JP2008184404A - Lectin binding to n-binding type one-three side chain sugar chain - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To obtain a new lectin exhibiting a sugar chain specificity different from that of a conventional lectin and to provide its use. <P>SOLUTION: The adsorbent or binder of an N-binding type one-three side chain sugar chains comprises (d) a lectin composed of an amino acid sequence of sequence number 3, (e) a lectin composed of a partial amino acid sequence of sequence number 3 and having binding activity at an N-binding type one-three side chain sugar chains and (f) a lectin composed of an amino acid sequence of sequence number 3 or an amino acid sequence in which one to several amino acids are added, deleted or substituted in its partial amino acid sequence and having binding activity at an N-binding type one-three side chain sugar chains. <P>COPYRIGHT: (C)2008,JPO&INPIT

Description

  The present invention relates to a lectin that binds to N-linked 1-3 side chain sugar chains, a method for producing the same, an N-linked 1-3 side chain sugar chain adsorption or binding agent, N in a test sample, and the like. -It is related with the method of isolate | separating 1-3 type | mold side chain sugar chains of a coupling | bonding type, the detection method of cancer, and the detection method of 1-3 type | mold side chain sugar chains of N- coupling | bonding type.

Lectin is a general term for proteins having affinity for sugar chains. Lectins exist widely in the living world regardless of animals and plants, and more than 100 types have been isolated so far. Since lectins specifically recognize sugar chains and bind reversibly, the glycan structure can be determined by examining the lectin binding pattern of glycoproteins in the test sample using multiple lectins with different sugar chain binding specificities. Can be estimated or identified.
In addition, there are unique sugar chains on the cell surface, and sugar chains are used for communication such as recognition and adhesion between cells. Since the sugar chain present on the surface changes depending on the state of the cell, it is possible to identify the cell and estimate its state by examining whether the test cell contains a sugar chain that binds to the specific lectin. For example, since a sugar chain that serves as a cancer marker exists on the surface of a cancer cell, a lectin that specifically binds to the target cancer marker sugar chain is brought into contact with a cell-containing sample such as serum to bind to the lectin. A cancer cell can be detected by detecting the sugar chain.
In addition, a specific glycoprotein or cell in a test sample containing glycoprotein or cells can be fractionated or concentrated using a plurality of columns or beads to which lectins are immobilized.

Here, the sugar chain of the glycoprotein includes an N-linked sugar chain that binds to an asparagine (Asn) residue and an O-linked (mucin-type) sugar that binds to a serine (Ser) or threonine (Thr) residue. It can be roughly divided into chains. The N-linked sugar chain is a group of sugar chains in which N-acetylglucosamine at the reducing end of the sugar chain is N-glycosidically linked to the acid amide group of Asn in the peptide, which is called trimannosyl core, and is the 5 of Man ₃ GlcNAcGlcNAc. Sugar is the common mother nucleus. Based on the structure and site of the sugar residue added thereto, N-linked sugar chains are classified into the following three subgroups. It is a high mannose-type sugar chain in which only 2 to 6 α-mannosyl residues are bound, and 1 to 5 various sugar chains starting from N-acetylglucosamine are bound to two α-mannosyl residues in the mother nucleus. It is a complex type sugar chain and a hybrid sugar chain of a hybrid of both. N-acetylglucosamine bound to the C-4 position of β-mannosyl residue is found in complex and hybrid sugar chains and changes the steric structure of the sugar chains, so it is called Bisecting GlcNAc. Yes. Furthermore, there are those in which the reducing end is modified with fucose. Also, depending on the number of sugar chains branched from the trimannosyl core, it is called a double side chain sugar chain, a triple side chain type chain, or the like. The classification of N-linked sugar chains is shown in FIG.

It is known that all sugar chains are subjected to various modifications and take various structures. Many glycoproteins often have a plurality of sugar chains, and the sugar chains themselves are complex mixtures. For this reason, it is difficult to separate or identify specific glycoproteins only by affinity with lectins, but these can be achieved by adding lectin affinity chromatography and lectin arrays to glycoprotein and cell separation and purification processes and identification processes. Accuracy can be improved. In the glycoprotein and cell separation / concentration step, the yield can be improved.
Therefore, it is desired to find a lectin exhibiting a new sugar chain binding specificity not found in conventional lectins.

  An object of the present invention is to find a new lectin exhibiting a sugar chain specificity different from that of a conventional lectin and to provide its use.

In order to solve the above problems, the present inventors have conducted research and found a novel lectin produced by Aspergillus oryzae in the microbial cells. It was also found that this lectin strongly binds to 1 to 3 side chain sugar chains among N-linked sugar chains but does not bind to 4 side chain sugar chains.
The present invention has been completed based on the above findings, and provides the following lectins and the like.

Item 1. A lectin that binds to N-linked 1 to 3 side chain sugar chains, comprising the following polypeptide (a), (b), or (c):
(a) a polypeptide comprising the amino acid sequence of SEQ ID NO: 3
(b) a polypeptide comprising the partial amino acid sequence of SEQ ID NO: 3 and having binding activity to N-linked 1 to 3 side chain sugar chains
(c) the amino acid sequence of SEQ ID NO: 3 or a partial amino acid sequence thereof, consisting of an amino acid sequence in which one to several amino acids are added, deleted, or substituted, and N-linked 1-3 side chain sugar chains Item 2. Polypeptide having binding activity to An N-linked 1-3 side chain sugar chain adsorption or binding agent comprising the following lectin (d), (e), or (f):
(d) a lectin consisting of the amino acid sequence of SEQ ID NO: 3
(e) a lectin consisting of a partial amino acid sequence of SEQ ID NO: 3 and having binding activity to N-linked 1 to 3 side chain sugar chains
(f) an amino acid sequence of SEQ ID NO: 3 or a partial amino acid sequence thereof in which one to several amino acids are added, deleted, or substituted, and an N-linked 1-3 side chain sugar chain 2. A lectin having binding activity to A step of bringing a test sample containing a sugar chain into contact with the following lectin (d), (e), or (f) to adsorb or bind N-linked 1-3 side chain sugar chains to the lectin. And a step of separating a complex formed by adsorption or binding of an N-linked 1-3 side chain sugar chain and a lectin, and a method for separating the N-linked 1-3 side chain sugar chain.
(d) a lectin consisting of the amino acid sequence of SEQ ID NO: 3
(e) a lectin consisting of a partial amino acid sequence of SEQ ID NO: 3 and having binding activity to N-linked 1 to 3 side chain sugar chains
(f) an amino acid sequence of SEQ ID NO: 3 or a partial amino acid sequence thereof in which one to several amino acids are added, deleted, or substituted, and an N-linked 1-3 side chain sugar chain 3. A lectin having binding activity to A test sample containing glycoproteins or cells is brought into contact with the following lectins (d), (e), or (f) to adsorb or bind N-linked 1-3 side chain sugar chains to the lectins. A step of removing a complex due to adsorption or binding of N-linked 1-3 side chain sugar chains and lectin from the test sample, and an N-linked type in the test sample from which the complex has been removed Detecting a sugar chain having four or more side chains.
(d) a lectin consisting of the amino acid sequence of SEQ ID NO: 3
(e) a lectin comprising the partial amino acid sequence of SEQ ID NO: 3 and having binding activity to N-linked 1 to 3 side chain sugar chains
(f) an amino acid sequence of SEQ ID NO: 3 or a partial amino acid sequence thereof in which one to several amino acids are added, deleted, or substituted, and an N-linked 1-3 side chain sugar chain A lectin having binding activity to A step of bringing a test sample containing a sugar chain into contact with the following lectin (d), (e), or (f); and adsorption or binding between the lectin and an N-linked 1-3 side chain sugar chain A method for detecting N-linked 1-3 side chain sugar chains, comprising a step of detecting a complex by
(d) a lectin consisting of the amino acid sequence of SEQ ID NO: 3
(e) a lectin comprising the partial amino acid sequence of SEQ ID NO: 3 and having binding activity to N-linked 1 to 3 side chain sugar chains
(f) an amino acid sequence of SEQ ID NO: 3 or a partial amino acid sequence thereof in which one to several amino acids are added, deleted, or substituted, and an N-linked 1-3 side chain sugar chain 5. A lectin having binding activity to A step of culturing a transformant in which a vector capable of expressing the following DNA (g), (h), or (i) is introduced into a eukaryotic cell; A method for producing a lectin that binds to an N-linked 1-3 side chain sugar chain, comprising a step of recovering the lectin that binds to the three side chain sugar chains.
(g) DNA consisting of the base sequence of SEQ ID NO: 1
(h) DNA encoding a polypeptide consisting of a partial base sequence of SEQ ID NO: 1 and having binding activity to N-linked 1-3 side chain sugar chains
(i) encodes a polypeptide that hybridizes with a DNA comprising the nucleotide sequence of SEQ ID NO: 1 or a partial nucleotide sequence thereof under stringent conditions and binds to N-linked 1-3 side chain sugar chains DNA
Item 7. A step of culturing a transformant introduced with a vector capable of expressing the following DNA of (j), (k), or (l), and N-linked 1-3 side chains from the culture: A method for producing a lectin that binds to N-linked 1-3 side chain sugar chains, comprising a step of recovering a lectin that binds to a sugar chain.
(j) DNA consisting of the base sequence of SEQ ID NO: 2
(k) DNA encoding a polypeptide consisting of a partial base sequence of SEQ ID NO: 2 and having binding activity to N-linked 1-3 side chain sugar chains
(l) encodes a polypeptide that hybridizes with a DNA comprising the nucleotide sequence of SEQ ID NO: 2 or a partial nucleotide sequence thereof under stringent conditions and binds to N-linked 1-3 side chain sugar chains DNA

