JP2007525409A - TNF-α binding molecule - Google Patents

Abstract

The present invention relates to TNF-α binding molecules and nucleic acid sequences encoding TNF-α binding molecules. In particular, the present invention relates to a TNF-α binding molecule that has high binding affinity, high binding rate, and low dissociation rate for human TNF-α, and can neutralize TNF-α at low concentrations. Preferably, the TNF-α binding molecules of the invention comprise light and / or heavy chain variable regions with a fully human framework (eg, human germline framework).

Description

  This application claims priority from both US patent application Ser. No. 10 / 338,552 filed Jan. 8, 2003 and US Patent Application No. 10 / 338,627 filed Jan. 8, 2003.

The present invention relates to TNF-α binding molecules and nucleic acid sequences encoding TNF-α binding molecules. In particular, the present invention relates to a TNF-α binding molecule that has high binding affinity, high binding rate, low dissociation rate for human TNF-α and can block TNF-α-mediated cytotoxicity at low concentrations. . Preferably, the TNF-α binding molecules of the invention comprise light and / or heavy chain variable regions with a fully human framework (eg, human germline framework).

BACKGROUND OF THE INVENTION Tumor necrosis factor alpha (TNF-α) is a cytokine produced by a variety of cell types, including monocytes and macrophages, and was initially identified based on its ability to induce necrosis in specific mouse tumors. . It was then shown that a factor called cachectin associated with cachexia is identical to TNF-α. TNF-α has been implicated in the pathophysiology of various other human diseases and disorders such as shock, sepsis, infections, autoimmune diseases, graft rejection and graft-versus-host disease.

  The deleterious role of human TNF-α (hTNF-α) in various human disorders has designed therapeutic strategies to inhibit or counteract hTNF-α activity. In particular, antibodies that bind to and neutralize hTNF-α have been sought as a means of inhibiting hTNF-α activity. The earliest of such antibodies include mouse monoclonal antibodies (mAbs) secreted by hybridomas prepared from mouse lymphocytes immunized with hTNF-α (see, for example, US Pat. see al). These mouse anti-hTNF-α antibodies often showed high affinity for hTNF-α and were able to neutralize hTNF-α activity, but their in vivo use administered mouse antibodies to humans It has been limited by problems that accompany it. Such problems include, for example, short serum half-life, inability to trigger certain human effector functions, and the induction of undesirable immune responses against mouse antibodies in humans (the “human anti-mouse antibody” (HAMA) reaction). It is done.

  In an attempt to overcome the problems associated with using fully murine antibodies in humans, murine anti-hTNF-α antibodies have been genetically engineered to become more “human-like”. For example, a chimeric antibody was prepared in which the variable region of the antibody chain was derived from mouse and the constant region of the antibody chain was derived from human (eg, US Pat. No. 5,698,195, incorporated herein by reference). In addition, humanized antibodies have also been prepared in which the hypervariable domains of antibody variable regions and a number of framework residues are derived from mice, but the remaining variable regions and antibody constant regions are derived from humans (e.g. US Pat. No. 5,994,510, Adair et al.). However, because these antibodies still retain a significant number of mouse residues, they still elicit a human anti-chimeric antibody (HACA) response, an undesirable immune response, especially when administered for long periods of time. (See, for example, Elliott, et al., (1994) Lancet 344: 1125-1127; and Elliot, et al., (1994) Lancet 344: 1105-1110).

  Attempts have been made to further limit or eliminate the presence of mouse sequences in anti-TNF-α antibodies. For example, human monoclonal autoantibodies against hTNF-α were prepared using human hybridoma technology (eg, US Pat. No. 5,654,407, Boyle, which is incorporated herein by reference). However, these hybridoma-derived monoclonal autoantibodies have a low affinity for hTNF-α that cannot be measured by conventional methods and cannot bind to soluble hTNF-α, neutralizing hTNF-α-induced cytotoxicity. Has been reported (see Boyle, et al., (1993) cells. Immunol. 152: 556-581). Furthermore, the success of human hybridoma technology generally relies on the natural presence of lymphocytes that produce autoantibodies specific for hTNF-α in human peripheral blood.

An alternative to the natural human anti-hTNF-α antibody would be a recombinant hTNF-α antibody. Recombinant human antibodies have been described that bind to hTNF-α with relatively low affinity (ie, K _d about 10 ⁻⁷ M) and relatively fast dissociation rate (ie, k _off about 10 ⁻² s ⁻¹ ). (Griffiths, AD, et al. (1993) EMBO J. 12: 725-734). However, due to their relatively fast dissociation kinetics and relatively low affinity, these antibodies may not be suitable for therapeutic applications. Furthermore, moderate binding affinity (K _d about 6 x 10 ^-10 M), dissociation rate (k _off of about 8.8 x 10 ^-5 s ^-1), association rate (k _on approximately 1.9 x 105 M-1 s ^{- 1} ), and a recombinant human anti-hTNF-α antibody having neutralizing ability (IC ₅₀ approximately 1.25 × 10 ⁻¹⁰ ) has been described (the D2E7 antibody of US Pat. See)

  Therefore, what is needed is a TNF-α binding molecule with high binding affinity, high binding rate, low dissociation rate and improved neutralizing properties for human TNF-α, and significantly reduced immunogenicity in humans. TNF-α binding molecule.

SUMMARY OF THE INVENTION The present invention provides TNF-α binding molecules and nucleic acid sequences encoding TNF-α binding molecules. In particular, the present invention provides TNF-α binding molecules that have high binding affinity, high binding rate, low dissociation rate for human TNF-α and enhanced neutralizing properties in vitro and in vivo. Preferably, the TNF-α binding molecules of the invention comprise light and / or heavy chain variable regions with a fully human framework. In particularly preferred embodiments, the TNF-α binding molecules of the invention comprise light and / or heavy chain variable regions having a germline framework (eg, a human germline framework).

  In some embodiments, the present invention provides a composition comprising a peptide, or a nucleic acid sequence encoding the peptide, wherein the peptide comprises an amino acid sequence selected from SEQ ID NOs: 11, 13, and 15. In another embodiment, the peptide is further selected from SEQ ID NOs: 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53 and 55 One or more amino acid sequences.

  In certain embodiments, the invention provides a composition comprising a peptide, or a nucleic acid sequence encoding the peptide, wherein the peptide comprises an amino acid sequence selected from SEQ ID NOs: 21, 25, and 27. In another embodiment, the peptide is one or more amino acids selected from SEQ ID NOs: 9, 11, 13, 15, 17, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53 and 55 Contains an array.

  In a further aspect, the present invention provides a composition comprising a peptide, or a nucleic acid sequence encoding the peptide, wherein the peptide comprises the amino acid sequence set forth in SEQ ID NO: 33. In certain embodiments, the peptide further comprises SEQ ID NOs: 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 35, 37, 39, 41, 43, 45, 47, 49, It includes one or more amino acid sequences selected from 51, 53 and 55.

  In some embodiments, the present invention provides a composition comprising a peptide, or a nucleic acid sequence encoding the peptide, wherein the peptide comprises an amino acid sequence selected from SEQ ID NOs: 35, 37, and 39. In another embodiment, the peptide is further from SEQ ID NOs: 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 43, 45, 47, 49, 51, 53 and 55. Contains one or more selected amino acid sequences.

  In certain embodiments, the present invention provides a composition comprising a peptide, or a nucleic acid sequence encoding the peptide, wherein the peptide comprises an amino acid sequence selected from SEQ ID NOs: 45 and 49. In another embodiment, the peptide is further selected from SEQ ID NOs: 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41 and 53 The above amino acid sequence is included.

  In certain embodiments, the present invention provides a composition comprising a peptide, or a nucleic acid sequence encoding the peptide, wherein the peptide comprises the amino acid set forth in SEQ ID NO: 53. In a further embodiment, the peptide further comprises SEQ ID NO: 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49 , 51 and 55, comprising one or more amino acid sequences.

  In a particular embodiment, the present invention provides a composition comprising a peptide, or a nucleic acid sequence encoding the peptide, wherein the peptide is SEQ ID NO: 87, 89, 91, 93, 95, 97, 99, 101, 103, 105. , 107 and 109.

In some embodiments, the TNF-α binding molecule is a TNF-α binding peptide or polypeptide. In certain embodiments, the TNF-α binding peptide comprises an anti-TNF-α antibody or anti-TNF-α antibody fragment (eg, Fab, F (ab ′) ₂ etc.). In another embodiment, the peptide comprises a light chain and / or heavy chain variable region. In particular embodiments, the light chain variable region and / or heavy chain variable region comprises a framework region. In certain embodiments, at least FRL1, FRL2, FRL3, or FRL4 is fully human. In another embodiment, at least FRH1, FRH2, FRH3, or FRH4 is fully human. In some embodiments, at least FRL1, FRL2, FRL3, or FRL4 is a germline sequence (eg, human germline). In another embodiment, at least FRH1, FRH2, FRH3, or FRH4 is a germline sequence (eg, human germline). In a preferred embodiment, the framework region is a fully human framework region (eg, the human framework region shown in FIGS. 5 and 6). In some embodiments, the framework region comprises SEQ ID NOs: 57, 58, 59, 60, or combinations thereof. In another embodiment, the framework region comprises SEQ ID NO: 65, 66, 67, 68, or a combination thereof.

  In some embodiments, the present invention provides a composition comprising an oligonucleotide, wherein the oligonucleotide comprises a nucleic acid sequence selected from SEQ ID NOs: 12, 14, or 16. In another embodiment, the oligonucleotide is further from SEQ ID NOs: 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, and 56. Contains one or more selected nucleic acid sequences.

  In certain embodiments, the present invention provides a composition comprising an oligonucleotide, wherein the oligonucleotide comprises a nucleic acid sequence selected from SEQ ID NOs: 22, 26, and 28. In a further embodiment, the oligonucleotide is one or more nucleic acid sequences selected from SEQ ID NOs: 10, 12, 14, 16, 18, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, and 54. Further includes.

  In another aspect, the invention provides a composition comprising an oligonucleotide, wherein the oligonucleotide comprises the nucleic acid sequence set forth in SEQ ID NO: 34. In certain embodiments, the oligonucleotide is SEQ ID NO: 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 36, 38, 40, 42, 44, 46, 48, 50, It further comprises one or more nucleic acid sequences selected from 52 and 54.

  In a particular embodiment, the present invention provides a composition comprising an oligonucleotide, wherein the oligonucleotide comprises a nucleic acid sequence selected from SEQ ID NOs: 36, 38, and 40. In a further embodiment, the oligonucleotide is selected from SEQ ID NOs: 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 44, 46, 48, 50, 52 and 54 It further includes one or more nucleic acid sequences.

  In another embodiment, the present invention provides a composition comprising an oligonucleotide, wherein the oligonucleotide comprises a nucleic acid sequence selected from SEQ ID NOs: 46 and 50. In some embodiments, the oligonucleotide is selected from SEQ ID NOs: 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, and 54. One or more nucleic acid sequences.

  In a further aspect, the present invention provides a composition comprising an oligonucleotide, wherein the oligonucleotide comprises the nucleic acid sequence set forth in SEQ ID NO: 54. In certain embodiments, the oligonucleotide is SEQ ID NO: 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, It further comprises one or more nucleic acid sequences selected from 50 and 52.

  In some embodiments, the oligonucleotide further comprises a vector sequence. In another embodiment, the oligonucleotide further comprises a nucleic acid sequence encoding an antibody variable region framework. In a preferred embodiment, the framework is completely human. In a further embodiment, the oligonucleotide further comprises a nucleic acid sequence encoding an antibody constant region. In some embodiments, the oligonucleotide comprises a framework region selected from SEQ ID NOs: 61, 62, 63, 64, 69, 70, 71, 72, or combinations thereof. In certain embodiments, the human germline light and / or heavy chain framework shown in FIG. 15 is used (ie, IGKV1-39 for the light chain and IGVH3-72 for the heavy chain).

In some embodiments, the invention provides a composition comprising a TNF-α binding molecule, or an oligonucleotide encoding a TNF-α binding molecule, wherein the TNF-α binding molecule comprises:
i) a CDRL3 sequence comprising SEQ ID NO: 33, and
ii) CDRH3 comprising SEQ ID NO: 53.
In a particular embodiment, the TNF-α molecule comprises a hu1 Fab (eg, an IgG having a variable region present in a hu1 Fab fragment).

In certain embodiments, the TNF-α binding molecule further comprises:
iii) a CDRL1 sequence comprising SEQ ID NO: 11, and
iv) A CDRL2 sequence comprising SEQ ID NO: 21.
In another embodiment, the TNF-α binding molecule further comprises:
v) CDRH1 sequence comprising SEQ ID NO: 37, and
vi) CDRH2 sequence comprising SEQ ID NO: 49.
In some embodiments, the TNF-α binding molecule comprises a 2C6K Fab (eg, an IgG having a variable region present in a 2C6K Fab fragment). In a further embodiment, the TNF-α binding molecule further comprises:
v) CDRH1 sequence comprising SEQ ID NO: 39, and
vi) CDRH2 sequence comprising SEQ ID NO: 49.
In particular embodiments, the TNF-α binding molecule comprises 2C6P Fab (eg, an IgG having a variable region present in a 2C6P Fab fragment).

In some embodiments, the TNF-α binding molecule further comprises:
iii) a CDRL1 sequence comprising SEQ ID NO: 11, and
iv) A CDRL2 sequence comprising SEQ ID NO: 25.
In another embodiment, the TNF-α binding molecule further comprises:
v) CDRH1 sequence comprising SEQ ID NO: 37, and
vi) CDRH2 sequence comprising SEQ ID NO: 55.
In a particular embodiment, the TNF-α binding molecule comprises 2E7K Fab (eg, an IgG having a variable region present in a 2E7K Fab fragment).
In another embodiment, the TNF-α binding molecule further comprises:
v) CDRH1 sequence comprising SEQ ID NO: 39, and
vi) CDRH2 sequence comprising SEQ ID NO: 55.
In particular embodiments, the TNF-α binding molecule comprises 2E7P Fab (eg, an IgG having a variable region present in a 2E7P Fab fragment).

In a further embodiment, the TNF-α binding molecule further comprises:
iii) a CDRL1 sequence comprising SEQ ID NO: 13, and
iv) A CDRL2 sequence comprising SEQ ID NO: 27.
In some embodiments, the TNF-α binding molecule further comprises:
v) CDRH1 sequence comprising SEQ ID NO: 37, and
vi) CDRH2 sequence comprising SEQ ID NO: 55.
In a particular embodiment, the TNF-α binding molecule comprises an A9K Fab (eg, an IgG having a variable region present in an A9K Fab fragment). In certain embodiments, the TNF-α binding molecule further comprises:
v) CDRH1 sequence comprising SEQ ID NO: 39, and
vi) CDRH2 sequence comprising SEQ ID NO: 55.
In a particular embodiment, the TNF-α binding molecule comprises A9P Fab (eg, an IgG having a variable region present in an A9P Fab fragment).

In some embodiments, the TNF-α binding molecule further comprises:
iii) a CDRL1 sequence comprising SEQ ID NO: 15, and
iv) A CDRL2 sequence comprising SEQ ID NO: 25.
In another embodiment, the TNF-α binding molecule further comprises:
v) CDRH1 sequence comprising SEQ ID NO: 37, and
vi) CDRH2 sequence comprising SEQ ID NO: 45.
In a particular embodiment, the TNF-α binding molecule comprises an A10K Fab (eg, an IgG having a variable region present in an A10K Fab fragment). In another embodiment, the TNF-α binding molecule further comprises:
v) CDRH1 sequence comprising SEQ ID NO: 39, and
vi) CDRH2 sequence comprising SEQ ID NO: 45.
In a particular embodiment, the TNF-α binding molecule comprises an A10P Fab (eg, an IgG having a variable region present in an A10P Fab fragment).

In some embodiments, the TNF-α binding molecule further comprises:
iii) a CDRL1 sequence comprising SEQ ID NO: 9, and
iv) A CDRL2 sequence comprising SEQ ID NO: 19.
In another embodiment, the TNF-α binding molecule further comprises:
v) CDRH1 sequence comprising SEQ ID NO: 35, and
vi) CDRH2 sequence comprising SEQ ID NO: 43.

  In certain embodiments, the TNF-α binding molecule further comprises a light chain variable region, wherein the light chain variable region comprises a framework region. In some embodiments, the light chain variable region comprises a light chain framework region selected from SEQ ID NOs: 57, 58, 59, 60, and combinations thereof. In a preferred embodiment, the framework region is a fully human framework. In particularly preferred embodiments, the framework region is a germline framework (eg, a human or other animal germline framework).

  In some embodiments, the TNF-α binding molecule further comprises a heavy chain variable region, wherein the heavy chain variable region comprises a framework region. In certain embodiments, the heavy chain variable region comprises a heavy chain framework region selected from SEQ ID NOs: 65, 66, 67, 68, and combinations thereof. In a preferred embodiment, the framework is a fully human framework. In particularly preferred embodiments, the framework region is a germline framework (eg, a human or other animal germline framework).

  In certain embodiments, the present invention provides a composition comprising a light chain variable region or a nucleic acid sequence encoding a light chain variable region, wherein the light chain variable region is an amino acid selected from SEQ ID NOs: 1 and 5 Contains an array. In another embodiment, the present invention provides a composition comprising an oligonucleotide encoding a light chain variable region, wherein the oligonucleotide comprises SEQ ID NO: 2 or SEQ ID NO: 6.

  In some embodiments, the invention provides a composition comprising a heavy chain variable region, or a nucleic acid sequence encoding a heavy chain variable region, wherein the heavy chain variable region is an amino acid selected from SEQ ID NOs: 3 and 7. Contains an array. In a particular embodiment, the present invention provides a composition comprising an oligonucleotide encoding a heavy chain variable region, wherein the oligonucleotide comprises SEQ ID NO: 4 or SEQ ID NO: 8.

  In some embodiments, the present invention provides a computer readable medium that encodes a representation of a nucleic acid or amino acid sequence selected from SEQ ID NOs: 1-108 or its complementary strand. In certain embodiments, the display of these sequences is intended for display to the user when delivered to a computer processor (eg, on the Internet). In particular embodiments, the present invention provides CDR-encoding nucleic acid sequences described herein (e.g., SEQ ID NOs: 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36 , 38, 40, 42, 44, 46, 48, 50, 52, 54, 74, 76, 78, 80, 82, 84, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106 , And 108). In further embodiments, the present invention provides CDR encoding nucleic acid sequences described herein (e.g., SEQ ID NOs: 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 74, 76, 78, 80, 82, 84, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, And 108) are provided (under conditions of low, medium to high stringency).

