JP2008301813A - New aggrecanase molecule - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide an aggrecanase protein, a nucleotide sequence encoding the protein, a method for producing the same, an aggrecanase enzyme inhibitor for the treatment of symptoms characterized by the degradation of aggrecan, and a method for developing an antibody to the enzyme. <P>SOLUTION: The invention provides a separated DNA molecule containing a DNA sequence having a specific sequence, an aggrecanase protein encoded by the DNA molecule, a method for producing a human aggrecanase protein by culturing and purifying a host cell transformed by the DNA molecule, an inhibitor for the aggrecanase activity, and an antibody to the enzyme. <P>COPYRIGHT: (C)2009,JPO&INPIT

Description

  The present invention relates to the discovery of nucleotide sequences encoding novel aggrecanase molecules, aggrecanase proteins and methods for their production. The invention further relates to inhibitors of aggrecanase enzyme as well as antibodies. These inhibitors and antibodies may be useful for the treatment of various aggrecanase related conditions including osteoarthritis.

  Aggrecan is the main extracellular component of articular cartilage. It is the cause that gives cartilage mechanical properties such as compressibility and plasticity. Aggrecan loss is associated with articular cartilage degradation in joint diseases. Osteoarthritis is a debilitating disease affecting at least 30 million Americans (Non-Patent Document 1). Osteoarthritis significantly degrades quality of life due to degradation of articular cartilage and the resulting chronic pain. An important early feature of the osteoarthritic process is the loss of aggrecan from the extracellular matrix (2). Therefore, the large sugar-containing portion of aggrecan is lost from the extracellular matrix and the biochemical characteristics of cartilage are lost.

Proteolytic activity called “aggrecanase” is responsible for the cleavage of aggrecan and is therefore thought to play a role in cartilage degradation associated with osteoarthritis and inflammatory joint diseases. Studies have been conducted to identify the causative enzymes of aggrecan degradation in human osteoarthritic cartilage. Two enzyme cleavage sites were identified in the interglobular domain of aggrecan. One (Asn ³⁴¹ -Phe ³⁴² ) was observed to be cleaved by several known metalloproteases (Non-patent Document 3 and Non-patent Document 4). The aggrecan fragment found in human synovial fluid and produced by IL-1 induced cleavage of cartilage aggrecan is due to cleavage of the Glu ³⁷³ -Ala ³⁷⁴ bond (Non-patent document 5, Non-patent document 6, Patent Document 7), which indicates that the known enzyme is not involved in aggrecan cleavage in vivo.

Recently, two enzymes belonging to the "Disintegrin-like and Metalloprotease with Thrombospondin type 1 motif" (ADAM-TS) family have been identified, aggrecanase-1 (ADAMTS-4) and aggrecanase-2 (ADAMTS-11), which are IL Is synthesized by cartilage stimulated by -1, and cleaves aggrecan at an appropriate site (Non-patent Documents 8 and 9). These enzymes may be synthesized by osteoarthritic human articular cartilage. It is also possible that there are other related enzymes of the ADAM-TS family that can cleave aggrecan at the Glu ³⁷³ -Ala ³⁷⁴ bond and may contribute to aggrecan cleavage in osteoarthritis.
MacLean et al. J. Rheumatol 25: 2213-8 (1998) Brandt, KD. And Mankin HJ. Pathogenesis of Osteoarthritis, in Textbook of Rheumatology, WB Saunders Company, Philadelphia, PA pgs. 1355-1373. (1993) Flannery, CR et al. J. Biol. Chem 267: 1008-14. (1992) Fosang, AJ et al. Biochemical J. 304: 347-351. (1994) Sandy, JD, et al. J Clin Invest 69: 1512-1516. (1996) Lohmander LS, et al. Arthritis Rheum 36: 1214-1222. (1993) Sandy JD et al. J Biol Chem. 266: 8683-8685 (1991) Tortorella MD, et al Science 284: 1664-6. (1999) Abbazade, I, et al. J Biol Chem 274: 23443-23450. (1990)

  It is an object of the present invention to provide identification of an aggrecanase protein capable of cleaving aggrecan, a nucleotide sequence encoding the aggrecanase enzyme, a method for producing aggrecanase, and the like.

  The inventors of the present invention have made extensive studies to solve the above-mentioned problems, identified a novel aggrecanase protein capable of cleaving aggrecan and a nucleotide sequence encoding the same, further developed a method for producing the enzyme, etc. It came to complete.

  Also provided by the present invention are methods for developing inhibitors of aggrecanase that block the proteolytic activity of aggrecanase, and these inhibitors and antibodies can be used in various assays and treatments for the treatment of conditions characterized by degradation of articular cartilage. Can be used.

  The present invention is directed to identification of an aggrecanase protein capable of cleaving aggrecan, a nucleotide sequence encoding the aggrecanase enzyme, and a method for producing aggrecanase. These enzymes are thought to be characterized as having proteolytic aggrecanase activity. Furthermore, the present invention includes compositions comprising these enzymes as well as antibodies against these enzymes. Furthermore, the present invention encompasses methods for developing inhibitors of aggrecanase that block the proteolytic activity of aggrecanase. These inhibitors and antibodies may be used in various assays and therapies for the treatment of conditions characterized by articular cartilage degradation.

  The nucleotide sequence of the aggrecanase molecule of the present invention is shown in SEQ ID NO: 3. In another embodiment, the nucleotide sequence of an aggrecanase molecule of the invention is shown in nucleotide numbers # 1 to # 3766 of SEQ ID NO: 1. In another embodiment, the nucleotide sequence of the invention is nucleotides # 1086 (TCG) to # 3396 (CGC) of SEQ ID NO: 1. The present invention further includes a degenerate codon sequence equivalent to the sequence shown in SEQ ID NO: 1 and fragments thereof exhibiting aggrecanase activity.

  The amino acid sequence of the isolated aggrecanase molecule of the present invention comprises the sequence shown in SEQ ID NO: 4. The amino acid sequence of the isolated aggrecanase molecule includes the sequence shown in SEQ ID NO: 2. The invention further encompasses fragments of the amino acid sequence that encode molecules that exhibit aggrecanase activity.

  Cells transformed with the DNA sequence of SEQ ID NO: 1 comprising SEQ ID NO: 3 or nucleotides # 1 to # 3766 of SEQ ID NO: 1 or nucleotides # 1086 to # 3396 of SEQ ID NO: 1 are then cultured, respectively Human aggrecanase protein substantially free from other proteinaceous substances produced at the same time by recovering the protein characterized by the amino acid sequence shown in SEQ ID NO: 4 or SEQ ID NO: 2 from the medium and purifying it Fragments may be obtained. For production in mammalian cells, the DNA sequence includes a DNA sequence encoding an appropriate propeptide that is 5 'to the nucleotide sequence encoding the aggrecanase enzyme and joined in frame.