The lectin of the present invention shows a stronger affinity for N-linked sugar chains having fewer sugar chain side chains branched from the trimannosyl core. The lectin of the present invention adsorbs or binds to N-linked 1-3 side chain sugar chains and does not show affinity for N-linked 4 side chain sugar chains. That is, the lectin of the present invention specifically adsorbs or binds to N-linked 1 to 3 side chain sugar chains.
Utilizing this sugar chain binding specificity, combining with other lectins having sugar chain binding specificity, estimation or identification of sugar chain structure of glycoprotein, fractionation or concentration of glycoprotein or cells, etc. be able to.

  As described above, the lectin of the present invention binds to 1 to 3 side chain sugar chains of N-linked sugar chains and does not substantially bind to 4 side chain sugar chains. When cancer occurs, hyperbranched side chains increase in the sugar chains of glycoproteins on the cell surface. Further, it is known that sugar chains having 4 or more side chains among sugar chains present on the surface of cancer cells are involved in malignant transformation of cancer and acquisition of metastatic ability. Therefore, an increase in sugar chains having four or more side chains in blood or tissue is one of the diagnostic indicators for cancer. On the other hand, IgA, IgG, fetuin, and the like, which are glycoproteins present in large quantities in serum and other body fluids, mainly have N-linked 1 to 3 side chain sugar chains. Therefore, in detecting a body fluid such as serum as a test sample and the four side chain sugar chains as a cancer marker, the N-linked 1-3 side chain sugar chains in the test sample are previously adsorbed to the lectin of the present invention. If it is removed by binding, the detection sensitivity of sugar chains having four or more N-linked side chains in the test sample can be improved.

  Examples of conventional lectins that specifically have an affinity for N-linked 1 to 3 side chain sugar chains include red bean lectin ConA, a kind of taro lectin (AMA), and the like. Including these, most of the conventional lectins showing affinity for N-linked sugar chains are derived from plants. When obtaining a target lectin from a plant, other lectins and various proteins are included in the plant components, and therefore proteins other than the target lectin are easily mixed. In addition, the amount of lectin obtained is not constant because the growth of the plant and the amount of the product change depending on the growth conditions of the soil and other plants. Moreover, since the growth of plants is slow, it takes time to produce lectins. With respect to these points, the lectin of the present invention is produced by culturing microorganisms such as koji molds into which a lectin gene has been introduced. Therefore, the lectin can be produced in a large amount and stably with high purity.

Moreover, the lectin of the present invention exhibits hemagglutination activity in a wide pH range of about pH 4.6-9. In many cases, the washing solution for washing the carrier on which the lectin is immobilized is not neutral. However, since the lectin of the present invention is stable in a wide pH range, the lectin activity is hardly impaired even if the lectin column is washed.
The lectin of the present invention is a tetramer composed of subunits having a molecular weight of 12,000. On the other hand, the fucose-specific lectin of Aspergillus described above is a dimer composed of subunits having a molecular weight of 35000 (Japanese Patent Laid-Open No. 2002-112786), and is a lectin specific to N-linked 1-3 side chain sugar chains. ConA is a tetramer composed of subunits with a molecular weight of 26000. Thus, since the lectin of the present invention has a small molecular weight, it can be fixed to a carrier at a high density, and as a result, a lectin-binding carrier with high separation efficiency and detection sensitivity can be obtained.

In addition, the lectin of the present invention is extremely stable against freezing and thawing, and the hemagglutination activity does not decrease at all after 4 times of freezing and thawing. For this reason, it can be frozen for distribution and storage, and can be distributed to a long distance or stored for a long time.
In addition, the lectin of the present invention has a low minimum concentration showing hemagglutination activity, that is, a high affinity of the lectin for sugar chains. For this reason, sugar chain detection sensitivity and separation accuracy are high.

Hereinafter, the present invention will be described in detail.
(I) The lectin of the present invention The lectin of the present invention is a lectin that binds to N-linked 1 to 3 side chain sugar chains comprising the following polypeptide (a), (b), or (c): It is.
(a) a polypeptide comprising the amino acid sequence of SEQ ID NO: 3
(b) a polypeptide comprising the partial amino acid sequence of SEQ ID NO: 3 and having binding activity to N-linked 1 to 3 side chain sugar chains
(c) the amino acid sequence of SEQ ID NO: 3 or a partial amino acid sequence thereof, consisting of an amino acid sequence in which one to several amino acids are added, deleted, or substituted, and N-linked 1-3 side chain sugar chains Polypeptide having binding activity to

This lectin is a lectin that does not bind to N-linked four-side sugar chains, that is, specifically binds to N-linked 1-3 side-chain sugar chains. In the present invention, the mode of bonding is not limited and includes all types of bonding such as covalent bonding, ionic bonding, hydrogen bonding, hydrophobic bonding, and van der Waals bonding. Thus, “binding” includes physical “adsorption”.
The lectin consisting of the amino acid sequence of SEQ ID NO: 3 in (a) is a lectin produced by Aspergillus as described later. The lectin consisting of the partial sequence of (b) is not particularly limited as long as it has lectin activity that binds to N-linked 1-3 side chain sugar chains. In addition, the lectin comprising the amino acid sequence of (c) includes the corresponding lectin produced by organisms other than Neisseria gonorrhoeae that exhibit the same sugar chain binding specificity as the gonococcal lectin of (a), and N-linked 1 to 3 sides. The partial peptide having lectin activity that binds to a sugar chain is included. The amino acid sequence (c) is preferably an amino acid sequence of SEQ ID NO: 3 or a partial sequence thereof in which about 1 to 5, especially about 1 to 3 amino acids are added, deleted or substituted.

  Regarding the method for obtaining the amino acid sequence of (c) based on the amino acid sequence of (a) or (b), the modification that does not lose the biological function is, for example, polar in terms of maintaining the structure of the protein obtained after translation. The amino acid can be substituted by an amino acid having properties similar to those of the amino acid before substitution in terms of charge, solubility, hydrophilicity / hydrophobicity, and the like. For example, glycine, alanine, valine, leucine, isoleucine, proline are classified as nonpolar amino acids; serine, threonine, cysteine, methionine, asparagine, glutamine are classified as polar amino acids; phenylalanine, tyrosine, tryptophan Lysine, arginine and histidine are classified as basic amino acids; aspartic acid and glutamic acid are classified as acidic amino acids. Accordingly, substitution can be made by selecting from the same group of amino acids.