  In some embodiments, the present invention provides complementary strands of the nucleic acid sequences described herein (see, eg, Tables 1-3 and 6). In some embodiments, the present invention provides nucleic acid sequences that hybridize to nucleic acid sequences described herein (see, eg, Tables 1-3 and 6) under conditions of high, medium to low stringency.

In certain embodiments, the invention provides a composition comprising a TNF-α binding molecule that has a binding rate constant (k _on ) for human TNF-α of 3.0 × 10 ⁶ M ⁻¹ s ⁻¹ or greater. In another embodiment, the association rate constant is 4.0 x 10 ⁶ M ^-1 s ^-1 or greater (e.g., about 4.1 x 10 ⁶ M ^-1 s ^-1 , about 5.5 x 10 ⁶ M ^-1 s ^-1 , Or about 7.0 x 10 ⁶ M ^-1 s ^-1 ). In another embodiment, the binding rate constant is about 3.0 x 10 ⁶ M ^-1 s ^-1 to about 7.5 x 10 ⁶ M ^-1 s ^-1 (e.g., about 3.5 x 10 ⁶ M ^-1 s ^-1 to about 7.0 x 10 ⁶ M ^-1 s ^-1 , or about 4.0 x 10 ⁶ M ^-1 s ^-1 to about 6.0 x 10 ⁶ M ^-1 s ^-1 ).

  In some embodiments, the binding rate constant is determined by a kinetic exclusion assay (eg, Chiu et al., (2001) Anal. Chem., 73: 5477-5484; Blake, et al., (1996) Journal of Biological Chemistry, 271: 27677-27685; Hongo, et al., (2000) Hybridoma, 19: 303-315; Khosraviani, et al., (2000) Bioconjugate Chemistry, 11: 267-277; and Powers, et al. (2001) Journal of Immunological Methods, 251: 123-135, all of which are incorporated herein by reference). In particular embodiments, the kinetic exclusion assay is performed using a KinExA instrument (eg, KinExA ™ 3000, Sapidyne Instruments, Boise, Idaho), or similar instrument.

In a further embodiment, the TNF-α binding molecule has a binding affinity (K _d ) for human TNF-α of about 7.5 × 10 ⁻¹² M or less. In another embodiment, the binding affinity is about 5.0 x ^10-12 M or less. In certain embodiments, the binding affinity is about 3.0 × 10 ⁻¹² M or less. In some embodiments, the binding affinity is 2.2 x ^10-12 M or less. In yet another embodiment, the binding affinity is about 7.2 x 10 ^-12 M ~ about 2.0 x 10 ^-12 M (e.g., about 6.0 x 10 ^-12 M to about 3.0 x 10 ^-12 M, or about 5.0 x 10, ^{- 12} M to about 4.0 × 10 ⁻¹² M). In particular embodiments, binding affinity is measured by a kinetic exclusion assay (eg, using a KinExA device).

In certain embodiments, the TNF-α binding molecule has a dissociation rate constant (k _off ) for human TNF-α of about 1.0 × 10 ⁻⁴ s ⁻¹ or less. In some embodiments, the dissociation rate constant is about 1.0 × 10 ⁻⁵ s ⁻¹ or less, about 9.0 × 10 ⁻⁶ s ⁻¹ or less, or about 7.0 × 10 ⁻⁶ s ⁻¹ or less. In another embodiment, the dissociation rate constant is from about 1.0 x 10 ^-4 s ^-1 to about 8.0 x 10 ^-6 s ^-1 (e.g., from about 1.0 x 10 ^-5 s ^-1 to about 6.0 x 10 ^-6 s ^-1 ). In certain embodiments, the dissociation rate is measured by a kinetic exclusion assay.

In some embodiments, the present invention in vitro, human TNF-alpha cytotoxicity in cell-based assays (e.g., see Example 2) EC ₅₀ 1.0 x 10 ^-10 or less ^{(e.g., 1.0 x 10 -10 - 1.0 x} 10 - A composition comprising a TNF-α binding molecule that neutralizes in ¹¹ ) is provided. In another embodiment, the TNF-α binding molecule neutralizes human TNF-α cytotoxicity in an in vitro, cell-based assay with EC ₅₀ 7.0 x 10 ^-11 or less (eg, 7.0 x 10 ^-11-3.0 x 10 ^-11 ). To do. In some embodiments, the TNF-α binding molecule has human TNF-α cytotoxicity in an in vitro, cell-based assay of EC ₅₀ 2.0 x 10 ^-12 or less (e.g., 1.9 x 10 ^-12 or less, 1.8 x 10 ^-12 or less, 1.7 x 10 ^-12 or less, 1.6 x 10 ^-12 or less, 1.5 x 10 ^-12 or less, 1.4 x10 ^-12 or less, 1.3 x 10 ^-12 or less, 1.2 x 10 ^-12 or less, 1.1 x 10 ^-12 or less, 1.0 x 10 ^-12 or less, 0.9 x 10 ^-12 or less, 0.8 x 10 ^-12 or less, etc.). In a further embodiment, the TNF-α binding molecule neutralizes human TNF-α cytotoxicity in an in vitro, cell-based assay with an EC ₅₀ 3.0 x10 ^-12 or less (eg, 3.0 x 10 ^-12-2.0 x 10 ^-12 ). . In a particular embodiment, the neutralization assay is performed by treating L929 mouse fibroblasts with a molecule of the invention and then measuring the effective concentration that can prevent TNF-α-mediated cell death.

  In some embodiments, the TNF-α binding molecule comprises a light chain variable region and a heavy chain variable region. In certain embodiments, the light chain variable region comprises a fully human framework (see, eg, FIG. 5). In some embodiments, the light chain variable region comprises a germline framework (eg, a human germline framework). In another embodiment, the heavy chain variable region comprises a fully human framework (see, eg, FIG. 6). In further embodiments, the heavy chain variable region comprises a germline framework (eg, a human germline framework). In certain embodiments, the human germline light and / or heavy chain framework shown in FIG. 15 is used (ie, IGKV1-39 for the light chain and IGVH3-72 for the heavy chain).

In a particular embodiment, the TNF-α binding molecule comprises Fab or F (ab ′) ₂ . In another embodiment, the TNF-α binding molecule comprises a Fab and further comprises one or more constant regions (eg, CH2 and / or CH3, see FIG. 13). In particular embodiments, the TNF-α binding molecule comprises an antibody (eg, an antibody comprising a fully human framework with a synthetic CDR sequence). In certain embodiments, the antibody comprises an altered (eg, mutated) Fc region. For example, in some embodiments, the Fc region is altered to increase or decrease the effector function of the antibody. In some embodiments, the Fc region is an isotype selected from IgM, IgA, IgG, IgE or other isotype.

In some embodiments, the invention provides a composition comprising a TNF-α binding molecule, or a nucleic acid sequence encoding a TNF-α binding molecule, wherein the TNF-α binding molecule comprises at least one of the following CDR sequences: including;
i) a CDRL1 sequence comprising SEQ ID NO: 93;
ii) a CDRL2 sequence comprising SEQ ID NO: 95;
iii) a CDRL3 sequence comprising SEQ ID NO: 97;
iv) CDRH1 sequence comprising SEQ ID NO: 87;
v) CDRH2 sequence including SEQ ID NO: 89, and
vi) CDRH3 sequence comprising SEQ ID NO: 91.
In another embodiment, the TNF-α binding molecule comprises at least 2, or at least 3, or at least 4, or at least 5 CDR sequences. In some embodiments, the TNF-α binding molecule comprises all six CDR sequences. In certain embodiments, the TNF-α binding molecule comprises the heavy chain sequence set forth in SEQ ID NO: 109 (see FIG. 15). In another embodiment, the TNF-α binding molecule comprises the light chain sequence set forth in SEQ ID NO: 110 (see FIG. 15). In a preferred embodiment, the TNF-α binding molecule is AME 3-2 and comprises both SEQ ID NO: 109 (heavy chain) and SEQ ID NO: 110 (light chain).

  In some embodiments, amino acid modifications are introduced into the CH2 domain of the Fc region of the TNF-α binding molecule. Fc gamma receptor (FcγR) Amino acid positions for modifications useful for making variant IgG Fc regions with altered binding affinity or activity include one or more of the following amino acid positions: TNF-α 268, 269, 270, 272, 276, 278, 280, 283, 285, 286, 289, 290, 292, 293, 294, 295, 296, 298, 300 301, 303, 305, 307 of the binding molecule 309, 331,333, 334, 335, 337, 338, 340, 360, 373, 376, 416, 419, 430, 434, 435, 437, 438 or 439. In a preferred embodiment, the parent Fc region used as a template for creating such variants comprises a human IgG Fc region. In some embodiments, Fc region variants with reduced binding to FcγR may be made by introducing amino acid modifications at any one or more of the following amino acid positions: 252 of the Fc region of the TNF-α binding molecule. , 254,265,268,269,270,272,278,289,292,293,294,295,296,298,300,301,303,322,324,327,329,333,335,338,340 , 373, 376, 382, 388, 389, 414, 416, 419, 434, 435, 437, 438 or 439. In particular embodiments, Fc region variants with increased binding to one or more FcγRs can also be made. Such Fc region variants include amino acid modifications at one or more of the following amino acid positions: 280, 283, 285, 286, 290, 294, 295, 298, 300, 301, 305, 307 of the Fc region of the TNF-α binding molecule. , 309, 312, 315, 331, 333, 334, 337, 340, 360, 378, 398 or 430.

  In certain embodiments, the invention provides a TNF-α binding molecule comprising a variant of a parent polypeptide having an Fc region, wherein the variant binds to FcγR with higher affinity than the parent polypeptide, and / or Interact with FcγR at high assay signals, and / or mediate antibody-dependent cell-mediated cytotoxicity (ADCC) in the presence of effector cells, and contain at least one amino acid modification at position 300 of the Fc region. In certain embodiments, the amino acid modification is Y300I. In another embodiment, the amino acid modification is Y300L.

  In some embodiments, the invention provides a TNF-α binding molecule comprising a variant of a parent polypeptide having an Fc region, wherein the variant has a higher affinity than the parent polypeptide for Fc gamma receptor III (FcγRIII). Binds to or interacts with FcγRIII with a higher assay signal and / or mediates antibody-dependent cell-mediated cytotoxicity (ADCC) in the presence of effector cells and at least one amino acid at position 295 of the Fc region Includes modifications. In certain embodiments, the amino acid modification is Q295K or Q295L.

  In certain embodiments, the invention provides a TNF-α binding molecule comprising a variant of a parent polypeptide having an Fc region, wherein the variant binds FcγRIII with higher affinity compared to the parent polypeptide, or The variant interacts with FcγRIII with a higher assay signal and / or mediates antibody-dependent cell-mediated cytotoxicity (ADCC) in the presence of effector cells and at least one amino acid modification at position 294 of the Fc region including. In certain embodiments, the amino acid modification is E294N.

  In another embodiment, the present invention provides a TNF-α binding molecule comprising a variant of a parent polypeptide having an Fc region, wherein the variant binds about 0.25 or less of FcγRII or FcγRIIb as measured in an ELISA FcγR binding assay. Has affinity, ie assay signal. In certain embodiments, the variant comprises at least one amino acid modification at position 296 of the Fc region. In certain embodiments, the amino acid modification at position 296 is Y296P. In another embodiment, the variant comprises at least one amino acid modification at position 298 of the Fc region. In some embodiments, the amino acid modification at position 298 is S298P.

  In a particular embodiment, the present invention provides a TNF-α binding molecule comprising a variant of a parent polypeptide having an Fc region, wherein the variant binds to FcγRIII with high affinity compared to the parent polypeptide and has a low affinity Binds to FcγRIIb, and the variant contains a S298N amino acid modification in the Fc region. In some embodiments, the present invention provides a composition comprising a variant of a parent polypeptide having an Fc region, wherein the variant interacts with FcγRIII with a high assay signal compared to the parent polypeptide and with a low assay signal. It interacts with FcγRIIb and the variant contains a S298N amino acid modification in the Fc region.

  In another embodiment, the present invention provides a TNF-α binding molecule comprising a variant of a parent polypeptide having an Fc region, wherein the variant binds to FcγRIII with high affinity compared to the parent polypeptide and has a low affinity. Binds to FcγRIIb, and the variant contains a S298V amino acid modification in the Fc region. In some embodiments, the present invention provides a composition comprising a variant of a parent polypeptide having an Fc region, wherein the variant interacts with FcγRIII with a high assay signal compared to the parent polypeptide and with a low assay signal. It interacts with FcγRIIb and the variant contains a S298V amino acid modification in the Fc region.

  In some embodiments, the invention provides a TNF-α binding molecule comprising a variant of a parent polypeptide having an Fc region, wherein the variant binds to FcγRIII with high affinity compared to the parent polypeptide and has a low affinity. Binds FcγRIIb with sex and the variant contains a S298D amino acid modification in the Fc region. In another embodiment, the invention provides a composition comprising a variant of a parent polypeptide having an Fc region, wherein the variant interacts with FcγRIII with a high assay signal compared to the parent polypeptide and with a low assay signal, FcγRIIb. And the variant contains a S298D amino acid modification in the Fc region.

  In certain embodiments, the invention provides a TNF-α binding molecule comprising a variant of a parent polypeptide having an Fc region, wherein the variant has a binding affinity, ie assay, for FcγRII or FcγRIIb as measured by an ELISA FcγR binding assay. The signal is approximately 0.25 or less, and the variant contains at least one amino acid modification at position 298 of the Fc region. In certain embodiments, the amino acid modification at position 298 is S298P.

  The polypeptide variants may be further modified as desired or depending on the use of the polypeptide. Such modifications can include, for example, further amino acid sequence changes (amino acid residue substitutions, insertions and / or deletions), fusions with heterologous polypeptides and / or covalent modifications. Such further modification may be performed either before, simultaneously with, or after the amino acid modification, resulting in a change in Fc receptor binding and / or ADCC activity.

  Alternatively or additionally, it may be useful to combine the amino acid modification with one or more additional amino acid modifications that alter the C1q binding and / or complement dependent cytotoxic function of the Fc region of the TNF-α binding molecule. obtain. Particularly interesting starting polypeptides may be those that bind to C1q and exhibit complement dependent cytotoxicity (CDC). The amino acid substitutions described herein may help to alter the ability of the starting polypeptide to bind to C1q and / or modify its complement-dependent cytotoxic function (e.g., reduce these effector functions, Preferably removed). However, polypeptides with increased C1q binding and / or complement-dependent cytotoxicity (CDC) function, including substitutions at one or more of the previously described positions are also contemplated herein. For example, the starting polypeptide may not be capable of binding to C1q and / or mediating CDC and may be modified according to the teachings of the specification to obtain such additional effector functions. In addition, polypeptides having existing C1q binding activity, and optionally having the ability to mediate CDC, can be modified to enhance one or both of these activities. Amino acid modifications that alter C1q and / or alter its complement-dependent cytotoxic function are described, for example, in WO0042072, which is incorporated herein by reference.

  As described above, the Fc region of a TNF-α binding molecule with a modified effector function can be designed, for example, by altering C1q binding and / or FcγR binding thereby causing CDC activity and / or ADCC Change activity. For example, a variant Fc region of a TNF-α binding molecule with increased C1q binding and increased FcγRIII binding (eg, increased both ADCC and CDC activity) can be made. Alternatively, when it is desired to reduce or eliminate the effector function, a variant Fc region with reduced CDC activity and / or ADCC activity may be engineered. In another embodiment, only one of these activities can be increased and, if desired, the other activity can be decreased (e.g., Fc region variants with increased ADCC activity but decreased CDC activity). Creation, and vice versa).

  Fc mutations can be introduced into the TNF-α binding molecules of the present invention to alter its interaction with the neonatal Fc receptor (FcRn) and improve its pharmacokinetic properties. Several experiments suggest that the interaction of the antibody Fc region with FcRn plays a role in the persistence of immunoglobulins in serum. For example, an unusually short serum half-life has been observed for IgG molecules lacking functional FcRn in mice. Fc mutations that increase binding to FcRn appear to increase serum half-life, conversely, mutations that enhance IgG binding in rat FcRn also increase serum half-life. A collection of human Fc variants with increased binding to FcRn has also been described (Shields et al., (2001) High resolution mapping of the binding site on human IgG1 for FcγRI, FcγRII, FcγRIII, and FcRn and design of IgG1 variants with improved binding to the FcγR, J. Biol. Chem. 276: 6591-6604). Increased binding affinity of IgG molecules to FcRn observed at low pH (eg during pinocytosis or liquid phase endocytosis of IgG molecules from serum) has been reported to affect serum half-life. (Ghetie et al., (1997) Increasing the serum persistence of an IgG fragment by random mutagenesis, Nat. Biotechnol. 15: 637-640; Medesan et al., (1998) Comparative studies of rat IgG to further delineate the Fc : FcRn interaction site. Eur. J. Immunol. 28: 2092-2100; Kim et al., (1999) Mapping the site on human IgG for binding of the MHC class I-related receptor, FcRn, Eur. J. Immunol. 29: 2819-2825; Acqua et al., (2002) Increasing the affinity of a human IgG1 for the neonatal Fc receptor: biological consequences, J. Immunol. 169: 5171-5180). However, mutations that increase binding at high pH appear to adversely affect serum half-life (Acqua et al., (2002) Increasing the affinity of a human IgG1 for the nepnatal Fc receptor: biological consequences, J Immunol. 169: 5171-5180). All of the above documents are incorporated herein by reference. Therefore, Fc mutations can be introduced into the TNF-α binding molecules of the present invention to increase its affinity for FcRn at low pH and maintain or decrease its affinity for FcRn at high pH.

  Another type of amino acid substitution serves to alter the glycosylation pattern of the Fc region of the TNF-α binding molecule. This can be accomplished, for example, by deletion of one or more glycosylation sites found in the polypeptide and / or addition of one or more glycosylation sites that are not present in the polypeptide. Glycosylation of the Fc region is typically N-linked or O-linked. N-linked refers to a carbohydrate moiety bound to the side chain of an asparagine residue. The peptide sequences, asparagine-X-serine and asparagine-X-threonine, where X may be any amino acid other than proline, are recognition sequences for enzymatic binding of the carbohydrate moiety to the asparagine side chain. Thus, the presence of any of these peptide sequences in the polypeptide creates a potential glycosylation site. O-linked glycosylation is a hydroxy amino acid of either sugar, N-acetylgalactosamine, galactose, or xylose, most commonly serine or threonine (but 5-hydroxyproline or 5-hydroxylysine is also used. ) Say bond to.

