JP2008086201A - Method for detecting production of micro-rna and diagnosis/treatment of cancer, and micro-rna production adjusting agent - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a method for detecting the production of a micro-RNA (miRNA), by which the production of the micro-RNA (miRNA) can be detected accurately and simply, to provide a method for diagnosing/treating a disease relating to the increase or decrease of micro-RNA-143 and 145, and to provide a micro-RNA production-adjusting agent for adjusting the production of the micro-RNA that is useful for the treatment. <P>SOLUTION: This method for detecting the production of the micro-RNA detects the production of the micro-RNA, with a vector produced by making a micro-RNA-bound site downstream of a luciferase gene and with a recombinant cell transduced with the vector. When the micro-RNA is bound to the micro-RNA-bound site, translation of the luciferase gene is inhibited, and the expression amount of the luciferase is increased or decreased depending on the amount of the micro-RNA produced. The amount of micro-RNA can be measured by measuring the fluorescence intensity. <P>COPYRIGHT: (C)2008,JPO&INPIT

Description

  The present invention relates to a method for detecting short RNA, particularly microRNA (miRNA), a cancer diagnosis / treatment method, and a microRNA production regulator containing mangosteen having a microRNA production regulation action.

  It has been found that short RNAs exist widely from plants to animal cells, and that they play an important role for living organisms, not just the transcribed short RNAs of transcribed RNA. In Patent Document 1, RNA interference using small nucleic acid molecules such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), microRNA (miRNA), and short hairpin RNA (shRNA) molecules. Regulation of interleukin family gene expression by (RNAi) is disclosed.

  In Patent Document 2, miRNA suppresses translation in an intervening sequence-specific manner during translation of mRNA and regulates the generation timing. Further, it is disclosed that siRNA is double-stranded while miRNA is single-stranded. Furthermore, it can be used as a modulator or target for developmental processes and diseases such as cancer. For example, miRNA-15 and miRNA16 probably function as tumor-suppressors, so introduction of these RNAs or analogs or precursors thereof into tumor cells is particularly useful for leukemias, such as B-cell chronic lymphocytic leukemia. It is disclosed that a therapeutic effect can be provided.

  Patent Document 3 discloses that γ-mangostin has an excellent radical scavenging action and is useful as an antioxidant.

  Patent Document 4 discloses an antiallergic agent containing α-mangosteen and γ-mangosteen.

  Patent Document 5 discloses an antibacterial deodorant characterized by containing 0.001 to 70% by weight of a precipitate obtained by evaporating mangosteen peel with a water-containing organic solvent and then distilling off the organic solvent.

  As described above, microRNA (miRNA) functions as an interleukin family gene expression and functions as a tumor-suppressor, and microRNAs are involved in gene expression control, as well as important functional RNA molecules involved in cell differentiation and proliferation. Therefore, increase or decrease of microRNA is considered to cause a serious disease. Since microRNA has an important role in cell maintenance and proliferation, factors that regulate microRNA production are expected to be useful as a wide range of therapeutic agents.

On the other hand, mangosteen peel extract, or α-mangostin and γ-mangosteen purified from them are known to have various pharmacological actions as described above. However, it is not yet known that mangosteen has a microRNA (miRNA) production regulating action.
JP 2005-524393 A "RNA interference-mediated inhibition of interleukin gene expression using short interfering nucleic acids (siRNA)" Japanese Patent Publication No. 2005-503827 “MicroRNA molecule” JP 08-225783 “Natural antioxidant containing γ-mangostin as an active ingredient” JP-A-10-72357 “Antiallergic Agent” JP 2003-231607 A “Mangosteen extract and antibacterial agent containing the same”

  The present invention provides a method that can accurately and easily detect the production of microRNA (miRNA). Also provided are microRNA production regulators that regulate the diagnosis and treatment of diseases related to the increase or decrease of microRNA-143 and 145, and the production of microRNA useful for treatment.