The lectin of the present invention described above can be used alone or as an adsorbent or binding agent for N-linked 1-3 side chain sugar chains in a state immobilized on a carrier. Examples of the carrier include known column carriers, beads, and substrates that are generally used in column affinity chromatography. The material of the substrate and beads is not particularly limited, and examples thereof include glass, plastic, metal, and nitrocellulose. Methods for immobilizing lectins on these carriers are well known. For example, a carrier binding method in which a lectin is immobilized on a water-insoluble carrier through physical or hydrophobic adsorption, ionic bond, or covalent bond; a cross-linking method in which a reagent having a divalent functional group such as glutaraldehyde is cross-linked and immobilized; It can be immobilized by a method such as entrapment in which a lectin is confined in a gel having a network structure or a semipermeable membrane.
(II) Method of using the lectin of the present invention
Method for separating N-linked 1 to 3 side chain sugar chains

In the method for separating N-linked 1-3 side chain sugar chains in a test sample of the present invention, a test sample containing a sugar chain is contacted with the lectin of the present invention described above, and the lectin is N-linked. A method comprising adsorbing or binding 1 to 3 side chain sugar chains and separating a complex formed by adsorption or binding of an N-linked 1 to 3 side chain sugar chain and a lectin from a test sample. It is.
The lectin of the present invention is usually used in a state where it is immobilized on a carrier such as a column carrier, a bead or a substrate.

Examples of the test sample containing a sugar chain include a biological sample (blood, serum, urine, ascites, saliva, tissue suspension collected by biopsy, etc.) in addition to a sugar chain mixture and a glycoprotein mixture. In these biological samples, sugar chains are contained as sugar chains or as glycoproteins or cells. The sample can be contacted with the lectin as it is, or can be contacted with the lectin after being diluted with a buffer to which physiological saline is added.
When a glycoprotein mixture or a biological sample is used as a test sample, a test sample treated with trypsin or sialidase can be used. By these treatments, the sugar chain recognized by the lectin may be exposed or conversely lost and the adsorption activity may be changed, so that marker detection different from that of the untreated one can be expected. Furthermore, the sugar chain can be released from the glycoprotein and brought into contact by a chemical method such as a hydrazine decomposition method or TFMS method or an enzymatic method using glycosidase. In addition, since the lectin of the present invention exhibits strong activity at about pH 4.6 to 9, when the pH of the sample greatly deviates from this range, it is preferable to use one adjusted to this pH range. Moreover, about 0.01% of surfactant (Tween 20) and about 0.15M sodium chloride may be added for the purpose of preventing non-specific adsorption.

When using a lectin-immobilized column, if a test sample is applied to the column, N-linked 1-3 side chain sugar chains exhibiting binding affinity for the lectin of the present invention, and such sugars Cells having chains on the surface are adsorbed to the lectin immobilized on the column carrier, and other components are eluted without being adsorbed. By separating the eluate and the column carrier, the complex of the lectin and the 1-3 chain N-linked sugar chain can be separated from the test sample.
Moreover, when using the bead or the board | substrate which fix | immobilized the lectin, if a bead or a board | substrate and a test sample are mixed within a container, N-linked type 1-3 side chain sugar will be attached to a lectin fixed bead or a board | substrate. Since a cell having a chain or such a sugar chain on its surface is adsorbed, the test sample that is a supernatant may be separated from the bead or the substrate.

Other types of sugar chains are concentrated in the test sample from which the N-linked 1-3 side chain sugar chains have been separated and removed by the above method. For this reason, if this concentrate is used as a test sample, sugar chains other than N-linked 1-3 side chain sugar chains can be detected with high sensitivity.
Therefore, the separation method of the present invention can also be regarded as a pretreatment method for detecting sugar chains other than N-linked 1-3 side chain sugar chains. For example, a pretreatment method for detecting a sugar chain having 4 or more N-linked side chains of a specific glycoprotein that increases when a normal cell changes to a cancer cell, or a cancer cell itself. Can do.
How to detect cancer

  The cancer detection method of the present invention comprises contacting a test sample containing glycoprotein or cells with the lectin of the present invention described above to adsorb or bind N-linked 1-3 side chain sugar chains to the lectin. A step of removing a complex due to adsorption or binding of lectin and N-linked 1-3 side chain sugar chains from the test sample, and N-linked 4 in the test sample from which the complex has been removed. And a step of detecting a sugar chain having more than one side chain.

As the test sample containing glycoprotein or cells, for example, the biological sample described above can be used. In a test sample from which a complex due to adsorption or binding between lectin and N-linked 1-3 side chain sugar chains is removed, four or more side chains of N-linked type are sugar chains or sugars. Contained as a protein or cell.
In this method, a known method is used as a method for detecting a sugar chain having 4 or more N-linked side chains in a sample from which N-linked 1-3 side chain sugar chains have been removed. it can. For example, a wheat germ lectin (WGA) specific for N-linked three or more side chains is used to bind this lectin to a sugar chain having four or more N-linked side chains. What is necessary is just to detect. A method for detecting the binding between the lectin and the sugar chain will be described later.

Further, surface plasmon resonance (SPR) method can also detect the binding between a lectin and a sugar chain specific to a sugar chain having four or more N-linked side chains.
In addition, a sugar chain having four or more N-linked side chains can also be detected by an immunoassay using an antibody specific for the sugar chain having four or more N-linked side chains. it can. Such immunoassays include enzyme immunoassay, radioimmunoassay, latex agglutination immunoassay, a combination of lectin electrophoresis and antibody affinity transfer (lectin affinity electrophoresis), in the liquid phase. Examples thereof include an LBA (Liquid-phase binding assay) method in which a reaction between an antigen to be measured and a labeled antibody is performed, and then a free labeled antibody and an antigen-antibody complex are subjected to B / F separation using a column. These antibodies can be produced according to well-known production methods (for example, Current protocols in Molecular Biology edit. Ausubel et al. (1987) Publish. John Wiley and Sons. Sections 11.12 to 11.13).
In addition, the presence of a four-chain type sugar chain can also be confirmed by identifying the sugar chain structure by measuring the sugar chain by tandem mass (MS ⁿ ).

If the amount of N-linked glycans having 4 or more side chains, glycoproteins containing them, or the amount of cells detected in the test sample of the subject increases, there is a possibility of suffering from cancer. Judgment can be made. The increase in the detection amount may be obtained by quantifying the detection amount and comparing it to obtain an increase, or by qualitatively comparing the detection amount by visual observation, for example, to determine whether or not the increase is detected. You can also. In addition, if the detection rate of sugar chains, glycoproteins, or cells having four or more N-linked side chains occupying the entire cell is increased, the cancer may be affected. It can be judged that there is sex. An increase in the detection ratio can also be determined quantitatively or qualitatively.
Method for detecting N-linked type 1-3 side chain sugar chains

The method for detecting N-linked 1 to 3 side chain sugar chains of the present invention comprises a step of contacting a test sample containing a sugar chain with the lectin of the present invention described above, and the lectin and N-linked types 1 to 3. And a step of detecting a complex by adsorption or binding with the side chain sugar chain.
The lectin of the present invention may be used as it is or immobilized on a column carrier, bead, substrate or the like.
As a test sample containing a sugar chain, the above-described biological sample containing a sugar chain, a glycoprotein, a cell, etc. can be used in addition to a sugar chain mixture or a glycoprotein mixture.

