JP2007267700A - Method for judging malignant tumor including nephrocyte cancer with methylation of hoxb 13 gene - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a method for judging the presence or absence of malignant tumor including nephrocyte cancer and the extent of the tumor; to provide a diagnostic agent capable of being effectively used for the judgment; to provide an anti-tumor agent which can inhibit the proliferation of cancer cells and can effectively be used to prevent or treat malignant tumors; and to provide a method for screening an anti-tumor substance effective for the treatments of malignant tumors including nephrocyte cancer. <P>SOLUTION: This method for judging the malignant tumor comprises measuring methylation frequency of HOXB 13 gene, especially CpG island, of a mammal or a correlation value thereof. The diagnostic agent contains a primer pair capable of detecting the methylation of the CpG island as an active ingredient. The anti-tumor agent contains a DNA having a base sequence encoding the amino acid sequence of HOXB 13 as an active ingredient. <P>COPYRIGHT: (C)2008,JPO&INPIT

Description

  The present invention relates to a method for determining the presence or absence and the degree of malignant tumor including renal cell carcinoma, and a diagnostic agent that can be effectively used for the determination. The present invention also relates to an antitumor agent that can be effectively used for preventing or treating malignant tumors by suppressing the growth of cancer cells. Furthermore, the present invention relates to a screening method for an antitumor substance effective for the treatment of malignant tumors including renal cell carcinoma.

  Renal cell carcinoma (RCC) is the most common cancer in the human kidney (see Non-Patent Document 1, etc.), and more than 30,000 new cases are found in the United States and 7000 in Japan each year. Previous studies have reported that the von Hippel-Lindau (VHL) gene is a major tumor suppressor gene involved in human renal cell carcinoma development, and is largely inactivated in approximately 60% of sporadic renal cell carcinoma cases by genetic changes. It has become clear (see Non-Patent Documents 2 to 6). However, the mechanism of tumor formation in sporadic renal cell carcinoma without inactivation of the VHL gene and the multistage carcinogenic mechanism of malignant renal cell carcinoma have not been clarified. Recently, the fumarate hydratase (FH) gene and the Bert Hogg Dube (BHD) gene have been identified by positional cloning methods as candidate tumor suppressor genes in renal cell carcinoma, but these are mainly involved in the development of hereditary human renal cell carcinoma. (See Non-Patent Documents 7 to 8).

  Loss of function of the tumor suppressor gene is a fundamental factor in cancer progression, but it is known that abnormal DNA methylation in the promoter region is involved in loss of function of the tumor suppressor gene (transcriptional inhibition) (non-patent literature) 9-12 etc.).

  For this reason, some cancer-related genes known to be epigenetic inactivated are inactivated in sporadic renal cell carcinoma by revealing the methylation status in renal cell carcinoma Attempts have been made to identify genes. However, it is estimated that several hundred genes are abnormally methylated in cancer (see Non-Patent Document 13 etc.), and the elucidation of genes involved in the onset and progression of sporadic renal cell carcinoma has not progressed yet. . For this reason, clinically effective tumor markers using genes involved in the onset and progression of renal cell carcinoma as an index have not been established, and current tests for renal cell carcinoma are mainly conducted by echo / CT. It is often based on diagnostic imaging and involves problems such as simplicity and difficulty in mass screening.

On the other hand, the Homeo-box (Hox) gene encodes a transcription factor and plays an important role in the development of vertebrates. Mouse homeo-box gene B13 (mouse HoxB13 gene) is expressed in the urogenital system, tail bud, spinal cord posterior end and hind gut of mouse fetus (see Non-patent Document 14). Hoxb13 homozygous mutant mice show a tail overgrowth phenotype with enhanced cell proliferation and decreased apoptosis in the tail, thus HoxB13 function activates cell proliferation suppression and programmed cell death in mice (See Non-Patent Document 15). However, the function of HOXB13 in human adult kidney and its involvement in canceration are not known.
Thoenes W, Storkel S and Rumpelt HJ. (1986). Pathol Res Pract., 181, 125-143 Foster K, Prowse A, van den Berg A, Fleming S, Hulsbeek MM, Crossey PA, Richads FM, Cairns P, Affara NA and Ferguson-Smith MA. (1994). Hum Mol Genet., 3, 2169-2173 Gnarra JR, Tory K, Weng Y, Schmidt L, Wei MH, Li H, Latif F, Liu S, Chen F, Duh FM, Lubensky I, Duan DR, Florence C, Pozzatti R, Walther MM, BanderNH, Grossman HB, Brauch H, Pomer S, Brooks JD, Isaacs WB, Lerman MI, Zbar B and Linehan WM. (1994). Nat Genet., 7, 85-90 Herman JG, Latif F, Weng Y, Lerman MI, Zbar B, Liu S, Samid D, Duan DS, Gnarra JR, Linehan WM and Baylin SB. (1994) .Proc Natl Acad Sci USA., 91, 9700-9704 Shuin T, Kondo K, Torigoe S, Kishida T, Kubota Y, Hosaka M, Nagashima Y, Kitamura H, Latif F and Zbar B. (1994). Cancer Res., 54, 2852-2855 Shuin T, Kondo K, Ashida S, Okuda H, Yoshida M, Kanno H and Yao M. (1999). Contrib Nephrol., 128, 1-10. Nickerson ML, Warren MB, Toro JR, Matrosova V, Glenn G, Turner ML, Duray P, Merino M, Choyke P, Pavlovich CP, Sharma N, Walther M, Munroe D, Hill R, Maher E, Greenberg C, Lerman MI , Linehan WM, Zbar B and Schmidt LS. (2002). Cancer Cell, 2, 157-164 Tomlinson IP, Alam NA, Rowan AJ, Barclay E, Jaeger EE, Kelsell D, Leigh I, Gorman P, Lamlum H, Rahman S, Roylance RR, Olpin S, Bevan S, Barker K, Hearle N, Houlston RS, Kiuru M , Lehtonen R, Karhu A, Vilkki S, Laiho P, Eklund C, Vierimaa O, Aittomaki K, Hietala M, Sistonen P, Paetau A, Salovaara R, Herva R, Launonen V and Aaltonen LA. (2002). Nat Genet. , 30, 406-410 Jones PA and Laird PW. (1999). Nat Genet., 21, 163-167 Toyota M and Issa JP. (1999a) .Semin Cancer Biol., 9, 349-357. Baylin SB, Esteller M, Rountree MR, Bachman KE, Schuebel K and Herman JG. (2001). Hum Mol Genet., 10, 687-692 Herman JG and Baylin SB. (2003). N Engl J Med., 349, 2042-2054 Costello JF, Fruhwald MC, Smiraglia DJ, Rush LJ, Robertson GP, Gao X, Wright FA, Feramisco JD, Peltomaki P, Lang JC, Schuller DE, Yu L, Bloomfield CD, Caligiuri MA, Yates A, Nishikawa R, Su Huang H, Petrelli NJ, Zhang X, O'Dorisio MS, Held WA, Cavenee WK and Plass C. (2000). Nat Genet., 24, 132-138 Zeltser L, Desplan C and Heintz N. (1996) .Development, 122, 2475-2484 Economides KD, Zeltser L and Capecchi MR. (2003). Dev Biol., 256, 317-330

  The present invention provides a method for easily determining the presence or absence of malignant tumors including renal cell carcinoma and the extent thereof, using as an index a phenomenon that is specifically observed in malignant tumors, particularly renal cell carcinoma, and is effective for the determination. The purpose is to provide diagnostic agents that can be used in the future. It is another object of the present invention to provide an antitumor agent that can be effectively used for preventing and improving the onset and progression of malignant tumors by suppressing the growth of cancer cells such as renal cancer cells. Furthermore, an object of the present invention is to provide a method for screening an antitumor substance that is an active ingredient of the antitumor agent.

  The inventors of the present invention have been diligently researching to solve the above-described problems. As a result, human homeobox B13 gene (in the present specification and claims, “HOXB13 gene” in primary renal cell carcinoma tumors and renal cancer cell lines). CpG islands are also abnormally methylated at a significantly higher frequency compared to normal cell lines and normal kidney tissues, and such HOXB13 gene methylation correlates with loss of HOXB13 expression. It was found that the expression was recovered by treating a HOXB13 non-expressing cell line with a methyltransferase inhibitor. Furthermore, the present inventors have found that the growth of renal cancer cells is suppressed and apoptosis is induced by expressing an exogenous HOXB13 gene in a highly methylated renal cancer cell line that does not express the HOXB13 gene. This finding suggests that the HOXB13 gene acts as a tumor suppressor gene in human renal cell carcinoma and can be effectively used as an antitumor substance.

The present invention has been completed based on such findings, and has the following specific embodiments;
(I) Malignant tumor determination method Item 1. A method for determining a malignant tumor, which comprises measuring methylation frequency of a mammalian HOXB13 gene or a correlation value thereof.
Item 2. Item 2. The determination method according to Item 1, wherein the methylation frequency of the HOXB13 gene is the methylation frequency of the CpG island of the gene.
Item 3. Item 3. The method according to Item 2, wherein the CpG island is a region of base numbers -1 to -376 of the HOXB13 gene.
Item 4. Item 4. The determination method according to any one of Items 1 to 3, wherein the malignant tumor is renal cell carcinoma.

(II) Method for determining the degree of malignant tumor 5. A method for determining the degree of malignant tumor in a test mammal having the following steps:
(1) a step of measuring the methylation frequency of the HOXB13 gene in mammals or a correlation value thereof,
(2) a step of comparing the measured methylation frequency or the correlation value thereof with the methylation frequency or the correlation value of the HOXB13 gene of a healthy mammal as a control, and (3) a test based on the comparison result. Evaluating the degree of malignant tumor in mammals.
Item 6. Item 6. The determination method according to Item 5, wherein the methylation frequency is a methylation frequency of a CpG island of the HOXB13 gene.
Item 7. Item 7. The determination method according to Item 6, wherein the CpG island is a region of base numbers -1 to -376 of the HOXB13 gene.
Item 8. Item 8. The determination method according to any one of Items 5 to 7, wherein the malignant tumor is renal cell carcinoma.

(III) Diagnostic drug item for detecting the incidence and degree of malignant tumor 9. A diagnostic agent for detecting morbidity or degree of malignant tumor, comprising a primer pair capable of detecting the methylation frequency of CpG island of HOXB13 gene.
Item 10. Item 10. The reagent according to Item 9, wherein the CpG island is a region of base numbers -1 to -376 of the HOXB13 gene.
Item 11. Item 11. The diagnostic agent according to Item 9 or 10, wherein the primer pair has a nucleotide sequence represented by SEQ ID NOs: 13 and 14, or a nucleotide sequence represented by SEQ ID NOs: 15 and 16.
Item 12. Item 12. The diagnostic agent according to any one of Items 9 to 11, wherein the malignant tumor is renal cell carcinoma.