As a result of diligent research on how to detect microRNA accurately and easily, detection of microRNA production using a vector in which a microRNA binding site is created downstream of a luciferase gene and a recombinant cell into which the vector has been introduced is detected. The detection method of microRNA was completed. Translation of the luciferase gene is suppressed when the generated microRNA binds to the microRNA binding site introduced downstream of the luciferase gene. Since the expression level of luciferase increases or decreases depending on the amount of microRNA produced, the amount of microRNA can be accurately and easily measured by measuring the fluorescence intensity by luciferase. The production of microRNA (miR-143) is detected using an expression vector characterized by introducing a miR-143 binding site downstream of luciferase and a recombinant cell into which the miR-143 binding site has been introduced. This is a method for detecting RNA. By introducing a miR-143 binding site downstream of luciferase, the amount of miR-143 produced can be specifically measured. Here, the sequence of miR-143 is UGAGAUGAAGCACUGUAGCUCA, which is a known sequence.

  Furthermore, this invention detects the production | generation of microRNA (miR-145) using the expression vector which created the miR-145 binding site downstream of luciferase, and the genetically modified cell which introduce | transduced it. It is a detection method of microRNA. By introducing a miR-145 binding site downstream of luciferase, the amount of miR-145 produced can be specifically measured.

  Here, the sequence of miR-145 is GUCCAGUUUUCCCAGGAAUCCCUU, which is a known sequence.

  Furthermore, the present invention provides a method for diagnosing cancer in which microRNA-143 or 145 is detected by the method according to any one of claims 1 to 3 to distinguish cancer cells from normal cells. By detecting microRNA, cancer cells and normal cells can be distinguished. That is, the expression of miR-143 or miR-145 was specifically decreased in colorectal cancer, hematopoietic tumors, particularly lymphoid tumors, compared with normal tissues. Since many other cancer cells also show decreased miR-143 or miR-145 expression, these microRNAs were found to be useful as biomarkers that distinguish cancer cells from normal cells. Moreover, since the reduction | decrease of the expression of miR-143 or miR-145 is related with the growth of cancer, it is possible to suppress the growth of cancer cells by introducing them into cancer cells.

  Furthermore, by using the microRNA detection method according to any one of claims 1 to 3, by measuring the fluorescence intensity of luciferase expression, the amount of microRNA produced is measured and the microRNA is detected against cancer cells. -Search for substances that increase 143 or 145.

  The present invention is also a microRNA production regulator characterized by containing mangosteen. We have found that mangosteen regulates the production of microRNA. MicroRNAs are important functional RNA molecules involved in gene expression control and cell differentiation and proliferation, and increase or decrease in microRNAs may cause serious diseases. Mangosteen, which regulates microRNA production, plays an important role in the maintenance and proliferation of living organisms. As a microRNA regulator, mangosteen normalizes abnormal cells or induces apoptosis (cell necrosis), lymphokine Expected to be a wide range of therapeutic agents related to cell growth such as metabolic regulators.

  The microRNA production regulator according to claim 4, wherein the microRNA is miR-143. Mangosteen that regulates miR-143 production of microRNA is expected as a broad therapeutic agent related to the amount of miR-143 produced.

  The microRNA production regulator according to claim 4, wherein the microRNA is miR-145. Mangosteen that regulates miR-145 production of microRNAs is expected as a broad therapeutic agent related to the amount of miR-145 produced.

  The present invention also includes compositions prepared for storage or administration that include a pharmaceutically effective amount of mangosteen in a pharmaceutically acceptable carrier or diluent. Acceptable carriers or diluents for use in therapeutic applications are well known in the pharmaceutical art and include, for example, preservatives, stabilizers, colorants, lubricants, and flavoring agents. These include sodium benzoate, sorbic acid, and esters of p-hydroxybenzoic acid. In addition, antioxidants and suspending agents may be used.

  A pharmaceutically effective dose is the volume necessary to prevent, inhibit, or treat a disease state (alleviate symptoms to some extent, preferably alleviate all symptoms). The pharmaceutically effective dose depends on the type of disease, the composition used, the route of administration, the type of mammal being treated, the physical properties of the particular mammal under consideration, the drugs being administered simultaneously, and the pharmaceutical field It depends on other factors that those skilled in the art will recognize. For example, 0.1 mg / kg to 100 mg / kg body weight / day of active ingredient is administered.

