TFA aqueous solution) is dropped onto a sample plate for mass spectrometry, and each sample solution is added thereto. 1 μl was added dropwise and mixed on the sample plate and dried. Thereafter, a laser having an intensity of 2500 to 3000 was irradiated with a MALDI-TOF mass spectrometer Voyager (Applied Biosystems) to obtain a mass spectrum. As a result of comparing the molecular weight of the peak detected by the mass spectrum with the theoretical molecular weight calculated from the amino acid sequence of the improved protein produced, both samples matched within the measurement error, and the target protein (GR-PG01, It was confirmed that GR-PG03, GR-PG05, GR-PG06, GR-PG07, GR-PG08) were manufactured. Further, no significant peak other than the target protein was found in the mass spectrum.

Example 4
In this example, a gene encoding an improved protein (protein G variant) was synthesized, and then the recombinant proteins (M-PG01, M-PG07, M-PG08, M -PG09, M-PG10, M-PG11) are shown as examples.
(1) Synthesis of M-PG gene
For PG01, PG07, and PG08, a PCR method (anneal 45 ° C., 15 seconds → 55 ° C., 5 ° C. with the addition of a primer containing a restriction enzyme recognition sequence using the GR-PG expression plasmid prepared in Example 3 (2) as a template. Second) to prepare an M-PG gene. The primers used were a sense primer (ATAGCTCCATG GACACTTACAAATTAATCC (SEQ ID NO: 25)) and an antisense primer (attggatcc ttattcagtaactgtaaaggt (SEQ ID NO: 24)). The obtained amplified product was confirmed and purified in the same manner as in Example 3 (1).
For PG09, PG10, and PG11, first, a 56-59mer chemically synthesized oligo DNA fragment (Tables 2 and 3) having complementary regions at the 5′- and 3′-ends was combined to obtain Example 3 (1). Each PG gene consisting of the base sequences of [SEQ ID NO: 18], [SEQ ID NO: 19], and [SEQ ID NO: 20] was synthesized by the same method as described above. Next, using this as a template, a primer containing a restriction enzyme recognition sequence was added and amplified by PCR (annealing 45 ° C., 15 seconds → 55 ° C., 5 seconds) to synthesize the M-PG gene. The primers used were a sense primer (ATAGCTCCATG GACACTTACAAATTAATCC (SEQ ID NO: 24)) and an antisense primer (attggatcc ttattcagtaactgtaaaggt (SEQ ID NO: 25)). The obtained amplified product was confirmed and purified in the same manner as in Example 3 (1).

(2) Cloning With the same restriction enzyme as plasmid pET16b (Novagen) digested with restriction enzymes Nco I and BamH I (Nippon Gene, 37 ° C, overnight) and dephosphorylated (Takara Shuzo, CIAP, 50 ° C, 30 minutes) The digested M-PG gene was ligated (Toyobo, Ligation High, 16 ° C, 1 hour), and the resulting plasmid vector was used to transform Escherichia coli DH5α strain for storage (Toyobo, Competent high). The LB plate medium containing was selected. This transformant was selected by the same method as in Example 3 (2), and then the plasmid was extracted. Using this, Escherichia coli BL21 (DE3) strain (Novagen) for expression was further transformed.

(3) Recombinant protein expression and purification
The E. coli BL21 (DE3) transformant pre-cultured in LB medium was subcultured to LB medium at 2.5 ml / 500 ml and cultured with shaking until OD ₆₀₀ = 0.8 to 1.0. IPTG was added at a final concentration of 0.5 mM, and further cultured with shaking at 37 ° C. for 2 hours. The collected cells were suspended in 10 ml of PBS and subjected to ultrasonic crushing. The crushed liquid is sterilized by filtration, and the filtrate is injected into the liquid chromatography device AKTApurifier (GE Healthcare Bioscience) equipped with an IgG Sepharose 6 Fast Flow column (GE Healthcare Bioscience), and the affinity chromatography method (running buffer: 50 mM)
AKTApurifier (GE Healthcare Bioscience), a liquid chromatography system equipped with Tris-HCl (pH 7.6), 150 mM NaCl, 0.05% Tween20; elution buffer: 0.5 M acetic acid) and / or RESOURCE S column (GE Healthcare Bioscience) The M-PG recombinant protein was purified by ion exchange chromatography (running buffer: 20 mM citric acid, pH 3.5; elution buffer: 20 mM citric acid, 1M NaCl, pH 3.5). Fractionated fractions were neutralized with NaOH, concentrated with a centrifugal concentrator (RABCONCO, CentriVap concentrator), and dialyzed against 50 mM phosphate buffer (pH 6.8). Each solution was freeze-dried, and powdered recombinant proteins (M-PG01, M-PG07, M-PG08, M-PG09, M-PG10, M-PG11) were stored at -20 ° C.