(IV) Antitumor Agent Item 13. An antitumor agent comprising DNA having a base sequence encoding the amino acid sequence of HOXB13 as an active ingredient.
Item 14. Item 14. The antitumor agent according to Item 13, which is an anticancer agent against renal cell carcinoma.

(V) Screening method 15. A method for screening an antitumor substance against renal cell carcinoma, comprising the following steps:
(A) contacting a test substance with a renal cancer cell in which expression of the HOXB13 gene is suppressed due to methylation of a CpG island of the HOXB13 gene;
(B) measuring the expression level of the HOXB13 gene in the renal cancer cells and comparing the expression level (control expression level) of the HOXB13 gene in the renal cancer cells not contacted with the test substance, and (c) the control expression level A step of selecting a test substance brought into contact with a renal cancer cell having an increased expression level of the HOXB13 gene as an antitumor substance against renal cell carcinoma.
Item 16. Item 16. The method for screening an antitumor substance according to Item 15, wherein the expression of the HOXB13 gene is detected as an mRNA amount by a real-time RT-PCR method.

  In the above, “region of base numbers −1 to −376 of the HOXB13 gene” is a region located at base numbers −1 to −376 when the start codon of exon 1 of the human HOXB13 gene is set to base number 1. Means. Hereinafter, throughout the present specification, xxx in the case of “base number xxx” indicates the position of the base when the start codon of the HOXB13 gene exon 1 is base number 1.

  On the other hand, in the present specification, the “yyyth” of a specific base sequence or amino acid sequence refers to the base when the 5′-end base of the base sequence or the N-terminal amino acid of the amino acid sequence is the first. Or the position of an amino acid shall be shown.

  The present invention shows that the HOXB13 gene exhibits tumor-specific methylation that is not found in normal renal tissue in primary renal cell carcinoma, is inactivated by methylation, and is introduced by introduction of the HOXB13 gene into renal cancer cells. It was completed based on the finding that apoptosis was induced and proliferation of cancer cells was suppressed. ADVANTAGE OF THE INVENTION According to this invention, the diagnostic method which determines the morbidity and the grade of the malignant tumor containing renal cell carcinoma by detecting the methylation of HOXB13 gene can be provided. Furthermore, according to the present invention, it is possible to provide a diagnostic agent that can be effectively used in the method for diagnosing the morbidity and the degree of the malignant tumor. In addition, according to the present invention, an antitumor agent utilizing the renal cancer cell growth inhibitory function of the HOXB13 gene or its expression product can be provided. Furthermore, according to the present invention, it is possible to provide a method for searching for a new antitumor substance for primary renal cell carcinoma using the recovery of expression by demethylation of the HOXB13 gene as an index.

(I) Malignant Tumor Determination Method The present invention is characterized by using a methylated homeo-box B13 gene (HOXB13 gene) as a malignant tumor marker, preferably a renal cell carcinoma marker.

  In the present invention, the HOXB13 gene used as a malignant tumor marker includes a translation region (coding region), a non-coding region containing a nucleotide sequence encoding the amino acid sequence (NCBI RefSeq. NP_006352) of mammals, preferably human-derived HOXB13. Examples thereof include a gene containing a translation region and a promoter region located 5 ′ upstream thereof. For example, the base sequence of the human-derived HOXB13 gene is described in Genbank Accession No. AC091179, and the base sequence of the mouse-derived Hoxb13 gene is described in Genbank Accession No. AL645478. The base sequence of the human-derived HOXB13 gene is shown in SEQ ID NO: 1 in the sequence listing, and the amino acid sequence of human-derived HOXB13 (protein) encoded thereby is shown in SEQ ID NO: 2.

  In the base sequence of human-derived HOXB13 gene (SEQ ID NO: 1), the 2611st to 26711st and 27661th to 27915th regions are the translation regions [exon 1] and [exon 2], respectively, and the 26712th to 27660th regions. Is an untranslated region, and the 25691st to 261111th region is a promoter region. The HOXB13 gene used in the present invention includes a gene having a known base sequence registered in the above-mentioned Genbank and the like, as well as the natural sequence due to the species difference of individuals, individual differences, or differences between organs and tissues. In addition, a gene having a base sequence in which deletion, substitution, or addition of a base due to a mutation occurring in is caused is also included.

  In mammals, there is a phenomenon in which only cytosine is methylated among four types of bases constituting a gene (genomic DNA). This DNA methylation modification is a base sequence represented by 5′-CG-3 ′ (C means cytosine, G means guanine. Hereinafter, this base sequence is referred to as “CpG” or “CpG sequence”) This is done by adding a methyl group to the 5-carbon part of cytosine. Such a region rich in CpG sequences in the genome is called a “CpG island”. CpG islands are often present in the transcriptional promoter region of genes. In addition, during DNA replication prior to cell division, only cytosine in the CpG sequence of the template strand is methylated immediately after replication, but the cytosine in the CpG sequence of the nascent strand is also immediately activated by the action of the methyltransferase. Methylated. For this reason, DNA methylation is inherited as it is by two new sets of DNA even after DNA replication.

  The method for determining a malignant tumor of the present invention uses methylation of a HOXB13 gene derived from a mammal as an index, and a subject having a methylated HOXB13 gene suffers from a malignant tumor, particularly renal cell carcinoma. It can be judged that there is a high possibility. In particular, the determination method of the present invention can be carried out using cytosine methylation in one or more CpG sequences in the base sequence of the HOXB13 gene as an index. In particular, it is preferable to perform cytosine methylation of the CpG sequence in the region where the CpG sequence is dense (CpG island) as an index.

  The nucleotide sequence including one or more CpG sequences present in the HOXB13 gene includes exon 1 of human-derived HOXB13 gene (SEQ ID NO: 1) (26112 to 26711 of SEQ ID NO: 1) and a promoter located 5 ′ upstream thereof. The base sequence of the area | region containing a area | region (25691st-26111th of sequence number 1) can be mentioned. More specifically, the base sequence of the 25691st to 26711st regions in the base sequence (SEQ ID NO: 1) of the human-derived HOXB13 gene can be mentioned.

  The cytosine of the CpG sequence present in the nucleotide sequence shown in SEQ ID NO: 1, particularly the cytosine of the CpG sequence present in the CpG island has a high methylation frequency (ie, hypermethylation) in cancer cells such as kidney cancer cells. State (hypermethylation). In the HOXB13 gene, the CpG island is a region from 25736 to 26111 in the base sequence (SEQ ID NO: 1) of the HOXB13 gene. This region corresponds to the region of base numbers -376 to -1 when the start codon of exon 1 of the HOXB13 gene is base number 1. The base sequence of this region is shown in SEQ ID NO: 3.

  More specifically, examples of cytosine having a high methylation frequency in kidney cancer cells include the 25919th, 25932th, 25934th, and 25936 included in the CpG island in the base sequence represented by SEQ ID NO: 1. Can give the second cytosine.

  The methylation frequency of the HOXB13 gene can be expressed as the percentage of haploids in which the cytosine is methylated when the presence or absence of cytosine methylation in the CpG to be investigated is examined for multiple haploids. In addition, the method of the present invention is an index value correlated with the methylation frequency of the HOXB13 gene instead of or in parallel with the methylation frequency of the HOXB13 gene (also referred to as “correlation value” in the present invention). It can also be performed by measuring. Examples of such correlation values include the expression level of the HOXB13 gene, more specifically, the amount of the transcription product of the gene (mRNA amount) and the amount of the translation product of the gene (HOXB13 protein amount). There is a negative correlation between the methylation of the HOXB13 gene and the expression level thereof, such that if the methylation frequency of the HOXB13 gene increases, the expression level decreases accordingly.

  Specifically, the method of the present invention can be carried out on a biological sample separated from a mammal and containing a DNA. Examples of mammals include mice, rats, rabbits, and the like used as laboratory animals, but humans are preferred. Biological samples include, for example, cancer cells such as renal cancer cells or tissues containing the same, cells that can contain DNA derived from cancer cells such as renal cancer cells, and tissues containing the cells (here, tissue refers to blood , Plasma, serum, body fluids such as lymph, and the like in a broad sense including lymph nodes, etc.) or body secretions (urine, milk, etc.). These biological samples may be used as they are as specimens for measurement, or DNA-containing fractions prepared by various operations such as separation, fractionation, and immobilization from such biological samples may be used as samples. .

  In measurement, DNA is first extracted from these samples using, for example, a commercially available DNA extraction kit. For example, when blood is used as a specimen, plasma or serum is prepared from the blood according to a normal method, and the prepared plasma or serum is used as a specimen to contain free DNA (including renal cancer cell-derived DNA). Can be analyzed by avoiding DNA derived from blood cells.

  (I-1) After contacting the extracted DNA with a reagent that modifies unmethylated cytosine (hereinafter referred to as “unmethylated cytosine modifying reagent” or simply “modifying reagent”), the DNA sequence in the HOXB13 gene The amount of amplification product obtained by amplifying a DNA containing cytosine in the base sequence represented by one or more CpGs present in the PCR reaction using primers that identify the presence or absence of cytosine methylation to be analyzed Check out.

  Here, as described above, the one or more CpG sequences present in the base sequence of the HOXB13 gene include, for example, the base sequence of the CpG island located at positions 25736 to 26111 of the HOXB13 gene represented by SEQ ID NO: 1. be able to. Among them, preferred are the 25837th to 26075th and 25860th to 26111th positions in SEQ ID NO: 1.

  Cytosine in CpG present in such a CpG island exhibits a high methylation frequency (ie, hypermethylation) in renal cell carcinoma cells.

  As the unmethylated cytosine modifying reagent, for example, bisulfite such as sodium bisulfite can be used. In order to bring the extracted DNA into contact with an unmethylated cytosine modifying reagent, for example, the DNA is first subjected to modification with a modifying reagent (concentration in the solution: for example, a final concentration of 3M) in an alkaline solution (pH 9 to 14). Treat at 55 ° C for ~ 16 hours. In this case, unmethylated cytosine (hereinafter referred to as “unmethylated cytosine”) is converted to uracil, while methylated cytosine (hereinafter referred to as “methylated cytosine”) is not converted to uracil. Remain cytosine. Next, the base sequence (methylated cytosine [cytosine in CpG] remains cytosine and contained in unmethylated cytosine [CpG] when DNA treated with the modifying reagent is used as a template and methylated cytosine is contained. Cytosine] is a PCR using a pair of methylation-specific primers each selected from a nucleotide sequence that has become uracil) and a complementary nucleotide sequence to the nucleotide sequence (hereinafter also referred to as “methylation-specific PCR”). )) And DNA sequence treated with the modifying reagent as a template, and the base sequence when cytosine is not methylated (base sequence in which all cytosines are uracil) is complementary to the base sequence. PCR using a pair of unmethylated specific primers each selected from the base sequence (hereinafter also referred to as “unmethylated specific PCR”) is performed. In the above PCR, in the case of PCR using methylation specific primers (the former), DNA in which cytosine to be analyzed is methylated is amplified, while in the case of PCR using unmethylation specific primers ( In the latter case, DNA in which cytosine to be analyzed is not methylated is amplified. The presence or absence of methylation of the target cytosine can be determined by the presence or absence of any of these amplification products.