  The mangosteen of the present invention and its formulations are orally, topically, parenterally, inhaled or sprayed in a volume unit formulation containing conventional non-toxic pharmaceutically acceptable carriers, adjuvants and vehicles. Or can be administered rectally. As used herein, the term parenteral includes transdermal, subcutaneous, intravascular (eg, intravenous), intramuscular, or intrathecal injection or infusion techniques. Further provided is a pharmaceutical formulation comprising the mangosteen of the present invention and a pharmaceutically acceptable carrier. One or more of the mangosteen of the present invention is present with one or more non-toxic pharmaceutically acceptable carriers and / or diluents, and / or adjuvants, and other active ingredients as desired. be able to. The pharmaceutical composition containing the mangosteen of the present invention is in a form suitable for oral use, such as tablets, troches, lozenges, aqueous or oily suspensions, dispersible powders or granules, emulsions, hard capsules or soft It can be in the form of a capsule or syrup or elixir.

  Compositions intended for oral use can be prepared according to any method known in the art for the manufacture of pharmaceutical compositions, and such compositions can be prepared using a pharmaceutically sophisticated mouthpiece. One or more of such sweeteners, fragrances, colorants or preservatives may be included to provide a product suitable for Tablets contain the active ingredient in admixture with non-toxic pharmaceutically acceptable excipients that are suitable for the manufacture of tablets. These excipients include, for example, inert diluents such as calcium carbonate, sodium carbonate, lactose, calcium phosphate or sodium phosphate; granulating and disintegrating agents such as corn starch, or alginic acid; binders such as starch, It can be gelatin or gum arabic and lubricants such as magnesium stearate, stearic acid or talc. The tablet may not be coated, and may be coated by a known method. In some cases, such coatings can be prepared by known techniques to delay disintegration and absorption in the gastrointestinal tract, thereby providing a longer duration of action. For example, a time delay material such as glycerol monostearate or glycerol distearate can be employed.

  Formulations for oral use include hard gelatin capsules in which the active ingredient is mixed with an inert solid diluent such as calcium carbonate, calcium phosphate or kaolin, or the active ingredient is water or an oily medium such as peanut oil, liquid paraffin Or it may be a soft gelatin capsule mixed with olive oil.

  By using an expression vector with a microRNA binding site downstream of luciferase and a genetically engineered cell into which the vector is introduced, the reaction product of luciferase is measured by the fluorescence method to easily detect the amount of microRNA produced. be able to.

  Among hematopoietic tumors, it can be used as a diagnostic marker for lymphoid tumors (acute lymphoblastic leukemia, chronic lymphocytic leukemia, B cell lymphoma, T cell lymphoma, T cell leukemia). Chronic lymphocytic leukemia and B-cell lymphoma are particularly useful diagnostic markers. In lymphoid tumors, cell proliferation can be suppressed by introducing precursors of miR-143 and miR-145. In other words, the possibility of gene therapy is suggested.

  By administering a preparation containing mangosteen, the production of microRNA can be adjusted to treat diseases involving microRNA. Moreover, by using together with another therapeutic agent, the therapeutic effect of the combined drug can be increased.

  Examples of the method for carrying out the present invention will be described below, but the present invention is not limited to the following examples.

Preparation of genetically modified cells (introduction of luciferase gene and microRNA binding site)
As shown in FIG. 1, the recombinant cell was prepared by purchasing a pGL3 luciferase expression vector from Promega (code NO. E1741) and binding miR-143 or miR-145 synthesized on the 3 ′ side of this luciferase gene. The site was double-stranded by kinase and annealing, and then introduced by ligation. The vector was then transfected into E. coli and mass cultured to prepare the vector according to conventional methods.

  When the intracellular concentration of miR-143 or miR-145 increases by using the luciferase expression vector prepared as described above, these miRNAs are attached to the binding site of the 3 ′ microRNA introduced downstream of the luciferase gene. In combination, translation of the luciferase gene is suppressed. This suppression of luciferase gene translation depends on the intracellular concentration of miR-143 or miR-145. Therefore, the intracellular concentration of miR-143 or miR-145 can be detected by detecting the fluorescence intensity generated by the reaction of luciferase.