  The present invention includes a method for obtaining additional aggrecanase molecules, the DNA sequence obtained by this method and the protein encoded thereby. The method of isolating the full length sequence uses the aggrecanase sequence shown in SEQ ID NO: 3 or nucleotides # 1086 to # 3396 of SEQ ID NO: 1, and the screening probe using standard methods known to those skilled in the art. Including designing.

  Other species are believed to have DNA sequences that are homologous to the human aggrecanase enzyme. Thus, the present invention encompasses methods for obtaining DNA sequences encoding other aggrecanase molecules, DNA sequences obtained by those methods, and proteins encoded by those DNA sequences. This method involves screening a library using the nucleotide sequences of the invention or portions thereof and searching for corresponding genes or coding sequences or fragments thereof from other species using standard methods. Thus, the present invention encompasses DNA sequences from other species, which are homologous to human aggrecanase and can be obtained using human sequences. The invention can also include functional fragments of aggrecanase proteins, and DNA sequences encoding such functional fragments, as well as functional fragments of other related proteins. The ability of such fragments to function can be examined by assaying the protein in the biological assay described for the assay for aggrecanase protein.

  Culturing cells transformed with the DNA sequence of SEQ ID NO: 1 comprising nucleotide # 1 to # 3766 of SEQ ID NO: 3 or SEQ ID NO: 1 or comprising nucleotides # 1086 to # 3396 of SEQ ID NO: 1 Then, the aggrecanase protein of the present invention may be produced by recovering and purifying the aggrecanase protein from the medium. In one embodiment, the protein comprises the amino acid sequence of SEQ ID NO: 4 or amino acids # 1 to # 770 of SEQ ID NO: 2. The purified expressed protein is substantially free of other proteinaceous materials that are co-produced as well as other contaminants. The recovered purified protein is considered to exhibit proteolytic aggrecanase activity that cleaves aggrecan. Thus, the proteins of the present invention are further characterized by their ability to exhibit aggrecan proteolytic activity in assays that determine the presence of aggrecan degrading molecules. These assays or their development are within the knowledge of one of ordinary skill in the art. Such an assay involves contacting an aggrecan substrate with an aggrecanase molecule and then monitoring the production of aggrecan fragments (eg, Hughes et al., Biochem J 305: 799-804 (1995); Mercuri et al, J Bio Chem. 274: 32387-32395 (1999)).

  In another embodiment, the present invention encompasses methods for developing inhibitors of aggrecanase and the resulting inhibitors. These inhibitors prevent aggrecan cleavage. The method includes determining a binding site based on the three-dimensional structure of aggrecanase and aggrecan and then developing a molecule that reacts with the binding site. Candidate molecules are assayed for inhibitory activity. Further standard methods for developing inhibitors of aggrecanase molecules are known to those skilled in the art. An inhibitor assay involves contacting an aggrecan and inhibitor mixture with an aggrecanase molecule, and then detecting and measuring the aggrecan fragment produced by cleavage at, for example, a potential cleavage site for aggrecanase. Including measuring inhibition.

  Therefore, another aspect of the present invention provides a pharmaceutical composition comprising a therapeutically effective amount of an aggrecanase inhibitor in a pharmaceutically acceptable carrier.

  Aggrecan degradation mediated by aggrecanase in cartilage is associated with osteoarthritis and other inflammatory diseases. Therefore, these compositions of the present invention may be used to treat diseases characterized by degradation of aggrecan and / or upregulation of aggrecanase. The composition may be used to treat or prevent these symptoms.

  The present invention encompasses a method of treating or preventing a patient suffering from a condition characterized by degradation of aggrecan. These methods of the invention comprise administering to a patient in need of such treatment an effective amount of a composition comprising an aggrecanase inhibitor that inhibits the proteolytic activity of the aggrecanase enzyme.

  A further aspect of the invention is a DNA sequence that encodes expression of an aggrecanase protein. Such a sequence is shown in SEQ ID NO: 1 or SEQ ID NO: 3 comprising nucleotides # 1 to # 3766 of SEQ ID NO: 1 or comprising nucleotides # 1086 to # 3396 in the 5 ′ to 3 ′ direction. Except for the nucleotide sequence and the degeneracy of the genetic code, the DNA sequence is identical to the DNA sequence of SEQ ID NO: 1 and SEQ ID NO: 3 and includes a DNA sequence encoding an aggrecanase protein. Furthermore, the present invention encompasses DNA sequences that encode proteins having the ability to hybridize with the DNA sequences of SEQ ID NO: 1 and SEQ ID NO: 3 under stringent conditions and cleave aggrecan. Preferred DNA sequences include those that hybridize under stringent conditions (see T. maniatis et al, Molecular Cloning (A Laboratory Manual), Cold Spring Harbor Laboratory (1982)). Such a DNA sequence comprises at least about 80% of the sequence shown in SEQ ID NO: 1 comprising SEQ ID NO: 3 or nucleotides # 1 to # 3766 of SEQ ID NO: 1 or comprising nucleotides # 1086 to # 3396 It is generally preferred to encode a polypeptide having at least about 90% homology, more preferably at least about 90% homology. Eventually, an allelic variant or other variant of SEQ ID NO: 1 or SEQ ID NO: 3 will still have aggrecanase activity regardless of whether such nucleotide changes result in changes in the peptide sequence. Are included in the present invention. The present invention also encompasses a fragment of the DNA sequence set forth in SEQ ID NO: 1 that encodes a polypeptide that retains aggrecanase activity.

  The DNA sequence of the present invention is useful, for example, as a probe for detecting mRNA encoding aggrecanase in a cell population. Thus, the present invention encompasses methods for detecting or diagnosing diseases involving genetic diseases associated with aggrecanase, or diseases of cells, organs or tissues in which aggrecanase is mis-transcribed or expressed. The DNA sequence may also be useful for the production of vectors that are applied to gene therapy described below.

  A further aspect of the present invention includes a vector comprising the above DNA sequence operably linked to an expression control sequence. These vectors may be used in the novel method for producing an aggrecanase protein of the present invention, in which a cell line transformed with a DNA sequence encoding an aggrecanase protein operably linked to an expression control sequence is suitably used. Culture in a suitable medium and collect and purify aggrecanase protein. Many known cells, both prokaryotic and eukaryotic cells, can be used in this method as host cells for expression. The vector may be applied to gene therapy. In such use, the vector may be transfected ex vivo into the patient's cells and then the cells may be reintroduced into the patient. Alternatively, the vector may be introduced into the patient by targeted transfection in vivo.