  Here, the methylation-specific primer and the non-methylation-specific primer are bases containing each methylated cytosine, considering that unmethylated cytosine is converted to uracil and methylated cytosine is not converted to uracil. It is designed as a PCR primer specific for the sequence and the base sequence including unmethylated cytosine. Designed on the basis of DNA strands that were chemically converted by non-methylated cytosine modification reagent treatment and became non-complementary. Primers and unmethylated specific primers can also be made. Such a primer is preferably designed to contain cytosine in the CpG sequence in the vicinity of the 3 ′ end of the primer in order to increase the specificity of methyl and non-methyl. Further, in order to facilitate analysis, one of the primers may be labeled.

  More specifically, as a primer for determining the presence or absence of methylation of the HOXB13 gene by PCR, based on a base sequence containing one or more cytosines of CpG present in the promoter region of the HOXB13 gene, particularly the CpG island region, It can be designed as described above.

  For example, one or more cytosines of CpG present in the base sequence represented by SEQ ID NO: 1, specifically, the cytosines located at the 25919th, 25932th, 25934th and 25936th positions in the base sequence represented by SEQ ID NO: 1 It can design based on the base sequence to contain. Examples of such primers are shown below.

<Unmethylated specific primer pair>
MSPU1F: TTTAGGTTGTAGTTAATTAGTGTGTGT (SEQ ID NO: 4)
MSPU1R: AAACCAAAAAAATCCAAAACATT (SEQ ID NO: 5)
MSPU2F: TTTAGGTTGTAGTTAATTAGTGT (SEQ ID NO: 6)
MSPU2R: AACCAAAAAAATCCAAAACATT (SEQ ID NO: 7)
MSPU3R: CCAAAAAAATCCAAAACATT (SEQ ID NO: 8)
Here, MSPU1F and MSPU1R, MSPU2F and MSPU2R, and MSPU1F and MSPU3R are primer pairs for amplifying the regions 2511 to 26040, 25911 to 26039, and 25911 to 26037 of SEQ ID NO: 1, respectively.

<Methylation specific primer pair>
MSPM1F: GTCGTAGTTAATTAGCGCGC (SEQ ID NO: 9)
MSPM1R: AACCGAAAAAATCCAAAACGT (SEQ ID NO: 10)
MSPM2F: TAGGTCGTAGTTAATTAGCGC (SEQ ID NO: 11)
MSPM2R: ACCGAAAAAATCCAAAACGTT (SEQ ID NO: 12)
Here, MSPM1F and MSPM1R and MSPM2F and MSPM2R are primer pairs for amplifying the regions 25917 to 26039 and 25914 to 26038 of SEQ ID NO: 1, respectively.

As a reaction solution in methylation-specific PCR, for example, DNA as a template, each primer solution, dNTP, 10 × buffer (for example, 100 mM Tris-HCl pH 8.3, 500 mM KCl, 20 mM MgCl ₂ ), and heat resistance A reaction solution in which DNA polymerase is mixed and sterilized ultrapure water is added thereto can be used. As the reaction conditions, for example, the above reaction solution is kept at 94 ° C. for 10 minutes, then at 94 ° C. for 30 seconds, then at 55 to 65 ° C. for 60 seconds, and further at 72 ° C. for 45 seconds. The conditions for performing the cycle reaction for about 30 cycles can be given. After performing such PCR, the presence or absence of amplification products is compared. For example, when electrophoresis (for example, denaturing polyacrylamide gel electrophoresis or agarose gel electrophoresis) is used, the gel after electrophoresis is stained with DNA, PCR using a methylation specific primer and non-methylation specific A band of each amplification product obtained by PCR using primers is detected. Here, instead of DNA staining, a pre-labeled primer can be used to compare the presence or absence of a band using the label as an index. When quantification is required, the amount of each product can be compared by monitoring PCR reaction products in real time and performing kinetic analysis. As such a method, for example, real-time PCR capable of high-precision quantification capable of detecting even a slight difference of about twice the gene amount can be mentioned. Examples of real-time PCR include a method using a probe such as a template-dependent nucleic acid polymerase probe or a method using an intercalator such as Cyber Green. Equipment and kits for real-time PCR are already commercially available.

  The method described above (I-1) is generally reported as a methylation-specific PCR by Herman et al. (Herman et al., Proc. Natl. Acad. Sci USA, 93, 9821-9826, 1996). This method can be partially modified and used.

  (I-2) As another method, regardless of methylation or non-methylation, a specific region of the HOXB13 gene, preferably a CpG island region, is first amplified by PCR, and then the amplified sequence is cleaved with a restriction enzyme. Diagnosis can also be made based on whether the band obtained by electrophoresis is divided into one or two. When methylated cytosine is present, the band is divided into two.

  Restriction enzymes used in this method are not recognized after treatment with a non-methylated cytosine modifying reagent (bisulfite such as sodium bisulfite) on a sequence containing unmethylated cytosine (unmethylated cytosine). It is preferable that the restriction enzyme can digest only a recognition sequence containing methylated cytosine. In the case where the cytosine contained in the CpG island is not methylated, even if such a restriction enzyme is allowed to act, the DNA after treatment with the unmethylated cytosine modifying reagent is not cleaved, whereas the cytosine contained in the recognition sequence In the case of DNA that is methylated, the DNA is cleaved. Specific examples of restriction enzymes include BstUI, TaqI and the like. BstUI is preferable.

  As a method for examining the presence or absence of digestion with the restriction enzyme, for example, a specific region of the HOXB13 gene, preferably CpG island DNA is used as a template, and cytosine to be analyzed is included in the recognition sequence. PCR can be performed using a primer pair capable of amplifying DNA that does not contain an enzyme recognition sequence, and the amplified DNA (amplified product) is treated with a restriction enzyme to check for the presence of a cleaved fragment. When cytosine to be analyzed is methylated, a cleaved fragment is obtained. On the other hand, when the cytosine to be analyzed is not methylated, a cleaved fragment cannot be obtained. In this way, the degree of methylation of cytosine to be analyzed can be measured by comparing the amounts of cleaved DNA fragments.

  For example, since cytosines shown at 25932, 25934, and 25936 in the base sequence shown in SEQ ID NO: 1 are included in the recognition sequence of BstUI, the degree of methylation of the cytosine is determined by the above method. be able to. Examples of primer pairs used here are shown below.

MIRC9-2 primer pair
MIRC9-2F: GGGTAAAGTATTTTYGTAGTTTT (SEQ ID NO: 13)
MIRC9-2R: CCTTAACTCCATCCAAAATAAC (SEQ ID NO: 14)
MIRC9-3 primer pair
MIRC9-3F: AGAGAGAGAGAGAGAATAAGT (SEQ ID NO: 15)
MIRC9-3R: AAATCTAAAAAACACCCAACTC (SEQ ID NO: 16)
Here, the amplification regions of the MIRC9-2 primer pair and the MIRC9-3 primer pair are the regions 25860 to 26151 and 25837 to 26075 of SEQ ID NO: 1, respectively.

  In addition, as another method for examining the presence or absence of digestion with the restriction enzyme, for example, DNA derived from the HOXB13 gene with respect to DNA subjected to a methylation-sensitive restriction enzyme containing cytosine to be analyzed as a recognition sequence, and A method of examining the length of the hybridized DNA by performing Southern hybridization using a DNA that does not contain the recognition sequence of the restriction enzyme as a probe can also be mentioned. When the cytosine to be analyzed is methylated, longer DNA is detected than when the cytosine is not methylated. By comparing the amount of long DNA detected with the amount of short DNA detected, the frequency of cytosine methylation to be analyzed can be measured.

  (I-3) As another method, DNA extracted from a biological sample is brought into contact with an unmethylated cytosine modifying reagent (bisulfite such as sodium bisulfite) and then present in the base sequence of the HOXB13 gene. Another example is a method in which DNA containing one or more CpGs is hybridized with a probe capable of discriminating the presence or absence of cytosine methylation, and the presence or absence of binding between the probe and the DNA is examined.

  The probe used for the hybridization is based on the base sequence containing the cytosine of CpG to be analyzed, and cytosine that has not been methylated is converted to uracil, and cytosine that has undergone methylation is converted to uracil. Designed in consideration of not being converted. That is, the base sequence containing methylated cytosine (methylated cytosine [cytosine in CpG] remains cytosine, and unmethylated cytosine [cytosine not contained in CpG] is uracil base sequence) or A methylation-specific probe having a complementary base sequence, and a base sequence when cytosine is not methylated (a base sequence in which all cytosines are uracil) or a base sequence complementary thereto An unmethylated specific probe is designed. Such a probe may be labeled in order to easily analyze the presence or absence of binding between DNA and the probe. The probe can also be used by being immobilized on a carrier according to a usual method.

  In order to bring DNA into contact with an unmethylated cytosine modifying reagent, for example, the DNA is first denatured with an alkaline solution (pH 9 to 14), and then the modifying reagent (concentration in the solution: for example, final concentration of 3M) is used. Treat at 55 ° C for about 10-16 hours (overnight). To accelerate the reaction, denaturation at 95 ° C and reaction at 50 ° C can be repeated 10-20 times. In this case, unmethylated cytosine is converted to uracil, while methylated cytosine is not converted to uracil and remains cytosine. If necessary, the DNA may be amplified in advance by performing PCR in the same manner as in the above method (I-1) using a DNA treated with an unmethylated cytosine modifying reagent as a template.

  Next, the probe is hybridized with DNA treated with an unmethylated cytosine modifying reagent or DNA previously amplified by PCR. Hybridization is a conventional method described in, for example, Sambrook J., Frisch EF, Maniatis T., Molecular Cloning 2nd edition, Cold Spring Harbor Laboratory press. It can be performed according to. Hybridization is usually performed under stringent conditions. Here, “stringent conditions” means, for example, that a hybrid is formed at 45 ° C. in a solution containing 6 × SSC (a solution containing 1.5M NaCl, 0.15M trisodium citrate is 10 × SSC). And then washing with 2 × SSC at 50 ° C. (Molecular Biology, John Wiley & Sons, NY (1989), 6.3.1-6.3.6). The salt concentration in the washing step can be selected, for example, from 2 × SSC at 50 ° C. (low stringency conditions) to 0.2 × SSC at 50 ° C. (high stringency conditions). The temperature in the washing step can be selected from room temperature (low stringent conditions) to 65 ° C. (high stringent conditions), for example. It is also possible to change both the salt concentration and the temperature.