  Addition of a glycosylation site to the Fc region of a TNF-α binding molecule is easily accomplished by altering the amino acid sequence to include one or more of the above tripeptide sequences (for N-linked glycosylation sites). An exemplary glycosylation variant has an amino acid substitution at residue Asn 297 in the heavy chain. Such changes can also be made by addition or substitution of one or more serine or threonine residues to the original polypeptide sequence (for O-linked glycosylation sites).

  In some embodiments, the present invention provides a method of treating a TNF-α mediated disease comprising administering a TNF-α binding molecule of the present invention to a subject (eg, a human). In certain embodiments, administration is under conditions such that symptoms of TNF-α mediated disease are reduced or eliminated. In a particular embodiment, the TNF-α mediated disease is selected from: sepsis, autoimmune disease, rheumatoid arthritis, hypersensitivity, multiple sclerosis, autoimmune uveitis, nephrotic syndrome, infection, malignancy, transplantation Hepatic rejection, graft-versus-host disease, systemic lupus erythematosus, thyroiditis, scleroderma, diabetes mellitus, Graves' disease, lung disorder, bone disorder, bowel disorder, heart disorder, cachexia, circulatory collapse, acute or chronic bacterial infection Due to shock, acute and chronic parasitic diseases and / or infections, chronic inflammatory symptoms, vascular inflammatory symptoms, sarcoidosis, inflammatory bowel disease, ulcerative colitis, Crohn's disease, disseminated intravascular blood coagulation, atheroma Atherosclerosis, Kawasaki disease, neurodegenerative disease, demyelinating disease, multiple sclerosis, acute transverse myelitis, extrapyramidal and cerebellar disorders, corticospinal disorders, basal ganglia disorders Hyperactivity disorder, Huntington's disease, senile chorea, drug-induced movement disorders (e.g., those induced by drugs that block CNS dopamine receptors), movement deficit disorders, Parkinson's disease, progressive supranuclear palsy, Spinocerebellar disorder, organic lesions of the cerebellum, spinocerebellar degeneration, spinal ataxia, Friedreich's ataxia, cerebellar cortical degeneration, multiple system degeneration, Shy-Drager syndrome, Mencel (Mencel), Dejelin Sottas, And Machado-Joseph disease, systemic disorder, refsum syndrome, abetalipoproteinemia, ataxia, peripheral vasodilation, mitochondrial multisystem disorder, motor unit disorder, neuromuscular atrophy, anterior horn Cellular degeneration, Amyotrophic lateral sclerosis, Pediatric spinal muscular atrophy, Juvenile spinal muscular atrophy, Alzheimer's disease, Down syndrome, Diffuse Lewy body disease , Lewy body senile dementia, Wernicke-Korsakov syndrome, chronic alcoholism, Creutzfeldt-Jakob disease, subacute sclerosing panencephalitis, Hallelfolden-Spatz disease, fighter dementia, TNF-α-secretory tumor Malignant conditions associated with or other malignant tumors with TNF, e.g. leukemia (acute, chronic myelocytic, chronic lymphocytic and / or myelodysplastic syndrome), lymphoma (e.g. Hodgkin, non-Hodgkin and Burkitt lymphoma), fungus Symptoms, alcohol-induced hepatitis, psoriasis, psoriatic arthritis, Wegner's granulomatosis, ankylosing spondylitis, heart failure, reperfusion injury, chronic obstructive pulmonary disease, pulmonary fibrosis, and hepatitis C infection. In preferred embodiments, the TNF-α mediated disease is selected from the group consisting of: juvenile and adult rheumatoid arthritis, Crohn's disease, psoriasis, ulcerative colitis, psoriatic arthritis, ankylosing spondylitis, and other vertebrae Arthropathy, Wegner's granulomatosis, idiopathic pulmonary fibrosis, chronic obstructive pulmonary disease, asthma, cancer and graft-versus-host disease.

  In some embodiments, the TNF-α binding molecule is administered in combination with an immunosuppressive agent, such as methotrexate. In another embodiment, the TNF-α binding molecule is administered intravenously.

In certain embodiments, the present invention provides a kit comprising:
a) a TNF-α binding molecule of the invention; and
b) Instructions for the use of TNF-α binding molecules for the treatment of disease in the subject or for the use of TNF-α binding molecules for scientific research or diagnostic purposes (e.g. performing an ELISA assay) Etc.) In some embodiments, the invention provides cell lines that are stably or transiently transfected with a nucleic acid sequence encoding a TNF-α binding molecule of the invention.

Definitions To facilitate an understanding of the present invention, a number of terms are defined below.

  As used herein, the term “antibody” refers to an immunoglobulin molecule consisting of four polypeptide chains, in which two heavy (H) chains and two light (L) chains are linked together by disulfide bonds. Yes. Each heavy chain is composed of a heavy chain variable region (abbreviated herein as HCVR or VH) and a heavy chain constant region. The heavy chain constant region consists of three domains, CH1, CH2 and CH3 (see FIG. 13). Each light chain is composed of a light chain variable region (abbreviated herein as LCVR or VL) and a light chain constant region. The light chain constant region consists of one domain, CL (see FIG. 13). The VH and VL regions are further subdivided into hypervariable regions called complementarity determining regions (CDR), which are distributed and conserved in regions called framework regions (FR). Each variable part (VH or VL) contains three CDRs, which are referred to as CDR1, CDR2 and CDR3 (see FIGS. 5, 6 and 13). Each variable also includes four framework subregions, referred to as FR1, FR2, FR3, and FR4 (see FIGS. 5, 6, and 13).

As used herein, the term “antibody fragment” refers to a portion of an intact antibody. Examples of antibody fragments include, but are not limited to, linear antibodies, single chain antibody molecules, Fab and F (ab ′) ₂ fragments, and multi-selective antibodies formed from antibody fragments. The antibody fragment preferably retains at least a portion of the heavy and / or light chain variable region.

  As used herein, the terms “complementarity determining region” and “CDR” refer to a region that is a primary factor for antigen binding. There are three CDRs (CDRL1, CDRL2, and CDRL3) in the light chain variable region and three CDRs (CDRH1, CDRH2, and CDRH3) in the heavy chain variable region. The residues that make up these six CDRs have been characterized by Kabat and Chothia as follows: residues 24-34 (CDRL1), 50-56 (CDRL2) and 89-97 (CDRL3) in the light chain variable region And 31-35 (CDRH1), 50-65 (CDRH2) and 95-102 (CDRH3) in the heavy chain variable region; Kabat et al., (1991) Sequences of Proteins of Immunological Interest, 5th, which is incorporated herein by reference. Ed. Public Health Service, National Institutes of Health, Bethesda, MD .; and residues 26-32 (CDRL1), 50-52 (CDRL2) and 91-96 (CDRL3) in the light chain variable region and in the heavy chain variable region 26-32 (CDRH1), 53-55 (CDRH2) and 96-101 (CDRH3); Chothia and Lesk (1987) J. Mol. Biol. 196: 901-917, incorporated herein by reference. Unless otherwise noted, the terms “complementarity determining region” and “CDR” as used herein include residues that include both the Kabat and Chothia definitions (ie, residues 24- in the light chain variable region). 34 (CDRL1), 50-56 (CDRL2), and 89-97 (CDRL3); and 26-35 (CDRH1), 50-65 (CDRH2), and 95-102 (CDRH3)). Unless otherwise specified, the CDR residue numbering used in this specification follows Kabat.

  As used herein, the term “framework” refers to residues of the variable region other than the CDR residues as defined herein. There are four separate framework subregions that make up the framework: FR1, FR2, FR3, and FR4 (see FIGS. 5, 6, and 13). To indicate whether the framework subregion is in the light chain or heavy chain variable region, append “L” or “H” to the abbreviation of the small region (for example, “FRL1” is the frame of the light chain variable region). Shows work subregion 1). Unless otherwise noted, framework residue numbering follows Kabat.

  As used herein, the term “fully human framework” means a framework having an amino acid sequence found naturally in humans. Examples of fully human frameworks include, but are not limited to, KOL, NEWM, REI, EU, TUR, TEI, LAY and POM (e.g., Kabat et al., (1991) Sequences of Proteins of Immunological Interest, US Department of Health and Human Services, NIH, USA; and Wu et al., (1970) J. Exp. Med. 132, 211-250, both of which are incorporated herein by reference).

  As used herein, the terms “subject” and “patient” refer to any animal, such as mammals such as dogs, cats, birds, livestock, preferably humans (eg, humans with TNF-α mediated diseases). is there.

  As used herein, “nucleic acid sequence encoding”, “DNA sequence encoding” and “DNA encoding” refer to the order or sequence of deoxyribonucleotides along the strand of deoxyribonucleic acid. The order of these deoxyribonucleotides determines the order of amino acids along the polypeptide (protein) chain. Thus, the DNA sequence encodes an amino acid sequence.

  A DNA molecule is said to have a “5 ′ end” and a “3 ′ end”. This is because the mononucleotide reacts so that one 5 ′ phosphate of the mononucleotide pentose ring is bound in one direction to the adjacent 3 ′ oxygen via a phosphodiester bond to form an oligonucleotide or polynucleotide. is there. Therefore, the end of an oligonucleotide or polynucleotide is referred to as the “5 ′ end” if its 5 ′ phosphate is not attached to the 3 ′ oxygen of the mononucleotide pentose ring, and the 3 ′ oxygen is the next mononucleotide pentose. If it is not attached to the 5 'phosphate of the ring, it is referred to as the "3' end". As used herein, a nucleic acid sequence is said to have 5 ′ and 3 ′ ends, even within longer oligonucleotides or polynucleotides. In either linear or circular DNA molecules, the separate elements are referred to as “upstream” or “downstream” 5 ′ or 3 ′ elements. This terminology reflects the fact that transcription proceeds 5 'to 3' along the DNA strand. Promoter and enhancer elements that cause transcription of linked genes are generally located 5 ′ or upstream of the coding region. However, enhancer elements can exert their effect even if they are located 3 ′ to the promoter element and the coding region. Transcription termination and polyadenylation signals are located 3 ′ or downstream of the coding region.

  As used herein, the term “codon” or “triplet” refers to a group of three adjacent nucleotide monomers that specify one of the natural amino acids found in a polypeptide. The term also includes codons that do not specify amino acids.

  As used herein, the terms “oligonucleotide having a nucleotide sequence encoding a polypeptide”, “polynucleotide having a nucleotide sequence encoding a polypeptide” and “nucleic acid sequence encoding a peptide” refer to a specific polypeptide A nucleic acid sequence comprising the coding region of The coding region can be present in the form of cDNA, genomic DNA, or RNA. When present in DNA form, the oligonucleotide or polynucleotide may be single-stranded (ie, the sense strand) or double-stranded. A coding region of a gene where appropriate regulatory elements such as enhancer / promoter, splice site, polyadenylation signal, etc. are required to allow proper initiation of transcription and / or correct processing of the primary RNA transcript You may arrange | position close to. Alternatively, the coding region utilized in the expression vectors of the invention may include an endogenous enhancer / promoter, splice site, intervening sequence, polyadenylation signal, etc., or a combination of both endogenous and exogenous regulatory elements.

  As used herein, there is no size limitation or size distinction between the terms “oligonucleotide” and “polynucleotide”. Both terms simply refer to molecules consisting of nucleotides. Similarly, there is no size distinction between the terms “peptide” and “polypeptide”. Both terms simply refer to molecules consisting of amino acid residues.

  As used herein, the terms “complementary” or “complementarity” are used for polynucleotides that conform to base pairing rules (ie, nucleotide sequences). For example, the sequence “5′-A-G-T 3” is complementary to the sequence “3-T-C-A-5 ′”. Complementarity may be “partial”, where only some of the nucleobases may meet the base pairing rule, or “completely” or “all” nucleic acids may be complementary. May be. The degree of complementarity between nucleic acid strands significantly affects the efficiency and strength of hybridization. This is particularly important in amplification reactions and in detection methods that rely on binding between nucleic acids.

  As used herein, the term “complementary strand” of a given sequence is used to refer to a sequence that is completely complementary to the sequence over its entire length. For example, the sequence 5′-A-G-T-A-3 ′ is the “complementary strand” of the sequence 3′-T-C-A-T-5 ′. The invention also provides a complementary strand of the sequences described herein (eg, the complementary strand of the nucleic acid sequence in SEQ ID NOs: 1-84).

  The term “homology” (when referring to nucleic acid sequences) refers to the degree of complementarity. There may be partial homology or complete homology (ie identity). A partially complementary sequence is one that at least partially inhibits a completely complementary sequence from hybridizing to a target nucleic acid and is said to be “substantially homologous” using functional terms. .

  As used for nucleic acid binding, the term “inhibition of binding” refers to inhibition of binding caused by competition of homologous sequences for binding to a target sequence. Inhibition of hybridization of a completely complementary sequence to the target sequence can be examined using hybridization assays (Southern or Northern blots, solution hybridization, etc.) under conditions of low stringency. A substantially homologous sequence or probe will compete and inhibit binding of a fully homologous sequence to a target (ie, hybridization) under conditions of low stringency. This does not mean that low stringency conditions allow non-specific binding; low stringency conditions indicate that the binding of two sequences to each other is a specific (ie selective) interaction. Need. The absence of non-specific binding can be tested by the use of a second target that does not even have a partial degree of complementarity (e.g., less than about 30% identity); in the absence of non-specific binding The probe will then not hybridize to the second non-complementary target.

  It will be well known in the art that a number of equivalent conditions can be used to include low stringency conditions; factors such as probe length and nature (DNA, RNA, base composition) and target Consideration of length and nature (DNA, RNA, base composition, whether in solution or immobilized) and salt concentrations and other components (e.g. presence or absence of formamide, dextran sulfate, polyethylene glycol), hybridization solution May vary to create conditions for low stringency hybridization that differ from, but are equivalent to, the above conditions. Furthermore, conditions that promote hybridization under high stringency conditions are known in the art (eg, increased temperature of the hybridization and / or washing steps, use of formamide in the hybridization solution, etc.).

  As used herein, the term “hybridization” is used to refer to a pair of complementary nucleic acids. Hybridization and hybridization strength (ie, the strength of binding between nucleic acids) are affected by factors such as: degree of complementarity between nucleic acids, stringency of conditions used, Tm of hybrids formed and nucleic acids G: C ratio inside.

  As used herein, the term “stringency” is used for the conditions of the presence of other components, such as temperature, ionic strength, and organic solvent, under which nucleic acid hybridization takes place. One skilled in the art will recognize that “stringency” conditions may be altered by varying the above parameters separately or in combination. Under "high stringency" conditions, nucleobase pairing occurs only when there is a high frequency of complementary base sequences (e.g., hybridization under "high stringency" conditions is approximately 85-100% Identity, preferably between homologs having about 70-100% identity). Under moderate stringency conditions, nucleobase pairing will occur between nucleic acids having a moderate frequency of complementary base sequences (e.g., hybridization under "medium stringency" conditions is approximately Can occur between homologs with 50-70% identity). Thus, “weak” or “low” stringency conditions are often required for nucleic acids derived from genetically different organisms. This is because the frequency of complementary sequences is usually low.

“High stringency conditions” when used for nucleic acid hybridization, 5X SSPE at 42 ° C. (43.8 g / l NaCl, 6.9 g / l NaH ₂ PO ₄ H ₂ O and 1.85 g / l EDTA, adjusted to pH 7.4 with NaOH), 0.5% SDS, 5X Denhardt reagent (50X Denhardt with 500 ml / ml: 5 g Ficoll (Type 400, Pharmacia), 5 g BSA (Fraction V; Sigma) And 100 μg / ml denatured salmon sperm DNA in a solution or hybridization, followed by conditions equivalent to a wash at 42 ° C. with a solution containing 0.1 × SSPE, 1.0% SDS.

  “Medium stringency conditions” when used for nucleic acid hybridization, when using a probe approximately 500 nucleotides long, a solution of 5X SSPE, 0.5% SDS, 5X Denhardt's reagent and 100 μg / ml denatured salmon sperm DNA at 42 ° C Includes conditions equivalent to binding or hybridization in, followed by washing at 42 ° C with a solution containing 1.0X SSPE, 1.0% SDS.

  "Low stringency conditions" means binding or hybridization at 42 ° C in a solution consisting of 5X SSPE, 0.1% SDS, 5X Denhardt's reagent and 100 g / ml denatured salmon sperm DNA when using a probe of approximately 500 nucleotides in length. Then, conditions equivalent to washing in a solution containing 5X SSPE, 0.1% SDS at 42 ° C are included.

  As used herein, the term “polymerase chain reaction” (“PCR”) refers to the methods described in US Pat. Nos. 4,683,195, 4,683,202 and 4,965,188, which are hereby incorporated by reference. A method is described for increasing the concentration of a segment of a target sequence in a genomic DNA mixture without cloning or purification. This method of amplifying a target sequence consists of introducing a large excess of two oligonucleotide primers into a DNA mixture containing the desired target sequence, followed by thermal cycling of the correct sequence in the presence of DNA polymerase. The two primers are complementary to their respective strands of the double stranded target sequence. To perform amplification, the mixture is denatured and then the primer is annealed with its complementary sequence in the target molecule. After annealing, the primer is extended with a polymerase to form a new pair of complementary strands. The steps of denaturation, primer annealing, and polymerase extension are repeated many times (ie, denaturation, annealing and extension constitute one “cycle”; multiple “cycles” can be performed), and a high concentration of the desired target sequence. Obtain an amplified segment. The length of the amplified segment of the desired target sequence is determined by the relative position of the primers with respect to each other, and thus this length is a controllable parameter. Due to the iterative aspect of the process, this method is referred to as the “polymerase chain reaction” (hereinafter “PCR”). The desired amplified segment of the target sequence becomes the dominant sequence (in terms of concentration) in the mixture and these are referred to as “PCR amplified”.

PCR allows a single copy of a specific target sequence in genomic DNA to be amplified to a level detectable by various methods (e.g., hybridization with a labeled probe; incorporation of a biotinylated primer, Avidin-enzyme conjugate detection; incorporation of ³² P-labeled deoxynucleotide triphosphates such as dCTP or dATP into the amplified segment). In addition to genomic DNA, any oligonucleotide or polynucleotide sequence can be amplified using an appropriate set of primer molecules. In particular, the amplification segment created by the PCR process is itself an effective template for subsequent PCR amplification.