  A further aspect of the invention is an aggrecanase protein or polypeptide. Such polypeptides have the sequence shown in SEQ ID NO: 2 or 4, the amino acid sequence variants of SEQ ID NO: 2 or 4, including naturally occurring allelic variants, and the ability of the protein to cleave aggrecan characteristic of an aggrecanase molecule. Characterized by having an amino acid sequence encompassing other variants it retains. Preferred polypeptides include polypeptides having at least about 80% homology, more preferably at least about 90% homology to the amino acid sequence shown in SEQ ID NO: 2 or 4. Eventually, an allelic variant or other variant of the sequence of SEQ ID NO: 2 or 4 is defined as a peptide sequence, regardless of whether such amino acid changes were induced by mutations, chemical changes, or DNA sequence changes. If it also has aggrecanase activity, it is included in the present invention. The present invention also encompasses fragments of the amino acid sequence of SEQ ID NO: 2 or 4 that retain the activity of the aggrecanase protein.

  Using the purified protein of the present invention, monoclonal antibodies or polyclonal antibodies against aggrecanase and / or other aggrecanase-related proteins may be obtained using methods known in the field of antibody production. Thus, the present invention also includes antibodies against aggrecanase or other related proteins. The antibodies can be useful for the detection and / or purification of aggrecanase or related proteins, or to inhibit or prevent the effects of aggrecanase. An antibody that specifically binds to aggrecanase may be obtained using the aggrecanase of the present invention or a portion thereof.

Detailed Description of the Invention The human aggrecanase of the present invention comprises the nucleotide sequence shown in SEQ ID NO: 3. In another embodiment, the human aggrecanase of the invention comprises nucleotides # 1 to # 3766 or nucleotides # 1086 to # 3396 of SEQ ID NO: 1. The human aggrecanase protein sequence includes the amino acid sequence shown in SEQ ID NO: 4. In another embodiment, the human aggrecanase protein sequence comprises amino acids # 1 to # 770 of SEQ ID NO: 2. Using standard methods, a probe for screening full-length sequences using the sequence of SEQ ID NO: 3 comprising SEQ ID NO: 3 or nucleotides # 1086 to # 3396 is used to further aggrecanase of the present invention May be obtained.

  The aggrecanase of the present invention includes a polypeptide having the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 4 and having the ability to cleave aggrecan.

  The aggrecanase protein recovered from the medium is purified by isolation from other proteinaceous substances produced simultaneously and other contaminating contaminants present. Isolated and purified proteins may be characterized by their ability to cleave aggrecan substrates. The aggrecanase protein provided herein comprises SEQ ID NO: 3 or a sequence similar to the sequence of SEQ ID NO: 1 comprising nucleotides # 1 to # 3766 of SEQ ID NO: 1 or comprising nucleotides # 1086 to # 3396 Also included are factors that are encoded, naturally modified (eg, allelic variants of a nucleotide sequence that can cause amino acid changes in a polypeptide), or artificially processed. For example, the synthetic polypeptide may be a complete replication or a partial replication of the contiguous sequence of amino acid residues of SEQ ID NO: 2 or SEQ ID NO: 4. These sequences may have their common biological properties by sharing primary, secondary, tertiary, or quaternary structure as well as conformational characteristics with the aggrecanase molecule. Good. For example, it is known that many conservative amino acid substitutions can be made without significantly modifying the structure and conformation of the protein, thus maintaining biological properties. For example, conservative amino acid substitutions may be between amino acids having basic side chains such as lysine (Lys or K), arginine (Arg or R) and histidine (His or H); aspartic acid (Asp or D) And amino acids having acidic side chains such as glutamic acid (Glu or E); asparagine (Asn or N), glutamine (Gln or Q), serine (Ser or S), threonine (Thr or T) and It may be between amino acids having an uncharged polar side chain such as tyrosine (Tyr or Y); alanine (Ala or A), glycine (Gly or G), valine (Val or V), leucine (Leu or L). ), Isoleucine (Ile or I), proline (Pro or P), Niruaranin (Phe or F), methionine (Met or M), or even between amino acids with nonpolar side chains such as tryptophan (Trp or W) and cysteine (Cys or C). Thus, these modifications and deletions of native aggrecanase may be used as biologically active substitutes for naturally occurring aggrecanases and used to develop inhibitors of polypeptides in therapeutic processes. Also good. By subjecting both aggrecanase and aggrecanase variants and inhibitors thereof to the assays described in the Examples, it can be readily determined whether the aggrecanase variant maintains the biological activity of aggrecanase.

  Other special variations of the aggrecanase protein sequences described herein include modification of the glycosylation site. These modifications include O-linked or N-linked glycosylation sites. For example, the absence of glycosylation or negligible glycosylation results from amino acid substitutions or deletions at the asparagine-linked glycosylation site. The asparagine-linked glycosylation recognition site comprises a tripeptide sequence that is specifically recognized by an appropriate cellular glycosylation enzyme. These tripeptide sequences are either asparagine-X-threonine or asparagine-X-serine, where X is usually any amino acid. Various amino acid substitutions or deletions (and / or amino acid deletions at the second position) at one or both of the first or third amino acid positions of the glycosylation recognition site are glycosylated in the modified tripeptide sequence. Does not cause. Furthermore, bacterial expression of aggrecanase-related proteins will result in proteins that are not glycosylated even though the glycosylation site remains unmodified.

  The present invention also includes a novel DNA sequence that is not bound to a DNA sequence encoding another proteinaceous substance and encodes expression of an aggrecanase protein. These DNA sequences include those shown in SEQ ID NO: 1 or 3 in the 5 ′ to 3 ′ direction as well as stringent hybridization washing conditions (T. Maniatis et al, Molecular Cloning (A Laboratory Manual), Cold Spring Harbor Laboratory (1982), pages 387 to 389), which includes a sequence that encodes a protein that hybridizes to it and has the proteolytic activity of aggrecanase. These DNA sequences include sequences that include the DNA sequence of SEQ ID NO: 1 as well as sequences that encode proteins that hybridize to it under stringent hybridization conditions and maintain other activities disclosed for aggrecanases. To do.