Detection of microRNA Total RNA was extracted from cells by the phenol / guanidine thiocyanate method. Next, using MirVana ™ qRT-PCR miRNA detection kit (Ambion) and mirVana ™ qRT-PCR primer set (Ambion), the DNA was first denatured at 95 ° C for 3 minutes, followed by PCR ( Their expression levels were examined by 95 ° C., 15 seconds, 60 ° C., 30 seconds, 22 cycles). That is, 50 mg of extracted RNA was converted to cDNA by reverse transcriptase, and their expression levels were examined by PCR using miR-143 and miR-145 primers (purchased from Ambion).

Human cancer cells consist of 2 mM L-glutamine, 10% heat inactivated FBS (Sigma, St.
In RPMI-1640 medium containing Louis, Mo, USA), the cells were cultured at 37 ° C. in an atmosphere of 95% air and 5% carbon dioxide gas. The number of viable cells was measured by trypan blue staining.

  FIG. 2 shows the results of examining the expression of miR-143 and miR-145 in the tumor part of a colon cancer patient and the normal tissue of the patient. As a result, in the tumor part, both miR-143 and miR-145 were specifically decreased in colorectal cancer (5 of 6 cases).

  FIG. 3 shows the results of examining the expression of miR-143 and miR-145 for all normal human tissues and cancer cell lines derived from the tissues. Although normal tissues were sufficiently expressed (upper), the expression of miR-143 or miR-145 was decreased in all cell lines of cancer cell lines (lower). U6 was used as an internal standard. This result shows that miR-143 or miR-145 expression is decreased not only in colorectal cancer but also in many other cancer cells, and detection of microRNA is a biomarker that can distinguish cancer cells from normal cells. It turned out to be useful.

  In FIG. 4, miR-143 or miR-145 precursor microRNA was introduced into colon cancer cell line DLD-1, SW480 in which miR-143 or miR-145 is reduced. As a result, cell growth suppression was observed depending on the concentration of microRNA, suggesting that miR-143 or miR-145 functions to suppress cancer cell growth.

The expression of miR-143 or miR-145 in various leukemia patients was examined.
Leukemia is classified as follows: myeloid (acute myeloid leukemia, myelodysplastic syndrome, myeloproliferative disorder), lymphoid tumor (acute lymphoblastic leukemia, acute T-cell leukemia, adult T-cell leukemia, chronic Lymphatic leukemia, B-cell lymphoma). Informed consent was obtained from patients, and samples were collected from peripheral blood, bone marrow, and lymph nodes at the first visit and at the time of recurrence (mostly malignant cells) and examined by qRT-PCR. As a result, as shown in FIG. 5a, FIG. 5b, FIG. 5c, and FIG. Among these, chronic lymphocytic leukemia and B cell lymphoma shown in FIG. Healthy human peripheral lymphocytes, tonsils and bone marrow were used as controls.

(1) Preparation of α-Mangosteen Water (600 L) was added to 60 kg of dried mangosteen peel and washed for 1 hour while stirring at 90 ° C or higher, preferably 95 ° C to 100 ° C. In the heating and washing process, a large amount of impurities such as red substances, viscous substances and hygroscopic substances contained in mangosteen peel are eluted, and a composition containing mangosteen crystals with high purity can be obtained in the subsequent extraction process. .

  The heat-washed mangosteen peel was filtered, 600 L of 50% (v / v) ethanol was added to the residue, and the mixture was extracted with stirring at 80 ° C. to 85 ° C. for 1 hour, and the extract was filtered.

  The filtrate was gradually cooled to room temperature and then left overnight at room temperature to precipitate crude mangosteen crystals. The liquid in which the crude mangosteen crystals were precipitated was filtered to separate the crude mangosteen crystals. The separated crude mangosteen crystals were washed with 10 L of 50% V / V ethanol and then vacuum dried at 60 ° C. to obtain 2.4 kg of crude mangosteen crystal powder.