  The term “isolated” when used with a nucleic acid as “isolated oligonucleotide” or “isolated polynucleotide” or “isolated nucleic acid sequence encoding a TNF-α binding molecule” means at least one of its natural A source refers to a nucleic acid sequence that has been identified and separated from contaminating nucleic acid originally bound. An isolated nucleic acid is present in a form or setting that is different from that in which it is found in nature. An isolated nucleic acid molecule is therefore distinguished from a nucleic acid molecule because it is present in natural cells. However, an isolated nucleic acid molecule also includes a nucleic acid molecule contained in cells that ordinarily express the polypeptide, where, for example, the nucleic acid molecule is at a chromosomal location different from that of natural cells. An isolated nucleic acid, oligonucleotide, or polynucleotide can exist in single-stranded or double-stranded form. When an isolated nucleic acid, oligonucleotide or polynucleotide is used for protein expression, the oligonucleotide or polynucleotide will contain at least the sense or coding strand (i.e., the oligonucleotide or polynucleotide is single stranded). And may include both sense and antisense strands (ie, an oligonucleotide or polynucleotide may be double stranded).

  As used herein, the term “portion” when used in reference to a nucleotide sequence (as in “a portion of a given nucleotide sequence”) refers to a fragment of that sequence. Fragments can vary in size from 10 nucleotides to full length nucleotide sequence-1 nucleotide (eg, 10 nucleotides, 20, 30, 40, 50, 100, 200, etc.).

  As used herein, the term “portion” when used in reference to an amino acid sequence (as “a portion of a given amino acid sequence”) refers to a fragment of that sequence. Fragments can vary in size from 6 amino acids to full length amino acid sequence-1 amino acid (eg, 6 amino acids, 10, 20, 30, 40, 75, 200, etc.).

  As used herein, the term “purification” or “purify” refers to removing contaminants from a sample. For example, TNF-α specific antibodies can be purified by removing contaminating non-immunoglobulin proteins; they are also purified by removing immunoglobulins that do not bind to the same antigen. Removal of non-immunoglobulin protein and / or removal of immunoglobulin that does not bind to a specific antigen results in an increase in the percentage of antigen-specific immunoglobulin in the sample. In another example, the recombinant antigen-specific polypeptide is expressed in a bacterial host cell and the polypeptide is purified by removal of host cell proteins; the percentage of recombinant antigen-specific polypeptide is thereby determined in the sample. To rise.

  As used herein, the term “recombinant DNA molecule” refers to a DNA molecule composed of segments of DNA joined together by molecular biology techniques.

  As used herein, the term “recombinant protein” or “recombinant polypeptide” refers to a protein molecule expressed from a recombinant DNA molecule.

  As used herein, the term “vector” is used in reference to nucleic acid molecules that move a DNA segment from one cell to another. The term “medium” is often used interchangeably with vector.

  As used herein, the term “expression vector” refers to a recombinant DNA molecule comprising a desired coding sequence and, in particular, an appropriate nucleic acid sequence necessary for expression of the coding sequence operably linked in the host organism. Nucleic acid sequences required for expression in prokaryotes usually include a promoter, an operator (if desired), and a ribosome binding site, often along with other sequences. Eukaryotic cells are known to use promoters, enhancers, termination and polyadenylation signals.

  As used herein, the term “host cell” refers to any eukaryotic or prokaryotic cell (eg, bacterial cell, eg, E. coli, yeast cell, mammalian cell, eg, PER.C6 ™ (Crucell, The Netherlands). ) And CHO cells, avian cells, amphibian cells, plant cells, fish cells, and insect cells), which may be in vitro or in vivo. For example, the host cell may be in a transgenic animal.

  As used herein, the terms “transfection” and “transformation” refer to the introduction of foreign DNA into cells (eg, eukaryotic and prokaryotic cells). Transfection can be accomplished by various means known in the art, such as calcium phosphate-DNA coprecipitation, DEAE-dextran-mediated transfection, polybrene-mediated transfection, electroporation, microinjection, liposome fusion, lipofection, Protoplast fusion, retroviral infection, and gene guns.

  The term “stable transfection” or “stably transfected” refers to the introduction and integration of foreign DNA into the genome of the transfected cell. A “stable transfectant” refers to a cell in which foreign DNA is stably integrated into genomic DNA.

  The term “transient transfection” or “transiently transfected” means that foreign DNA has been introduced into the cell, but the foreign DNA has not been integrated into the genome of the transfected cell. Foreign DNA is retained in the nucleus of the transfected cell for several days. During this time, the foreign DNA is subject to regulatory control that controls the expression of endogenous genes in the chromosome. The term “transient transfectant” refers to a cell that has taken up foreign DNA but has not incorporated this DNA.

  As used herein, the terms “computer memory” and “computer memory device” refer to any storage medium readable by a computer processor. Examples of computer memory include, but are not limited to, RAM, ROM, computer chip, digital video disc (DVD), compact disc (CD), hard disk drive (HDD), and magnetic tape.

  As used herein, the term “computer-readable medium” refers to an apparatus or system that stores and provides information (eg, data and instructions) to a computer processor. Examples of computer readable media include, but are not limited to, DVDs, CDs, hard disk drives, magnetic tapes, and network streaming media servers.

  As used herein, the term “computer-readable medium encoding an indication” of a nucleic acid or amino acid sequence refers to a computer-readable medium that stores information, and when transferred to a processor, displays the nucleic acid or amino acid sequence to a user. (For example, print out or display on the display screen).

  As used herein, the terms “processor” and “central processing unit” or “CPU” are used interchangeably and can read a program from computer memory (eg, ROM or other computer memory), A device that can execute a series of processes according to a program.

  As used herein, the term “Fc region” is the C-terminal region of an immunoglobulin heavy chain (see, eg, FIG. 13). The “Fc region” can be a native sequence Fc region or a variant Fc region (eg, increased or decreased effector function).

  As used herein, an Fc region can have an “effector function” that is responsible for activating or decreasing a physiological activity (eg, in a subject). Examples of effector functions include, but are not limited to: C1q binding; complement-dependent cytotoxicity (CDC); Fc receptor binding; antibody-dependent cell-mediated cytotoxicity (ADCC); Tosis; down-regulation of cell surface receptors (eg B cell receptor; BCR), etc. Such effector functions require the Fc region to be combined with a binding domain (eg, an antibody variable domain) and can be assessed using a variety of assays (eg, Fc binding assay, ADCC assay, CDC assay, etc.).

As used herein, an “isolated” peptide, polypeptide, or protein refers to one that has been identified and separated and / or recovered from a component of its natural environment. Contaminant components of its natural environment are substances that interfere with the diagnostic or therapeutic use of the polypeptide, including enzymes, hormones, and other proteinaceous or non-proteinaceous solutes. In certain embodiments, the isolated polypeptide is purified to the following extent:
(1) Up to 95% by weight of the polypeptide, preferably 99% by weight, as judged by the Lowry method,
(2) to a degree sufficient to obtain at least 15 residues of the N-terminal or internal amino acid sequence using a spinning cup sequenator, or
(3) Using Coomassie blue or silver staining until uniform by SDS-page under reducing or non-reducing conditions.
Isolated polypeptide includes polypeptide in vivo within recombinant cells. This is because at least one component of the polypeptide's natural environment is not present. Ordinarily, however, isolated polypeptide will be prepared by at least one purification step.

  As used herein, the term “therapy” includes both therapeutic treatment and prophylactic or preventative measures. Those that require treatment include those that already have a disorder and those that should be prevented.

  As used herein, a nucleic acid is said to be “operably linked” when it is placed into a functional relationship with another nucleic acid sequence. For example, DNA for a presequence or secretion leader is operably linked to DNA for a polypeptide when it is expressed as a preprotein that is involved in the secretion of the polypeptide; Is operably linked to a coding sequence if it affects the transcription of the ribosome; or a ribosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation. In a preferred embodiment, “operably linked” means that the bound DNA sequences are in close proximity and, in the case of a secretory leader, in close proximity in the reading frame. However, enhancers, for example, need not be in close proximity. Ligation is achieved, for example, by ligation at appropriate restriction sites. If such sites do not exist, synthetic oligonucleotide adapters or linkers may be used according to conventional means.

  The term “under reduced conditions” refers to any degree of qualitative or quantitative reduction in detectable symptoms of any TNF-α mediated disease, including but not limited to a detectable disease. Reduction in effect on recovery rate (eg, body weight recovery rate) or at least one symptom usually associated with a particular disease (eg, reduction in at least one of the following symptoms if TNF-α mediated disease is Crohn's disease: abdominal pain Diarrhea, rectal bleeding, weight loss, fever, loss of appetite, dehydration, anemia, swelling, fibrosis, intestinal inflammation and malnutrition).

  As used herein, the term “human TNF-α” (herein abbreviated as hTNF-α, or simply hTNF) refers to a human that exists as a secreted form of 17 kDa and a membrane-bound form of 26 kDa. It is a cytokine and its bioactive form is composed of non-covalently linked trimers of 17 kDa molecules. The structure of hTNF-α is further described, for example, in Jones, et al. (1989) Nature, 338: 225-228. The term human TNF-α also includes recombinant human TNF-α (rhTNF-α), which can be prepared by standard recombinant expression methods or purchased from commercial sources.

The terms “affinity”, “binding affinity” and “K _d ” refer to the equilibrium dissociation constant associated with each TNF-α binding molecule TNF-α protein complex (expressed in units of concentration). The binding affinity is directly off-rate constant (generally expressed in units of reciprocal time, eg seconds ^-1 ) on-rate constant (generally expressed as concentration units per unit time, eg mol / sec) Is related to the ratio. Binding affinity can be measured, for example, by kinetic exclusion assays or surface plasmon resonance.

As used herein, “dissociation”, “dissociation rate” and “k _off ” refer to the off rate constant for dissociation of a TNF-α binding molecule from an antibody / antigen complex.

As used herein, “binding”, “binding rate” and “k _on ” refer to the on rate constant for binding to form an antibody / antigen complex between a TNF-α binding molecule and an antigen.

As used herein, the terms “effective concentration” and “EC ₅₀ ” refer to TNF-α binding molecules that can interact with TNF-α molecules and neutralize a sufficient amount of TNF-α molecules, approximately 50% The concentration that can affect the treated cells. For example, in the L929 assay (see Example 2), the EC ₅₀ is the concentration required to protect approximately 50% of cells from TNF-a mediated cytotoxicity. In such an assay, the concentration of TNF-α used is the concentration experimentally examined to exert a cytotoxic effect on 90% or more of the cell population. Again, there is no distinction between effective concentration (EC ₅₀ ) and inhibitory concentration (IC ₅₀ ).

DESCRIPTION OF THE INVENTION The present invention provides TNF-α binding molecules and nucleic acid sequences encoding TNF-α binding molecules. In particular, the present invention provides TNF-α binding molecules with high binding affinity, high binding rate, low dissociation rate and low EC ₅₀ values (eg in the L929 cell assay) for human TNF-α. Preferably, the TNF-α binding molecules of the invention comprise light and / or heavy chain variable regions with a fully human framework. In particularly preferred embodiments, the TNF-α binding molecules of the invention comprise light and / or heavy chain variable regions having a human germline framework. The description of the invention is divided into the following sections for convenience: I. TNF-α binding molecules; II. Production of TNF-α binding molecules; III. Therapeutic formulations and uses; and IV. Additional TNF-α binding molecules uses.

I. TNF-α Binding Molecules The present invention provides TNF-α binding molecules having desirable characteristics. In particular, in some embodiments, the TNF-α binding molecule has a high binding affinity (K _d ) for human TNF-α. In another embodiment, the TNF-α binding molecule has a high binding rate constant (k _on ) for human TNF-α. In certain embodiments, the TNF-α binding molecule has a low dissociation rate (k _off ) for human TNF-α. In another embodiment, the TNF-α binding molecule has a low effective concentration (EC ₅₀ ) in cell-based assays. In a preferred embodiment, the TNF-α binding molecules of the invention have high binding affinity, high binding rate, low dissociation rate and are effective at low concentrations. Although it is not necessary to practice or understand the present invention, the TNF-α binding molecules of the present invention with high binding affinity, high binding rate, low dissociation rate and low EC ₅₀ will be particularly suitable for therapeutic use in humans (Eg for the treatment of TNF-α mediated diseases).

  In a further embodiment, the TNF-α binding molecules of the invention do not bind to mouse TNF-α. In another embodiment, the TNF-α binding molecules of the invention do not bind to rat, pig or rhesus monkey, macaque TNF-α.

  In a preferred embodiment, the TNF-α binding molecules of the invention preferably comprise light and / or heavy chain variable regions with a fully human framework. In particularly preferred embodiments, the TNF-α binding molecules of the invention preferably comprise light and / or heavy chain variable regions having a human germline framework. Although it is not necessary to practice or understand the present invention, the TNF-α binding molecules of the present invention (see, eg, the examples below), when administered to humans (eg, for the treatment of disease) have very little immunogen. It is believed that no sexual response is elicited or at all.

  As described in Tables 1, 2, 3, and 6 below, the present invention provides a number of CDRs useful for making TNF-α binding molecules. For example, one or more of the indicated CDRs can be combined with a framework subregion (eg, fully human FR1, FR2, FR3, or FR4) thereby encoding a TNF-α binding peptide or TNF-α binding peptide A nucleic acid sequence is created. Further, the CDRs shown in the following table may be combined so that, for example, three CDRs are present in the light chain variable region and / or three CDRs are present in the heavy chain variable region.

  The CDRs shown below may be inserted into the human framework (for example, by recombinant technology), and inserted into the light and heavy chain frameworks shown in FIGS. 5 and 6 to insert TNF-α binding molecules or TNF-α binding molecules. Nucleic acid sequences that encode can be made. For example, CDRL1 shown in FIG. 5A can be replaced by SEQ ID NO: 9, 11, 13, 15, or 17 shown in Table 1. Similarly, CDRL1 shown in FIG. 5B can be replaced by SEQ ID NO: 10, 12, 14, 16, or 18 shown in Table 1. This same procedure can be used for all CDRs shown in Tables 1-3 and 6. These three tables are shown directly below.

Table 1-Light chain CDRs

* Kabat study was used for residue numbering. CDRs contain Kabat and Chothia residues.
** Changes from hu1 were named by hu1 amino acid, then position, and new amino acid (eg, S31L is S to L change at position 31).
*** “Xaa” indicates that this position can be any amino acid, and “n” indicates that this position can be any nucleotide.

Table 2-Heavy chain CDRs

* Kabat study was used for residue numbering. CDRs contain Kabat and Chothia residues.
** Changes from hu1 were named by hu1 amino acid, then position, and new amino acid (eg, T28K is T to K change at position 28).
*** “Xaa” indicates that this position can be any amino acid, and “n” indicates that this position can be any nucleotide.

Table 3-Further useful CDRs

* Kabat study was used for residue numbering. CDRs contain Kabat and Chothia residues.
** Changes from hu1 were named by hu1 amino acid, then position, and new amino acid (eg, T28K is T to K change at position 28).
*** “Xaa” indicates that this position can be any amino acid, and “n” indicates that this position can be any nucleotide.

Table 6-Further useful CDRs

* Kabat's work was used for residue numbering. CDRs contain Kabat and Chothia residues.

  The present invention also provides substantially the same sequences as the CDR sequences shown in the table above (both amino acids and nucleic acids). For example, one or two amino acids may be changed in the sequence shown in the table. Also, for example, a number of nucleotide bases may be varied in the sequences shown in the table. Changes to the amino acid sequence can be made by changing the nucleic acid sequence encoding the amino acid sequence. Nucleic acids encoding variants of a given CDR can be prepared using methods known in the art using the teachings herein for a particular sequence. These methods include, but are not limited to: Preparation by site-specific (or oligonucleotide-specific) mutagenesis, PCR mutagenesis, and cassette mutagenesis of a nucleic acid encoding a previously prepared CDR. Site-directed mutagenesis is a preferred method for the preparation of substitutional variants. This technique is well known in the art (eg Carter et al., (1985) Nucleic Acids Res. 13: 4431-4443 and Kunkel et. Al., (1987) Proc. Natl. Acad. Sci. USA 82 : 488-492, both of which are incorporated herein by reference).

  Briefly, in performing site-directed mutagenesis of DNA, the starting DNA is altered by hybridizing an oligonucleotide that encodes the desired mutation to a single strand of such starting DNA. After hybridization, a complete second strand is synthesized using a DNA polymerase using a single strand of the starting DNA as a template and a hybridized oligonucleotide as a primer. Thus, an oligonucleotide encoding the desired mutation is incorporated into the resulting double stranded DNA.

  PCR mutagenesis is also suitable for making amino acid sequence variants of the starting CDR (see, e.g., Vallette et. Al., (1989) Nucelic Acids Res. 17: 723-733, incorporated herein by reference). . Briefly, when a small amount of template DNA is used as a starting material in PCR, specific DNA that differs from the template sequence only at positions where the primer differs from the template using primers that differ slightly in sequence from the corresponding regions in the template DNA. You can make a relatively large amount of fragments.

  Another method of preparing variants is cassette mutagenesis, which is based on the technique described in Wells et al. (1985) Gene 34: 315-323, which is hereby incorporated by reference. The starting material is a plasmid (or other vector) containing the starting CDR DNA to be mutated. Identify the codons in the starting DNA to be mutated. There must be a unique restriction endonuclease site on each side of the identified mutation site. If there is no such restriction site, it is created using the oligonucleotide-specific mutagenesis method described above and introduced at the appropriate location in the starting polypeptide DNA. Plasmid DNA is cut at these sites to linearize it. Double-stranded oligonucleotides that encode the sequence of DNA between the restriction sites but contain the desired mutation are synthesized using standard methods. Here, the two strands of the oligonucleotide are synthesized separately and hybridized to each other using standard techniques. Double stranded oligonucleotides are referred to as cassettes. This cassette may be designed to have 5 'and 3' ends that are compatible with the ends of the linear plasmid and ligated directly to the plasmid. This plasmid contains the mutated DNA sequence.

Alternatively or additionally, a desired amino acid sequence encoding a polypeptide variant can be determined and a nucleic acid sequence encoding such an amino acid sequence variant may be generated synthetically. Conservative modifications in the amino acid sequence of CDRs can also be made. Natural residues are classified into classes based on common side chain properties:
(1) Hydrophobic: norleucine, met, ala, val, leu, ile;
(2) Neutral hydrophilicity: cys, ser, thr;
(3) Acidity: asp, glu;
(4) Basic: asn, gln, his, lys, arg;
(5) Residues that affect chain orientation: gly, pro; and
(6) Aromatic: trp, tyr, phe.