  After such hybridization, the amount of DNA bound to the methylation-specific probe is compared with the amount of DNA bound to the non-methylation-specific probe, so that the cytosine to be analyzed (ie, the probe) The frequency of methylation of cytosine in CpG contained in the base sequence on which the design was based can be measured.

  More specifically, the probe for measuring the methylation frequency of the HOXB13 gene is based on, for example, a nucleotide sequence containing one or more cytosines of CpG present in the promoter region of the HOXB13 gene, particularly in the nucleotide sequence in the CpG island. Can be designed. For example, cytosine in CpG present in the base sequence represented by SEQ ID NO: 1, specifically, one or more cytosines of 25919th, 25932th, 25934th, 25936th in the base sequence represented by SEQ ID NO: 1 It can be designed based on the base sequence. Examples of such probes are shown below.

<Set 1>
Unmethylated specific probe: ACACACACTAATTAACTACAACCTAAA (SEQ ID NO: 17)
Methylation specific probe: GCGCGCTAATTAACTACGAC (SEQ ID NO: 18)
The unmethylated specific probe is a region amplified by the unmethylated specific primer pair (MSPU1F and MSPU1R set), and the methylated specific probe is the methylated specific primer pair (MSPM1F and MSPM1F). It is a probe that recognizes each region amplified by MSPM1R set).

<Set 2>
Unmethylated specific probe: ACACTAATTAACTACAACCTAAA (SEQ ID NO: 19)
Methylation specific probe: GCGCTAATTAACTACGACCTA (SEQ ID NO: 20).

  The unmethylated specific probe is a region amplified by the unmethylated specific primer pair (MSPU2F and MSPU2R set), and the methylated specific probe is the methylated specific primer pair (MSPM2F and MSPM2F). It is a probe that recognizes each region amplified by MSPM2R set).

  (I-4) As another method for determining the methylation frequency, DNA treated with an unmethylated cytosine modifying reagent (such as sodium hydrogen sulfite) is used, and a specific region of the HOXB13 gene, preferably a specific CpG island region is selected. Examples include a method of preparing a clone by TA cloning after amplification by PCR and sequencing the base sequence of the amplified fragment. Thereby, methylation / non-methylation can be identified for all CpG sequences contained in the amplification region, and methylation frequency can be measured.

(II) Method for Determining the Level of Malignant Tumor According to the determination method of the present invention, the methylation frequency of the HOXB13 gene measured by the above method increases with the progress of the degree of malignant tumor, particularly renal cell carcinoma, and both are positive. It was designed based on the knowledge that there is a correlation.

The determination method of the present invention includes the following steps:
(1) a step of measuring the methylation frequency of the HOXB13 gene in mammals or a correlation value thereof,
(2) a step of comparing the measured methylation frequency or the correlation value thereof with the methylation frequency or the correlation value of the HOXB13 gene of a healthy mammal as a control, and (3) a test based on the comparison result. Evaluating the degree of malignant tumor in mammals.

  In the first step, the method of measuring the methylation frequency of the HOXB13 gene of a mammal, preferably a human, or the correlation value thereof can be performed according to the method described in (I). In the second step, it has a methylation frequency measured in the first step or a correlation value thereof [an index value correlated with the methylation frequency (for example, the amount of expression product)] and a cancer cell such as a renal cancer cell. Compare the methylation frequency of the HOXB13 gene or its correlation value (control) contained in a sample derived from a healthy mammal diagnosed as having no disease, and determine the degree of malignancy of the sample based on the difference obtained by the comparison To do. If the HOXB13 gene methylation frequency and its correlation value contained in a mammal-derived sample are higher than the control (if the HOXB13 gene is highly methylated in comparison with the control), It can be determined that the degree of malignancy is high compared to the control.

  Here, the “malignant tumor degree” has the same meaning as that generally used in the art, and specifically, for example, when a mammal-derived specimen is a cell, it means the malignancy of the cell. For example, when the mammal-derived specimen is a tissue, it means the abundance of cancer cells in the tissue.

  In the first step of the determination of the present invention, as a method for measuring an index value correlated with the methylation frequency of the HOXB13 gene contained in a mammal-derived specimen, for example, the amount of mRNA that is a transcription product of the HOXB13 gene The method of measuring can be mention | raise | lifted. For the measurement, for example, RT-PCR method, Northern blot method [Molecular Cloning, Cold Spring Harbor Laboratory (1989)], in situ RT-PCR method [Nucleic Acids Res., 21, 3159-3166 (1993)], Known methods such as in situ hybridization and NASBA [Nucleic acid sequence-based amplification, nature, 350, 91-92 (1991)] can be used. A sample containing mRNA that is a transcription product of the HOXB13 gene contained in a mammal-derived specimen may be prepared by extraction, purification, or the like from the specimen according to a normal method.

  When Northern blotting is used to measure the amount of mRNA contained in the prepared sample, the detection probe should be the HOXB13 gene or a part thereof (restriction enzyme cleavage of the HOXB13 gene, the base sequence of the HOXB13 gene). It may contain any chemically synthesized oligos or polynucleotides of about 100 bp to about 1000 bp, etc., and give a detectable specificity under the detection conditions used in the hybridization with the mRNA contained in the sample. If there is no restriction in particular.

In addition, when the RT-PCR method is used to measure the amount of mRNA contained in the prepared sample, the primer used may be any primer that can specifically amplify only the HOXB13 gene. There are no particular restrictions on the region to be amplified or the base length. Examples of such primers include the following primers (S: sense, A: antisense).
S: 5'-TTGCCTGTGGACAGTTACC-3 '(SEQ ID NO: 21) (corresponding to the 26601 to 26619th region of SEQ ID NO: 1)
A: 5′-AACTTGTTAGCCGCATACTC-3 ′ (SEQ ID NO: 22) (corresponding to the 27760-27779th region of SEQ ID NO: 1).

  Using these primers, the amount of transcription product by RT-PCR can also be measured as shown in the following experimental examples. When quantification is required, real-time PCR can be used to compare the amount of each product.

  In the first step of the determination method of the present invention, another method for measuring an index value correlated with the methylation frequency of the HOXB13 gene contained in a mammal-derived specimen is, for example, a translation product of the HOXB13 gene. A method for measuring the amount of a certain HOXB13 (protein) can be mentioned. For the measurement, for example, a known method such as immunoblotting using a specific antibody (monoclonal antibody, polyclonal antibody) against HOXB13 or a partial peptide thereof, separation by immunoprecipitation, indirect competitive inhibition (ELISA), etc. It may be used (see, for example, Cell Engineering Handbook, Yodosha, 207 (1992)). A specific antibody against HOXB13 or a partial peptide thereof can be produced according to an ordinary immunological method using the protein or the like as an immunizing antigen. Specifically, as an example of a partial peptide of HOXB13 used as an immunizing antigen, a 14 amino acid sequence corresponding to positions 268 to 281 of the amino acid sequence of human HOXB13 (SEQ ID NO: 2) used in Experimental Example 5 is used. Or a peptide containing the amino acid sequence (RVKEKKVLAKVKNS: (SEQ ID NO: 23)).

(III) Diagnostic Agent for Malignant Tumor Determination Primer and probe that can be used for measuring the methylation frequency of HOXB13 gene or an index value correlated therewith in the aforementioned malignant tumor of the present invention and the method for determining the degree thereof Alternatively, a specific antibody against HOXB13 is useful as a reagent (diagnostic agent) for detecting a malignant tumor such as a mammalian, preferably human renal cell carcinoma. The present invention relates to a kit for detecting cancer cells such as renal cancer cells containing at least one of these primers, probes or specific antibodies as a reagent, and these primers, probes or specific antibodies on a carrier. The present invention also provides a chip for detecting cancer cells such as immobilized renal cancer cells. Specific examples of these primers, probes, and specific antibodies include those described in the above (I), (II) and the following experimental examples.

(IV) Antitumor agent
The expression of HOXB13 gene is lower in cancer cells such as renal cancer cells than in specimens such as cells and tissues derived from healthy mammals. In addition, by causing a substance that inhibits DNA methylation related to the HOXB13 gene to act on cancer cells such as renal cancer cells, the amount of the expression product of the gene can be increased. In addition, as shown in the experimental examples to be described later, by expressing an exogenous HOXB13 gene in a highly methylated renal cancer cell line that does not express the HOXB13 gene, the proliferation of renal cancer cells is suppressed and apoptosis is induced. confirmed. These findings indicate that a cDNA consisting of the nucleotide sequence encoding the amino acid sequence of the HOXB13 gene or HOXB13 protein acts as a tumor suppressor gene in human renal cell carcinoma, treating malignant tumors such as kidney cancer, and suppressing canceration of normal tissues such as kidney This suggests that it is useful as an effective antitumor substance. Similarly, substances that can increase the expression level of HOXB13 protein, such as substances that reduce the methylation frequency of HOXB13 gene and substances that inhibit DNA methylation related to HOXB13 gene, are useful for the treatment of malignant tumors such as kidney cancer. It is considered useful as an antitumor substance effective in suppressing canceration of normal tissues such as kidney and kidney.

  Accordingly, the present invention provides an antitumor agent (antimalignant tumor agent, anticancer agent) containing DNA having a base sequence encoding the amino acid sequence of HOXB13 protein as an active ingredient. The DNA may be the HOXB13 gene itself, or may be a DNA (for example, a vector DNA) containing a base sequence encoding the amino acid sequence of HOXB13 (protein) in an expressible state. An effective amount of the antitumor agent of the present invention is parenterally administered to a mammal such as a human (for example, a cell in a mammal that can be diagnosed as a malignant tumor, preferably a kidney cell). Can do. For example, parenteral administration methods include injection (subcutaneous, intravenous, topical) and the like.

  The dose varies depending on the age, sex, weight, disease level, type of the antitumor agent of the present invention, dosage form, etc. of the mammal to be administered, but the active ingredient is usually effective in the patient cell. It is sufficient to administer an amount of the active ingredient that produces an intracellular level equal to the concentration level that acts on the cell. In addition, the above-mentioned daily dose can be administered once or divided into several times.

  Here, as a method for introducing the HOXB13 gene into a cell, a gene introduction method using a viral vector, a gene introduction method using a non-viral vector (Nikkei Science, April 1994, pages 20-45, experimental medicine) Special issue, 12 (15) (1994), experimental medicine separate volume "Basic technology of gene therapy", Yodosha (1996)). As the former gene transfer method, for example, HOXB13 or mutant HOXB13 is encoded on a DNA virus or RNA virus such as a retrovirus, adenovirus, adeno-associated virus, herpes virus, vaccinia virus, poxvirus, poliovirus, symbis virus, etc. And a method for introducing and incorporating the DNA to be processed. Examples of gene transfer methods using non-viral vectors include a method in which an expression plasmid is directly administered into muscle (DNA vaccine method), a liposome method, a lipofectin method, a microinjection method, a calcium phosphate method, an electroporation method, and the like. Is given.