(4) Identification of improved protein After the mass spectrum of the purified and purified improved protein was measured in the same manner as in Example 3 (6), the molecular weight of the detected peak and the produced improved protein As a result of comparing the theoretical molecular weight calculated from the amino acid sequence, both samples matched within the measurement error, and the target protein (M-PG01, M-PG07, M-PG08, M-PG09, M-PG10, It was confirmed that M-PG11) was manufactured. Further, no significant peak other than the target protein was found in the mass spectrum.
(5) Purity of improved protein (protein G variant).
After preparing the improved protein isolated and purified in (4) above in an aqueous solution with a concentration of 75 μM, perform Tricine-SDS-PAGE or Tricine-native-PAGE (16% T, 2.6% C, 100V, 100min). The band was detected by CBB (G-250) staining to confirm the purity. The concentration of the improved protein was determined using the molar extinction coefficient in Table 5. As a result, all the measured samples are detected as a single band, and the improved proteins (M-PG01, M-PG07, M-PG08, M-PG09, M-PG10, M-PG11) It was confirmed that it was manufactured and purified as

Example 5
In this example, the results of evaluating the binding of the improved protein (protein G mutant) to the antibody by the surface plasmon resonance (SPR) method are shown.
The SPR method is known to be an excellent method capable of measuring a specific interaction between biopolymers over time and quantitatively interpreting the reaction from a kinetic viewpoint.
First, the Fc region of human immunoglobulin (Jackson ImmunoResearch) was immobilized on the measurement cell of sensor chip CM5 (Biacore) by the amine coupling method. As a measurement control, a control cell in which the carboxymethyl group was blocked with ethanolamine was used. Next, the improved protein isolated and purified in Examples 3 and 4 was dissolved in HBS-P (10 mM HEPES pH 7.4, 150 mM NaCl, 0.05% v / v Surfactant P20) as a running buffer, and 600, Sample solutions having six concentrations of 500, 400, 300, 200, and 100 nM were prepared. The concentration of the improved protein was determined using the molar extinction coefficient in Tables 4 and 5. SPR was measured using Biacore T100 (Biacore) at a reaction temperature of 25 ° C. The collected data was analyzed using Biacore T100 Evaluation Software, fitted to a 1: 1 Langmuir model, and association rate constant k _on , dissociation rate constant k _off , and dissociation equilibrium constant K _D were calculated.

  As a result, all the improved proteins measured (GR-PG03, GR-PG05, GR-PG06, GR-PG07, GR-PG08, M-PG07, M-PG08, M-PG09, M-PG10, M-PG11) ) In human immunoglobulin, the binding ability to the Fc region is comparable to that of the control protein (GR-PG01, M-PG01) having the wild-type amino acid sequence, and has the same or better kinetic characteristics than the wild-type. It became clear that it was retained (Figure 11, Table 4, Table 5). For example, the most improved protein among them has a binding property 1.5 times or more that of the wild type.

nd: not determined

Example 6
This example shows the results of evaluating the thermal stability of the improved protein. It is known that the circular dichroism (CD) spectrum is a spectroscopic analysis method that sharply reflects changes in the secondary structure of proteins. By observing the molar ellipticity corresponding to the intensity of the CD spectrum while changing the temperature of the sample, it is possible to clarify at what temperature each modified protein (protein G variant) is denatured. .
Each of the improved proteins isolated and purified in Examples 3 and 4 was prepared in an aqueous solution (50 mM sodium phosphate buffer, pH 6.8) containing a concentration of 15 to 25 μM. The concentration of the improved protein was determined using the molar extinction coefficient in Tables 4 and 5. This sample solution was poured into a cylindrical cell (cell length: 0.1 cm), and the CD805 was moved from 260 nm to 195 nm at a temperature of 20 ° C. using a J805 circular dichroism spectrophotometer (JASCO). A spectrum was obtained. The same sample was heated to 98 ° C. and further cooled to 98 ° C. to 20 ° C. to obtain a circular dichroism spectrum from 260 nm to 195 nm. The molar ellipticity of the spectrum re-cooled after heating recovered 80% or more, confirming the reversibility of the three-dimensional structure of the improved protein.