Specifically, the test sample is applied to an affinity chromatography column on which the lectin of the present invention is immobilized, and the adsorbed sugar chain is eluted using an appropriate competitive sugar, acid, base, salt or the like. For example, N-linked 1-3 side chain sugar chains can be eluted by using a high concentration mannose solution. The eluted test sugar chain and the test sugar chain subjected to its saccharide-degrading enzyme treatment (sialidase, b-galactosidase, mannosidase, fucosidase) are separated by reversed-phase HPLC, and the elution position of various carbohydrate degrading enzyme standard substances By comparison, the sugar chain structure can be estimated. The structure of the eluted sugar chain is preferably determined by MS ⁿ analysis.
By sequentially applying a test sample to a plurality of affinity chromatography columns to which lectins having different sugar binding specificities are immobilized, and detecting the presence or absence of binding to these lectins, the sugar chains in the test sample are detected. The lectin binding pattern (binding profile) can be determined, and the sugar chain structure can be estimated or identified. As one of the lectin columns used in this method, a column on which the lectin of the present invention is immobilized can be used.

Further, by using an array in which a plurality of lectins having different sugar chain binding specificities including the lectin of the present invention are immobilized on a substrate and detecting the lectin to which the test sugar chain binds, the lectin binding of the test sugar chain The pattern can be determined efficiently. Further, in frontal affinity chromatography (Akira Hirabayashi, Yoichiro Arata, Seiichi Kasai (2003) Protein / Nucleic Acid / Enzyme 48: 1206-1212), the lectin of the present invention can also be used as one of the lectins.
(III) Method for producing lectin of the present invention

  The lectin that binds to the N-linked 1-3 side chain sugar chains of the present invention described above is produced by a method of isolation from cells or tissues of Neisseria gonorrhoeae or other biological species, a chemical synthesis method, or the like. Can do. Further, as described later, a transformant obtained by introducing the DNA of (g), (h), or (i) into a eukaryotic cell, or the DNA of (j), (k), or (l) It can also be obtained by isolation from a transformant introduced into a cell or prokaryotic cell.

Especially, it can manufacture efficiently with the following method. That is, the first method for producing a lectin that binds to the N-linked 1-3 side chain sugar chains of the present invention can express the following DNA (g), (h), or (i): The method includes a step of culturing a transformant in which a vector having the vector is introduced into a eukaryotic cell, and a step of recovering a lectin that binds to N-linked 1-3 side chain sugar chains from the culture.
(g) DNA consisting of the base sequence of SEQ ID NO: 1
(h) DNA encoding a polypeptide consisting of a partial base sequence of SEQ ID NO: 1 and having binding activity to N-linked 1-3 side chain sugar chains
(i) encodes a polypeptide that hybridizes with a DNA comprising the nucleotide sequence of SEQ ID NO: 1 or a partial nucleotide sequence thereof under stringent conditions and binds to N-linked 1-3 side chain sugar chains DNA

In addition, the second method for producing a lectin that binds to the N-linked 1-3 side chain sugar chains of the present invention can express the following DNA (j), (k), or (l): The method includes a step of culturing a transformant into which the vector is introduced, and a step of recovering a lectin that binds to N-linked 1-3 side chain sugar chains from the culture.
(j) DNA consisting of the base sequence of SEQ ID NO: 2
(k) DNA encoding a polypeptide consisting of a partial base sequence of SEQ ID NO: 2 and having binding activity to N-linked 1-3 side chain sugar chains
(l) encodes a polypeptide that hybridizes with a DNA comprising the nucleotide sequence of SEQ ID NO: 2 or a partial nucleotide sequence thereof under stringent conditions and binds to N-linked 1-3 side chain sugar chains DNA
Lectin gene

In the present invention, DNA includes DNA having the base sequence and DNA complementary thereto.
The base sequence of SEQ ID NO: 1 in (g) is a genomic DNA sequence of Aspergillus oryzae encoding a polypeptide consisting of the amino acid sequence of SEQ ID NO: 3. DNA comprising the nucleotide sequence of SEQ ID NO: 1 is screened by hybridization using, for example, a probe designed based on SEQ ID NO: 1 from an Aspergillus oryzae (hereinafter sometimes referred to as “gonococcus”) genomic DNA library. Obtainable. The Neisseria gonorrhoeae genomic DNA library can be obtained, for example, by partially digesting Neisseria gonorrhoeae genomic DNA with a restriction enzyme such as Sau3AI and inserting it into a phage vector such as EMBL3.

The base sequence of SEQ ID NO: 2 in (j) is an Aspergillus oryzae cDNA sequence encoding a polypeptide consisting of the amino acid sequence of SEQ ID NO: 3. In the genomic DNA sequence of SEQ ID NO: 1, base numbers 204 to 323 are introns, and the sequence excluding this region is the base sequence of SEQ ID NO: 2. The DNA of SEQ ID NO: 2 can be obtained from, for example, an Aspergillus oryzae cDNA library by screening by hybridization using a probe designed based on SEQ ID NO: 2. The Neisseria gonorrhoeae cDNA library can be obtained, for example, by adding an adapter such as a NotI site to cDNA synthesized based on Neisseria gonorrhoeae mRNA and inserting it into a phage vector such as lambda gt10.
The DNA consisting of the partial base sequences of (h) and (k) is not limited as long as it encodes a polypeptide having binding activity to N-linked 1 to 3 side chain sugar chains.

In the present invention, a polynucleotide that hybridizes under stringent conditions with DNA consisting of the base sequence of SEQ ID NO: 1 or SEQ ID NO: 2, or DNA consisting of a partial base sequence of SEQ ID NO: 1 or SEQ ID NO: 2, for example, Molecular Cloning : A Laboratory Manual (edited by Sambrook et al., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989).
In the present invention, “stringent” conditions are as follows: 6 × SSC (standard saline citrate; 1 × SSC = 0.15M NaCl, 0.015M sodium citrate), 42% in a solution of 0.5% SDS and 50% formamide. An example of the condition is that it is not desorbed from the polynucleotide when heated at 68 ° C. for 30 minutes in a solution of 0.1 × SSC and 0.5% SDS after heating at ° C. overnight.

A method of obtaining DNA of (i) by modifying the DNA of (g) or (h) by utilizing the similarity of the structure of amino acids, and modifying the DNA of (j) or (k) of (l) The method for obtaining DNA is as described above. In addition, when one amino acid has several translation codons, base substitution within this translation codon is also possible. For example, alanine has four translation codons, GCA, GCC, GCG and GCT, and the third base of the codon can be substituted between ATGCs.
Examples of DNA encoding a polypeptide that hybridizes with the DNA of SEQ ID NO: 1 or SEQ ID NO: 2 under stringent conditions and exhibits a binding activity to N-linked 1-3 glycans include: DNA of other species corresponding to the DNA is included. Such DNA can be selected, for example, by NCBI blast search (www.ncbi.nlm.nih.gov/BLAST/). Specifically, for example, the base sequence of SEQ ID NO: 1 or SEQ ID NO: 2 is subjected to NCBI blast search to search for sequences having higher homology than base sequence databases and EST databases of other species. By selecting a nucleotide sequence having a nucleotide sequence homology of 90% or more selected by the search, for example, a corresponding gene of another corresponding species can be selected.
vector

The vector for expressing the above lectin gene (referring to each of the above DNAs (g) to (l); the same shall apply hereinafter) may be any vector that can function in a usable host. For example, vectors that can function in Aspergillus oryzae, vectors that can function in yeast, and the like can be mentioned. Since the lectin of the present invention is derived from Aspergillus oryzae, if the Aspergillus is used as a host, it becomes self-cloning and does not become a recombinant. Therefore, a vector that can function with Aspergillus is particularly preferable.
In Aspergillus oryzae, a plasmid having autonomous replication ability cannot be maintained in a passage, and therefore a chromosomally integrated plasmid vector is used. In this case, what inserted the promoter, terminator, and selection marker which functions by a gonococcus in general-purpose vectors, such as pUC118, may be used. In particular, it has a high activity promoter derived from Aspergillus oryzae such as sodM (Japanese Patent Laid-Open No. 2001-224181), glaB (Japanese Patent Laid-Open No. 2000-245465, Japanese Patent Laid-Open No. 11-243965), or melO (Japanese Patent Laid-Open No. 2001-46078), Those having a terminator derived from Aspergillus oryzae such as JP 2000-245465, JP 11-243965) are preferred. As a selection marker, niaD (Mol. Gen. Genet., 218, 99-104, (1989)), ptrA (Biosci. Biotechnol. Biochem., 64, 1464-1421, (2000)) and the like can be used.