  Conservative substitutions mean substitutions from one member of these classes to another member of the same class. The invention also provides complementary strands of the nucleic acid sequences shown in Tables 1-3 and 6 and nucleic acid sequences that hybridize to such nucleic acid sequences under conditions of low, medium and high stringency.

  The CDRs of the present invention can be used with any type of framework. Preferably, CDRs are used with a fully human framework, or framework subregion. In particularly preferred embodiments, the framework is a human germline sequence. An example of a fully human framework is shown in FIGS. Another example is shown in FIG. Other fully human frameworks or framework subregions can also be used. For example, the NCBI website contains sequences of currently known human framework regions. Examples of human VH sequences include but are not limited to: VH1-18, VH1-2, VH1-24, VH1-3, VH1-45, VH1-46, VH1-58, VH1-69, VH1 -8, VH2-26, VH2-5, VH2-70, VH3-11, VH3-13, VH3-15, VH3-16, VH3-20, VH3-21, VH3-23, VH3-30, VH3-33 , VH3-35, VH3-38, VH3-43, VH3-48, VH3-49, VH3-53, VH3-64, VH3-66, VH3-7, VH3-72, VH3-73, VH3-74, VH3 -9, VH4-28, VH4-31, VH4-34, VH4-39, VH4-4, VH4-59, VH4-61, VH5-51, VH6-1, and VH7-81, these are human immunoglobulin chains Including the complete nucleotide sequence of the variable locus, these VH sequences are provided in Matsuda et al., (1998) J. Exp. Med. 188: 1973-1975, which is incorporated herein by reference. Examples of human VK sequences include, but are not limited to: A1, A10, A11, A14, A17, A18, A19, A2, A20, A23, A26, A27, A3, A30, A5, A7, B2, B3 , L1, L10, L11, L12, L14, L15, L16, L18, L19, L2, L20, L22, L23, L24, L25, L4 / 18a, L5, L6, L8, L9, O1, O11, O12, O14 O18, O2, O4, and O8, Kawasaki et al., (2001) Eur. J. Immunol. 31: 1017-1028; Schable and Zachau, (1993) Biol. Chem. Hoppe Seyler 374: 1001-1022 And Brensing-Kuppers et al., (1997) Gene 191: 173-181, all of which are incorporated herein by reference. Examples of human VL sequences include, but are not limited to: V1-11, V1-13, V1-16, V1-17, V1-18, V1-19, V1-2, V1-20, V1- 22, V1-3, V1-4, V1-5, V1-7, V1-9, V2-1, V2-11, V2-13, V2-14, V2-15, V2-17, V2-19, V2-6, V2-7, V2-8, V3-2, V3-3, V3-4, V4-1, V4-2, V4-3, V4-4, V4-6, V5-1, V5- 2, V5-4, and V5-6, which are provided in Kawasaki et al., (1997) Genome Res. 7: 250-261, which is hereby incorporated by reference. A fully human framework may be selected from any such functional germline gene. In general, these frameworks differ from each other by a limited number of amino acid changes. These frameworks can be used with the CDRs described herein. For example, L6, a gene often used in the Vk3 subfamily, can be selected as an alternate framework for the light chain of the TNF-α binding molecule of the present invention. Examples of additional human frameworks that can be used with the CDRs of the invention include, but are not limited to, KOL, NEWM, REI, EU, TUR, TEI, LAY and POM (e.g., Kabat et al., ( (1991) Sequences of Proteins of Immunological Interest, US Department of Health and Human Services, NIH, USA; and Wu et al., (1970), J. Exp. Med. 132: 211-250, both cited by reference. Included in this specification).

  Also, although not necessary to practice or understand the present invention, the reasons for using germline sequences that are believed to help eliminate harmful immune responses in many individuals are as follows. Somatic mutations frequently occur in the variable region of immunoglobulins as a result of affinity maturation processes that occur during normal immune responses. These mutations mainly clump around the hypervariable CDRs, but also affect residues in the framework regions. These framework mutations are not present in germline genes and appear to be immunogenic in patients. On the other hand, the general population is exposed to the majority of framework sequences expressed from germline genes and, as a result of immune tolerance, these germline frameworks are considered to be less or less immunogenic in patients. To maximize potential for tolerance, genes encoding variable regions can be selected from commonly occurring populations of functional germline genes, and genes encoding VH and VL regions are specific for immunoglobulin molecules Further selection may be made to match the known bonds between the heavy and light chains.

II. Generation of TNF-α Binding Molecules In a preferred embodiment, a TNF-α binding molecule of the invention comprises an antibody or antibody fragment (eg, comprising one or more of the CDRs described herein). The antibodies, or antibody fragments of the present invention can be prepared by recombinant expression of immunoglobulin light and heavy chain genes in host cells. For example, to recombinantly express an antibody, the host cell is transfected with one or more recombinant expression vectors carrying DNA fragments encoding the immunoglobulin light and heavy chains of the antibody, and the light and heavy chains are then transfected. The chain is expressed in the host cell, preferably secreted into the medium in which the host cell is cultured, and the antibody is recovered from the medium. Standard recombinant DNA methods are used to obtain antibody heavy and light chain genes, these genes are incorporated into recombinant expression vectors, and the vectors are introduced into host cells. This is incorporated herein by reference, Sambrook, Fritsch and Maniatis (eds), Molecular Cloning; A Laboratory Manual, Second Edition, Cold Spring Harbor, NY, (1989), Ausubel, FM et al. (Eds. ) Current Protocols in Molecular Biology, Greene Publishing Associates, (1989) and US Pat. No. 4,813,697, Boss et al.

  In order to express an antibody having one or more CDRs of the present invention, DNA fragments encoding light chain and heavy chain variable regions are first obtained. These DNAs can be obtained by amplifying and modifying germline light and heavy chain variable sequences using the polymerase chain reaction (PCR). Germline DNA sequences for human heavy and light chain variable region genes are known in the art (see above).

  Once the germline VH and VL fragments are obtained, these sequences are mutated to encode one or more CDR amino acid sequences disclosed herein (see, eg, Tables 1-3 and 6). The amino acid sequence encoded by the germline VH and VL DNA sequences is compared with the desired CDR sequence to identify amino acid residues that differ from the germline sequence. The genetic code is then used to determine which nucleotide changes should be made, and the appropriate nucleotide of the germline DNA sequence is mutated so that the germline sequence encodes the selected CDR (e.g., Table 1). 6 CDRs selected from -3 and 6). Germline sequence mutagenesis is standard methods such as PCR-mediated mutagenesis (nucleotides to be mutated are incorporated into PCR primers and PCR products contain mutations) or site-directed mutagenesis. Can be done. In another embodiment, the variable region is newly synthesized (eg, using a nucleic acid synthesizer).

  Once DNA fragments encoding the desired VH and VL segments are obtained (e.g., by amplification and mutagenesis of the germline VH and VL genes or synthetic synthesis as described above), these DNA fragments can be further assembled into standard sets. For example, the variable region gene may be converted into a full-length antibody chain gene, a Fab fragment gene, or an scFv gene. In these manipulations, a VL- or VH-encoding DNA fragment is operably linked to another polypeptide, eg, another DNA fragment encoding an antibody constant region or a flexible linker. Isolated DNA encoding the VH region can be converted to a full-length heavy chain gene by operably linking the VH-encoding DNA to another DNA molecule encoding the heavy chain constant region (CH1, CH2 and CH3). Human heavy chain constant region gene sequences are known in the art (e.g., Kabat, EA, et al., (1991) Sequences of Proteins of Immunological Interest, Fifth Edition, US Department of Health and Human Services, NIH Publication No. 91-3242), DNA fragments containing these regions are obtained by standard PCR amplification. The heavy chain constant region may be, for example, an IgG1, IgG2, IgG3, IgG4, IgA, IgE, IgM or IgD constant region, but most preferably is an IgG1 or IgG4 constant region. For Fab fragment heavy chain genes, the VH-encoding DNA may be operably linked to another DNA molecule that encodes only the heavy chain CH1 constant region.

  Isolated DNA encoding the VL region can be converted to a full-length light chain gene (and a Fab light chain gene). This can be done by operably linking VL-encoding DNA with another DNA molecule encoding the light chain constant region, CL. The sequences of human light chain constant region genes are known in the art (e.g., Kabat, EA, et al., (1991) Sequences of Proteins of immunological Interest, Fifth Edition, US Department of Health and Human Services.NIH Publication No. 91-3242), DNA fragments containing such regions can be obtained by standard PCR amplification. The light chain constant region may be either a kappa or lambda constant region, but most preferably is a kappa constant region.

To create the scFv gene, the VH and VL-encoding DNA fragments are operably linked to another fragment encoding a flexible linker, such as one encoding the amino acid sequence (Gly ₄ -Ser) _3, to generate VH and VL The sequence may be expressed as a continuous single chain protein, where the VL and VH regions are linked by a flexible linker (eg, Bird et al., (1988) Science 242: 423-426; Huston et al (1988) Proc. Natl. Acad. Sci. USA 85: 5879-5883; McCafferty et al., (1990) Nature 348: 552-554, all of which are incorporated herein by reference).

In order to express the antibody or antibody fragment of the present invention, the DNA encoding the partial or full-length light and heavy chains obtained as described above can be inserted into an expression vector to operate the gene with transcriptional and translational control sequences. You may connect to. In this case, the term “operably linked” refers to that the antibody gene is ligated to the vector and that the transcriptional and translational control sequences in the vector perform the intended function of controlling the transcription and translation of the antibody gene. The expression vector and expression control sequences are generally chosen to be compatible with the expression host cell used. The antibody light chain gene and the antibody heavy chain gene may be inserted into separate vectors, but more generally both genes are inserted into the same expression vector. The antibody gene is inserted into the expression vector by standard methods (eg, ligation of complementary restriction sites on the antibody gene fragment and vector, or blunt end ligation if no restriction sites are present). Prior to insertion of the light or heavy chain sequence, the expression vector should already carry the antibody constant region sequence. For example, one approach to convert VH and VL sequences into full-length antibody genes is to insert them into expression vectors that already encode the heavy and light chain constant regions, respectively, and insert the VH segment into the CH segment in the vector. And the VL segment is operably linked to the CL segment in the vector. Additionally or alternatively, the recombinant expression vector may encode a signal peptide that facilitates secretion of the antibody chain from a host cell. The antibody chain gene is cloned into the vector and the signal peptide is linked in-frame to the amino terminus of the antibody chain gene. The signal peptide may be an immunoglobulin signal peptide or a heterologous signal peptide (ie, a signal peptide from a non-immunoglobulin protein).
In addition to the antibody chain gene, the recombinant expression vector of the present invention may retain regulatory sequences that control the expression of the antibody chain gene in a host cell. The term “regulatory sequence” includes promoters, enhancers and other control elements (eg, polyadenylation signals) that control the transcription or translation of the antibody chain genes. Such regulatory sequences are described, for example, in Goeddel; Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif. (1990), which is incorporated herein by reference. Those skilled in the art will appreciate that the design of an expression vector, including the selection of regulatory sequences, depends on factors such as: selection of host cells to be transformed, level of expression of the desired protein, etc. . Preferred regulatory sequences for mammalian host cell expression include: viral elements that provide high levels of protein expression in mammalian cells, such as cytomegalovirus (CMV) (eg, CMV promoter / enhancer), simian virus 40 (SV40 ) (Eg, SV40 promoter / enhancer), adenovirus, (eg, adenovirus major late promoter (AdMLP)) and polyoma virus-derived promoters and / or enhancers. For further description of viral regulatory elements and their sequences, see US Pat. Nos. 5,516,062, Stinski, 4510245, Bell et al. And 4968615, Schaffner et al., All of which are hereby incorporated by reference.

  In addition to antibody chain genes and regulatory sequences, the recombinant expression vectors of the invention may carry additional sequences, such as sequences that control replication of the vector in host cells (eg, origins of replication) and selectable marker genes. The selectable marker gene allows selection of host cells into which the vector has been integrated (eg, US Pat. Nos. 4,399,216, 4,634,665 and 5179017, all Axel et al.). For example, typically the selectable marker gene confers drug resistance, eg, resistance to G418, hygromycin or methotrexate, to a host cell into which the vector has been introduced. Preferred selectable marker genes include the dihydrofolate reductase (DHFR) gene (for dhfr-host cells using methotrexate selection / amplification) and the neomycin gene (for G418 selection).

  For expression of light and heavy chains, expression vectors encoding the heavy and light chains may be transfected into host cells by standard techniques. Various forms of the term “transfection” are intended to include various techniques commonly used to introduce foreign DNA into prokaryotic or eukaryotic host cells, eg, electroporation, calcium phosphate precipitation, DEAE-dextran. For example, transfection.

  Preferred mammalian host cells for expression of the recombinant antibodies of the invention include PER.C6 ™ cells (Crucell, The Netherlands), Chinese hamster ovary (CHO cells) (including dhfr-CHO cells, Urlaub and Chasin (1980) Proc. Natl. Acad. Sci. USA 77: 4216-4220, used with DHFR selectable markers, e.g., described in RJ Kaufman and PA Sharp (1982) Mol. Biol. 159: 601-621), NSO myeloma cells, COS cells and SP2 cells. When introducing a recombinant expression vector encoding an antibody gene into a mammalian host cell, the antibody is generally produced by culturing the host cell for a time sufficient to allow expression of the antibody in the host cell, or more Preferably, the antibody is produced by culturing the host cell for a time sufficient to be secreted into the medium in which the host cell is cultured. Antibodies can be recovered from the culture medium by standard protein purification methods.

  Host cells can also be used to produce intact antibody portions, such as Fab fragments or scFv molecules. It should be understood that modifications to the above procedure are within the scope of the present invention. For example, it may be desirable to transfect host cells with DNA encoding either the light chain or the heavy chain of an antibody of the invention. Recombinant DNA technology can also be used to remove some or all of the DNA encoding one or both of the light and heavy chains that are not required for binding to hTNF-α. Molecules expressed from such truncated DNA molecules are also included in the antibodies of the present invention. Furthermore, one heavy chain and one light chain are antibodies of the present invention, and the other heavy chain and light chain are a bifunctional antibody specific for an antigen other than hTNF-α. It can also be produced by cross-linking with antibodies by standard chemical cross-linking methods.

  In one preferred form of recombinant expression of an antibody or fragment thereof, a recombinant expression vector encoding both the antibody heavy chain and antibody light chain is introduced into dhfr-CHO cells by calcium phosphate mediated transfection. In the recombinant expression vector, the antibody heavy chain and light chain genes are enhancer / promoter regulatory elements (e.g., derived from SV40, CMV, adenovirus, etc., for example, CMV enhancer / AdMLP promoter regulatory element or SV40 enhancer / AdMLP promoter regulatory element). Operably linked to high levels of gene transcription. The recombinant expression vector may carry a DHFR gene, which allows selection of CHO cells transfected with the vector using methotrexate selection / amplification. Selected transformed host cells are cultured to allow expression of antibody heavy and light chains, and intact antibody is recovered from the medium. Recombinant expression vectors are prepared using standard molecular biology techniques, transfected into host cells, transformants are selected, host cells are cultured, and antibodies are recovered from the medium.

  In certain embodiments, the antibodies and antibody fragments of the invention are produced in transgenic animals. For example, transgenic sheep and cows can be engineered to produce antibodies or antibody fragments in their milk (e.g., Pollock DP, et al., (1999) Transgenic milk as a method, which is incorporated herein by reference). for the production of recombinabt antibody. J. Immunol. Methods 231: 147-157). The antibodies and antibody fragments of the invention can also be produced in plants (eg, Larrick et al., (2001) Production of secretory IgA antibofy in plants. Biomol. Eng. 18: 87-94, incorporated herein by reference). reference). Additional methods and purification protocols are provided in Humphreys et al., (2001) Therapeutic antibody production technologies: Molecules applications, expression and purification, Curr. Opin. Drug Discov. Devel. 4: 172-185, which is incorporated herein by reference. ing. In certain embodiments, the antibodies or antibody fragments of the present invention are produced by transgenic chickens (see, eg, US Patent Publication Nos. 20020108132 and 20020028488, both of which are incorporated herein by reference).

III. Therapeutic Formulations and Uses The TNF-α binding molecules (eg, antibodies and antibody fragments) of the present invention are useful for the treatment of subjects having a medical condition or condition associated with abnormal levels of substances reactive with TNF-α binding molecules. It is. Such abnormal levels are, for example, excess or less of TNF-α than is present in normal healthy subjects, such excess or low levels being systemic, local or certain tissue types in the body Or say what happens to the position. Such tissue types include, but are not limited to: blood, lymph, CNS, liver, kidney, spleen, myocardium or blood vessels, brain or spinal cord, white or gray matter, cartilage, ligament, tendon, lung, pancreas, Ovary, testis and prostate. An increase or decrease in TNF-α concentration compared to normal levels can be localized to specific areas or cells in the body, such as joints, synovium, neurovascular junctions, bones, specific tendons or ligaments, or Infectious sites include, for example, bacterial or viral sites.

TNF-related conditions include, but are not limited to:
(A) Acute and chronic immune and autoimmune diseases such as systemic lupus erythematosus (SLE), rheumatoid arthritis, thyroiditis, graft-versus-host disease, scleroderma, diabetes mellitus, Graves' disease, etc .;
(B) sepsis, cachexia, circulatory collapse and / or shock due to acute or chronic bacterial, viral parasites or fungal infections;
(C) Inflammatory diseases such as chronic and vascular inflammatory symptoms such as, but not limited to, chronic inflammatory symptoms such as, but not limited to, sarcoidosis, inflammatory bowel disease (ie ulcerative colitis and Crohn's disease) And vascular inflammatory symptoms such as, but not limited to, disseminated intravascular blood coagulation, atherosclerosis, and Kawasaki disease;
(D) neurodegenerative diseases such as, but not limited to, demyelinating diseases such as multiple sclerosis and acute transverse myelitis; extrapyramidal and cerebellar disorders such as corticospinal injuries; basal ganglia disorders Hyperactivity disorders such as Huntington's disease and senile chorea; drug-induced movement disorders such as those induced by drugs that block CNS dopamine receptors; hypokinetic disorders such as Parkinson's disease; Paralysis; Cerebellar and spinocerebellar disorders, such as organic lesions of the cerebellum; spinocerebellar degeneration (spinal ataxia, Friedreich's ataxia, cerebellar cortical degeneration, multisystem degeneration (Shy-Drager syndrome, Dejerin Sottas) , And Machado-Joseph disease)); and systemic disorders (lefsum syndrome, ataxia, peripheral vasodilation, and mitochondrial multisystem disorders); demyelinating nuclear disorders, examples For example, multiple sclerosis, acute transverse myelitis; motor unit disorders, such as neuromuscular atrophy (anterior horn cell degeneration, such as amyotrophic lateral sclerosis, pediatric spinal muscular atrophy and Juvenile spinal muscular atrophy); Alzheimer's disease; middle-aged Down syndrome; diffuse Lewy body disease; Lewy body type senile dementia; Wernicke-Korsakov syndrome; chronic alcoholism; Creutzfeldt-Jakob disease; Subacute sclerosing panencephalitis, Hallelfolden-Spatz disease; and fighter dementia, or a subset thereof;
(E) Malignant pathology related to TNF-secreting tumors or other malignant tumors with TNF, including but not limited to leukemia (acute, chronic myelocytic, chronic lymphocytic and / or myelodysplastic syndrome); lymphoma (Hodgkin And non-Hodgkin lymphoma, such as malignant lymphoma (Burkitt lymphoma or mycosis fungoides)); and
(F) Alcohol-induced hepatitis.