  In addition, as a method of using the DNA of the HOXB13 gene as an active ingredient of a gene therapy agent as an antitumor agent, an in vivo method in which the DNA of the gene is directly introduced into the body, a specific cell is taken out from a human, and the gene Ex vivo method that introduces DNA into the cells and returns the cells to the body (Nikkei Science, April 1994, pages 20-45, Monthly Pharmaceutical Affairs, 36 (1), 23-48 (1994), experimental medicine Special edition, 12 (15) (1994)).

  In the former in vivo method, the DNA of the gene can be administered by an appropriate administration route according to the disease, symptoms and the like. For example, it can be administered by injection into kidney cancer cells, veins, arteries, subcutaneous, intradermal, intramuscular and the like. As a dosage form of the gene therapy agent as the antitumor agent, a liposome preparation such as an injection, a suspension, a freezing agent, a centrifugal concentrated freezing agent and the like can be used. Such a preparation is pharmaceutically acceptable, for example, the gene (vector type or virus type, or the like) in a carrier such as a water-soluble solvent, a water-insoluble solvent, a buffer, a solubilizing agent, an isotonic agent, a stabilizer. Or a plasmid type of the above gene form). You may add adjuvants, such as antiseptic | preservative, a suspending agent, and an emulsifier, as needed. Moreover, when administering parenterally (in general, injection etc. are preferable), the said antitumor agent can be used with the form of normal liquid agents, such as a solution.

(V) Screening method As described above, by causing a substance that inhibits methylation of the HOXB13 gene to act on cancer cells such as renal cancer cells, the amount of the expression product of the gene can be increased. By expressing an exogenous HOXB13 gene in a highly methylated renal cancer cell line that is not expressed, the growth of renal cancer cells is suppressed. These findings indicate that substances that can compensate for the decrease in the expression level of the HOXB13 gene in cancer cells such as renal cancer cells or the accompanying decrease in function, such as unmethylation (or methylation abnormality as observed in cancer). (Not) HOXB13 gene, the expression product of the gene, the substance that has the ability to promote the expression of the gene (for example, the substance that inhibits the methylation of the HOXB13 gene, the substance that decreases the methylation frequency of the HOXB13 gene, etc.) This means that it is useful for the treatment of malignant tumors such as kidney cancer and the suppression of canceration of normal tissues such as kidney.

Therefore, the present invention provides a method (screening method) for searching for an antitumor substance useful for the treatment of malignant tumors such as kidney cancer and the suppression of canceration of normal tissues such as kidneys based on such findings. The screening method of the present invention is characterized by having the following steps:
(A) contacting a test substance with a renal cancer cell in which expression of the HOXB13 gene is suppressed due to methylation of a CpG island of the HOXB13 gene;
(B) measuring the expression level of the HOXB13 gene in the renal cancer cells and comparing the expression level (control expression level) of the HOXB13 gene in the renal cancer cells not contacted with the test substance, and (c) the control expression level A step of selecting a test substance brought into contact with a renal cancer cell having an increased expression level of the HOXB13 gene as an antitumor substance against renal cell carcinoma.

  The kidney cancer cells used in step (a) of the search method of the present invention may be cancer cells isolated from mammal-derived kidney cancer tissues, or derived from mammals established as cell lines. May be a renal cancer cell line. Examples of the mammal include humans, monkeys, mice, rats, hamsters and the like. Specifically, for example, 786-O, UMRC-6, KC-12, ACHN, A498, OUR-10, OUR-20, VHL-renal, YCR, Caki-1, Caki-2, used in the experimental example, Examples include human-derived kidney cancer cell lines such as SKRC-1, SKRC-7, TUHR4TKB, and TUHR14TKB. Of these cell lines, 786-O, ACHN, A498, Caki-1, Caki-2 (above, ATCC), TUHR4TKB, and TUHR14TKB (above, RIKEN CELL BANK) are commercially available and are commercially available. be able to.

  The renal cancer cells used in step (a) have no HOXB13 gene deletion (especially homotypic deletion), but the expression level of the gene due to methylation of CpG island of HOXB13 gene Is a renal cancer cell line that is suppressed. These cell lines can be obtained according to a conventional method. For example, an existing demethylation reagent (for example, from among renal cancer cells confirmed by CGH method or FISH method, for example, that at least deletion of HOXB13 gene (preferably homotypic deletion) is not observed is observed. , 5-azadeoxycytidine) to select cells that recover the level of the HOXB13 gene, subculture this, and select the desired HOXB13 gene due to methylation of the CpG island of the HOXB13 gene. It can be obtained as a “renal cancer cell line in which the expression of is suppressed” (hereinafter also referred to as methylated cancer cell line).

  Test substances include, but are not limited to, nucleic acids, peptides, proteins, organic compounds, inorganic compounds, etc., and screening is performed using these test substances or compositions containing them (for example, cell extracts, genes) Library expression products and the like) can be brought into contact with renal cancer cells in which the expression of the HOXB13 gene is suppressed due to the aforementioned methylation of the CpG island of the HOXB13 gene.

The environment for bringing the test substance into contact with the renal cancer cell in the step a of the present invention is preferably an environment that maintains the vital activity of the renal cancer cell. For example, the energy source of the cancer cell coexists. The environment can be raised. Specifically, it is convenient that the step (a) is performed in a medium. The amount of renal cancer cells is usually about 10 ⁴ to 10 ⁸ cells, preferably about 10 ⁵ to 10 ⁷ cells. The concentration of the test substance is usually about 0.1 ng / ml to about 100 μg / ml. The time for contacting the test substance with the renal cancer cells is usually about 1 hour to 5 days. The number of times the test substance is brought into contact with the renal cancer cells may be one time or a plurality of times.

  In order to measure the expression level of the HOXB13 gene in renal cancer cells in the step (b) of the method of the present invention, according to the method for measuring the index value (correlation value) correlated with the methylation frequency of the HOXB13 gene described above. To measure. Specifically, methods for quantifying mRNA, such as real-time RT-PCR, Southern blot, Northern blot, and DNA chip method, preferably real-time RT-PCR can be mentioned.

  In the step (b) of the present invention, the HOXB13 expression level of the renal cancer cells contacted with the test substance is compared with the HOXB13 expression level of the renal cancer cells not contacted with the test substance (control HOXB13 expression level). In the step (c), the ability to promote the expression of the HOXB13 gene is determined for each test substance as a result of the comparison in the step (b). In this case, if the HOXB13 expression level of the renal cancer cells contacted with the test substance is higher than the control HOXB13 expression level, it can be determined that the test substance has the ability to promote the expression of the HOXB13 gene. As a control, the expression level of the HOXB13 gene when a renal cancer cell is previously contacted with another test substance whose ability to promote the expression of the HOXB13 gene may be used.

  In addition, as a background or control, the expression level of the HOXB13 gene contained in a normal cell line such as a normal kidney cell line and a healthy mammal specimen that can be diagnosed as having no cancer cells such as a kidney cancer cell, It is preferable to measure both when the test substance is contacted and when it is not contacted.

  Thus, a test substance having increased expression of the HOXB13 gene can be selected as a candidate substance for an antitumor substance of kidney cancer. The substance selected by the above screening can be used as an active ingredient of a pharmaceutical composition useful for the treatment of malignant tumors such as kidney cancer and the suppression of canceration of normal tissues such as kidney.

  Candidate substances selected by the screening method described above are further used for drug efficacy tests, safety tests, kidney cancer patients (humans) or patients in the previous state (humans) using pathological non-human animals having kidney cancer. Pharmaceutical compositions that may be used for clinical trials and are useful for the treatment of more practical antitumor substances and malignant tumors such as kidney cancer and suppression of canceration of normal tissues such as kidney by conducting these tests It is possible to select and acquire the active ingredients.

  The material selected in this way is subjected to structural analysis as necessary, and then, depending on the type of the material, chemical synthesis, biological synthesis (including fermentation), or genetic engineering operations can be used for industrialization. And can be used to prepare pharmaceutical compositions.

  In order to clarify the structure and effects of the present invention, experimental examples and examples are described below. However, the present invention is not affected by these examples.

Experimental Materials and Preparation The following 17 human renal cell carcinoma cell lines were used for the following experiments: KMRC-1 and KMRC-2 (created by the inventor), 786-O, UMRC-6 [the National Cancer Granted by Dr. B. Zbar of Institute-Frederick Cancer Research and Development Center (Frederick, MD, USA)], KC-12, ACHN, A498, OUR-10, OUR-20, VHL-renal, YCR, Caki-1 , Caki-2 (provided by Department of Urology, Yokohama City University), SKRC-1 and SKRC-7 (provided by Dr H Uemura of Kinki University), TUHR4TKB and TUHR14TKB (obtained from RIKEN CELL BANK).

  All 56 cases of primary renal cell carcinoma and adjacent normal tissue samples were obtained from surgical resection with patient consent from Japanese renal cell carcinoma patients (hereinafter referred to as case 1-68). All primary renal cell carcinomas were pathologically determined according to the rules for handling renal cancer (Kanehara Company, 1999).

  Genomic DNA was extracted from cell lines and tissue samples by standard phenol / chloroform methods.

Experimental Example 1 Identification of methylated CpG islands in renal cell carcinoma Methylated CpG island amplification / representational difference analysis (MCA / RDA) method was used to identify CpG islands methylated in renal cell carcinoma. MCA / RDA was performed by a slight modification to the method of Toyota et al. (Toyota M, et al., (1999). Cancer Res., 59, 2307-2312; Ueki T, et al., (2001). Cancer Res., 61, 8540-8546). The outline is shown below.

5 μg of DNA was digested with 100 units of Sma I (New England Biolabs, Beverly, Mass .) And then digested with 20 units of Xma I (New England Biolabs). The RMCA PCR adapter was prepared by incubating RMCA12 (5'-CCGGGCAGAAAG-3 ': SEQ ID NO: 24) and RMCA24 (5'-CCACCGCCATCCGAGCCTTTCTGC-3': SEQ ID NO: 25) at 65 ° C for 2 minutes and then cooling to room temperature. did. A restriction enzyme-treated fragment (0.5 μg) was ligated to 0.5 nmol of this RMCA PCR adapter using T4 DNA ligase (TAKARA, Tokyo, Japan), and 3 μl of each ligation mix was subjected to PCR amplification. The reaction solution was 16.6 mM Tris-HCl (pH 8.0), 4 mM MgCl ₂ , 166 mM (NH ₄ ) ₂ SO ₄ , 0.1 mg / ml BSA, 5% v / v DMSO, 300 μM of each deoxynucleotide triphosphate, 200 pmol. f Total volume 200 μl containing RMCA24 primer and 15 units Taq polymerase (TAKARA). After incubating the reaction solution at 72 ° C. for 5 minutes, the reaction was carried out for 25 cycles of 95 ° C. for 1 minute and 77 ° C. for 3 minutes, and final extension was performed at 72 ° C. for 10 minutes.