24 L of ethanol was added to 2.4 kg of the crude mangosteen crystals, and dissolved by stirring at room temperature for 1 hour. The solution was added dropwise to 36 L of water while stirring at room temperature, and then stirred at 80 to 85 ° C. for 1 hour. The liquid is gradually cooled to room temperature, stirred at room temperature overnight to precipitate mangosteen crystals, filtered, and then the obtained mangosteen crystals are washed with 50% V / V ethanol and dried in vacuo to contain mangosteen crystals. A mangosteen-containing composition was obtained.
(2) Method for quantifying mangosteen The mangosteen-containing composition obtained by the above method was quantified by accurately measuring 20 mg of the mangosteen-containing composition and adding ethanol to dissolve it exactly in 100 ml to prepare a sample. Separately, 20 mg of α-mangostin standard product was weighed, and ethanol was added and dissolved exactly in 100 ml to obtain standard solution-1. Separately, 10 mg of γ-mangostin standard product was accurately weighed and ethanol was added to dissolve it exactly in 50 ml. 5 ml of this liquid was accurately measured, and ethanol was added to make exactly 50 ml, which was designated as standard solution-2.

  Each sample was analyzed using high performance liquid chromatography. The column used was Develosil ODS-5 (φ4.6 × 250 mm, manufactured by Nomura Chemical), acetonitrile / 0.05M aqueous phosphoric acid solution (7: 3) was used for the mobile phase, and the flow rate was 1.0 ml / min. Development was performed at 40 ° C. and measurement was performed at a wavelength of 365 nm. As a result of analyzing the mangosteen-containing composition by high performance liquid chromatography, the mangosteen-containing composition obtained by the purification method described above contained α-mangosteen in a proportion of 82.1% and γ-mangosteen in a proportion of 9.0%. . The chemical structure of the mangosteen (xanthone) derivative separated and purified by the above method is shown in FIG.

  Mangosteen, which is a microRNA production regulator characterized by containing mangosteen used in the present invention, may be either α-mangosteen or γ-mangostin, but it takes time and labor to separate them. A mixture of α-mangostin and γ-mangosteen may be used, and is not limited to either one.

Mangosteen microRNA-regulating action When mangosteen was treated against human colon cancer cell line DLD-1, it was found that cell growth was suppressed and the expression levels of miR-143 and miR-145 increased in a dose-dependent manner with mangosteen. .

  FIG. 6 shows the results of treatment of colon cancer cell line DLD-1 with 20 mM a-mangosteen. As a result, it was recognized that the expression of miR-143 and miR-145 increases with time.

  FIG. 7 shows the treatment with 0 to 20 mM a-mangostin after introducing pGL3-miR-143 sensor or pGL3-miR-145 sensor into the luciferase expression vector shown in FIG. The results are shown. As a result, it was found that the luciferase activity decreased (relative fluorescence intensity decreased) depending on the concentration of a-mangostin. That is, depending on the concentration of mangosteen, the intracellular concentration of miR-143 or miR-145 increases, and miR-143 or miR-145 binds to the binding site on the 3 ′ side downstream of the luciferase gene. This shows that gene translation was suppressed. From this result, it was revealed that the effect of suppressing the translation of the luciferase gene of mangosteen is suppressed by increasing the intracellular concentration of miR-143 or miR-145.

Preparation of MicroRNA Modifier Containing Mangosteen As shown in Example 4, it was found that mangosteen can adjust the microRNA content in a dose-dependent manner. Examples of the preparation for oral administration of the mangosteen-containing composition obtained in Example 4 include tablets, granules, fine granules, hard capsules, soft capsules, oral liquid preparations and the like. The dosage of mangosteen as a microRNA regulator is a total dosage of 2 to 2000 mg, preferably 10 to 1000 mg per day.
The mangosteen containing composition was mix | blended in the ratio shown below, and the tablet containing a mangosteen was prepared.
(Formulation Example 1) 130 g of a mangosteen-containing composition and 260 g of hydroxypropylcellulose were added to produce a powder containing 130 mg of mangosteen per 390 mg.
(Formulation Example 2) 130 g of a mangosteen-containing composition, 65 g of hydroxypropyl cellulose and 305 g of D-mannitol were added to produce a granule containing 130 mg of mangosteen per 500 mg.