As vectors that can function in yeast, known vectors such as YIp5 and YEp24 can be used without limitation. In addition, yeast SED1 promoter (Japanese Patent Laid-Open No. 2003-265177), GAPDH promoter (Japanese Patent Publication No. 7-24594), PGK1 promoter (EMBO J. (1982), 1,603-Tuite, M.F. et. And a vector capable of expressing a foreign gene with the ADH1 promoter (Nature (1981), 293, 717-Hitzeman, RA et al.). Examples of terminators that can be used in these vectors include ADH1 (aldehyde dehydrogenase) terminator, GAPDH (glyceraldehyde 3′-phosphate dehydrogenase) terminator, and the like.
Moreover, vectors that can function in insect cells such as AcNPV can also be used.
Host

  The host cell into which the genomic DNA encoding the lectin of the present invention used in the first production method is a eukaryotic cell. For example, fungal cells, insect cells, animal cells, plant cells and the like can be used without limitation. The host cell into which the cDNA encoding the lectin of the present invention used in the second production method described above may be either a eukaryotic cell or a prokaryotic cell. In addition to the above eukaryotic cells, bacterial cells, yeast cells and the like can be used without limitation.

Aspergillus oryzae includes leu-5 (Japanese Patent Laid-Open No. 2006-55090).
As yeast, practical yeasts that are resistant to various culture stresses may be used, and examples include sake yeast “Kyokai Yeast” (Japanese Brewing Association). When an auxotrophic gene is used as a transformation marker, a strain obtained by imparting auxotrophy to these sake yeasts using a technique such as mutation may be used. Such auxotrophs include uracil auxotrophy and tryptophan. Requirement, leucine requirement, histidine requirement, adenine requirement and the like. As an example of adding uracil requirement to sake yeast, we selected “Kyokai No. 9 yeast” as a host, and selected by resistance to 5-fluoroorotidine acid using a mutagenic chemical reagent such as UV, EMS and NTG. Saccharomyces cerevisiae GRI-117-U.
Transformation method

The introduction method (transformation method) of the lectin gene of the present invention into the host is not particularly limited, and transfection methods such as calcium phosphate method, electroporation method, lipofection method, DEAE dextran method, lithium acetate method, protoplast method, etc. A known method such as a microinjection method can be used without limitation.
Transformant culture and lectin recovery

What is necessary is just to culture | cultivate the transformant which introduce | transduced the vector containing the lectin gene of this invention obtained as mentioned above, and collect | recovers lectins from a culture.
When producing lectins in Aspergillus oryzae, the medium for culturing the transformant may be a medium suitable for culturing Aspergillus as a host. For example, potato dextrose medium (Nissui) or Czapek-Dox minimal medium (2% glucose (or starch), 0.3% NaNO ₃ , 0.2% KCl, 0.1% KH ₂ PO ₄ , 0.05% MgSO ₄ , 0.002% FeSO ₄ , pH 6.0) and the like can be used. The medium may be a solid medium or a liquid medium. In addition, what is necessary is just to use the culture medium which added about 1-3% agar when using it as a solid culture medium.

The culture temperature should just be the temperature range which can grow a transformant, for example, about 25-42 degreeC is mentioned. Although the culture time varies depending on other conditions, it may normally be about 2 to 7 days.
In the case of producing lectin in yeast, the medium for culturing the transformant may be a medium suitable for culturing yeast as a host. For example, a YPD medium, an SD medium to which an appropriate selection pressure is applied, and the like can be used.
The culture temperature should just be the temperature range which can grow a transformant, for example, about 15-40 degreeC is mentioned. Although the culture time varies depending on other conditions, it may normally be about 2 to 7 days.

In addition, since the lectin of the present invention accumulates in the cells of koji mold or yeast, it is collected by filter paper, glass filter, etc., and usually frozen by liquid nitrogen and pulverized, or crushed by sea sand B. do it. As another method, a polytron, a homogenizer, or the like can be used for disrupting the cells. The obtained crushed liquid is centrifuged at about 5000 to 12000 g for about 5 to 20 minutes, and the supernatant may be recovered.
Furthermore, the lectin may be purified by subjecting these supernatants to various known chromatographic methods such as ion exchange, hydrophobicity, gel filtration, and affinity.

EXAMPLES Hereinafter, the present invention will be described in more detail with reference to examples and test examples, but the present invention is not limited to these examples.

Acquisition of new lectin genes of Aspergillus oryzae From the analysis of Aspergillus genome database (http://www.bio.nite.go.jp/dogan/MicroTop?GENOME_ID=ao), there are 55 lectin-like genes in Aspergillus genome. However, most of these genes are pseudogenes encoding proteins that do not have lectin activity, and genes that are not expressed even when highly expressed in a high expression system. In addition, since the gene in the genome database does not identify the start codon by obtaining cDNA, the start codon predicted from the nucleotide sequence is often not actually the start codon. Furthermore, even if an attempt is made to obtain cDNA, the expression conditions are unknown and not all cDNA can be obtained. Under such circumstances, we have found from gonococcus a lectin gene that is a gene encoding a protein having lectin activity and is highly expressed.

  The base sequence of genomic DNA encoding the lectin of SEQ ID NO: 3 is shown in SEQ ID NO: 1, and the base sequence of cDNA is shown in SEQ ID NO: 2. In SEQ ID NO: 1, the start codon is base numbers 1 to 3, and the stop codon is base numbers 463 to 465. One intron exists and has base numbers 204 to 323. The deduced amino acid sequence consisting of 114 amino acids encoded by this open reading frame is shown in SEQ ID NO: 3.

Expression of Neisseria gonorrhoeae lectin gene in liquid culture.
<Koji mold host>
Aspergillus oryzae host for transforming the gene is Aspergillus oryzae O-1013 (FERM P-16528, National Institute of Advanced Industrial Science and Technology, Biology Center for Biological Biology, 1-1-1 Tsukuba Center, Tsukuba City, Ibaraki, Japan) Leucine-requiring mutant strain Aspergillus oryzae leu-5 (FERM P-20079 at the National Institute of Advanced Industrial Science and Technology (AIST)) obtained using a known ultraviolet irradiation mutagenesis method Deposited (deposit date: June 7, 2004)) was used.
<Selectable marker plasmid>

As a selectable marker, the gene ANleu2 derived from Aspergillus nidulans encoding β-isopropylmalate dehydrogenase, which can complement the leucine-requiring mutation of the leucine-requiring mutant strain Aspergillus oryzae leu-5, was used. Nleu2 is a gene containing two introns and encodes β-isopropylmalate dehydrogenase consisting of 370 amino acid residues.
SEQ ID NO: 4 shows the base sequence of ANleu2 used for the preparation of the selection marker plasmid. Base numbers 1 to 319 of SEQ ID NO: 4 are promoter regions, base numbers 320 to 1549 are open reading regions, and base numbers 1550 to 3560 are terminator regions. Of the open reading regions from base numbers 320 to 1549 of SEQ ID NO: 4, two introns are base numbers 795 to 851 and base numbers 1273 to 1332.
This ANleu2 was amplified by PCR using LA-Taq (Takara Bio) using Aspergillus nidulans genomic DNA as a template. As PCR primers, primers (5'-TGCCAGTTTTACCAGCTTGACC-3 ': SEQ ID NO: 5) and primers (5'-
CTTTCATGTCATGTCCCTAGAAG-3 ′: SEQ ID NO: 6) was used.