  For representational difference analysis (RDA), MCA amplicons derived from either KMRC-1 or KMRC-2 renal cancer cell lines were used as testers, and 4 separate patients (2 males and 2 females) were used. MCA amplicon obtained from a mixture of DNA obtained from normal kidney tissue was used as a driver. The JMCA PCR adapter was used for the first RDA and the NMCA PCR adapter was used for the second RDA.

The plumers for JMCA and NMCA are:
Primer for JMCA
JMCA24: 5'-GTGAGGGTCGGATCTGGCTGGCTC-3 '(SEQ ID NO: 26)
JMCA12: 5'-CCGGGAGCCAGC-3 '(SEQ ID NO: 27)
Primer for NMCA
NMCA24: 5'-GTTAGCGGACACAGGGCGGGTCAC-3 '(SEQ ID NO: 28)
NMCA12: 5′-CCGGGTGACCCG-3 ′ (SEQ ID NO: 29).

  For the first and second competitive hybridizations, 500 and 100 ng tester amplicons ligated to each adapter were used. After the second round of competitive hybridization and selective PCR amplification, the RDA product was cloned into the pBluescript II plasmid vector (Stratagene, La Jolla, Calif.). DNA sequence of isolated clones was determined using ABI 3100 automated DNA sequencer, BigDye Terminator cycle sequencing kit ver.3 (Applied Biosystems, Foster City, CA) and MT-T3 primer (SIGMA, St. Louis, MO) . Homology search with known sequences was performed using the BLAST program (National Center for Biotechnology Information, http://www.ncbi.nlm.nih.gov/BLAST/). CpG island region was determined using CpG island Searcher (http://cpgislands.usc.edu/).

  Table 1 shows the criteria for CpG islands (ie length> 200 bp, GC content> 50%, ObsCpG / ExpCpG> 0.6) (Gardiner-Garden M and Frommer M. (1987). J. Mol. Biol., 196, 261 4 clones (MIRC8, MIRC9, MIRC11, MIRC17) containing CpG sequences satisfying -282) and in which specific methylation was detected are shown.

  A BLAST search identified MIRC9 among the 4 clones as the 5 'region of the HOXB13 gene located on chromosome 17q21.2 (GenBank accession no. U57052). FIG. 1a shows the relationship between the isolated MIRC9 clone and the CpG island of the HOXB13 gene. The 2 base pair position of CpG island is indicated by a vertical line, and the exon of the HOXB13 gene is indicated by a box (Exon 1, Exon 2). The region analyzed by COBRA is indicated by a horizontal solid line, and the region analyzed by bisulfite sequencing is indicated by a horizontal broken line. From these results, it was considered that the HOXB13 gene was inactivated by DNA methylation of the 5 'region of the HOXB13 gene and involved in the development of renal cell carcinoma.

Experimental example 2 Analysis of HOXB13 gene methylation by COBRA method HOXB13 gene methylation in primary renal cell carcinoma found in Experimental example 1 was analyzed by combined bisulfite restriction analysis (COBRA method) and 56 cases of adjacent renal cell carcinoma and adjacent to them. A normal tissue sample was examined.

  Specifically, genomic DNA obtained from renal cancer cell lines, primary tumors and adjacent normal tissues was subjected to sodium bisulfite treatment (Clark et al., (1994). Nucleic Acids Res., 22, 2990-2997). COBRA was then performed according to a previously reported method (Xiong Z et al., (1997). Nucleic Acids Res., 25, 2532-2534). The outline is as follows.

Add 2 μl of bisulfite-treated DNA solution to 67 mM Tris-HCl (pH 8.8), 16.6 mM (NH ₄ ) ₂ SO ₄ , 6.7 mM MgCl ₂ , 10 mM β-mercaptoethanol, 2.5 mM each dNTP mixture, 0.5 μM each Amplification was performed in a 50 μl reaction solution containing primers and 1 unit of Ex Taq Hot Start Version polymerase (TAKARA). The amplification product (15-20 μl) was cleaved with a restriction enzyme that recognizes the CpG site sequence obtained due to methylation.

The primer pairs used for HOXB13 are as follows:
MIRC9-2 primer pair
MIRC9-2F: 5'-GGGTAAAGTATTTTYGTAGTTTT-3 '(SEQ ID NO: 13)
MIRC9-2R: 5'-CCTTAACTCCATCCAAAATAAC-3 '(SEQ ID NO: 14)
MIRC9-3 primer pair
MIRC9-3F: 5'-AGAGAGAGAGAGAGAATAAGT-3 '(SEQ ID NO: 15)
MIRC9-3R: 5'-AAATCTAAAAAACACCCAACTC-3 '(SEQ ID NO: 16)
When using the MIRC9-2 primer pair, PCR was performed at 94 ° C for 3 minutes, followed by 35 cycles of reaction at 94 ° C for 40 seconds, 60 ° C for 30 seconds and 72 ° C for 30 seconds, and MIRC9 When the primer pair -3 was used, the reaction was carried out at 94 ° C. for 3 minutes, and subsequently, 35 cycles of 94 ° C. for 40 seconds, 58 ° C. for 30 seconds and 72 ° C. for 30 seconds were performed. Bst UI (New England Biolabs) was used as a restriction enzyme for HOXB13. COBRA was similarly performed for other genes (p14ARF, p15INK4B, p16INK4A, CHFR, CACNA1G, TMS1, BNIP3, COX-2, hMLH1, DAPK, DCC, MINT1, MINT2). The primer sequences, PCR conditions, and restriction enzymes used in this procedure were as previously reported (Ogi et al., (2002) Clin Cancer Res., 8, 3164-3171; Satoh A, et al., ( 2003) Cancer Res., 63, 8606-8613; Terasawa et al., (2004). Clin Cancer Res., 10, 2000-2006; Kikuchi et al., (2002). Int J Cancer, 97, 272-277 ). The obtained DNA fragment was electrophoresed on a 2.5% agar gel and then stained with ethidium bromide.

  FIG. 1b shows the result of COBRA analysis of HOXB13 gene methylation in primary renal cell carcinoma tumor tissue (Primary RCC) (using MIRC9-3 set as PCR primer). The symbols in FIG. 1b indicate N = normal kidney tissue, T = primary cancer, U = unmethylated fragment, M = methylated fragment. Tumor-specific abnormal methylation of HOXB13 was detected in 17 (30%) of 56 primary renal cell carcinomas. As shown in FIG. 1b, HOXB13 is methylated in primary renal cell carcinoma, but no methylation was detected in its adjacent normal kidney tissue sample.

  To investigate HOXB13 methylation in renal cell carcinoma in more detail, 15 renal cancer cell lines (786-O, UMRC-6, KC-12, ACHN, A498, OUR-10, OUR-20, VHL-renal) , YCR, Caki-1, Caki-2, SKRC-1, SKRC-7, TUHR4TKB, TUHR14TKB) were analyzed by the COBRA method (using MIRC9-3 set as PCR primers). The results are shown in FIG. 2a. Abnormal methylation of HOXB13 was detected in 11 types (73%) of them. The symbols in FIG. 2a indicate U = unmethylated fragment, M = methylated fragment. In the four kidney cancer cell lines UMRC-6, KC-12, VHL-renal and SKRC-7, the upstream region of HOXB13 is almost completely methylated, while the other seven kidney cancer cell lines ( 786-O, A498, Caki-1, Caki-2, SKRC-1, TUHR4TKB, TUHR14TKB) were partially methylated.

  From these results, specific methylation was frequently observed in both renal cell carcinoma and renal cancer cell lines.

Experiment 3 Analysis of HOXB13 gene methylation by bisulfite sequencing
In order to clarify the range of methylation in the upstream region of the HOXB13 gene, samples of primary renal cell carcinoma in which methylation of the HOXB13 gene was detected were subjected to analysis by the bisulfite sequencing method together with their adjacent normal tissue samples.

  The bisulfite-PCR product sequence was obtained by cloning fragments amplified using MIRC9-3F and MIRC9-2R primers into pGEM-T Easy vector using pGEM-T Easy Vector Systems (Promega, Madison, WI). Decided. At least 10 clones were sequenced for each primary renal cell carcinoma sample or kidney cancer cell line. DNA sequencing was determined using BigDye Terminator cycle sequencing kit ver.1.1 (Applied Biosystems) and ABI 3100 automated DNA sequencer.

The cancer specific methylated CpG site of the HOXB13 gene in the determined primary renal cell carcinoma tumor tissue is shown in FIG. 1c. Specifically, FIG. 1c shows the results of HOXB13 bisulfite sequencing of a primary renal cell carcinoma sample (Tumor) showing HOXB13 methylation and a normal kidney tissue sample (Normal kidney tissue) paired therewith. In the figure, “Case 5”, “Case 33”, and “Case 34” indicate case numbers. PCR products were cloned into vectors and at least 10 clones were sequenced for each sample. Analyzed CpG sites are indicated by vertical lines at the top of the figure and numbered from 1 to 22 from the left. When the methylation ratio is 50 to 100%, black is indicated, when 20 to 50% is hatched, and when 0 to 20% is indicated by white. The position of the Bst UI restriction enzyme recognition site analyzed by the COBRA method is indicated by a vertical arrow. In the COBRA method, it is detected only when CpG sites # 3 and # 4 or # 4 and # 5 are methylated in pairs. From FIG. 1c it can be seen that these sites are only methylated in the tumor sample. From this result, tumor-specific methylation of the CpG site shown by the COBRA method using Bst UI restriction enzyme was also confirmed by the bisulfite sequencing method. In addition, other CpG islands were shown to have increased methylation tendency in cancer-derived samples.

  To confirm the methylation status of each CpG site in renal cell carcinoma cell lines, two highly methylated renal cancer cell lines (UMRC-6, SKRC-7), partially methylated renal cancer cell lines (TUHR4TKB), non- The methylated renal cancer cell line (ACHN) was also subjected to bisulfite sequencing, and the cancer-specific methylated CpG site in the 5 ′ region of the HOXB13 gene was examined. Specifically, the PCR product was cloned into a vector and a sequence of at least 11 clones was performed for each cell line. The result is shown in FIG. Black circles indicate methylation, and white circles indicate unmethylated CpG sites. The distribution of CpG sites in the 5 'region of the HOXB13 gene is indicated by a vertical line at the top. The translation start site is indicated at the top with a horizontal arrow. As a result, all CpG sites analyzed in both of the highly methylated renal cancer cell lines were densely methylated. In contrast, the unmethylated renal cancer cell line showed little methylation in all regions, and the partially methylated renal cancer cell line showed moderate methylation status. From the above, it was shown that the HOXB13 gene is specifically methylated in renal cancer cell lines.