  The amount of the mangosteen-containing composition added to the microRNA preparation containing mangosteen is administered in order to increase the amount of microRNA desired for the treatment of the target disease, such as a drug to be used in combination, the target disease to be applied, the severity of the disease, etc. A microRNA regulator capable of adjusting the amount of microRNA produced can be prepared by appropriately changing the content and dose of the mangosteen-containing composition so as to be compatible with patients.

FIG. 1 shows a schematic diagram of the structure of pGL3-miR-143 sensor or pGL3-miR-145 sensor by introducing miR-143 and miR-145 binding sites into a luciferase expression vector. FIG. 2 shows the results of examining the expression of miR-143 and miR-145 in the tumor part of a colon cancer patient and the normal tissue of the patient. All the expression levels were decreased in all tumors compared to normal tissues. FIG. 3 shows the results of examining the expression of miR-143 and miR-145 for all normal human tissues and cancer cell lines derived from the tissues. Although normal tissues were well expressed (upper), human cancer cell lines showed decreased expression in all cell lines (lower). U6 is an internal standard. In FIG. 4, miR-143 and miR-145 precursor microRNAs were introduced into colon cancer cell lines DLD-1, SW480 in which miR-143 and miR-145 are reduced. As a result, cell growth inhibition was seen in a concentration-dependent manner. FIG. 5a shows the results of examining the expression of miR-143 and miR-145 in cells obtained from patients with acute myeloid leukemia, myelodysplastic syndrome, and myeloproliferative syndrome. FIG. 5b shows the results of examining the expression of miR-143 and miR-145 in acute lymphocytic leukemia cells obtained from patients. FIG. 5c shows the results of examining the expression of miR-143 and miR-145 in acute lymphocytic leukemia and B lymphoma cells obtained from patients. FIG. 5d shows the results of examining the expression of miR-143 and miR-145 in adult T-cell leukemia cells and T-cell acute lymphoblastic leukemia cells obtained from patients. In FIGS. 5a to 5d, there was a tendency for expression to decrease in lymphoid tumors. In particular, chronic lymphocytic leukemia and B-cell lymphoma decreased in all cases. Healthy human peripheral lymphocytes, tonsils and bone marrow were used as controls. FIG. 6 shows the chemical structure of a mangosteen (xanthone) derivative separated and purified from mangosteen. FIG. 7 shows the results of treatment of colon cancer cell line DLD-1 with 20 mM a-mangosteen. The expression of miR-143 and miR-145 increases with time. FIG. 8 shows the results of treatment with 0 to 20 mM a-mangostin after introducing the luciferase expression vector pGL3-miR-143 sensor or pGL3-miR-145 sensor into the colon cancer cell line DLD-1. It is suggested that miR-143 and miR-145 increase depending on the concentration of mangosteen, and that the activity of luciferase is decreased.

Claims (8)

A microRNA detection method for detecting the production of microRNA using an expression vector having a microRNA binding site downstream of luciferase and a recombinant cell into which the vector has been introduced. The microRNA according to claim 1, wherein the production of microRNA (miR-143) is detected using a genetically modified cell, wherein an expression vector having a miR-143 binding site is introduced downstream of luciferase. Detection method. The microRNA according to claim 1, wherein the production of microRNA (miR-145) is detected using a genetically modified cell characterized by introducing an expression vector having a miR-145 binding site downstream of luciferase. Detection method. A method for diagnosing cancer in which microRNA-143 or 145 is detected by the method according to any one of claims 1 to 3 to distinguish cancer cells from normal cells. A method for searching for a substance that increases microRNA-143 or 145 against cancer cells by measuring the amount of microRNA produced by measuring the fluorescence intensity of luciferase expression according to any one of claims 1 to 3. A microRNA production regulator comprising mangosteen. The microRNA production regulator comprising the mangosteen according to claim 6, wherein the microRNA is miR-143. The microRNA production regulator comprising the mangosteen according to claim 6, wherein the microRNA is miR-145.