<PCR conditions>
・ 96 ℃ (5 minutes), 1 cycle ・ 96 ℃ (20 seconds), 60 ℃ (30 seconds), 72 ℃ (5 minutes), 30 cycles ・ 72 ℃ (7 minutes), 1 cycle Results of PCR under the above conditions The ANleu2 gene was amplified. The obtained PCR amplification product was extracted with phenol-chloroform, followed by ethanol precipitation. The obtained amplification product was excised by agarose gel electrophoresis and extracted with QIAquick Gel Extraction kit (QIAGEN). The excised ANleu2 gene fragment has an adenine removed from the end of the amplified product of LA-Taq, and transferred to the T vector pGEM-T (Promega) at 4 ° C using T4 DNA ligase (Promega). Ligation was performed by time treatment. Thereafter, the ligation solution was transformed into E. coli JM109 competent cells (Takara Bio). Transformants were isolated as white colonies using LB medium supplemented with ampicillin, IPTG and X-gal. A plasmid was prepared from the transformant according to a conventional method. The plasmid into which ANleu2 was subcloned was named pANLA.
<Construction of lectin gene expression plasmid>

An attempt was made to express the lectin gene described in SEQ ID NO: 2 under the control of the sodM promoter that strongly expresses the gene in liquid culture of Aspergillus oryzae. The base sequence of the sodM promoter is shown in SEQ ID NO: 7. The glaB terminator shown in SEQ ID NO: 8 was used.
Specifically, PCR was first performed to prepare a lectin gene expression plasmid. As a first PCR reaction, aspergillus genomic DNA was used as a template, sodM promoter was primer (5'-ttatgtactc cgtactcggt tgaattatta-3 ': SEQ ID NO: 9) and primer (5'-
ttaccaagagtgttgggcattttgggtggtttggttggtattctggtt -3 ': SEQ ID NO: 10) was amplified by LA-PCR (Takara Bio).
-3 ′: SEQ ID NO: 11) and primer (5′-acacgcactggaaagtacattcagtgaccggtgttgctggcccagagaggcgtgc -3 ′
: SEQ ID NO: 12) is amplified by LA-PCR (Takara Bio), and glaB terminator is primer (5'-
ctgggccagcaacaccggtcactgaatgtactttccagtgcgtgtagtctactctgacctc-3 ': SEQ ID NO: 13) and primer (5'-
It was amplified by LA-PCR (Takara Bio) using gcgaacagagctataccttcacataccttctggacgaa-3 ': SEQ ID NO: 14).
<PCR conditions>
・ 96 ℃ (5 minutes), 1 cycle ・ 96 ℃ (20 seconds), 60 ℃ (30 seconds), 72 ℃ (5 minutes), 30 cycles ・ 72 ℃ (7 minutes), 1 cycle

Each amplification product was separated by agarose gel electrophoresis, and gel extraction was performed. These three gene fragments were mixed and the second PCR was performed. Primer is (5'-
ttatgtactc cgtactcggt tgaattatta-3 ': SEQ ID NO: 15) and primer (5'-gcgaacagagctataccttcacataccttctggacgaa
-3 ′: SEQ ID NO: 16), each amplified alone by LA-PCR (Takara Bio).
<PCR conditions>
・ 96 ℃ (5 minutes), 1 cycle ・ 96 ℃ (20 seconds), 68 ℃ (5 minutes), 30 cycles ・ 72 ℃ (7 minutes), 1 cycle

As a result, a single correct genomic gene product was amplified. The obtained PCR amplification product was excised by agarose gel electrophoresis and extracted with QIAquick Gel Extraction kit (QIAGEN). This PCR product had an adenine protruding at the end, and was ligated to TGE vector pGEM-T (Promega) by treatment with T4 DNA ligase (Promega) for 20 hours at 4 ° C. Thereafter, the ligation solution was transformed into E. coli JM109 competent cells (Takara Bio). Transformants were isolated as white colonies using LB medium supplemented with ampicillin, IPTG and X-gal. A plasmid obtained by subcloning the above fusion gene into the pGEM-T vector was designated as pML1.
<Transformation of Neisseria gonorrhoeae with lectin gene high expression plasmid pML1>

Aspergillus oryzae leu-5 was transformed with pML1 and pANLA by co-transformation by the protoplast-PEG-calcium method. Control is Aspergillus oryzae
leu-5 was transformed with pANLA.
Specifically, the protoplast-PEG-calcium method (Mol. Gen. Genet., 218, which is a conventional method) was used as a method for cotransformation of Aspergillus oryzae leu-5 with Aspergillus oryzae leu-5 using pML1 and pANLA. 99-104, (1989)). Protoplasts were collected from Aspergillus oryzae leu-5 in GPY (2% glucose, 1% polypeptone, 0.5% yeast extract) at 30 ° C for 1 day using a glass filter 3G1, and a protoplast solution containing 0.8M NaCl (5mg / ml yatalase (Takara Bio), 5 mg / ml cellulase (including Wako Pure Chemicals), and 5 mg / ml lysing enzyme (sigma)) at 30 ° C. for 3 hours.

The filtrate filtered through the glass filter 3G2 was used as a protoplast solution in the protoplast-PEG-calcium method, which is a conventional method. In the addition step of a plasmid in the protoplast-PEG-calcium method, which is the usual method, a plasmid containing a selectable marker and an arbitrary plasmid not containing the selectable marker are added at an arbitrary ratio, thereby adding a minimal medium. It is possible to perform a conventional cotransformation in which both plasmid fragments can be inserted into the chromosome of the transformant selected in (1). Here, the lectin expression plasmid pML1 and the selection marker plasmid pANLA were used.
As a selective medium for transformants, Czapek-Dox minimal medium (glucose 3%, magnesium sulfate 0.1%, dipotassium hydrogen phosphate 0.1%, potassium chloride 0.05%, sodium nitrate 0.3%, iron sulfate 0.00001M, 0.8M NaCl 1.5% agar, pH 6.3) was used. After culturing at 30 ° C. for 7 days, a plurality of transformants were obtained.
Three strains having lectin productivity were selected from a plurality of transformants, genomic DNA was extracted, and insertion of the gene into the genome was confirmed by PCR.

Liquid culture of transformants and product confirmation
40ml Czapek-Dox liquid medium (glucose 3%, magnesium sulfate 0.1%, dipotassium hydrogen phosphate 0.1%, potassium chloride 0.05%, respectively, transformant with pML1 and pANLA and control with pANLA alone After culturing with sodium nitrate 0.3%, iron sulfate 0.00001M, pH 6.3) at 30 ° C. for 3 days, the cells were collected with a glass filter. The obtained bacterial cells were crushed with liquid nitrogen, extracted with PBS buffer (100 mM sodium phosphate pH 7.2, containing 0.9% sodium chloride), centrifuged, and the supernatant was collected.
This is subjected to SDS-PAGE and the result of Coomassie staining is shown in FIG. 2. From FIG. 2, it was revealed that the transformant extract with pML1 and pANLA expressed a protein that was not found in the transformant with only pANLA as a control at the position of a molecular weight of about 12 kDa.

Lectin activity of transformant extracts
Extract of transformant with 25 μL of 2% rabbit erythrocyte solution and pML1 and pANLA, or extract of transformant with pANLA alone (each diluted 2 times stepwise with PBS buffer from a protein concentration of 1 μg / μL, respectively) ) 25 μL was mixed and left at room temperature for 30 minutes. A photograph of the mixture is shown in FIG. As a result of FIG. 3 (A), an agglutination reaction was observed only when the extract of the cotransformant by pML1 and pANLA was used. From this, it was shown that the product of the gene described in SEQ ID NO: 2 has lectin activity.

  In addition, the affinity of this lectin for α-methyl mannoside was examined. That is, 25 μL of a 2% rabbit erythrocyte solution, 25 μL of a solution obtained by diluting a transformant extract of pML1 and pANLA with water to a protein concentration of 1 μg / μL, and α-methyl-D-mannoside (final concentration 0) .5M to 2 times dilution stepwise) was allowed to stand at room temperature for 30 minutes. A photograph of the mixture is shown in FIG. No inhibition of hemagglutination was observed with α-methyl-D-mannoside. This shows that this lectin does not have the ability to adsorb to α-methyl mannoside.