Experimental Example 4 Expression analysis of HOXB13 gene by RT-PCR method It has been reported that the HOXB13 gene is abundantly expressed in normal prostate and colon tissues of human adults and mice (Sreenath et al., (1999). Prostate. , 41, 203-207; Jung C, et al., (2004). Cancer res., 64, 9185-9192). Various human normal tissues (Liver, Kidney, Prostate, Testis, Adrenal gland, Uterus, Placenta, Spinal cord, Lung ( Lung, Heart, Skeletal muscle, Thyroid gland, Thymus, Bone marrow, Whole brain (Brain, whole), Cerebellum (Brain, cerebellum)] Were analyzed by RT-PCR. The result is shown in FIG. RT-PCR analysis revealed that the HOXB13 gene is expressed in the normal kidney, testis, uterus, placenta, and thymus in addition to the prostate.

  To clarify whether abnormal methylation of the HOXB13 gene is associated with loss of expression in renal cell carcinoma, 15 types of renal cancer cell lines (786-O, UMRC-6, KC-12, ACHN, A498, OUR- 10, OUR-20, VHL-renal, YCR, Caki-1, Caki-2, SKRC-1, SKRC-7, TUHR4TKB, and TUHR14TKB) were used to analyze the expression of HOXB13 by RT-PCR. The analysis was carried out by amplifying the total RNA obtained from each renal cancer cell line to a plateau after reverse transcription (RT +). FIG. 3b shows the results of RT-PCR analysis of HOXB13 expression in renal cancer cell lines. As shown in FIG. 3b, the expression of the HOXB13 gene was completely lost in the four highly methylated renal cancer cell lines (UMRC-6, KC-12, VHL-renal, SKRC-7).

  In addition, to evaluate the effect of methylation on HOXB13 gene inactivation, three highly methylated renal cancer cell lines (UMRC-6, KC-12, VHL-renal) were combined with 1 μM methylation inhibitor 5-aza- The cells were cultured for 3 days in a medium containing 2'-deoxycytidine (5-aza-dC). Furthermore, since histone deacetylation is associated with gene inactivation caused by DNA methylation, cells were treated with 300 nM histone deacetylase (HDAC) inhibitor trichostatin A (TSA) for 24 hours to prepare total RNA Then, expression analysis by RT-PCR was performed. The result is shown in FIG. As shown in FIG. 3c, when treated with 5-aza-dC (methyltransferase inhibitor), reexpression of the HOXB13 gene was observed in all cell lines. However, recovery of HOXB13 expression was not induced by TSA alone (HDAC inhibitor). A joint effect of 5-aza-dC and TSA that enhanced the expression of the HOXB13 gene was seen in the VHL-renal strain, but no such effect was observed in the UMRC-6 and KC-12 strains. These results suggest that inactivation of the HOXB13 gene is regulated in a manner primarily dependent on methylation.

The above HOXB13 gene expression analysis by RT-PCR was performed by preparing total RNA from each renal cancer cell line using RNeasy Mini Kit (Qiagen, Valencia, CA), Oligo (dT) 15 primer (Promega) and Omniscript. A reverse transcription reaction was performed using RT Kit (Qiagen), and the obtained DNA was subjected to RT-PCR using the following primers. Normal human tissue-derived total RNA was obtained from Clontech Laboratories (Palo Alto, CA).
H13F: 5'-TTGCCTGTGGACAGTTACC-3 '(SEQ ID NO: 21)
H13R: 5'-AACTTGTTAGCCGCATACTC-3 '(SEQ ID NO: 22).

As a control to verify RNA reliability, a gene encoding glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was amplified for each renal cancer cell line and normal human tissue using the following primers;
GAPDHUP: 5'-CGGATTTGGTCGTATTGG-3 '(SEQ ID NO: 30)
GAPDHLW: 5'-TCCTGGAAGATGGTGATG-3 '(SEQ ID NO: 31).

Experimental Example 5 Expression analysis of HOXB13 gene by immunohistochemical analysis
To clarify whether abnormal methylation of the HOXB13 gene causes loss of expression in primary renal cell carcinoma samples, immunostaining was performed using an anti-HOXB13 rabbit polyclonal antibody (hereinafter referred to as “anti-HOXB13 antibody”). It was. The anti-HOXB13 antibody was produced by immunizing a rabbit with a chemically synthesized peptide corresponding to the 14 amino acid sequence (RVKEKKVLAKVKNS: (SEQ ID NO: 23)) in the amino acid sequence of human HOXB13 (SEQ ID NO: 2).

  Based on the methylation status of each primary renal cell carcinoma case analyzed by COBRA, a total of 11 Clear cell type renal cell carcinoma cases (3 methylated cases and 8 unmethylated cases) were examined. Immunohistochemical analysis using Ventana automated IHC system (DiscoveryTM, Ventana Medical systems, Inc., Tucson, Ariz.) Using 5 μm thick sections obtained from these 11 cases of formalin-fixed paraffin-embedded tissues (renal cell carcinoma) Slides were prepared. The deparaffinized tissue sections were recovered for antigenicity by heat treatment at 108 ° C. for 16 minutes and then reacted with diluted anti-HOXB13 antibody (3.4 μg / ml). The automated procedure was based on the indirect biotin-avidin system and used biotinylated universal secondary antibody, diaminobenzidine substrate and hematoxylin counterstaining.

  The results of immunohistochemical analysis of HOXB13 in primary renal cell carcinoma are shown in FIG.

  4, a and c are HE-stained images of HOXB13 methylated case (case 54) and unmethylated case (case 34), respectively, and b and d are HOXB13 methylated case (case 54) and unmethylated case, respectively. (Case 34) shows a staining image with an anti-HOXB13 antibody. The HE-stained image shows that it is a clear cell type renal cell carcinoma. Anti-HOXB13 antibody stains the cytoplasm of tumor cells. As shown in FIG. 4b, in the renal cell carcinoma of 8 unmethylated cases, positive staining was seen in the cytoplasm by the anti-HOXB13 antibody. In contrast, cytoplasmic staining with anti-HOXB13 antibody was not observed in the three primary renal cell carcinoma cases that showed HOXB13 methylation (FIGS. 4c and d). Regarding the non-cancerous part around the cancer cells, the expression of HOXB13 was detected in normal proximal tubule cells (right part of FIG. 4c). This revealed that the expression of HOXB13 in primary renal cell carcinoma correlated well with the methylation status analyzed by the COBRA method.

Experimental Example 6 Confirmation of suppression of renal cancer cell growth by HOXB13 gene expression by colony formation assay (1) Construction of FLAG-labeled HOXB13 expression vector
Human HOXB13 cDNA incorporating pDNR-Dual vector was obtained from Open Biosystems (Huntsville, AL) and then subcloned into pLP-IRESneo expression vector (Clontech) with FLAG-tag added to the C-terminus. The EGFP gene incorporated into pDNR-EGFP (Clontech) was also subcloned into the pLP-IRESneo vector. The EGFP gene incorporated into pDNR-EGFP (Clontech) was similarly subcloned into the pLP-IRESneo vector to prepare a pLP-IRES-EGFP expression vector.

(2) Colony formation assay Frequent tumor-specific methylation of HOXB13 gene in renal cell carcinoma and correlated gene inactivation suggest that HOXB13 inactivation may be involved in tumor formation and malignant progression in renal cancer It suggests. To clarify whether the HOXB13 gene works as a tumor suppressor gene, the HOXB13 gene with the FLAG-tag added was pLP-IRES to the renal cancer cell line KC-12, in which the HOXB13 gene was completely methylated and inactivated. -FLAG-HOXB13 expression vector (FLAG-labeled HOXB13 expression vector) was introduced for expression and colony formation assay was performed. As a control, the same cell line introduced with an empty pLP-IRESneo vector was used.

Specifically, HLPB13 non-expressing renal cancer cell line KC-12 (highly methylated renal cancer cell line) is expressed by pLP-IRES-FLAG-HOXB13 expression vector (HOXB13) or control pLP-IRES-EGFP vector (empty vector: pLP-neo) (8 μg each) were transfected using Lipofectamine 2000 (Invitrogen, Carlsbad, Calif.). 24 hours after transfection, cells (5 × 10 ⁴ ) were spread in a 100 mm dish, cultured in a medium containing 0.5 mg / ml G418 for 14 days, and then Giemsa staining was performed. Colony counting was performed in 3 cultures. The results of the colony formation assay are shown in FIGS. 5a and b. FIG. 5b shows the average number of colonies of triplicate cultures of transfected KC-12 cells as a percentage of the control (quantitative analysis of the number of colonies).

  As can be seen from this result, the proliferation (colony formation) of KC12 renal cancer cells was significantly reduced by re-expression of the HOXB13 gene. This indicates that the HOXB13 gene suppresses cell proliferation.

Experimental Example 7 Confirmation of apoptosis induced by HOXB13 gene expression by fluorescence microscopy In Example 6, the expression of exogenous HOXB13 gene inhibited the growth of highly methylated renal cancer cell line. Was used to express the HOXB13 gene in a renal cancer cell line lacking HOXB13 expression (UMRC-6 renal cancer cell line), and verified whether the expression of the HOXB13 gene induces apoptosis in the renal cancer cell line.

  Specifically, 5 μg of pLP-IRES-FLAG-HOXB13 expression vector (FLAG-labeled HOXB13 expression vector) or pLP using TransFast Transfection Reagent (Promega) -IRES-EGFP vector (empty vector) was transfected. After culturing for 48 hours, the cells on the cover glass were washed twice with PBS and fixed with PBS containing 3% paraformaldehyde at room temperature for 20 minutes. Thereafter, it was permeabilized with 0.1% Triton X-100 (in PBS) for 3 minutes, and blocked with PBS containing 10% goat serum for 30 minutes at room temperature.

  Subsequently, it was stained with DNA-binding dye DAPI, and TUNEL analysis was performed to detect apoptosis. First, the sample was incubated with an anti-FLAG M2 (SIGMA) primary antibody solution (20 mM Tris-HCl, pH 8.0, 150 mM NaCl, 0.05% Tween 20, 0.1% BSA) at 37 ° C. for 60 minutes. As the secondary antibody, Alexa Fluor 488 goat anti-mouse IgG (Molecular Probes, Eugene, OR) was used. ApopTag Red In Situ Apoptosis Detection Kit (Chemicon, Temecula, CA) was used for TUNEL assay. The cover glass was then mounted with VECTASHIELD Mounting Medium with DAPI (Vector Laboratories, Burlingame, Calif.) And observed using a fluorescence microscope. The result is shown in FIG. The expression of HOXB13 increased the number of apoptosis cells showing nuclear aggregation and TUNEL positivity, leading to cell death (UMRC-6 / FLAG-HOXB13 in FIG. 6a). In contrast, no increase in apoptotic cell death was observed in control EGFP expressing cells (UMRC-6 / EGFP in FIG. 6a).