  Similarly, an aggrecanase protein or SEQ ID NO encoded by SEQ ID NO: 1 or SEQ ID NO: 3 comprising nucleotides # 1 to # 3766 of SEQ ID NO: 1 or comprising nucleotides # 1086 to # 3396 : Encodes an aggrecanase protein comprising 2 or 4 amino acid sequences, but degenerates or allelic variation of the genetic code (in a population of species that may or may not cause an amino acid change) DNA sequences that differ in codon sequence due to spontaneous base changes) also encode the novel factors described herein. SEQ ID NO: 3 or SEQ ID NO generated by point mutations or induced modifications (including insertions, deletions and substitutions) to increase the activity of the encoded polypeptide, increase half-life or increase productivity A variant of the DNA sequence of SEQ ID NO: 1 comprising nucleotides # 1 to # 3766 of 1 or nucleotides # 1086 to # 3396 is also encompassed by the present invention.

  Another aspect of the present invention provides a novel method for producing aggrecanase protein. The method of the present invention comprises culturing a cell line transformed with a DNA sequence encoding an aggrecanase protein of the present invention under the control of known regulatory sequences. Purified protein is substantially free of other proteins that are co-produced as well as other contaminants.

  Suitable cell lines may be mammalian cells such as Chinese hamster ovary cells (CHO). The selection of appropriate mammalian cell lines and methods for transformation, culture, amplification, screening, product production and purification are known in the art. See, for example, Gething and Sambrook, Nature, 293: 620-625 (1981) or Kaufman et al, Mol. Cell. Biol., 5 (7): 1750-1759 (1985) or Howley et al, U.S. Patent 4,419,446. Another suitable mammalian cell line described in the Examples is the monkey COS-1 cell line. Mammalian CV-1 may also be appropriate.

  Bacterial cells are also suitable as hosts. For example, various strains of E. coli (eg, HB101, MC1061) are well known as host cells in the field of biotechnology. Various strains such as B. subtilis, Pseudomonas, and other Bacillus subtilis may be used in this method. For the expression of proteins in bacterial cells, DNA encoding an aggrecanase propeptide is generally not necessary.

  Many yeast cell lines known to those skilled in the art are also available as host cells for expression of the polypeptides of the present invention. Further, if desired, insect cells may be used as host cells in the methods of the invention. See, for example, Miller et al, Genetic Engineering, 8: 277-298 (Plenum Press 1986) and references cited therein.

  Another aspect of the present invention provides vectors used in the methods for expression of these novel aggrecanase polypeptides. Preferably, the vector contains the entire DNA sequence encoding the novel factor of the present invention. In addition, the vector contains appropriate expression control sequences that allow expression of the aggrecanase protein sequence. Alternatively, a vector containing the above modified sequence is a specific example of the present invention. In addition, SEQ ID NO: 3 or SEQ ID NO: 1 or other sequences encoding aggrecanase protein can be manipulated to express hybrid aggrecanase molecules. Thus, the present invention includes SEQ ID NO: 3 or nucleotides # 1 to # 3766 of SEQ ID NO: 1 linked to a DNA sequence encoding another aggrecanase polypeptide in the correct reading frame, or nucleotide # 1086. To a chimeric DNA molecule that encodes an aggrecanase protein comprising a fragment derived from SEQ ID NO: 1 comprising from # 3396 to # 3396.

  The vector may be used in cell line transformation methods, and the vector may further be selected regulatory sequences operably linked to the DNA coding sequences of the present invention capable of directing replication and expression in the selected host cell. including. Regulatory sequences for such vectors are known to those skilled in the art and can be selected depending on the host cell. Such selection is routine and does not form part of the present invention.

  Various symptoms such as osteoarthritis are known to be characterized by degradation of aggrecan. Therefore, the aggrecanase protein of the present invention that cleaves aggrecan may be useful in the development of inhibitors of aggrecanase. The present invention therefore provides a composition comprising an aggrecanase inhibitor. Inhibitors may be developed using aggrecanase (contacted with aggrecan) in screening assays using a mixture of aggrecan substrate and inhibitor. The composition can be used to treat osteoarthritis and other conditions indicative of aggrecan degradation.

  The invention further encompasses antibodies that can be used to detect aggrecanase and may be used to inhibit the proteolytic activity of aggrecanase.

  The therapeutic methods of the invention include administering the aggrecanase inhibitor composition locally, systemically, or locally as an implant or device. The administration rules may be determined by the physician taking into account the various factors that modify the action of the aggrecanase protein, the site of the disease, the severity of the disease, the patient's age, sex, diet, degree of inflammation, duration of administration and other clinical factors. Let's be determined. In general, systemic or injection administration is begun with a minimally effective dose and then the dose is increased over a predetermined period until a positive effect is observed. Thereafter, the dose is gradually increased to a level where the effect actually increases gradually, taking into account the adverse effects that may occur. The addition of other known factors to the final composition can also affect the dose.

  Progress can be monitored by periodically assessing the progression of the disease. For example, progress can be monitored by x-ray, MRI or other imaging devices, synovial fluid analysis, and / or clinical trials.

  The following examples illustrate the practice of the invention in isolating and characterizing human aggrecanase and other aggrecanase-related proteins, obtaining human proteins, and expressing proteins by recombinant methods.

DNA Isolation A database screening approach was used to identify potential novel aggrecanase family members. Aggrecanase-1 (Science 284: 1664-1666 (1999)) has at least six domains: signal, propeptide, catalytic domain, disintegrin, tsp and c-terminus. The catalytic domain contains a zinc binding signature region involved in protease activity, TAAHELGHVKF and a “MET turn”. Substitution at many positions in the zinc binding region results in protease activity, but histidine (H) and glutamic acid (E) residues must be present. The thrombospondin domain of aggrecanase-1 is also an important domain for substrate recognition and cleavage. It is these two domains that determine our classification of members of the novel aggrecanase family. GenBank ESTs were searched using the protein sequence of the aggrecanase-1 DNA sequence, focusing on human ESTs using TBLASTN. The resulting sequence was the starting point for identifying the full-length sequence of potential family members. The nucleotide sequence of the aggrecanase of the present invention comprises one EST (AA588434) showing homology to the catalytic domain of aggrecanase-1 (ADAMTS4) and the zinc binding motif.

This human aggrecanase sequence was isolated from a dT-primed cDNA library constructed in the plasmid vector pED6-dpc2. CDNA was made from human testis RNA purchased from Clonetch. A probe for isolating the aggrecanase of the present invention was obtained from the sequence obtained by database search. The probe sequence was as follows:
5'-GGTCAAATCGCGTCAGTGTAAATACGGG-3 '
DNA probes were radiolabeled with ³² P and a human testis dT-primed cDNA library was screened under high stringency hybridization / wash conditions to identify clones containing the sequence of human candidate # 8.