Production of lectin by transformant The lectin was isolated from the transformant culture obtained in Example 3 as follows. That is, the transformant showing lectin activity was added to Czapek-Dox medium (0.3% NaNO ₃ , 0.2% KCl, 0.1% KH ₂ PO ₄ , 0.05% MgSO ₄ · 7H ₂ O, 0.002% FeSO ₄ · 7H ₂ O, 3% glucose, pH 6.0) was used as a basic medium, and yeast nitrogen base (manufactured by Difco) as an additional nitrogen source was added to a final concentration of 0.5%, and cultured at 30 ° C. for 5 days. . The mycelium was collected and ground with sea sand in 20 mM acetate buffer (pH 5.0) containing 1.0 mM PMSF to obtain a cell extract. The homogenate was centrifuged at 10,000 × g for 10 minutes, and the supernatant was separated. A crude protein solution containing 23.4 mg per 30 ml medium, ie, 780 mg crude protein per 1000 ml medium was obtained.

Purification of lectin The crude protein solution obtained in Example 5 was applied to a Resource Q column (1.6 cm x 3 cm) (Amersham Bioscience) equilibrated with 50 mM potassium phosphate buffer (pH 7.0). B. gonococcus lectin (AOSL) was eluted with a linear gradient of 0-500 mM sodium chloride in 50 mM potassium phosphate buffer (pH 7.0). The peak fraction of hemagglutination activity was collected.
The active fraction was dialyzed overnight against 20 mM acetate buffer (pH 5.0) and concentrated, and this was used as purified AOSL (Aspergillus oryzae small lectin). Table 1 summarizes the liquid volume, protein concentration, protein amount, aggregation concentration, aggregation specific activity, and total activity of the crude protein obtained in Example 5 and the purified protein obtained here.

The specific agglutination activity in Table 1 was calculated from the minimum aggregation concentration with the lectin activity having a minimum aggregation amount of 100 μg / ml as 1 U / mg.
Moreover, as shown in FIG. 4, purified AOSL gave a single band in SDS-PAGE. The molecular weight of AOSL obtained by SDS-PAGE was 12,000.

  Further, the hemagglutination activity of this lectin was compared with a fucose-specific lectin (Japanese Patent Laid-Open No. 2002-112786) which is the same gonococcal lectin. That is, 25 μl of a 2% rabbit erythrocyte solution and an aqueous solution of each lectin (this lectin is diluted stepwise with water from a protein concentration of 75 μg / ml, and a fucose-specific lectin is gradually increased from a protein concentration of 500 μg / ml). (Liquid diluted twice with water) was mixed with 25 μL and allowed to stand at room temperature for 30 minutes. A photograph of the mixture is shown in FIG. This lectin has an erythrocyte minimum aggregation concentration activity of 0.6 μg / ml, and has an aggregation activity higher than the minimum aggregation concentration of Neisseria fucose-specific lectin of 2.0 to 15.6 μg / ml (average of about 3.9 μg / ml). Was.

Stability of lectin against freezing and thawing The stability of the lectin was confirmed. That is, the cell extract supernatant (2.5 mg / ml, 600 μl, erythrocyte minimum aggregation concentration activity 0.6 [μg / ml]) obtained in Example 5 was frozen at −20 ° C. One day later, the sample was melted at room temperature of 20 ° C., and 100 μl each was sampled. Immediately after sampling, the sample was frozen at -20 ° C. In this way, freezing and thawing for one day were repeated 5 times, and the remaining erythrocyte agglutination concentration activity of the 100 μl solution sampled every time of thawing was measured to determine the lectin activity. In addition, the erythrocyte minimum agglutination concentration activity of a sample stored at 20 ° C. for 5 days without freezing and a sample stored refrigerated (4 ° C.) for 5 days was also measured. The method for measuring the erythrocyte minimum aggregation concentration activity is the same as in Example 6.

  The results are shown in FIG. In FIG. 6, the horizontal axis indicates the number of storage days, and the vertical axis indicates the ratio of the erythrocyte minimum aggregation concentration activity of each sample to the erythrocyte minimum aggregation concentration activity 0.6 [μg / ml] of the cell extract supernatant at the start of storage. It can be seen that this lectin is extremely stable against freezing and thawing.

PH stability of lectin 90 μl of the purified enzyme obtained in Example 6 (protein concentration 541 μg / ml) and 1 M of each buffer (glycine-hydrochloric acid pH 2.1, the same pH 2.7, citric acid-sodium hydroxide pH 4.6, acetic acid- 10 μl of sodium acetate pH 5.0, sodium phosphate pH 6.2, sodium phosphate pH 7.0, tris-hydrochloric acid pH 8.1, boric acid-sodium carbonate pH 9.2, pH 10.3, pH 11.2) The total volume was 100 μl and incubated at room temperature (25 ° C.) for 30 minutes.
After incubation, each was diluted 10-fold by adding 900 μl of PBS buffer, and then hemagglutination activity was measured. The method for measuring the hemagglutination activity is the same as in Example 6.
The results are shown in FIG. FIG. 7 shows that the koji mold lectin is most stable at pH 5.0 and stably active at pH 4.6 to 9.0.

Analysis of bound sugar chain by frontal affinity chromatography (FAC) A lectin affinity column on which this lectin was immobilized was prepared as follows. That is, the purified enzyme obtained in Example 6 was dissolved in 10 mM phosphate buffer (pH 7.4, containing 0.8% NaCl), and immobilized according to the instruction manual of NHS-activated Sepharose gel (Amersham Bioscience). . The concentration immobilized on the gel was 2.9 mg / ml. After washing with the same buffer and blocking NHS groups by treating excess NHS with 1M monoethanolamine, the lectin-Sepharose gel was dissolved in 10 mM Tris-HCl buffer (pH 7.4, containing 0.8% NaCl). . The slurry was packed into a capsule-type minicolumn (inner diameter, 2 mm; length, 10 mm; bed volume, 31.4 μL) and attached to an automated FAC apparatus FAC-1 (Shimadzu Corporation) as a lectin column. Using an automated FAC apparatus equipped with an immobilized lectin column, the binding specificity of this lectin to 49 types of pyridylamino (PA) sugar chains (manufactured by Takara Bio Inc.) was analyzed. That is, the mobile phase was 10 mM Tris-HCl buffer (pH 7.4, containing 0.8% NaCl), and the lectin column was equilibrated with this buffer. Each PA sugar chain (Takara Bio) 2.5 to 5.0 nM, 300 μL is injected into the column at a flow rate of 0.125 ml / min at 25 ° C, and the elution position (time) is detected by fluorescence (excitation 310 nm, detection 380 nm) Thus, the bound sugar chain was quantified from the elution delay.

The results of the binding sugar chain analysis for these 49 sugar chains are shown in FIG. The structure of the sugar chain of each chromatogram in FIG. 8 is shown in FIGS.
Large elution delays were observed for sugar chains 5, 6, 8, and 9, and small elution delays were observed for sugar chains 12, 13, 2, and 10. Thus, this lectin is a lectin that binds to N-linked sugar chains, of which only weakly binds to high-mannose sugar chains and shows binding to complex sugar chains. Among complex-type sugar chains, 1 to 3 side chain sugar chains bind extremely strongly with or without galactose, but the binding decreases as the number of side chains increases, and 4 side chain sugar chains No longer combined. There was no effect of core fucose, which is a sugar addition near the reducing end. On the other hand, the binding strength decreased with the addition of 2,6 sialic acid.

Concentration of 4-chain sugar chains using this lectin column 46 (standard sugar chains STD: chitotriose), 5 (single chain), 9 (double-stranded) of the above-mentioned PA sugar chains (manufactured by Takara Bio Inc.) , 13 (3 strands) and 15 (4 strands) diluted with 10 mM Tris-HCl buffer (pH 7.4, containing 0.8% NaCl) were prepared in 50 μl aliquots. The standard sugar chain was diluted with the above buffer so that the other sugar chain was 10 pmol. These sugar chains are all N-linked complex sugar chains having a trimannosyl core structure and fucosylated to a reducing terminal GlcNAc, and the number of side chains bonded to the trimannosyl core is different from each other.
Each of these was divided into 25 μL halves, one of which was applied to an AOSL lectin column in the same manner as in Example 9, stored overnight at 4 ° C., and then eluted with the same Tris-HCl buffer as in Example 9. Each sugar chain was quantified by HPLC analysis and detection by fluorescence (excitation 310 nm, detection 380 nm). The other was used as a control and quantified by HPLC in the same manner without applying to the lectin column.