  Additional TNF-α pathologies include but are not limited to: psoriasis, psoriatic arthritis, Wegner's granulomatosis, ankylosing spondylitis, heart failure, reperfusion injury, chronic obstructive pulmonary disease, pulmonary fibrosis, And hepatitis C infection. See, for example, Berkow et al., Eds., The Merck Manual, 16th edition, chapter 11, pp 1380-1529, Merck and Co., Rahway, N.J., 1992, incorporated herein by reference.

  The TNF-α binding molecule of the present invention may be administered by any suitable means, for example, administration as follows: parenteral, parenteral-parenteral, subcutaneous, topical, intraperitoneal, intrapulmonary, nasal cavity Internal and intralesional administration (eg for local immunosuppressive treatment). Parenteral injection includes, but is not limited to, administration as follows: intramuscular, intravenous, intraarterial, intraperitoneal, or subcutaneous administration. Furthermore, TNF-α binding molecules can be preferably administered by pulse infusion, particularly at reduced doses. Preferably administration is by injection, most preferably by intravenous or subcutaneous injection, depending on whether the administration is short-term or long-term.

  Dosage regimens may be adjusted to provide the optimum desired response (eg, a therapeutic or prophylactic response). For example, a single bolus may be administered, several divided doses may be administered over a period of time, or the dose may be proportionally increased or decreased depending on the urgency of the treatment situation. It is convenient to formulate parenteral compositions in dosage unit form for ease of administration and uniformity of dosage. The dose of the TNF-α binding molecule of the present invention comprises (a) the specific properties of the active compound and the specific therapeutic or prophylactic effect to be achieved, and (b) the formulation of such active compound for the treatment of sensitivity in an individual. Generally depends on limitations inherent in the art.

  An exemplary non-limiting range for a therapeutically or prophylactically effective amount of an antibody or antibody fragment (or other TNF-α binding molecule of the invention) is 0.1-20 mg / kg, more preferably 1-10 mg / kg . Note that dose values vary depending on the type and severity of symptoms to be alleviated. For any particular subject, the specific dosage and dosage should be adjusted according to individual requirements and the judgment of the expert supervising the administration or administration of the composition, and the dose ranges given herein are merely illustrative It should be further understood that the invention is intended to be limiting and not limiting.

  The dose administered will, of course, depend on known factors such as: pharmacodynamic properties of the particular drug, mode and route of administration, recipient age, health and weight, nature and extent of symptoms, type of combination treatment , Treatment frequency, and desired effect. For example, the daily dose of active ingredient can be about 0.01-100 mg / kg body weight. Usually 1.0 to 5, and preferably 1 to 10 mg / kg / day, in divided doses 1 to 6 times a day, or sustained release forms are effective to obtain the desired results.

  By way of non-limiting example, treatment of TNF-related conditions in humans or animals can provide a TNF-α binding molecule of the invention at the following daily doses: 0.1-100 mg / kg, eg 0.5, 0.9, 1.0 1.1, 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 25, 26, 27, 28, 29, 30, 40, 45, 50, 60, 70, 80, 90 or 100 mg / kg / day, at least 1, 2, 3, 4, 5, 6, 7, 8 , 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33 , 34, 35, 36, 37, 38, 39, or 40 days, or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 , 15, 16, 17, 18, 19 or 20 weeks, or combinations thereof, and single or divided doses every 24, 12, 8, 6, 4, or 2 hours or combinations thereof.

  Dosage forms (composition) suitable for internal administration generally contain from about 0.1 mg to about 500 mg of active ingredient per unit. In such pharmaceutical compositions, the active ingredient is usually present in an amount of about 0.5-95% by weight, based on the total weight of the composition.

  The TNF-α binding molecule of the present invention may be incorporated into a pharmaceutical composition suitable for administration to a subject. For example, a pharmaceutical composition may include a TNF-α binding molecule (eg, an antibody or antibody fragment) and a pharmaceutically acceptable carrier. As used herein, “pharmaceutically acceptable carrier” includes physiologically compatible solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents and the like. Examples of pharmaceutically acceptable carriers include one or more of the following: water, saline, phosphate buffered saline, dextrose, glycerol, ethanol, and the like, and combinations thereof. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride in the composition. The pharmaceutically acceptable carrier may further contain minor amounts of adjuvants such as wetting or emulsifying agents, preservatives or buffering agents that enhance the expiration date or effectiveness of the TNF-α binding molecule.

  The composition of the present invention may be in various forms. Such forms include, for example, the following: liquid, semi-solid and solid dosage forms, such as liquid solutions (eg, injectable and injectable solutions), dispersions or suspensions, tablets, pills, powders , Liposomes and suppositories. The preferred form depends on the desired mode of administration and therapeutic application. A typical preferred composition is an injectable or injectable solution, such as a composition similar to that used for passive human immunization with other antibodies.

  The therapeutic composition is typically sterile and stable under the conditions of manufacture and storage. The composition may be formulated as follows: solution, microemulsion, dispersion, liposome, or other ordered structure suitable for high drug concentrations. Sterile injectable solutions can be prepared by incorporating the active compound (ie, antibody or antibody fragment) in the required amount, in an appropriate solvent, optionally with one or a combination of the above components, and then sterile filtered. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle that contains a basic dispersion medium and the other desired ingredients described above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred method of preparation is to perform vacuum drying and lyophilization to obtain a powder of the active ingredient and the desired further ingredients from the previously sterile filtered solution. Is. The proper fluidity of a solution can be maintained, for example, by the use of a coating such as lecithin. This is done by maintaining the required particle size in the case of dispersions and the use of surfactants. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent that delays absorption, for example, monostearate salts and gelatin.

  In certain embodiments, the active compounds may be prepared with carriers that will protect the compound against rapid release, resulting in a sustained release formulation, for example, implants, transdermal patches, and microencapsulated delivery systems. Biodegradable, biocompatible polymers may be utilized, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Many methods for the preparation of such formulations are patented or generally known to those skilled in the art (e.g. Sustained and Controlled Release Drug Delivery Systems, JR Robinson. Ed., Marcel Dekker, Inc., New York, 1978. reference).

  In certain embodiments, the TNF-α binding molecules of the invention may be orally administered, for example, with an inert diluent or an absorbable edible carrier. The compound (and other ingredients, if desired) may be contained in hard or soft shell gelatin capsules, compressed into tablets, or incorporated directly into the subject's diet. For oral therapeutic administration, the compounds may be incorporated with excipients and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, etc. . To administer a compound of the present invention other than by parenteral administration, it may be necessary to coat the compound with a substance that prevents its inactivation or co-administer the compound with it.

  Supplementary active compounds may be incorporated into the compositions. In certain embodiments, a TNF-α binding molecule (eg, antibody or antibody fragment) of the invention is co-formulated and / or co-administered with one or more additional therapeutic agents useful for the treatment of disorders where TNF-α activity is detrimental. Is done. For example, a TNF-α binding molecule of the invention may be co-formulated and / or co-administered with: one or more antibodies that bind to other targets (eg, antibodies or cell surface molecules that bind other cytokines). Antibodies that bind), one or more cytokines, soluble TNF-α receptor (see, eg, PCT Publication WO 94/06476) and / or one or more chemicals that inhibit hTNF-α production or activity (eg, PCT Publication) Cyclohexane-ylidene derivatives described in WO 93119751). Furthermore, the TNF-α binding molecule of the present invention may be used in combination with one or more of the above therapeutic agents. Such combination therapies beneficially use the administered therapeutics at low doses, thereby avoiding possible toxicity or complications from various monotherapy.

  Non-limiting examples of rheumatoid arthritis therapeutics that can be combined with the TNF-α binding molecules of the present invention include, but are not limited to: nonsteroidal anti-inflammatory drugs (NSAIDs); cytokine suppression Anti-inflammatory drug (CSAID); CDP-571 / BAY-10-3356 (humanized anti-TNF-α antibody; Celltech / Bayer); cA2 (chimeric anti-TNF-α antibody; Centocor); 75 kDa TNFR- IgG (75 kDa TNF receptor-IgG fusion protein; Immunex; see, for example, Arthritis & Rheumatism (1994) Vol. 37. S295; J. Invest Med. (1996) Vol. 44 235A); 55 kDa TNFR-IgG (55 kDa TNF receptor-IgG fusion protein; Hoffmann-LaRoche); IDEC-CE9.I / SB 210396 (non-destructive primatized anti-CD4 antibody; IDEC / SmithKline; e.g. Arthritis & Rheumatism (1995) Vol. 38, DAB 486-IL-2 and / or DAB 389-IL-2 (IL-2 fusion protein; Seragen; see, for example, Arthritis & Rheumatism (1993) Vol. 36, 1223); anti-Tac ( Humanized anti-IL-2R.α; Protein Design La bs / Roche); IL-4 (anti-inflammatory cytokine; DNAX / Schering); IL-10 (SCH 52000; recombinant IL-10, anti-inflammatory cytokine; DNAX / Schering); IL-10 and / or IL-4 agonist (e.g. agonist antibody); IL-1 RA (IL-1 receptor antagonist; Synergen / Amgen); TNF-bp / s-TNFR (soluble TNF binding protein; e.g. Arthritis & Rheumatism (1996) Vol. 39 No. 9 (supplement), S284; see Heart and Circulatory Physiology (1995) Vol. 268, pp. 3742); R973401 (phosphodiesterase type IV inhibitor; see Arthritis & Rheumatism (1996) Vol. 39. No. 9 (supplement), see S282); MK-966 (COX-2 inhibitor; see, for example, Arthritis & Rheumatism (1996) Vol. 3, No. 9 (supplement), S81); Iloprost (eg, Arthritis & Rheumatism (1996) Vol. 39.No. 9 (supplement), see S82); methotrexate: thalidomide (see, for example, Arthritis & Rheumatism (1996) Vol. 9, No. 9 (supplement), S282) Yo Thalidomide-related drugs (eg Celgen); leflunomide (anti-inflammatory and cytokine inhibitors; eg Arthritis & Rheumatism (1996) Vol. 39 No. 9 (supplement), S131; Inflammation Research (1996) Vol 4, pp. 103-107); tranexamic acid (plasminogen activation inhibitor; see, for example, Arthritis & Rheumatism (1996) Vol. 39, No. 9 (supplement), S284); T614 (cytokine inhibition) Agents; see, for example, Arthritis & Rheumatism (1996) Vol. 39 No. 9 (supplement), S282); prostaglandin E1 (see, for example, Arthritis & Rheumatism (1996) Vol. 39, No. 9 (supplement), S282) ); Tenidap (non-steroidal anti-inflammatory drugs; see, for example, Arthritis & Rheumatism (1996) Vol. 39 No. 9 (supplement), S280); naproxen (non-steroidal anti-inflammatory drugs; for example, Neuro Report ( 1996) Vol. 7, pp. 1209-1213); meloxicam (non-steroidal anti-inflammatory drug); ibuprofen ( Non-steroidal anti-inflammatory drugs); Piroxicam (non-steroidal anti-inflammatory drugs); Diclofenac (non-steroidal anti-inflammatory drugs); Indomethacin (non-steroidal anti-inflammatory drugs); Sulfasalazine (e.g. Arthritis & Rheumatism (1996) Vol. 9, No. 9 (supplement), see S281); azathioprine (see, eg, Arthritis & Rheumatism (1996) Vol. 39 No. 9 (supplement), S281); ICE inhibitor (of the enzyme interleukin-1 beta converting enzyme) Inhibitors); zap-70 and / or Ick inhibitors (inhibitors of tyrosine kinase zap-70 or Ick); VEGF inhibitors and / or VEGF-R inhibitors (vascular endothelial growth factor or vascular endothelial growth factor receptor) Inhibitors of the body; inhibitors of angiogenesis); corticosteroid anti-inflammatory drugs (e.g. SB203580); TNF-convertase inhibitors; anti-IL-12 antibodies; interleukin-11 (e.g. Arthritis & Rheumatism ( 1996) Vol. 39, No. 9 (supplement), see S296); Turleukin-13 (see, eg, Arthritis & Rheumatism (1996) Vol. 39, No. 9 (supplement), S308); interleukin-17 inhibitors (eg, Arthritis & Rheumatism (1996) Vol. 39. No. 9 ( supplement), see S120); gold; penicillamine; chloroquine; hydroxychloroquine; chlorambucil; cyclophosphamide; cyclosporine; systemic lymphoid tissue irradiation; anti-thymocyte globulin; anti-CD4 antibody; CD5-toxin; peptide for oral administration Robenzarit disodium; Cytokine regulators (CRA) HP228 and HP466 (Houghten Pharmaceuticals, Inc.); ICAM-1 antisense phosphorothioate oligodeoxynucleotides (ISIS 2302; Isis Pharmaceuticals, Inc.); soluble complement receptor 1 (TP10; T Cell Sciences, Inc.); Prezonidone. Orgothein; Glycosaminoglycan polysulfate; Minocycline; Anti-IL-2R Body; marine and plant lipids (fish and plant seed fatty acids; see, eg, DeLuca et al. (1995) Rheum. Dis. Clin. North Am. 21: 759-777); auranofm; phenylbutazone; meclofenamic acid Flufenamic acid; intravenous immunoglobulin; zileuton; mycophenolic acid (RS-61443); tacrolimus (FK-506); sirolimus (rapamycin); amiprilose (therafectin); cladribine (2- Chlorodeoxyadenosine); azaribine, and D2E7 antibody (see US Pat. No. 6,258,562, incorporated herein by reference).

  Non-limiting examples of therapeutic agents for inflammatory bowel disease that can be combined with the TNF-α binding molecules of the present invention include, but are not limited to: budenoside; epidermal growth factor; corticosteroids; Cyclosporine, sulfasalazine; aminosalicylic acid; 6-mercaptopurine; azathioprine; metronidazole; lipoxygenase inhibitor; mesalamine; olsalazine; balsalazide; antioxidant; thromboxane inhibitor; IL-1 receptor antagonist; IL-1 beta monoclonal antibody; anti-IL-6 monoclonal antibody; growth factor; elastase inhibitor; pyridinyl-imidazole compound; CDP-571 / BAY-10-3356 (humanized anti-TNF-α antibody; Celltech / Bayer) cA2 (chimeric anti-TNF-α antibody; Centocor); 75 kDa TNFR-IgG (75 kDa TNF receptor-IgG fusion protein; Immunex; eg Arthritis & Rheu matism (1994) Vol. 7, S295; J. Invest. Med. (1996) Vol. 44 235A); 55 kDa TNFR-IgG (55 kDa TNF receptor-IgG fusion protein; Hoffmann-LaRoche); interleukin- 10 (SCH 52000; Schering Plow); IL-4 (anti-inflammatory cytokine; DNAX / Schering); IL-10 and / or IL4 agonist (e.g., agonist antibody); Interleukin-11; prednisolone, dexamethasone or budesonide Glucuronide- or dextran-linked prodrug; ICAM-1 antisense phosphorothioate oligodeoxynucleotide (ISIS 2302; Isis Pharmaceuticals, Inc.); soluble complement receptor 1 (TP10; T Cell Sciences, Inc.); sustained release mesalazine Methotrexate; antagonist of platelet activating factor (PAF); ciprofloxacin; and lignocaine.

  Non-limiting examples of therapeutic agents for multiple sclerosis that may be combined with the TNF-α binding molecules of the present invention include, but are not limited to: corticosteroids; prednisolone; methylprednisolone; azathioprine; Phosphamide; cyclosporine; methotrexate; 4-aminopyridine; tizanidine; interferon-beta 1a (Avonex.TM .; Biogen); interferon-beta 1b (Betaseron.TM .; Chiron / Berlex); copolymer 1 (Cop1; Copaxone. TM .; Teva Pharmaceutical Industries, Inc.); hyperbaric oxygen; intravenous immunoglobulin; clabribine; CDP-571 / BAY-10-3356 (humanized anti-TNF-α antibody; Celltech / Bayer); cA2 (Chimeric anti-TNF-α antibody; Centocor); 75 kDa TNFR-IgG (75 kDa TNF receptor-IgG fusion protein; Immunex; e.g. Arthritis & Rheumatism (1994) Vol. 37, S295; J Invest. Med. 1996) Vol. 44, 235A); 55 kDa TNFR-IgG (55 kDa T NF receptor-IgG fusion protein; Hoffmann-LaRoche); IL-10; IL-4 (anti-inflammatory cytokine; DNAX / Schering); and IL-10 and / or IL-4 agonists (eg, agonist antibodies).

  Non-limiting examples of sepsis therapeutics that may be combined with the TNF-α binding molecules of the present invention include, but are not limited to: hypertonic saline solution; antibiotics; intravenous gamma globulin; continuous blood Carbapenem (eg, meropenem); Cytokines, eg, antagonists of TNF-α, IL-6 and / or IL-8; CDP-571 / BAY-10-3356 (humanized anti-TNF-α antibody; Celltech / Bayer); cA2 (chimeric anti-TNF-α antibody; Centocor); 75 kDa TNFR-IgG (75 kDa TNF receptor-IgG fusion protein; lmmunex; for example, Arthritis & Rheumatism (1994) Vol. 37, S295; J Invest Med. (1996) Vol. 44, 235A); 55 kDa TNFR-IgG (55 kDa TNF receptor-IgG fusion protein; Hoffmann-LaRoche); cytokine regulator (CRA) HP228 and HP466 (Houghten Pharmaceuticals, Inc. ); SK & F 107647 (low molecular weight peptide; SmithKline Beecham); tetravalent guanylhydrazone CNI-1493 (Picower Institute); histology Child pathway inhibitor (TFPI; Chiron); PHP (Chemically modified hemoglobin; APEX Bioscience); Iron chelators and chelates, such as diethylenetriaminepentaacetic acid-iron (III) complexes (DTPA iron (III); Molichem Medicines ); Lysofylline (synthetic small molecule methylxanthine; Cell Therapeutics, Inc.); PGG-glucan (water-soluble β-1,3 glucan; Alpha-Beta Technoligy); apolipoprotein reconstituted with lipid A-1 Chiral hydroxamic acid (a synthetic antibacterial agent that inhibits lipid A biosynthesis); Anti-endotoxin antibody; E5531 (Synthetic lipid A antagonist; Eisai America, Inc.); (Replacement N-terminal fragment); D2E7 antibody, and synthetic anti-endotoxin peptide (SAEP; Bios Ynth Research Laboratories).