50000 library transformants were plated on 10 plates so that there were approximately 5000 transformants per plate. Transform in standard hybridization buffer (1X Blotto [25X Blotto = 5% nonfat dry milk in dH2O, 0.02% azide] + 1% NP-40 + 6X SSC + 0.05% pyrophosphate) under conditions of high stringency. Nitrocellulose replicas of the transformant colonies were hybridized to ³² P-labeled DNA probes (shaking at 65 ° C. for 2 hours). Two hours after hybridization, the hybridization solution containing the radiolabeled DNA probe was removed and subjected to high stringency conditions (3X SSC, 0.05% pyrophosphate, 5 minutes at room temperature; then 2.2X SSC, 0. The filter was washed with 05% pyrophosphate, 15 minutes at room temperature; then 2.2X SSC, 0.05% pyrophosphate, 1-2 minutes at 65 ° C. The filter was wrapped in Saran wrap and exposed to X-ray film overnight. Autoradiographs were obtained to confirm positive hybridization transformants with various signal intensities. These positive clones were picked and grown for 12 hours in selective medium (L-broth supplemented with 100 μg / ml ampicillin) and plated at low density (approximately 100 colonies per plate). Colonies in standard hybridization buffer (1X Blotto [25X Blotto = 5% non-fat dry milk in dH2O, 0.02% azide] + 1% NP-40 + 6X SSC + 0.05% pyrophosphate) under conditions of high stringency Of nitrocellulose replicas were hybridized with ³² P-labeled probes (shaking at 65 ° C. for 2 hours). Two hours after hybridization, the hybridization solution containing the radiolabeled DNA probe was removed and subjected to high stringency conditions (3X SSC, 0.05% pyrophosphate, 5 minutes at room temperature; then 2.2X SSC, 0. The filter was washed with 05% pyrophosphate, 15 minutes at room temperature; then 2.2X SSC, 0.05% pyrophosphate, 1-2 minutes at 65 ° C. The filter was wrapped in Saran wrap and exposed to X-ray film overnight. Autoradiographs were obtained to confirm positive hybridization transformants. Bacterial stocks of purified hybridization positive clones were made and plasmid DNA was isolated. The sequence of the DNA insert was determined and is shown in SEQ ID NO: 1 from nucleotide # 1086 (TCG) to # 3396 (CGC). This sequence has been deposited as PTA-2284 in the American Type Culture Collection 10801 University Blvd. Manassas, VA 20110-2209 USA. The cDNA insert contained the sequence of the DNA probe used for hybridization. The 5 ′ (prime) and 3 ′ (prime) sequences of this isolated sequence were then extracted using the RACE protocol. The fully determined sequence is shown from nucleotide # 1 to # 3766 of SEQ ID NO: 1.

  The resulting human candidate # 8 sequence is juxtaposed compared to several ESTs in a public database. Candidate # 8 shows homology to ADAMTS 7 and 6. The aggrecanases of the present invention contain a zinc-binding signature region, a “MET turn”, and a tsp1-type motif, but lack the signal and propeptide regions and the c-terminal spacer region. It was based on these criteria that candidate # 8 was considered a member of the novel aggrecanase family.

  Probes for further screening of full-length clones containing isolated sequences can be designed using the aggrecanase sequences of the present invention.

The 5P (signal and propeptide) and 3P (C-terminal spacer region) ends of the full length version of EST8 were determined by RACE PCR using the Clontech Marathon cDNA Amplification Kit. Testicular and gastric Marathon cDNA sources were used as substrates for the RACE reaction. The 5P RACE primer used in the reaction is
GSP-1 AGTCTAGAAAGCTGGTGATGTAGTCACGGC
And GSP-2 TAGATGCATATGTCATAGCGTGTGATGAGCACTGC (including NsiI site)
Met.
A nested RACE reaction was set up using the Clontech Advantage-2 PCR Kit according to the instructions in the user manual for the Marathon cDNA Amplification Kit. The amount of GSP primer used was 0.2 pmol / μl of each primer per 1 μl of reaction mixture. GSP1 primer was used for the first round of PCR and GSP2 primer was used for nested reactions. The product of the nested RACE reaction is digested with NsiI (for the GSP2 primer) and NotI (for the AP2 primer provided in the Clontech kit and used for the nested RACE PCR) and ligated into the CS2 + vector cut with NsiI and NotI. did. The ligated product was transformed into ElectroMAX DH10B cells from Life Technologies.

The cloned RACE product was plated at low density (approximately 300 colonies per plate). Under conditions of high stringency, colony nitro in standard hybridization buffer (1X Blotto [25X Blotto = 5% nonfat dry milk, 0.02% azide] + 1% NP-40 + 6X SSC + 0.05% pyrophosphate) Cellulose replicas were hybridized with ³² P-labeled probes (shaking at 65 ° C. for 2 hours). The sequence at the 5P end of candidate 8-1 was used as the DNA probe:
CTCGAGTCTGGGAAGCACCGTTAACATCC