  The cells were stained with anti-cleaved caspase-3 antibody in order to detect caspase-dependent apoptosis. Specifically, the sample was treated with an anti-Cleaved Caspase-3 antibody (Cell Signaling Technology, Beverly, MA) solution (20 mM Tris-HCl, pH 8.0, 150 mM NaCl, 0.05% Tween 20 and 0.1% BSA) at 37 ° C. The mixture was incubated for 60 minutes and reacted with the secondary antibody using Alexa Fluor 568 goat anti-rabbit IgG (Molecular Probes). Immunofluorescence analysis of Caspase-3 activation is shown in Figure 6b. HOXB13-expressing cells (UMRC-6 / FLAG-HOXB13) showed caspase-3 activation associated with nuclear aggregation. These results indicate that HOXB13 induces apoptosis through a caspase-dependent pathway in renal cancer cell lines.

Experimental Example 8 Comparison of methylation status of HOXB13 gene and other genes To compare the methylation frequency of HOXB13 gene and other cancer-related genes in renal cell carcinoma, the methylation status of 13 known CpG islands was compared to primary kidney. Forty cell cancer cases and 16 renal cancer cell lines (RCC cell lines) were examined by the COBRA method. These CpG islands contain 11 genes (p14ARF, p15INK4B, p16INK4A, CHFR, CACNA1G, TMS1, BNIP3, COX-2, hMLH1, DAPK, DCC, which are known to be often highly methylated in various cancers. ) And two CpG islands (MINT1, MINT2). A summary of the methylation of these genes is shown in Table 2.

  Of these CpG islands, 6 (CHFR, CACNA1G, COX-2, TMS1, DAPK, MINT1) showed 3 to 18% less frequent methylation in primary renal cell carcinoma. The remaining genes (p14ARF, p15INK4B, p16INK4A, BNIP3, hMLH1, DCC, MINT2) were not methylated. These results indicate that HOXB13 is frequently methylated (30%) in primary renal cell carcinoma, whereas the methylation frequency of other genes is relatively low.

Experimental Example 9 Correlation between HOXB13 Gene Methylation and Clinicopathologic Factors 56 HOXB13 gene methylation and sex, age, tumor grade, clinical stage, tumor size, microvascular invasion in 56 cases of primary renal cell carcinoma examined Correlation with metastasis and VHL inactivation was analyzed by χ ² -test. The results are shown in Table 3.

  HOXB13 gene methylation was significantly correlated with tumor grade, stage, tumor size, and microvascular invasion (P <0.05).

  Next, the relationship between methylation of HOXB13 gene and clinicopathological index was analyzed by multivariate analysis using logistic regression model. The results are shown in Table 4.

  There was a significant correlation between HOXB13 gene methylation, tumor grade, and microvascular invasion (P <0.05). There was no correlation between HOXB13 gene methylation and VHL inactivation. Thus, epigenetic inactivation of HOXB13 is independent of VHL status. This accounts for about 40% of sporadic clear cell renal cell carcinoma cases (Foster et al., (1994). Hum Mol Genet., 3, 2169-2173; Gnarra et al., (1994). Nat Genet., 7, 85-90; Herman et al., (1994) .Proc Natl Acad Sci USA., 91, 9700-9704; Shuin et al., (1994). Cancer Res., 54, 2852-2855 Shuin et al., (1999). Contrib Nephrol., 128, 1-10), will help elucidate the mechanism of tumorigenesis in renal cell carcinoma without VHL inactivation. Of note, a multivariate analysis of clinicopathological factors using a logistic regression model revealed a significant correlation between HOXB13 gene methylation and tumor grade and microvascular invasion. This suggests that inactivation of the HOXB13 gene increases the malignancy of kidney cancer.

The analysis result of HOXB13 gene methylation in primary renal cancer is shown. FIG. 1a shows the relationship between the isolated MIRC9 clone and the COX island of the HOXB13 gene. FIG. 1b shows a typical result of COBRA. N = normal kidney tissue, T = primary cancer, U = unmethylated fragment, M = methylated fragment. FIG. 1c shows the results of HOXB13 bisulfite sequencing of primary renal cell carcinoma showing HOXB13 gene methylation and normal kidney tissue samples. Black indicates 50-100% methylation, diagonal lines indicate 20-50% methylation, and white indicates 0-20% methylation. The methylation state of HOXB13 gene in a renal cancer cell line is shown. FIG. 2a shows the COBRA results of a renal cancer cell line. U = unmethylated fragment, M = methylated fragment. FIG. 2b shows the result of bisulfite sequencing of the 5 'region of the HOXB13 gene. Black circles indicate methylation, and white circles indicate unmethylated CpG sites. The expression of the HOXB13 gene in normal human tissues and renal cancer cell lines is shown. FIG. 3a shows the results of RT-PCR analysis of HOXB13 gene expression in various normal human tissues. FIG. 3b shows the results of RT-PCR analysis of HOXB13 gene expression in renal cancer cell lines. FIG. 3c shows the effect on HOXB13 expression by treatment with a methyltransferase inhibitor in a highly methylated renal cancer cell line. The immunohistochemical analysis result of HOXB13 in primary renal cell carcinoma is shown. FIG. 4a is an HE-stained image showing clear cell-type renal cell carcinoma. FIG. 4b shows a positive staining image of anti-HOXB13 antibody of HOXB13 gene unmethylated renal cell carcinoma. FIG. 4d is an enlarged view of HOXB13 non-expressing cancer cells showing HOXB13 gene methylation. Figure 3 shows the effect of HOXB13 reexpression in highly methylated renal cancer cell lines. FIG. 5a shows the results of analysis by colony formation assay of suppression of growth of renal cancer cell lines due to the expression of exogenous HOXB13 gene. FIG. 5b shows the result of quantitative analysis of the number of colonies. The percentage is shown when the number of colonies of transfected KC-12 cells (average value of three cultures) is defined as 100% control. Bar indicates the standard error of three cultures. Figure 6 shows the induction of apoptosis by HOXB13 expression in HOXB13 highly methylated renal cancer cell line. FIG. 6a shows the result of immunofluorescence analysis of HOXB13 non-expressing UMRC-6 cells transfected with FLAG-HOXB13 or EGFP expression vector as a control. FIG. 6b shows immunofluorescence analysis of Caspase-3 activation.

SEQ ID NO: 4 is the base sequence of the MSPU1F primer SEQ ID NO: 5 is the base sequence of the MSPU1R primer SEQ ID NO: 6 is the base sequence of the MSPU2F primer SEQ ID NO: 7 is the base sequence of the MSPU2R primer SEQ ID NO: 8 is the base sequence of the MSPU3R primer SEQ ID NO: 9 is the MSPM1F Primer base sequence SEQ ID NO: 10 is MSPM1R primer base sequence SEQ ID NO: 11 is MSPM2F primer base sequence SEQ ID NO: 12 is MSPM2R primer base sequence SEQ ID NO: 13 is MIRC9-2F primer base sequence SEQ ID NO: 14 is MIRC9-2R primer The nucleotide sequence of SEQ ID NO: 15 is the nucleotide sequence of MIRC9-3F primer SEQ ID NO: 16 is the nucleotide sequence of MIRC9-3R primer SEQ ID NO: 17 is the nucleotide sequence of the unmethylated specific probe SEQ ID NO: 18 is the nucleotide sequence of the methylated specific probe SEQ ID NO: 19 is the base sequence of the unmethylated specific probe SEQ ID NO: 20 is the base sequence of the methylation specific probe SEQ ID NO: 21 is the sense (S) probe The nucleotide sequence of SEQ ID NO: 22 is the nucleotide sequence of the antisense (A) primer SEQ ID NO: 23 is the amino acid sequence of the immunizing antigen for antibody production SEQ ID NO: 24 is the base sequence of the PCR adapter SEQ ID NO: 25 is the base sequence of the PCR adapter No. 26 is the base sequence of JMCA24 primer SEQ ID No. 27 is the base sequence of JMCA12 primer SEQ ID NO: 28 is the base sequence of NMCA24 primer SEQ ID NO: 29 is the base sequence of NMCA12 primer SEQ ID NO: 30 is the base sequence of GAPDHUP primer SEQ ID NO: 31 is the GAPDHLW primer Nucleotide sequence

Claims (16)

  A method for determining a malignant tumor, which comprises measuring methylation frequency of a mammalian HOXB13 gene or a correlation value thereof.   The determination method according to claim 1, wherein the methylation frequency of the HOXB13 gene is a methylation frequency of a CpG island of the gene.   The determination method according to claim 2, wherein the CpG island is a region of base numbers -1 to -376 of the HOXB13 gene.   The determination method according to any one of claims 1 to 3, wherein the malignant tumor is renal cell carcinoma. A method for determining the degree of malignant tumor in a test mammal having the following steps:
(1) a step of measuring the methylation frequency of the HOXB13 gene in mammals or a correlation value thereof,
(2) a step of comparing the measured methylation frequency or the correlation value thereof with the methylation frequency or the correlation value of the HOXB13 gene of a healthy mammal as a control, and (3) a test based on the comparison result. Evaluating the degree of malignant tumor in mammals.   6. The determination method according to claim 5, wherein the methylation frequency is a methylation frequency of a CpG island of the HOXB13 gene.   The determination method according to claim 6, wherein the CpG island is a region of base numbers -1 to -376 of the HOXB13 gene.   The determination method according to any one of claims 5 to 7, wherein the malignant tumor is renal cell carcinoma.   A reagent for detecting the incidence or degree of malignant tumor, comprising a primer pair capable of detecting the methylation frequency of CpG island of HOXB13 gene.   The reagent according to claim 9, wherein the CpG island is a region of base numbers -1 to -376 of the HOXB13 gene.   The reagent according to claim 9 or 10, wherein the primer pair has a base sequence represented by SEQ ID NOs: 13 and 14, or a base sequence represented by SEQ ID NOs: 15 and 16.   The reagent according to any one of claims 9 to 11, wherein the malignant tumor is renal cell carcinoma.   An antitumor agent comprising DNA having a base sequence encoding the amino acid sequence of HOXB13 as an active ingredient.   The antitumor agent according to claim 13, which is an anticancer agent against renal cell carcinoma. A method for screening an antitumor substance against renal cell carcinoma, comprising the following steps:
(A) contacting a test substance with a renal cancer cell in which expression of the HOXB13 gene is suppressed due to methylation of a CpG island of the HOXB13 gene;
(B) measuring the expression level of the HOXB13 gene in the renal cancer cells and comparing the expression level (control expression level) of the HOXB13 gene in the renal cancer cells not contacted with the test substance, and (c) the control expression level A step of selecting a test substance brought into contact with a renal cancer cell having an increased expression level of the HOXB13 gene as an antitumor substance against renal cell carcinoma. The method for screening an antitumor substance according to claim 15, wherein the expression of the HOXB13 gene is detected as the amount of mRNA by a real-time RT-PCR method.

Images