  Non-limiting examples of therapeutic agents for adult respiratory distress syndrome (ARDS) that can be combined with the TNF-α binding molecules of the present invention include: anti-IL-8 antibody; surfactant replacement therapy; CDP- 571 / BAY-10-3356 (humanized anti-TNF-α antibody; Celltech / Bayer); cA2 (chimeric anti-TNF-α antibody; Centocor); 75 kDa TNFR-IgG (75 kDa TNF receptor-IgG fusion protein Immunex; see, for example, Arthritis & Rheumatism (1994) Vol. 3.7 S295; J. Invest. Med. (1996) Vol. 44, 235A); and 55 kDa TNFR-IgG (55 kDa TNF receptor-IgG fusion protein; Hoffmann-LaRoche).

  The pharmaceutical composition of the present invention may contain “therapeutically effective amount” or “prophylactically effective amount” of the antibody or antibody fragment of the present invention. “Therapeutically effective amount” refers to an amount effective to achieve a desired therapeutic result at the required dosage and timing. A therapeutically effective amount of an antibody or antibody fragment will vary depending on factors such as: for example, the disease state, age, sex, and weight of the individual, and the ability of the antibody or antibody fragment to elicit a desired response in the individual. . A therapeutically effective amount is also an amount that results in a therapeutically beneficial effect that exceeds the toxic or adverse effects of the antibody or antibody fragment. “Prophylactically effective amount” refers to an amount effective to achieve the desired prophylactic result at the required dosage and timing. Typically, since a prophylactic dose is used in subjects prior to or at an earlier stage of disease, the prophylactically effective amount will be less than the therapeutically effective amount.

IV. Uses of Additional TNF-α Binding Molecules The present invention also provides a diagnostic method for the detection of TNF-α in patients known or expected to be a TNF-α-mediated disease. Provided are detectably labeled TNF-α binding molecules (eg, anti-TNF-α peptides and antibodies) used as described below.

  The TNF-α binding molecules of the invention, such as anti-TNF-α peptides and / or antibodies, are useful for immunoassays that detect or quantify TNF-α in a sample. Immunoassays for TNF-α are typically biological in the presence of a detectably labeled high affinity anti-TNF-α peptide and / or antibody of the present invention capable of selectively binding to TNF-α. Incubating the sample and detecting the labeled peptide or antibody bound in the sample. Various clinical assay methods are well known in the art and are described, for example, in Immunoassays for the 80's, A. Voller et al., Eds., University Park, 1981.

  Thus, the anti-TNF peptide or antibody can be captured on nitrocellulose or other solid support capable of immobilizing soluble proteins. The TNF-α-containing sample is then added to the support and the support is then washed with a suitable buffer to remove unbound protein. Next, detectably labeled TNF-α specific peptide or antibody is added to the solid support, which is washed once more with buffer to remove unbound detectably labeled peptide or antibody. The amount of bound label on the solid support can be detected by known methods.

  “Solid support” or “carrier” refers to any support capable of binding to a peptide, antigen or antibody. Well known supports or carriers include glass, polystyrene, polypropylene, polyethylene, dextran, nylon, amylase, natural and modified cellulose, polyacrylamide, agarose and magnetite. The nature of the carrier may be either soluble to some extent or insoluble for the purposes of the present invention. The support material can be virtually any structure as long as the binding molecule retains its ability to bind to TNF-α. Therefore, the structure of the support may be spherical as in the bead, or may be cylindrical as in the inner surface of the test tube or the outer surface of the rod. Alternatively, the surface may be flat, such as a sheet, culture dish, test strip, microtiter plate. Preferred supports include polystyrene beads. One skilled in the art will know many other carriers suitable for antibody, peptide or antigen binding, or can be ascertained by routine experimentation. Well-known methods can be used to determine the binding activity of a given anti-TNF-α peptide and / or antibody lot. One skilled in the art can determine the efficacy and optimal assay conditions by routine experimentation.

  Detectable labeling of TNF-α binding molecules, such as TNF-specific peptides and / or antibodies, can be accomplished by conjugating to an enzyme used in an enzyme immunoassay (EIA) or enzyme-linked immunosorbent assay (ELISA) . The bound enzyme reacts with the exposed substrate to yield a chemical moiety that can be detected, for example, spectrophotometrically, fluorimetrically or by visible means. Enzymes used to detectably label the TNF-α binding molecules of the present invention include, but are not limited to: malate dehydrogenase, staphylococcal nuclease, delta-5-steroid isomerase, yeast alcohol dehydrogenase. , Alpha-glycerophosphate dehydrogenase, triose phosphate isomerase, horseradish peroxidase, alkaline phosphatase, asparaginase, glucose oxidase, beta-galactosidase, ribonuclease, urease, catalase, glucose-6-phosphate dehydrogenase, glucoamylase and acetylcholinesterase.

  Radiolabeling TNF-α binding molecules allows detection of TNF-α through the use of radioimmunoassay (RIA) (e.g., Work, et al., (1978) Laboratory Techniques and Biochemistry in Molecular Biology , North Holland Publishing Company, NY). The radioactive isotope can be detected by such means as the use of a gamma counter or a scintillation counter or by autoradiography.

  It is also possible to label the TNF-α binding molecule with a fluorescent compound. When a fluorescently labeled molecule is exposed to light of the appropriate wavelength, its presence can be detected by fluorescence. The most commonly used fluorescent labeling compounds are fluorescein isothiocyanate, rhodamine, phycoerythrin, phycocyanin, allophycocyanin, o-phthaldehyde and fluorescamine.

TNF-α binding molecules can also be detectably labeled using a fluorescence-emitting metal, such as ¹²⁵ Eu, or other lanthanide series. These metals can be bound to TNF-α binding molecules using such metal chelating groups, such as diethylenetriaminepentaacetic acid (DTPA) or ethylenediamine-tetraacetic acid (EDTA).

  The TNF-α binding molecule can also be detectably labeled by binding to a chemiluminescent compound. The presence of a chemiluminescent labeled molecule is determined by detecting the presence of luminescence that occurs during the course of a chemical reaction. Examples of particularly useful chemiluminescent labeling compounds are luminol, isoluminol, theromatic acridinium ester, imidazole, acridinium salt and oxalate ester.

  Similarly, a TNF-α binding molecule of the present invention can be labeled using a bioluminescent compound. Bioluminescence is found in biological systems, where the catalytic protein is a type of chemiluminescence that increases the efficiency of the chemiluminescent reaction. The presence of a bioluminescent protein is determined by detecting the presence of luminescence. Important bioluminescent compounds for labeling purposes are luciferin, luciferase and aequorin.

  Detection of TNF-α binding molecules can be accomplished, for example, by a scintillation counter when the detectable label is a radioactive gamma emitter, or by a fluorometer, for example, when the label is a fluorescent material. In the case of an enzyme label, detection can be accomplished by a colorimetric method using an enzyme substrate. Detection can also be accomplished by visual comparison of the extent of enzymatic reaction between a similarly prepared standard and the substrate.

  In some embodiments of the invention, TNF-α detected by the assay may be present in a biological sample. Any sample containing TNF-α may be used. Preferably, the sample is a biological fluid, such as blood, serum, lymph, urine, cerebrospinal fluid, amniotic fluid, synovial fluid, tissue extract or homogenate. However, the present invention is not limited to assays using only these samples. This is because those skilled in the art can determine suitable conditions that allow the use of other samples.

  In situ detection can be accomplished by removing a tissue section from a patient and providing such section with a combination of labeled TNF-α binding molecules of the invention. The TNF-α binding molecule is preferably provided by placing a labeled TNF-α binding molecule on the biological sample or covering the sample surface. Use of such a procedure makes it possible to examine not only the presence of TNF-α but also the distribution of TNF-α in the examined tissue. With the present invention, one of ordinary skill in the art will readily appreciate that any of a variety of histological methods (eg, staining methods) can be modified to achieve such in situ detection.

  The TNF-α binding molecules of the invention can be used for use in immunometric assays, also called “two-site” or “sandwich” assays. In a typical immunoassay assay, a large amount of unlabeled TNF-α binding molecule (eg, anti-TNF-α antibody) is bound to a solid support that is insoluble in the liquid to be tested and a large amount of detectably labeled soluble antibody. Is added to allow detection and / or quantification of the ternary complex formed between the solid phase antibody, the antigen, and the labeled antibody.

  Exemplary and preferred immunoassay assays include a “forward” assay, in which a TNF-α binding molecule (eg, an antibody) bound to a solid phase is first contacted with a test sample, and TNF-α is removed from the sample, Extracted by formation of a two-component solid phase antibody-TNF-α complex. After a suitable incubation time, the solid support is washed to remove residual liquid sample containing unreacted TNF-α (if present), and then a known amount of labeled antibody (this is referred to as the “reporter molecule”). In contact with a solution containing After a second incubation period in which the labeled antibody is complexed with TNF-α bound to the solid support via an unlabeled antibody, the solid support is washed to remove unreacted labeled antibody again. . This type of forward sandwich assay can be a simple yes / no assay to determine the presence of TNF-α, or measurements and labeled antibodies obtained for standard samples containing known amounts of TNF-α It can be made quantitative by comparing the measured values. Such “two-site” or “sandwich” assays are described in Wide (Radioimmune Assay Method, Kirkham, ed., Livingstone, Edinburgh, 1970, pp. 199-206).

  Another type of “sandwich” assay that may be useful for TNF-α is the so-called “simultaneous” and “reverse” assays. A simultaneous assay involves a single incubation step, wherein both the antibody bound to the solid support and the labeled antibody are added simultaneously to the test sample. After incubation is complete, the solid support is washed to remove residual liquid sample and uncomplexed antibody. The presence of labeled antibody bound to the solid support is then determined as in a conventional “forward” sandwich assay. In a “reverse” assay, stepwise addition is used, first adding a solution of labeled antibody to a liquid sample, then adding unlabeled antibody bound to a solid support after an appropriate incubation time. After the second incubation, the solid phase is washed by conventional means to exclude residual test sample and unreacted labeled antibody solution. Determination of labeled antibody bound to the solid support is performed as in the “simultaneous” and “forward” assays.

  In some embodiments, a TNF-α binding molecule of the present invention bound to a solid support can be used to remove TNF-α from a liquid or tissue or cell extract. In preferred embodiments, they are used to remove TNF-α from blood or plasma products. In another preferred embodiment, the TNF-α binding molecule can be suitably used in an in vitro immunosorbent device known in the art (see, eg, Seminars in Hematology, 26 (2 Suppl. 1) (1989)). Exposure of the patient's blood or other bodily fluids to the bound TNF-α binding molecule results in partial or complete removal of circulating TNF-α (free or immune complexes), after which the fluid is returned to the body. This immunoadsorption can be used in a continuous flow array with or without a cell centrifugation step. See, for example, Terman, et al., (1976) J. Immunol. 117: 1971-1975.

Experimental Examples The following examples further illustrate preferred embodiments of the present invention and are not intended to limit the scope of the invention.

  The following abbreviations are used in the following experimental descriptions: M (mole); mM (mmol); nM (nanomol); pM (picomole); mg (milligram); μg (microgram); pg (picogram); ml (Milliliter); μl (microliter); ° C (degrees Celsius); OD (absorbance); nm (nanometer); BSA (bovine serum albumin); and PBS (phosphate buffered saline).

Example 1
Construction and screening of anti-TNF-α Fab fragments with synthetic CDRs and human frameworks This example describes the construction of anti-TNF-α Fab fragments with fully human framework regions and synthetic CDRs. Nucleic acid sequences encoding the hu1 CDR and framework regions are shown in SEQ ID NOs: 2 and 4, respectively. The six hu1 CDRs used were as follows: CDRL1 (SEQ ID NO: 10); CDRL2 (SEQ ID NO: 20); CDRL3 (SEQ ID NO: 34); CDRH1 (SEQ ID NO: 36); CDRH2 (SEQ ID NO: 44); and CDRH3 (SEQ ID NO: 54).

  In order to identify mutations that improve the binding properties of hu1, a library of synthetic CDRs was inserted into the deletion template below. Each hu1 CDR is mutagenic individually using standard mutagenesis techniques (Kunkel, TA, (1985) Proc. Natl. Acad. Sci. USA, 82: 488-492, incorporated herein by reference). Replacement with a pool of oligonucleotides. In this example, a CDR is a residue that includes both the Kabat and Chothia definitions (eg, residues 26-35 for CDRH1). Due to the length of CDRH2, it was necessary to construct two separate libraries to cover the entire region.

  Mutagenic oligonucleotides were annealed to uridinylated phage templates lacking the corresponding hu1 CDRs. This template contains the hu1 light chain variable region sequence (SEQ ID NO: 2, suitably deleted hu1 CDR) and the human CL sequence shown in SEQ ID NO: 85 and the hu1 heavy chain variable region sequence (SEQ ID NO: 4, suitably deleted hu1 CDR) ) And the human CH1 sequence shown in SEQ ID NO: 86.

  Annealing was accomplished by incubating the reaction at 75 ° C. for 5 minutes and slowly cooling to 20 ° C. over 45 minutes. The annealed sample was placed on ice, T4 DNA polymerase and T4 DNA ligase were added to make double stranded DNA, and the reaction was incubated at 4 ° C. for 5 minutes and then at 37 ° C. for 90 minutes. The reaction was extracted with phenol, ethanol precipitated, and the DNA was electroporated into DH10B cells. XL1 Blue cells were added to the reaction to amplify the phage and then the library was plated. The phage stock was prepared by adding 8 ml of medium to the plate and incubating at 4 ° C. for a minimum of 4 hours. Phage-containing media was collected, clarified by centrifugation, and sodium azide (0.02%) was added as a preservative.

  Initial screening of the anti-TNF-α Fab library was performed by plaque lift as described in Watkins, JD et al., (1998) Anal. Biochem., 256: 169-177, incorporated herein by reference. . Briefly, nitrocellulose filters were coated with goat anti-human kappa antibody, blocked with 1% BSA, and placed on plates containing plaques made from phage libraries for 16 hours at 22 ° C. Filters were rinsed in PBS and incubated with various concentrations of biotinylated human TNF-α for various times. Filters were washed with PBS containing 0.1% Tween 20, incubated with NeutrAvidin alkaline phosphatase conjugate for 2-60 minutes and washed with the same buffer. Variants with increased binding properties were identified using differences in signal intensity revealed by a standard colorimetric substrate for alkaline phosphatase. As a result of this screening procedure, several Fab fragments were identified and further characterized as follows:

Positive plaques were picked with a Pasteur pipette and the phages were eluted in 100 μl 10 mM Tris HCl, pH 7.4 and 100 mM NaCl for 1 hour at 37 ° C. High titer stock was obtained by standard amplification techniques. XL1 Blue cells were cultured until OD ₆₀₀ was 1, and IPTG was added at a final concentration of 1 mM. After infection with 15 ml of bacterial culture and 10 μl of high titer phage stock, the cells were incubated at 37 ° C. for 1 hour and then at 22 ° C. for 16 hours. Bacteria were harvested and washed with 30 mM Tris HCl, pH 8, and 150 mM NaCl. The pellet was resuspended in 640 μl of 30 mM Tris HCl, pH 8, 2 mM EDTA and 20% sucrose and incubated at 4 ° C. for 15 minutes. Lysed cells were pelleted and supernatants containing periplasmic contents and Fab fragments were assayed in an ELISA format to determine the approximate off-rate. COSTAR # 3366 microtiter plates were coated with 1 μg / ml of hTNF-α in carbonate buffer for 16 hours at 4 ° C. The plate was washed 3 times with PBS containing 0.1% Tween 20 and blocked with 1% BSA for 1 hour at 22 ° C. Fab fragments released from the periplasmic space were serially diluted with PBS containing 0.05% Tween 20, and placed in a plate at 22 ° C. for 1 hour. Plates were washed and incubated with goat anti-human kappa antibody conjugated to alkaline phosphatase for 1 hour at 22 ° C. in PBS containing 0.05% Tween 20. Plates were washed with PBS containing 0.1% Tween 20 and developed using a standard colorimetric substrate for alkaline phosphatase (e.g., Watkins, JD et al., (1997) Anal. Biochem. 253: 37-45).

  An ELISA assay was used to measure the approximate on-rate. COSTAR # 3366 microtiter plates were coated with 2 μg / ml goat anti-human kappa antibody in carbonate buffer for 16 hours at 4 ° C. Fab fragments released from the periplasmic space were serially diluted in PBS containing 0.05% Tween 20, added to the wells, and incubated for 1 hour at 22 ° C. Plates were washed 3 times with PBS containing 0.1% Tween 20 and incubated with 5 nM biotinylated hTNF-α for 2 minutes at 22 ° C. Plates were washed once and NeutrAvidin alkaline phosphatase conjugate was added for 2 minutes at 22 ° C. Plates were washed and developed as described above. Characterization of positive variants in the initial filter lift screening procedure and subsequent ELISA assay reveals single amino acid changes in individual CDRs in several Fab fragments, and the affinity for TNF-α in a fully human framework Rose. These amino acid changes are shown in Tables 1, 2 and 3.

  A library was constructed using the above procedure to combine single beneficial mutations to assess additivity. A panel of combinatorial variants with increased binding properties when this library was screened using the three assays described in the previous section is shown in FIG. The names of the specific clones identified are shown in Table 4 below, along with beneficial mutations (indicated by the first residue in hu1 and the new residue of the specific clone).