After 2 hours, the hybridization solution (hybridization buffer containing 1 × 10 ⁶ cpm ³² P-labeled DNA probe) is removed, and under high stringency conditions (3 × SSC, 0.05% pyrophosphate, 5 minutes at room temperature; then 2 The filter was washed with 2X SSC, 0.05% pyrophosphoric acid, 15 minutes at room temperature; then 2.2X SSC, 0.05% pyrophosphoric acid, 65 ° C for 1-2 minutes). The filter was wrapped in Saran wrap and exposed to X-ray film overnight. Autoradiographs were obtained to confirm positive hybridization transformants with various signal intensities. These positive clones were picked and grown for 12 hours in selective medium (L-broth supplemented with 100 μg / ml ampicillin). Plasmid DNA was prepared and sent for DNA sequence analysis. A second round of hybridization was performed using a probe made to sequence more 5P than candidate 8-1 rather than candidate 8-1. The DNA probe sequence was deduced from the 5P RACE product. The second probe sequence was as follows:
GAAGGCGATCTCATAGCTCTCCAGACT
The cloned RACE product was plated again and the same hybridization protocol was performed except that the more 5P probe was used. The starting Met was deduced from consensus sequences derived from 5P RACE products obtained from both testis and stomach cDNAs. The 3P RACE primer used was
GSP1 GCTCTAGACTGGTCTGAGTGCACCCCCAGCT
And GSP2 GTCCTTTGCAAGAGCGCAGACCAC
Met.
A nested RACE reaction was set up using the Advantage GC-2 PCR Kit from Clontech. React according to the instructions in the user manual for Marathon cDNA Amplification Kit, except that the amount of CGmelt used was 5 μl per 50 μl reaction and the amount of GSP primer used was 0.2 pmol / μl of each PCR primer / μl reaction mixture. Set up. GSP1 primer was used for the first round of PCR and GSP2 was used for nested reactions. The product from the nested RACE reaction was ligated into the pT-Adv vector using the AdvanTAge PCR Cloning Kit according to the manufacturer's instructions. The ligated product was transformed into ElectroMAX DH10B cells from Life Technologies. The cloned RACE product was plated at low density (approximately 300 colonies per plate). Under conditions of high stringency, colony nitro in standard hybridization buffer (1X Blotto [25X Blotto = 5% nonfat dry milk, 0.02% azide] + 1% NP-40 + 6X SSC + 0.05% pyrophosphate) Cellulose replicas were hybridized with ³² P-labeled probes (shaking at 65 ° C. for 2 hours). The sequence at the 3P end of candidate 8-1 was used as the DNA probe:
GCACTGTGCAGAGCACTCACCCCA
After 2 hours, the hybridization solution (hybridization buffer containing 1 × 10 ⁶ cpm ³² P-labeled DNA probe) is removed, and under high stringency conditions (3 × SSC, 0.05% pyrophosphate, 5 minutes at room temperature; then 2 The filter was washed with 2X SSC, 0.05% pyrophosphoric acid, 15 minutes at room temperature; then 2.2X SSC, 0.05% pyrophosphoric acid, 65 ° C for 1-2 minutes). The filter was wrapped in Saran wrap and exposed to X-ray film overnight. Autoradiographs were obtained to confirm positive hybridization transformants with various signal intensities. These positive clones were picked and grown for 12 hours in selective medium (L-broth supplemented with 100 μg / ml ampicillin). Plasmid DNA was prepared and sent for DNA sequence analysis. Stop codons were deduced from consensus sequences derived from 3P RACE products obtained from both testis and stomach cDNAs.

  The full-length EST8 sequence was confirmed except for base pairs 1332 to 1517 (here, A in the starting Met (ATG) is base pair # 1). A public database search revealed an EST8 partial sequence called ADAMTS10. We used the sequence from this partial clone to construct a contiguous region of our EST8 (base pairs 1332 to 1517) using synthetic oligonucleotides.

The full-length sequence of EST8 (SEQ ID NO: 3) is a consensus sequence derived from PCR products from Clontech testis and stomach cDNAs, as well as the publicly available sequence representing hybridization positive candidate 8-1, EST8. It was. The final EST8 expression construct was collected from four specific fragments of EST8. The 5P portion of EST8 from base pairs 1-1342 is PCR amplified from a pool of stomach and testis cDNA and designated fragment 1. The following primers were used:
5P PCR primer AAATGGGCGAATTCCCACCATGGCTCCCGCCTGCCAGATCCTCCG (contains an 8 base pair linker (AAATGGGC) and an EciRI cloning site (GAATTC) and a Kozak sequence (CCACC) upstream of the starting Met)
And 3P PCR primer CCGAGTCTAGAAAGCTGGTGATGTAG (containing the XbaI site (TCTAGA)).
The PCR product was digested with EcoRI and XbaI using standard digestion conditions. Fragment 2, the next part of the gene, was constructed using a synthetic oligonucleotide. The synthetic fragment was from the XbaI site to the BsrFI site, from EST8 base pairs 1333 to 1517. The synthetic oligonucleotide consisted of the following sequence:
The top sequence consists of CTAGACTCGGGCCTGGGGCTCTGCCTGAACAACCGACCCCCCAGACAGGACTTTGTGTACCCGACAGTGGCACCGGGCCAAGCCTACGATGCAGATGAGCAATGCCGCTTTCAGCATGGAGTCAAATCGCGTCAGTGTAAATACGGGGAGGTCTGCAGCGAGCTGTGGTGTCTGAGCAAGAGCAA
The bottom sequence consisted of CCGGTTGCTCTTGCTCAGACACCACAGCTCGCTGCAGACCTCCCCGTATTTACACTGACGCGATTTGACTCCATGCTGAAAGCGGCATTGCTCATCTGCATCGTAGGCTTGGCCCGGTGCCACTGTCGGGTACACAAAGTCCTGTCTGGGGGGTCGGTTGTTCAGGCGGAGCCCCAGGCCCGAGT
Fragment 3, the next part of EST8, was a fragment from BsrFI to SphI and was digested from candidate 8-1. This was base pair 1518 to 2783 base pairs of the full length version of EST8. The 3P portion of EST8 called fragment 4 (base pairs 2663 to 3314) was PCT amplified. The following primers were used:
5P GGGTTGTAGGGAACTGGTCGCTCTG (present in fragment 3, upstream of SphI site)
And 3P AAATGGGCCTCGAGCCCTAGTGGCCCTGGCAGGTTTTGC (including 8 base pair linker (AAATGGGC) and XhoI site (CTCGAG) downstream of stop cotton (TAG))
The PCR product was digested with SphI and XhoI using standard digestion conditions. These four described fragments, namely 5P fragment 1 (EcoRI / XbaI), internal fragment 2 (XbaI / BsrFI), internal fragment 3 (BsrFI / SphI), and 3P fragment 4 (SphI / XhoI) are expressed in the Cos expression vector pED6. A full-length version of EST8 was constructed by ligation into dpc2 (digested with EcoRI and XhoI). The final construct had a mutation in the XhoI cloning site that was destroyed during ligation. This did not affect the EST8 coding sequence and remained in the construct.

Expression of aggrecanase In order to produce murine, human or other mammalian aggrecanase-related protein, the DNA encoding it is transferred into an appropriate expression vector by conventional genetic engineering, and cultured in mammalian cells or insect cells. It is introduced into other preferred eukaryotic or prokaryotic hosts, including the system. Expression systems for biologically active recombinant human aggrecanases are considered to be stably transformed mammalian cells, insects, yeast or bacterial cells.

  Those skilled in the art will include the sequence of SEQ ID NO: 3 or the sequence of SEQ ID NO: 1 comprising nucleotides # 1 to # 3766 of SEQ ID NO: 1 or comprising nucleotides # 1086 to # 3396 or other aggrecanase related proteins. DNA sequences or other modified sequences and pCD (Okayama et al., Mol. Cell Biol., 2: 161-170 (1982)), pJL3, pJL4 (Gough et al., EMBO J., 4: 645-653) (1985)) and known vectors such as pMT2 CXM can be used to construct mammalian expression vectors.