The reverse phase chromatographic analysis conditions by HPLC are as follows. Using PALPAK Type R (manufactured by Takara Bio Inc.) as a column, at a temperature of 40 ° C., 100 mM acetic acid-triethylamine buffer (pH 4.0) as solvent A, and a solution containing 0.5% 1-butyl alcohol in solution A as solution B The concentration gradient of solution B was increased so that the ratio of solution B was 5% to 100% in 0 → 100 minutes at a flow rate of 1 ml / min.
The results are shown in FIG. In the graph of FIG. 15, the vertical axis represents the ratio of the HPLC elution pattern area of each sugar chain when the area of the HPLC elution pattern of the standard sugar chain is 100%. As a result, it was found that this lectin binds to N-linked type 1-3 side chain sugar chains and does not bind at all to four side chain sugar chains. This shows that N-linked 1-3 side chain sugar chains and 4 side chain sugar chains can be separated by using a column to which the lectin of the present invention is immobilized.

It is a figure which shows the classification | category of N-linked sugar chain. It is a figure which shows the result of SDS-PAGE of the cell extract of the transformant by the lectin gene of this invention. Fig. (A) shows the agglutination activity of rabbit erythrocytes by the transformant introduced with the lectin gene of the present invention, and Fig. (B) shows that this agglutination activity is not inhibited by α-methyl-D-mannoside. . It is a figure which shows the result of SDS-PAGE of the purified lectin of this invention. It is the figure which compared the rabbit hemagglutination activity between the lectin of this invention and the koji mold fucose lectin. It is a figure which shows the stability with respect to the freeze thawing of the lectin of this invention. It is a figure which shows the stability with respect to pH of the lectin of this invention. It is a figure which shows the result of having investigated the affinity with respect to various sugar chains of the lectin of this invention by the frontal affinity chromatography. It is a figure which shows the structure of the sugar chain used for the frontal affinity chromatography of FIG. It is a figure which shows the structure of the sugar chain used for the frontal affinity chromatography of FIG. It is a figure which shows the structure of the sugar chain used for the frontal affinity chromatography of FIG. It is a figure which shows the structure of the sugar chain used for the frontal affinity chromatography of FIG. It is a figure which shows the structure of the sugar chain used for the frontal affinity chromatography of FIG. It is a figure which shows the structure of the sugar chain used for the frontal affinity chromatography of FIG. It is a figure which shows that the column which fix | immobilized the lectin of this invention can couple | bond N-linked type 1-3 side chain sugar chains.

Claims (7)

A lectin that binds to N-linked 1 to 3 side chain sugar chains, comprising the following polypeptide (a), (b), or (c):
(a) a polypeptide comprising the amino acid sequence of SEQ ID NO: 3
(b) a polypeptide comprising the partial amino acid sequence of SEQ ID NO: 3 and having binding activity to N-linked 1 to 3 side chain sugar chains
(c) the amino acid sequence of SEQ ID NO: 3 or a partial amino acid sequence thereof, consisting of an amino acid sequence in which one to several amino acids are added, deleted, or substituted, and N-linked 1-3 side chain sugar chains Polypeptide having binding activity to An N-linked 1-3 side chain sugar chain adsorption or binding agent comprising the following lectin (d), (e), or (f):
(d) a lectin consisting of the amino acid sequence of SEQ ID NO: 3
(e) a lectin consisting of a partial amino acid sequence of SEQ ID NO: 3 and having binding activity to N-linked 1 to 3 side chain sugar chains
(f) an amino acid sequence of SEQ ID NO: 3 or a partial amino acid sequence thereof in which one to several amino acids are added, deleted, or substituted, and an N-linked 1-3 side chain sugar chain Lectins that have binding activity A step of bringing a test sample containing a sugar chain into contact with the following lectin (d), (e), or (f) to adsorb or bind N-linked 1-3 side chain sugar chains to the lectin. And a step of separating a complex formed by adsorption or binding of an N-linked 1-3 side chain sugar chain and a lectin, and a method for separating the N-linked 1-3 side chain sugar chain.
(d) a lectin consisting of the amino acid sequence of SEQ ID NO: 3
(e) a lectin consisting of a partial amino acid sequence of SEQ ID NO: 3 and having binding activity to N-linked 1 to 3 side chain sugar chains
(f) an amino acid sequence of SEQ ID NO: 3 or a partial amino acid sequence thereof in which one to several amino acids are added, deleted, or substituted, and an N-linked 1-3 side chain sugar chain Lectins that have binding activity A test sample containing glycoproteins or cells is brought into contact with the following lectins (d), (e), or (f) to adsorb or bind N-linked 1-3 side chain sugar chains to the lectins. A step of removing a complex due to adsorption or binding of N-linked 1-3 side chain sugar chains and lectin from the test sample, and an N-linked type in the test sample from which the complex has been removed Detecting a sugar chain having four or more side chains.
(d) a lectin consisting of the amino acid sequence of SEQ ID NO: 3
(e) a lectin consisting of a partial amino acid sequence of SEQ ID NO: 3 and having binding activity to N-linked 1 to 3 side chain sugar chains
(f) an amino acid sequence of SEQ ID NO: 3 or a partial amino acid sequence thereof in which one to several amino acids are added, deleted, or substituted, and an N-linked 1-3 side chain sugar chain Lectins that have binding activity A step of bringing a test sample containing a sugar chain into contact with the following lectin (d), (e), or (f); and adsorption or binding between the lectin and an N-linked 1-3 side chain sugar chain A method for detecting N-linked 1-3 side chain sugar chains, comprising a step of detecting a complex by
(d) a lectin consisting of the amino acid sequence of SEQ ID NO: 3
(e) a lectin consisting of a partial amino acid sequence of SEQ ID NO: 3 and having binding activity to N-linked 1 to 3 side chain sugar chains
(f) an amino acid sequence of SEQ ID NO: 3 or a partial amino acid sequence thereof in which one to several amino acids are added, deleted, or substituted, and an N-linked 1-3 side chain sugar chain Lectins that have binding activity A step of culturing a transformant in which a vector capable of expressing the following DNA (g), (h), or (i) is introduced into a eukaryotic cell; A method for producing a lectin that binds to an N-linked 1-3 side chain sugar chain, comprising a step of recovering the lectin that binds to the three side chain sugar chains.
(g) DNA consisting of the base sequence of SEQ ID NO: 1
(h) DNA encoding a polypeptide consisting of a partial base sequence of SEQ ID NO: 1 and having binding activity to N-linked 1-3 side chain sugar chains
(i) encodes a polypeptide that hybridizes with a DNA comprising the nucleotide sequence of SEQ ID NO: 1 or a partial nucleotide sequence thereof under stringent conditions and binds to N-linked 1-3 side chain sugar chains DNA A step of culturing a transformant introduced with a vector capable of expressing the following DNA of (j), (k), or (l), and N-linked 1-3 side chains from the culture: A method for producing a lectin that binds to N-linked 1-3 side chain sugar chains, comprising a step of recovering a lectin that binds to a sugar chain.
(j) DNA consisting of the base sequence of SEQ ID NO: 2
(k) DNA encoding a polypeptide consisting of a partial base sequence of SEQ ID NO: 2 and having binding activity to N-linked 1-3 side chain sugar chains
(l) encodes a polypeptide that hybridizes with a DNA comprising the nucleotide sequence of SEQ ID NO: 2 or a partial nucleotide sequence thereof under stringent conditions and binds to N-linked 1-3 side chain sugar chains DNA