Next, the measurement wavelength was fixed at 222 nm, the temperature was increased from 20 ° C. to 100 ° C. at a rate of 1 ° C./min, and the change in molar ellipticity with time was measured. The resulting theoretical equation of the two-state phase transition model for thermal melting curve (Fumio Arisaka (2004) Protein Science Primer for Bioscience, Mohanabo) and analyzed using denaturing at denaturation temperature T _m, and T _m The enthalpy change ΔH _{m of} was determined. As a result, all the improved proteins measured (GR-PG03, GR-PG05, GR-PG06, GR-PG07, GR-PG08, M-PG07, M-PG08, M-PG09, M-PG10, M-PG11) ) Was improved as compared with the control proteins (GR-PG01, M-PG01) having wild-type amino acid sequences (FIG. 12, Table 4, Table 5). For example, the best improved protein among them shows a denaturation temperature of 12 ° C. or higher compared to the wild type.

Example 7
This example shows the results of evaluating the chemical stability of an improved protein (protein G mutant) against a denaturant. All improved proteins have one tryptophan residue in the molecule, and the fluorescence emitted from tryptophan changes greatly in intensity due to denaturation of the improved protein. Therefore, by observing the fluorescence intensity from tryptophan while gradually adding guanidine hydrochloride as a denaturing agent to the aqueous solution of the improved protein, it will be clarified at what concentration each improved protein is denatured. Can do. Actual measurement is carried out by mixing two solutions of a protein solution not containing guanidine hydrochloride (solution A) and a protein solution containing a high concentration of guanidine hydrochloride (solution B) at various ratios.

  First, the improved protein isolated and purified in Example 4 was dissolved in a 50 mM phosphate buffer (pH 6.86), adjusted to a final concentration of 0.30 to 0.33 μM, and solution A was prepared. The concentration of the improved protein was determined using the molar extinction coefficient in Table 5. On the other hand, for solution B, 8.15M guanidine hydrochloride aqueous solution was mixed with 500mM phosphate buffer at a ratio of 9: 1 to make 7.34M guanidine hydrochloride / 50mM phosphate buffer, then pH was adjusted to 6.86 with a small amount of 1.0M NaOH. In addition, each improved protein was added and prepared to a final concentration of 0.30 to 0.33 μM. The fluorescence intensity was measured using an FP-6500 spectrofluorometer with automatic titrator (JASCO) with the measurement temperature fixed at 20 ° C., the excitation wavelength at 295 nm, and the fluorescence wavelength at 350 nm. In the denaturation process, 2.5 mL of solution A was placed in a constant temperature cell with a stirrer of the spectrofluorometer, and then 0.1 mL of solution B was injected and discharged 25 times at intervals of 120 seconds. Was observed over time. In addition, in the observation of the regeneration process, 2.5 mL of B solution was placed in a constant temperature cell with a stirrer of the spectrofluorometer, and then injection / discharge of 0.1 mL of A solution was repeated 25 times at an interval of 120 seconds. The fluorescence intensity was observed over time.

In any of the improved proteins, the fluorescence intensity data of the denaturation process and the regeneration process coincided, so it was confirmed that the equilibrium state was sufficiently reached under the measurement conditions used. The measured data were analyzed using the theoretical formula of the two-state phase transition model (Fumio Arisaka (2004), Introduction to Protein Science for Bioscience, Saika Hanafusa), and the free energy change ΔG _D ^H2O and the midpoint of denaturation The guanidine hydrochloride concentration c _0.5 was determined. As a result, the chemical stability of all the improved proteins measured (M-PG07, M-PG08, M-PG10, M-PG11) against the denaturing agent was confirmed to be the control protein (M-PG01 ) (Fig. 13, Table 5). For example, the best improved protein among these shows a denaturation midpoint concentration of 1.6 M or more compared to the wild type.