  The mammalian expression vector pMT2 CXM is a derivative of p91023 (b) (Wong et al., Science 228: 810-815, 1985), which contains an ampicillin resistance gene instead of a tetracycline resistance gene, and is used for insertion of a cDNA clone. It differs from p91023 (b) in that it contains an XhoI site. The functional elements of pMT2 CXM have been described (Kaufman, RJ, 1985, Proc. Natl. Acad. Sci. USA 82: 689-693), the SV40 replication origin containing the adenovirus VA gene, 72 bp enhancer, 5 'Adenovirus major late promoter containing most of the splice site and adenovirus tripartite leader sequence present on adenovirus late mRNAs, 3' splice acceptor site, DHFR insert, SV40 early polyadenylation site (SV40), and E Contains the pBR322 sequence required for growth in E. coli.

American Type Culture Collection 10801 University Blvd. Manassas, VA 20110-2209 Plasmid pMT2 CXM is obtained by digesting pMT2-VWF deposited with the accession number ATCC 67122 in USA. EcoRI digestion deletes the cDNA insert present in pMT2-VWF, resulting in linear pMT2, which can be ligated and used to transform E. coli HB101 or DH-5 to make it ampicillin resistant. it can. Plasmid pMT2 DNA can be prepared by conventional methods. The pMT2 CXM is then constructed using the loop-out / in mutation method (Morinaga, et al., Biotechnology 84: 636 (1984)). This removes the 1075th to 1145th bases from the SV40 replication origin of pMT2 and the HindIII site close to the enhancer sequence. In addition, the following sequence is inserted at nucleotide 1145:
5 'PO-CATGGGCAGCTCGAG-3'
This sequence contains a recognition site for the restriction endonuclease XhoI. A derivative of pMT2CXM, designated pMT23, contains recognition sites for the restriction endonucleases RstI, EcoRI, SalI and XhoI. Plasmids pMT2 CXM and pMT23 DNA may be obtained by conventional methods.

  pEMC2β1 derived from pMT21 may also be suitable for the practice of the present invention. pMT21 is derived from pMT2 via the following two modifications. As described above, EcoRI digestion excises the cDNA insert present in pMT-VWF to obtain linear pMT2, which is ligated and transformed into E. coli HB101 or DH-5 to give ampicillin. Can be used to make it resistant. Plasmid pMT2 DNA can be obtained by conventional methods.

PMT21 is derived from pMT2 by the following two modifications. First, the 76 base pair 5 ′ untranslated region of DHFR cDNA containing 19 G residues extended from G / C tailing for cDNA cloning is deleted. In this step, an XhoI site is inserted and immediately upstream of DHFR the following sequence:
5 ' -CTGCAG GCGAGCCT GAATTCCTCGAG CCATC ATG -3'
PstI Eco RI XhoI
Get.

  A unique ClaI site is then introduced by digestion with EcoRV and XbaI, treatment with Klenow fragment of DNA polymerase I, and ligation to the ClaI linker (CATCGATTG). This deletes a 250 base pair fragment from the adenovirus associated RNA (VAI) region, but does not inhibit the expression or function of the VAI RNA gene. pMT21 is digested with EcoRI and XhoI and used to obtain the vector pEMC2B1.

Digestion with EcoRI and PstI resulted in a portion of the EMCV leader from pMT2-ECAT1 [SK Jung et al., J. Virol, 63: 1651-1660 (1989)], which is a 2752 base pair fragment. . This fragment is digested with TaqI to obtain a 508 base pair EcoRI-TaqI fragment, which is purified by electrophoresis on a low melting point agarose gel. The following sequence:
5'- CGA GGTTAAAAAACGTCTAGGCCCCCCGAACCACGGGGACGTGGTTTTCCTTT
TaqI
GAAAAACACG ATT G C -3 '
XhoI
A 68 base pair adapter and its complementary strand are synthesized using a 5 ′ TaqI overhang with 3 ′ and a 3 ′ XhoI overhang.
This sequence matches the EMC virus leader sequence from nucleotides 763-827. In addition, this sequence has an ATG at position 10 in the EMC virus leader changed to ATT followed by a XhoI site. Three vectors, the EcoRI-XhoI fragment of pMT21, the EcoRI-TaqI fragment of EMC virus, and the 68 base pair oligonucleotide adapter TaqI-16hoI adapter are ligated to obtain the vector pEMC2β1.

  This vector contains the SV40 origin of replication and enhancer, adenovirus late promoter, most cDNA copies of adenovirus tripartite leader sequences, small hybrid intervening sequences, SV40 polyadenylation signal and adenovirus VAI gene, DHFR and β- It contains a lactamase marker and an EMC sequence and is appropriately associated with directing the expression of high levels of the desired cDNA in mammalian cells.

  Construction of the vector may involve modification of the aggrecanase related DNA sequence. For example, the aggrecanase cDNA may be modified by removing non-coding nucleotides on the 5 'and 3' ends of the coding region. Deleted non-coding nucleotides may or may not be replaced with other sequences known to be beneficial for expression. These vectors are transformed into suitable host cells for expression of the aggrecanase-related protein. Furthermore, by deleting the propeptide sequence encoding aggrecanase and replacing it with a sequence encoding the complete polypeptide of another aggrecanase protein, nucleotides # 1 to # 3766 of SEQ ID NO: 3 or SEQ ID NO: 1 are substituted. The mature SEQ ID NO: 1 sequence comprising nucleotides # 1086 to # 3396 or other sequences encoding aggrecanase-related proteins can be processed to express the mature aggrecanase-related protein.

  The skilled artisan removes or replaces the mammalian regulatory sequences adjacent to the coding sequence with bacterial sequences to create bacterial vectors for intracellular or extracellular expression by bacterial cells. 3 or SEQ ID NO: 1 sequence can be processed. For example, the coding sequence can be further processed (eg, linked to other known linkers, or the non-coding sequence deleted, or the nucleotide changed by other known methods). The modified aggrecanase-related coding sequence is then transferred into known bacterial vectors using methods such as those described in T. Taniguchi et al., Proc. Natl. Acad. Sci. USA, 77: 5230-5233 (1980). Could be inserted into. This exemplary bacterial vector is then transformed into a bacterial host cell, thereby expressing an aggrecanase-related protein. See European Patent Publication EPA 177,343 for methods for extracellular expression of aggrecanase-related proteins in bacterial cells.