Next, the binding kinetics of the three Fab fragments listed in Table 4 were measured in a kinetic exclusion assay. Affinity measurements were performed on a KinExA ™ 3000 instrument (Sapidyne Instruments, Inc., Boise, Idaho). Fab fragments (A10K, A9K, and A10P) released from the periplasmic space were used and their concentrations were measured by quantitative ELISA. Briefly, antigen and antibody fragments were reacted in solution and the fraction of unbound reagent was determined by capture and measured on a bead support. Binding kinetics can be measured or calculated from the amount of unbound reagent. For example, after interaction between TNF-α and Fab fragments occurs in solution, the binding of unreacted free Fab fragments to TNF-α-coated beads can be measured with an instrument. This is done by detection of labeled secondary antibodies against Fab fragments (eg goat anti-IgG (heavy and light chain)). To measure K _d , individual tubes containing constant concentrations of Fab fragments and various concentrations of human TNF-α were incubated for 20 hours at 20 ° C. in PBS supplemented with 0.1% BSA. A total of 13 tubes were used for each _Kd measurement. For A10K and A10P, the Fab concentration was 10 pM, the human TNF-α concentration was limited to 0.078 pM starting from 160 pM, and no human TNF-α was included in the last tube. A9K incubation was similarly set, Fab was at a constant concentration of 20 pM, and human TNF-α was limiting diluted starting from 500 pM to a final concentration of 0.24 pM. After incubation, the amount of unbound Fab in the equilibrated sample was measured with a KinEx ™ 3000 instrument according to the manufacturer's instructions. K _d values were determined by instrument software. The results are shown in Table 5.

Individual Fab fragments of 40 pM concentration for measuring the k _on was mixed with hTNF-alpha of 400 pM to. A time course was taken for a series of measurements. It was calculated k _on using a device software using the resulting data. k _off was calculated by the formula K _d = k _off / k _on . The results are shown in Table 5.

Example 2
Characterization of anti-TNF-α binding molecules with improved binding properties This example describes various in vitro test procedures used to identify the characteristics of the eight anti-TNF-α binding molecules from Example 1 . First, the ability of these Fab fragments to block TNF-α-mediated cell death was examined by evaluating its protective effect on L929 mouse fibroblasts. Specifically, L929 mouse fibroblasts were seeded in individual wells of a 96-well plate at a density of 20,000 cells / well and maintained according to ATCC recommendations. After overnight incubation, Fab fragments released from the periplasmic space were serially diluted in medium, sterile filtered, and 50 μl was added with a final concentration of 1 μg / ml actinomycin D. Immediately thereafter, hTNF-α was added at a final concentration of 80 pg / ml, and the plate was placed in a humidified incubator at 37 ° C. and 5% CO ₂ atmosphere. After overnight incubation, the protective effect of various Fab fragments was assessed by monitoring cell survival. For this, Cell Titer 96® AQueous One solution reagent (Promega, Madison WI) was used according to the manufacturer's instructions. Figure 8 shows the results of measuring the absorbance of individual wells at 490 nm. At the TNF-α concentration used, approximately 90% of L929 cells died after overnight incubation and no protection was afforded by the addition of an unrelated control Fab fragment. On the other hand, each of the eight anti-TNF-α Fab fragments listed in Table 4 was able to prevent cell death. Of these TNF-α binding molecules, A10K and A10P were able to protect cells at the lowest concentrations, reflecting improved binding properties to TNF-α. Effective concentration (EC ₅₀ ) was determined using the curve fitting function and the EC ₅₀ inducing ability of SigmaPlot® software (SPSS Science, Chicago, IL). In the experiment shown in FIG. 8, the EC ₅₀ of the A10K Fab fragment was estimated to be approximately 25 pM.

  To further evaluate the clones in Table 4 (eg, A10K) as complete IgG molecules rather than Fab fragments, the following procedure was used. First, the light chain variable region (VL) and heavy chain variable region (VH) can be transferred from an A10K Fab expression phage to an expression vector containing, for example, a heavy chain and light chain constant region. Alternatively, the variable region can be cloned into two separate expression vectors, each vector ultimately expressing only one of the two strands. The VL region can be amplified by PCR using the following primers: VL 5 'primer: TGGCTCCCAGGTGCCAAATGTGAAATTGTGCTGACTCAG (SEQ ID NO: 109); VL 5' biotinylation primer: biotin-TGGCTCCCAGGTGCCAAATGT (SEQ ID NO: 110); and VL 3 'primer: GACAGATGGTGCAGCCACAGT Number 111). Similarly, the VH region can be amplified using the following primers: VH 5 'primer: CTCTCCACAGGTGTCCACT CCCAGGTCCAACTGCAGGTC (SEQ ID NO: 112); VH 5' biotinylation primer: biotin-CTCTCCACAGGTGTCCACTCC (SEQ ID NO: 113); and VH 3 ' Primer: GAAGACCGATGGGCCCTTGGT (SEQ ID NO: 114). After PCR amplification, the biotinylated DNA strand is removed and the non-biotinylated strand is annealed to a single-stranded uridine template prepared from an expression vector at an annealing ratio of 20: 1, then T4 DNA ligase in the presence of T4 DNA ligase. Synthesized by DNA polymerase. In DH10B cells, the uridine template is lost and, for example, a double-stranded plasmid with A10K IgG is obtained.

  Next, a mammalian cell (eg, CHO-K1 cell) can be transfected with an expression vector, and the stably transferred one can be selected by culturing the transfected cell in an appropriate medium under an appropriate selection. I can do it. Upon confirmation of IgG expression by ELISA, the pool may be expanded, for example in a roller bottle, and kept under selection. The medium is usually changed once every two days, and the culture supernatant containing A10K IgG is used for IgG purification. This same procedure can be used to make hu1 IgG or other IgG molecules.

A10K and hu1 were both characterized as Fab fragments and intact IgG molecules using the L929 cytoprotection assay, and control Fab and control IgG were also characterized. The assay was performed as described in the previous section. As shown in FIG. 9, both TNF-α binding molecules, both as Fab fragments and intact IgG, were able to protect cells from the deleterious effects of TNF-α. However, the concentration of A10K required to achieve the same protection is significantly lower than hu1, indicating that the improved binding properties achieved by protein engineering are reflected in the lower effective dose to the cells. In this experiment, the EC ₅₀ of the A10K Fab fragment was estimated to be approximately 67 pM.

Figure 10 shows a direct comparison between A10K and REMICADE (Oncology Supply, Dothan, Alabama), the standard for the treatment of rheumatoid arthritis and Crohn's disease. Similarly, both A10K and Remicade can fully protect L929 fibroblasts, but A10K can achieve the same protection at very low concentrations, and A10K is a more potent molecule and TNF-α It is shown to be more effective in neutralization. The EC _{50 of the} A10K IgG molecule was estimated to be approximately 2.7 pM.

Example 3
In vivo examples using A10K This example describes two in vivo assays using A10K intact IgG. In particular, this example describes the TNF-α neutralizing effect of A10K in vivo in mice and the protective effect of A10K against TNF-α-mediated polyarthritis in mice.

  The ability of A10K to neutralize TNF-α in vivo was evaluated as follows. Recombinant human TNF-α (5 μg / mouse) was injected intraperitoneally into female C3H / HeN mice (˜9 weeks old) in combination with the sensitizing drug galactosamine (18 mg / mouse). In untreated mice, such a condition resulted in approximately 90 percent mortality within 48 hours. The neutralizing effect of A10K was assessed by injecting mice 0.8 and 4 mg / kg intravenously 24 hours prior to hTNF-α challenge. A10K showed a dose-dependent inhibition of mortality and was observed at higher doses where complete protection was examined. These results are shown in FIG.

The effect of A10K on TNF-α-mediated polyarthritis was evaluated as follows. C57BL / 6NTac-TgN (TNF) mouse transgenic for human hTNF-α develops severe chronic arthritis at approximately 20 weeks of age (Keffer, J. et al., (1991), incorporated herein by reference) EMBO J., 10: 4025-4031). A dose escalation study was performed on mice with very early stage joint swelling (9 weeks old) to examine the effect of A10K on disease progression. The width of the posterior joint was examined and the animals were randomly grouped to balance the initial joint size. Animals were then injected intraperitoneally with 0.1, 0.3, or 1 mg / kg A10K or remicade (Cancer Supply, Dothan, Alabama) as a control. Joint swelling was monitored weekly by measuring the (joint width of the joint width t _o at t _x) increase in joint width. A10K showed a dose-dependent inhibition in the progression of polyarthritis and was more effective at similar doses than Remicade (Cancer Supply, Dothan, Alabama). These results are shown in FIG.

Example 4
Generation and screening of AME 3-2 This example describes the construction of AME-3-2 antibodies. PCR primers were used to convert the A10K light chain framework to the human germline framework IGKV1-39 (also known as O2 or DP-K9) that is frequently found in the human population. The heavy chain of AME-3-2 is IGVH3-72 (also known as 3-72 or DP-29). This construct was mutated, screened and tested as in Examples 1 and 2 above. This procedure identified 6 new CDRs for AME 3-2 (shown in Figure 15): CDRL1-SEQ ID NO: 93; CDRL2-SEQ ID NO: 95; CDRL3-SEQ ID NO: 97; CDRH1-SEQ ID NO: 87; CDRH2- SEQ ID NO: 89; and CDRH3-SEQ ID NO: 91. FIG. 15 also shows the complete light and heavy chains of the AME 3-2 antibody.

Table 7 shows the test results of AME 3-2 on KinExA ™ 3000 apparatus (Sapidyne Instruments, Inc., Boise, Idaho). The EC ₅₀ calculated for AME 3-2 was found to be similar to A10K.

Example 5
Use of TNF-α binding molecules for the treatment of TNF-α mediated diseases This example illustrates TNF-α mediated diseases in human patients (e.g. juvenile and adult rheumatoid arthritis, psoriatic arthritis, Crohn's disease, inflammatory bowel The use of TNF-α binding molecules for the therapeutic and prophylactic treatment of diseases (ulcerative colitis, psoriasis, ankylosing spondylitis, Wegner granulomatosis and sepsis) is described. For example, a single dose of an anti-TNF-α binding molecule, such as 2C6K, 2C6P, 2E7K, 2E7P, A9K, A9P, A10K, A10P, AME 3-2, or hu1, intravenously administered to a patient suffering from a TNF-α mediated disease In addition, it may be administered at 1-15 mg / kg patient body weight. This patient may, however, be administered multiple doses over a period of time (eg, 3 mg / kg for days or weeks). By monitoring the response to treatment, the need for dose escalation and the need for repeated treatments can be determined. Additional teachings on therapeutic response and dosage regimes can be found in US Pat. No. 5,698,195, incorporated herein by reference. The patient may be administered an immunosuppressant, eg, methotrexate, in combination with a TNF-α binding molecule.

  All documents and patents mentioned in the above specification are incorporated herein by reference. Various modifications and variations of the described methods and system of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described with reference to certain preferred embodiments, it is to be understood that the claimed invention is not limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention which are obvious to those skilled in chemical, pharmaceutical, molecular biology or related fields are intended to be within the scope of the following claims.

FIG. 1A shows the amino acid sequence of the light chain variable region of hu1 (SEQ ID NO: 1). FIG. 1B shows the nucleic acid sequence of the light chain variable region of hu1 (SEQ ID NO: 2). FIG. 2A shows the amino acid sequence of the heavy chain variable region of hu1 (SEQ ID NO: 3). FIG. 2B shows the nucleic acid sequence (SEQ ID NO: 4) of the heavy chain variable region of hu1. FIG. 3A shows the amino acid sequence of the light chain variable region of A10K (SEQ ID NO: 5). FIG. 3B shows the nucleic acid sequence of the light chain variable region of A10K (SEQ ID NO: 6). FIG. 4A shows the amino acid sequence of the heavy chain variable region of A10K (SEQ ID NO: 7). FIG. 4B shows the nucleic acid sequence (SEQ ID NO: 8) of the heavy chain variable region of A10K. FIG. 5A shows the amino acid sequence of the complete human light chain framework region with dispersed CDRs. The four framework subregions are displayed as follows: FRL1 (SEQ ID NO: 57), FRL2 (SEQ ID NO: 58), FRL3 (SEQ ID NO: 59), and FRL4 (SEQ ID NO: 60). FIG. 5B shows the nucleic acid sequence of the complete human light chain framework region with dispersed CDRs. The four framework subregions are displayed as follows: FRL1 (SEQ ID NO: 61), FRL2 (SEQ ID NO: 62), FRL3 (SEQ ID NO: 63), and FRL4 (SEQ ID NO: 64). FIG. 6A shows the amino acid sequence of the complete human heavy chain framework region with dispersed CDRs. Four framework subregions are displayed as follows: FRH1 (SEQ ID NO: 65), FRH2 (SEQ ID NO: 66), FRH3 (SEQ ID NO: 67), and FRH4 (SEQ ID NO: 68). FIG. 6B shows the nucleic acid sequence of the complete human heavy chain framework region with dispersed CDRs. Four framework subregions are displayed as follows: FRH1 (SEQ ID NO: 69), FRH2 (SEQ ID NO: 70), FRH3 (SEQ ID NO: 71), and FRH4 (SEQ ID NO: 72). FIG. 7 shows the results of ELISA described in Example 1. FIG. 8 shows the results of the L929 cell protection assay described in Example 2. FIG. 9 shows the results of the L929 cell protection assay described in Example 2. FIG. 10 shows the results of the L929 cell protection assay described in Example 2. FIG. 11 shows the results of the in vivo TNF-α neutralization assay described in Example 3. FIG. 12 shows the effect of TNF-α binding molecules in reducing the progression of TNF-α-mediated polyarthritis in mice as described in Example 3. FIG. 13 shows a schematic diagram of an IgG molecule with the various regions and sections indicated. One CDR of one variable region light chain and one CDR and framework region (FR) of two variable region heavy chains are also displayed. FIG. 14 shows the nucleic acid sequences of the human CL sequence and human CH1 sequence used for the construction of the Fab fragment described in Example 1. FIG. 15 shows the complete light and heavy chain amino acid sequences of AME 3-2, CDRs are shown in bold.

Claims (24)

A TNF-α binding molecule or a composition comprising a nucleic acid sequence encoding a TNF-α binding molecule, wherein the TNF-α binding molecule is;
i) a CDRL3 sequence comprising SEQ ID NO: 33, and
ii) CDRH3 comprising SEQ ID NO: 53,
including. The TNF-α binding molecule further comprises:
iii) a CDRL1 sequence comprising SEQ ID NO: 15, and
iv) a CDRL2 sequence comprising SEQ ID NO: 25,
The composition of claim 1 comprising: The TNF-α binding molecule further comprises:
v) CDRH1 sequence comprising SEQ ID NO: 37, and
vi) CDRH2 sequence comprising SEQ ID NO: 45,
The composition of claim 2 comprising: The TNF-α binding molecule further comprises:
v) CDRH1 sequence comprising SEQ ID NO: 39, and
vi) CDRH2 sequence comprising SEQ ID NO: 45,
The composition of claim 2 comprising: The TNF-α binding molecule further
iii) a CDRL1 sequence comprising SEQ ID NO: 13, and
iv) a CDRL2 sequence comprising SEQ ID NO: 27,
The composition of claim 1 comprising: The TNF-α binding molecule further comprises:
v) CDRH1 sequence comprising SEQ ID NO: 37, and
vi) CDRH2 sequence comprising SEQ ID NO: 55,
6. The composition of claim 5 comprising:   The composition of claim 1, wherein the TNF-α binding molecule further comprises a light chain variable region, wherein the light chain variable region comprises a human germline framework region.   2. The composition of claim 1, wherein the TNF-α binding molecule further comprises a heavy chain variable region, wherein the heavy chain variable region comprises a human germline framework region. A composition comprising a TNF-α binding molecule, or a nucleic acid sequence encoding a TNF-α binding molecule, wherein the TNF-α binding molecule is human in vitro, with an EC ₅₀ of 2.0 × 10 ⁻¹¹ or less in a cell-based assay A composition that neutralizes TNF-α cytotoxicity. 10. The composition of claim 9, wherein the TNF-α binding molecule has a binding affinity (K _d ) for human TNF-α of 7.5 × 10 ⁻¹² M or less. 10. The composition according to claim 9, wherein the binding rate (k _on ) of the TNF-α binding molecule to human TNF-α is 3.0 × 10 ⁶ M ⁻¹ s ⁻¹ or more. 10. The composition according to claim 9, wherein the dissociation rate (k _off ) of the TNF-α binding molecule with respect to human TNF-α is 1.0 × 10 ⁻⁴ s ⁻¹ or less.   10. The composition of claim 9, wherein the TNF-α binding molecule comprises a light chain variable region, wherein the light chain variable region comprises a human germline framework region.   10. The composition of claim 9, wherein the TNF-α binding molecule comprises a heavy chain variable region, wherein the heavy chain variable region comprises a human germline framework region. A method of treating a TNF-α mediated disease comprising the steps of:
a) providing i) and ii) below;
i) Target,
ii) a composition, wherein the composition comprises a TNF-α binding molecule that neutralizes human TNF-α cytotoxicity with an EC ₅₀ , 2.0 × 10 ⁻¹¹ or less in an in vitro, cell-based assay; and
b) administering the composition to the subject.   16. The method of claim 15, wherein the TNF-α mediated disease is selected from sepsis, autoimmune disease, and rheumatoid arthritis. 16. The method of claim 15, wherein the binding affinity (K _d ) of the TNF-α binding molecule to human TNF-α is 7.5 × 10 ⁻¹² M or less. 16. The method according to claim 15, wherein the binding rate (k _on ) of the TNF-α binding molecule to human TNF-α is 3.0 × 10 ⁶ M ⁻¹ s ⁻¹ or more. 16. The method according to claim 15, wherein the dissociation rate (k _off ) of the TNF-α binding molecule with respect to human TNF-α is 1.0 × 10 ⁻⁴ s ⁻¹ or less.   16. The method of claim 15, wherein the TNF-α binding molecule comprises a light chain variable region, wherein the light chain variable region comprises a human germline framework region.   16. The method of claim 15, wherein the TNF-α binding molecule comprises a heavy chain variable region and the heavy chain variable region comprises a human germline framework region. A composition comprising a TNF-α binding molecule or a nucleic acid sequence encoding a TNF-α binding molecule, wherein the TNF-α binding molecule comprises at least one of the following CDR sequences;
i) a CDRL1 sequence comprising SEQ ID NO: 93;
ii) a CDRL2 sequence comprising SEQ ID NO: 95;
iii) a CDRL3 sequence comprising SEQ ID NO: 97;
iv) CDRH1 sequence comprising SEQ ID NO: 87;
v) CDRH2 sequence including SEQ ID NO: 89, and
vi) CDRH3 sequence comprising SEQ ID NO: 91.   23. The composition of claim 22, wherein said TNF-α binding molecule comprises at least three of said CDR sequences. 23. The composition of claim 22, wherein said TNF-α binding molecule comprises all six of said CDR sequences.

Images