Example 8
In this example, in order to examine the structural stability of the improved protein, the results of evaluating the resistance to digestion of the proteolytic enzyme chymotrypsin are shown.
The improved protein isolated and purified in Example 4 was prepared in digestion reaction buffer (40 mM Tris-HCl (pH 8.0), 20 mM CaCl ₂ , 2 mM NaOAc) at a final concentration of 75 μM, and then final concentration of 7.5 uM chymotrypsin. Was added. Reactions were carried out at 25 ° C. for 0, 20, 40, 60, 120, 240 minutes, and 10 μl each was sampled. The reaction was stopped by adding 1 μl of 100 mM PMSF, and Tricine-SDS-PAGE or Tricine-native-PAGE (16% T, 2.6% C, 100 V, 100 min) was performed, and the band was detected by CBB (G-250) staining. Electrophoresis images were taken with a gel imaging device (Ato, Printgraph), and the image data was analyzed using the software Image J1.4.3.67. First, the background of the image was deleted (Rolling ball 50), the band of each lane was recognized, and the image density was plotted. The 0-minute result was taken as 100%, and the remaining degree of the band at the reaction time was quantified as the resistance to digestion. The obtained residual degree decreases exponentially with time, and the logarithm of residual degree and time are linear, indicating that it is reasonable to assume that the chymotrypsin digestion reaction is a pseudo-first order reaction. It was done. From this, the logarithm of the residual degree and the time regression analysis were performed, and the degradation half-life t _0.5 of each improved protein was determined.
As a result, improved proteins (M-PG07, M-PG08, M-PG10, M-PG11) have increased resistance to proteolytic enzymes compared to the control protein (M-PG01) that has a wild-type amino acid sequence. (Figure 14, Table 5). For example, the best improved protein among them shows a degradation half-life of 14 times or more compared to the wild type.

Example 9
In this example, in order to confirm whether the fusion protein obtained by linking the improved protein and any protein maintains its function even in the linked state, the binding property of the GST-PG protein to the affinity column is determined. The evaluation results are shown.
GST-PG01 and GST-PG07 culture solution obtained in Example 3 (5) was subjected to liquid chromatography with a GSTTrap HP column (GE Healthcare Bioscience) or IgG Sepharose 6 Fast Flow column (GE Healthcare Bioscience) set. It was injected into the AKTApurifier (GE Healthcare Bioscience) and the properties of the fusion protein were evaluated. As a result, GST-PG07 linked with the improved protein showed sufficient affinity for both columns, similar to GST-PG01 linked with the control protein (FIG. 15). This means that both glutathione-binding activity derived from GST and IgG-binding activity derived from protein G are maintained even in the linked state. From this, it became clear that the fusion protein including the improved protein is an effective means for imparting a plurality of functions including antibody binding activity.

It is a figure which shows the structure of the gene of protein G derived from Streptococcus sp. G148. It is a figure which shows the similarity on the amino acid sequence of each antibody binding domain (B1, B2, and B3 domain) of protein G. It is a figure which shows the number of contact atoms between each amino acid residue in protein G * B1 domain. It is a graph which shows the local contact index of protein G * B1 domain. It is a graph which shows the non-local contact index of protein G * B1 domain. It is a graph which shows the variation | mutation appropriateness index of protein G * B1 domain. It is a figure which shows the principal chain dihedral angle of the partial segment (43-51) of protein G * B1 domain. It is a figure which shows PSSM of the partial segment (43-51) of protein G * B1 domain. It is a graph which shows the preference of replacement | exchange of the substituted amino acid with respect to each amino acid residue of protein G * B1 domain; Pk value. It is a graph which shows exposed surface area ratio; Ri value of each amino acid residue of protein G * B1 domain. It is a graph which shows the result of having tested the binding property with respect to immunoglobulin Fc area | region of protein G improved type protein. It is a graph which shows the result of having tested the heat stability of protein G improved type protein. It is a graph which shows the result of having tested the chemical stability with respect to the denaturant of protein G improved type protein. It is a graph which shows the result of having tested the stability with respect to the proteolytic enzyme of protein G improved type protein. It is a figure which shows the result of having tested the glutathione binding property and IgG binding property of the fusion protein which connected protein G improved type protein. It is a figure which shows the base sequence of the gene of protein G derived from Streptococcus sp. G148. (Underlined are structural genes, double underlined are antibody binding domains) It is a figure which shows the N terminal sequence of GST fusion protein. The underlined portion corresponds to the amino acid sequence of glutathione S-transferase.