  For the purpose of expression in insect cells, the same processing can be performed to construct an insect vector [see, for example, the method described in published European Patent Application No. 155,476]. Yeast vectors can also be constructed using yeast regulatory sequences for intracellular or extracellular expression of the factor of the invention by yeast cells [eg published PCT application WO 86/00639 and European patent application EPA 123, See the method described in No. 289].

  A method for producing high levels of the aggrecanase-related protein of the present invention in mammalian cells involves the construction of cells having multiple copies of heterologous aggrecanase-related genes. A heterologous gene can be ligated to a marker that can be amplified, such as the dihydrofolate reductase (DHFR) gene, and the methotrexate (MXT) concentration can be increased by the method of Kaufman and Sharp, J. Mol. Biol. Cells that are elevated and have an increased gene copy can be selected for the marker. This approach can be used for a variety of different cell types.

Aggrecanases of the present invention operatively linked to sequences of other plasmids that allow expression of aggrecanase-related proteins by various methods including, for example, calcium phosphate coprecipitation and transfection, electroporation or protoplast fusion A plasmid containing a DNA sequence relating to a related protein and a DHFR expression plasmid pAdA26SV (A) 3 [Kaufman and Sharp, Mol. Cell. Biol., 2: 1304 (1982)] were simultaneously introduced into DHFR-deficient cells DUKX-BII. can do. Transformants expressing DHFR were selected for growth in alpha medium containing dialyzed fetal calf serum and then MTX as described by Kaufman et al., Mol. Cell. Biol., 5: 1750 (1983). Selection is made for amplification by growth when the concentration is increased (eg, sequentially 0.02, 0.2, 1.0, then 5 μM MTX). Transformants are cloned and the expression of biologically active aggrecanase is monitored by the above assay. Aggrecanase protein expression should increase with increasing levels of MTX resistance. Aggrecanase polypeptides are characterized using standard methods known in the art, such as pulse labeling with [ ³⁵ S] methionine or cysteine and polyacrylamide gel electrophoresis. Other related aggrecanase related proteins can be produced by similar methods.

  In one example, the aggrecanase gene of the present invention shown in SEQ ID NO: 3 is cloned into the expression vector pED6 (Kaufman et al., Nucleic Acid Res. 19: 44885-4490 (1990)). COS and CHO DUKX B11 cells are transiently transfected with the aggrecanase sequences of the present invention by lipofection (LF2000, Invitrogen) (+/- cotransfection of PACE on separate pe D6 plasmids). Genes of interest: (a) a gene for obtaining a conditioned medium for activity assay, and (b) a gene for 35-S-methionine / cysteine metabolic labeling, in two identical systems, respectively. Do.

  On day 1 the medium is collected on the wells by exchanging μg / ml heparin to DME (COS) or alpha (CHO) medium + 1% heat inactivated fetal calf serum +/− 100. After 48 hours (day 4), conditioned medium is collected for activity assays.

  On day 3, the 2 wells were replaced with MEM (methionine-free / cysteine-free) medium + 1% heat-inactivated fetal calf serum + 100 μg / ml heparin + 100 μCi / ml 35S-methionine / cysteine (Redivue Pro mix, Amersham) To do. After 6 hours incubation at 37 ° C., the conditioned medium is collected and run on an SDS-PAGE gel under reducing conditions. Visualize proteins by autoradiography.

Biological activity of the expressed aggrecanase In order to determine the biological activity of the expressed aggrecanase-related protein obtained in Example 2 above, the protein was recovered from the cell culture and co-generated proteinaceous material As well as isolation of aggrecanase-related proteins from other contaminants. Purified protein may be assayed by the above assay. Purification is performed using standard methods known to those skilled in the art.

  Silver-stained (Oakley, et al. Anal. Biochem. 105: 361 (1980)) SDS-PAGE acrylamide (Laemmli, Nature 227: 680 (1970)) and immunoblot (Towbin, et al. Proc. Natl. Acad) Analyze proteins using standard methods such as Sci. UAS 76: 4350 (1979)).

  The above description details the presently preferred embodiments of the invention. Many modifications and variations will occur to those skilled in the art in view of these descriptions in the practice of the invention. Those modifications and variations are believed to be within the scope of the appended claims.

  The present invention can be used in fields such as drug development.

Claims (20)

  An isolated DNA molecule comprising the DNA sequence set forth in SEQ ID NO: 3.   An isolated DNA molecule comprising the DNA sequence from nucleotide # 1086 to # 3396 shown in SEQ ID NO: 1. a) the sequence of SEQ ID NO: 3;
b) nucleotides # 1086 to # 3396 of SEQ ID NO: 1:
An isolated DNA molecule comprising a naturally occurring human allelic sequence and a DNA sequence selected from the group consisting of degenerate codon sequences equivalent to a) and b).   A vector comprising the DNA molecule of claim 1 operably linked to an expression control sequence.   A vector comprising the DNA molecule of claim 2 operably linked to an expression control sequence.   A host cell transformed with the DNA sequence of claim 1.   A host cell transformed with the DNA sequence of claim 2. The following process:
A method for producing a purified human aggrecanase protein, comprising: (a) culturing a host cell transformed with the DNA molecule of claim 1; and (b) recovering and purifying the aggrecanase protein from the medium. The following process:
A method for producing a purified human aggrecanase protein, comprising: (a) culturing a host cell transformed with the DNA molecule of claim 2; and (b) recovering and purifying the aggrecanase protein from the medium.   A purified aggrecanase polypeptide comprising the amino acid sequence of SEQ ID NO: 4.   A purified aggrecanase polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 2. The following process:
(A) a purified aggreca produced by culturing cells transformed with the DNA molecule according to claim 1; Nase polypeptide. The following process:
(A) a purified aggreca produced by culturing cells transformed with the DNA molecule according to claim 2; Nase polypeptide.   An antibody that binds to the purified aggrecanase protein of claim 10.   A method for developing an inhibitor of aggrecanase, comprising using the aggrecanase shown in SEQ ID NO: 4 or a fragment thereof.   A method for developing an inhibitor of aggrecanase, comprising using the aggrecanase shown in SEQ ID NO: 2 or a fragment thereof.   The method according to claim 15 or 16, characterized by three-dimensional structural analysis.   17. A method according to claim 15 or 16, characterized by a computer aided drug design.   A composition for inhibiting the proteolytic activity of aggrecanase, comprising a peptide that binds to aggrecanase and inhibits proteolysis of aggrecan.   A method of inhibiting aggrecan cleavage in a mammal comprising administering to the mammal an effective amount of a compound that inhibits aggrecanase activity.