Claims (9)

It consists of an amino acid sequence represented by the following (a), (b) or (c), or in the amino acid sequence represented by (a), (b) or (c), amino acids X35 to X37, X47 and X48 A protein comprising an amino acid sequence in which one or several amino acid residues are deleted, substituted, inserted or added in a portion other than the residue, and having an activity of binding to an antibody or immunoglobulin G or Fc region of immunoglobulin G .
(a) AspThrTyrLysLeuIleLeuAsnGlyLysThrLeuLysGlyGluThrThrThrGluAlaValAspAlaAlaThrAlaGluLysValPheLysGlnTyrAlaX35X36X37GlyValAspGlyGluTrThrTyrPrThrThrTyrAr
(In the above amino acid sequences, X35 represents Asn or Lys, X36 represents Asp or Glu, X37 represents Asn, His, or Leu, X47 represents Asp or Pro, and X48 represents Ala, Lys, or Glu, respectively. (Except when X35 is Asn, X36 is Asp, X37 is Asn, X47 is Asp, and X48 is Ala.)
(B) ThrThrTyrLysLeuValIleAsnGlyLysThrLeuLysGlyGluThrThrThrGluAlaValAspAlaAlaThrAlaGluLysValPheLysGlnTyrAlaX35X36X37GlyValAspGlyGluTrpThrTyrPrThrThrTyrArXV
(In the above amino acid sequences, X35 represents Asn or Lys, X36 represents Asp or Glu, X37 represents Asn, His, or Leu, X47 represents Asp or Pro, and X48 represents Ala, Lys, or Glu, respectively. (Except when X35 is Asn, X36 is Asp, X37 is Asn, X47 is Asp, and X48 is Ala.)
(c) ThrThrTyrLysLeuValIleAsnGlyLysThrLeuLysGlyGluThrThrThrLysAlaValAspAlaGluThrAlaGluLysAlaPheLysGlnTyrAlaX35X36X37GlyValAspGlyValTrpThrTyrPrThrThrTyrAr
(In the above amino acid sequences, X35 represents Asn or Lys, X36 represents Asp or Glu, X37 represents Asn, His, or Leu, X47 represents Asp or Pro, and X48 represents Ala, Lys, or Glu, respectively. (Except when X35 is Asn, X36 is Asp, X37 is Asn, X47 is Asp, and X48 is Ala.)   2. The protein according to claim 1, comprising the amino acid sequence represented by any of SEQ ID NOs: 4 to 11, or comprising a sequence in which one or several amino acid residues are added to the N-terminal side in the amino acid sequence.   The amino acid sequence of the protein according to claim 1 or 2 and an amino acid sequence in which the amino acid sequence of the linker peptide or linker protein is alternately repeated a plurality of times and has binding activity to the antibody or immunoglobulin G or the Fc region of immunoglobulin G protein.   A fusion protein comprising an amino acid sequence obtained by linking the amino acid sequence of the protein according to any one of claims 1 to 3 and the amino acid sequence of another protein, and binding activity to an antibody, immunoglobulin G, or Fc region of immunoglobulin G A protein having   The nucleic acid which codes the protein in any one of Claims 1-4.   A nucleic acid comprising the base sequence represented by any of SEQ ID NOs: 13 to 20.   A nucleic acid that hybridizes with the nucleic acid according to claim 5 or 6 under stringent conditions and encodes an antibody, an immunoglobulin G, or a protein having a binding activity to the Fc region of immunoglobulin G.   A recombinant vector containing the nucleic acid according to claim 5.   A transformant into which the recombinant vector according to claim 8 has been introduced.